Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stauffer, D. R.
Right arrow Articles by Castellino, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stauffer, D. R.
Right arrow Articles by Castellino, F. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of Transcriptional Regulatory Elements in the Promoter Region of the Murine Blood Coagulation Factor VII Gene*

Daniel R. Stauffer, Beatrice N. Chukwumezie, Julie A. Wilberding, Elliot D. Rosen, and Francis J. CastellinoDagger

From the Department of Chemistry and Biochemistry and the Center for Transgene Research, University of Notre Dame, Notre Dame, Indiana 46556

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

To identify the 5' sequences of the murine coagulation factor VII (fVII) gene that resulted in its efficient transcription, a variety of 5'-flanking sequences up to 7 kilobase pairs upstream of the translation ATG initiation codon were fused to the reporter gene, bacterial chloramphenicol acetyltransferase, and relative expression levels of this gene in mouse Hepa 1-6 cells were determined. It was found that the 5' region extending approximately 85 base pairs (bp) upstream of the transcriptional initiation site served as the minimal DNA region that provided full relative promoter activity for chloramphenicol acetyltransferase expression. This region of the gene also contains consensus sequences for liver-enriched transcription factors, C/EBPbeta and HNF4, as well as for the ubiquitous protein factors, AP1, H4TF1, NF1, and Sp1. In vitro DNase I footprinting of the 200-bp proximal region of the promoter with a murine Hepa 1-6 cell nuclear extract revealed a clear footprint of a region corresponding to -80 to -28 bp of the murine fVII gene, suggesting that liver factors interact with this region of the DNA. Competitive gel shift and supershift assays with different synthetic oligonucleotide probes demonstrate that proteins contained in the nuclear extract, identified as C/EBPbeta , H4TF1, and HNF4, bind to a region of the murine fVII DNA from 85 to 32 bp upstream of the transcription start site. Purified Sp1 also interacts with this region of the DNA at a site that substantially overlaps, but is not identical to, the H4TF1 binding locus. Binding of Sp1 to the mouse DNA was not observed with the nuclear extract as the source of the transcription factors, suggesting that Sp1 is likely displaced from its binding site by H4TF1 in the crude extract. In vivo dimethyl sulfate footprint analysis confirmed the existence of these sites and additionally revealed two other binding regions slightly upstream of the CCAAT/enhancer-binding protein (C/EBP) binding locus that are homologous to NF1 binding sequences. The data demonstrate that appropriate transcription factor binding sites exist in the proximal promoter region of the murine fVII gene that are consistent with its strong liver-based expression in a highly regulated manner.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Factor VII (fVII)1 is a vitamin K-dependent plasma protein that serves as the precursor for fVIIa, a serine protease that functions as a procoagulant in the extrinsic blood coagulation pathway. This latter activity is derived in part from the ability of fVIIa to activate the coagulation zymogens, fIX and fX to their respective enzymes, fIXa and fXa (1, 2). The presence of a cofactor for fVII, TF, along with Ca2+, creates optimal conditions for the functioning of fVIIa. Tissue factor pathway inhibitor serves to down-regulate this coagulation pathway by inactivating both fXa and the fVIIa·TF complex (3).

Human fVII is synthesized in liver as a single-chain protein containing 406 amino acids. Activation of this zymogen occurs consequent to cleavage of the Arg152-Ile153 peptide bond. This step is catalyzed by fXa (4), thrombin (4), TF·fVIIa (5), or hepsin (6), and leads to an enzyme composed of a 152-amino acid light chain, disulfide-linked to a 254-residue heavy chain. Factor VII is organized as a series of domain units (7) that are common to fIX (8), fX (9), and protein C (10). Specifically, the light chain of fVIIa consists of a Gla-containing domain, followed by a short helical spacer region and two epidermal growth factor-like motifs. The functions of these modules are to provide binding sites for regulators of fVII activity, such as TF (11, 12). The heavy chain of fVIIa contains the serine protease catalytic machinery, as well as binding sites for TF (13-15).

The intron-exon organization of the human fVII gene (7) and the entire genomic sequence of murine fVII (16) have been established. Both of these genes contain approximately 12 kb, and include transcriptional and translation start sites, 5'-flanking transcriptional regulatory regions, and 3'-capping polyadenylation sites and polyadenylation enhancer elements. The positions of the introns in these genes are in identical locations, and splice the exonic regions that encode the protein domains. The human fVII DNA is organized in eight exons, with an optional exon in the leader peptide region. The murine fVII gene possesses seven introns and eight exons. The major transcriptional start site of murine fVII has been located nine nucleotides upstream of the ATG translation initiation site (16). This short transcriptional initiator site in murine fVII presents a similar situation to that of the human gene, where in this latter case the major transcriptional start site was located 51 nucleotides 5' of the translational initiation site (17).

Although genetic deficiencies of human fVII have been reported, few patients present total fVII deficiency states. However, very low levels of this zymogen (<2% of normal) are associated with severe coagulation disorders (18-22). The clinical manifestations of less severe deficiencies are variable (18, 19, 23-25). Such observations suggest that only low levels of fVII activity are required to maintain hemostasis in unchallenged patients. Other data suggest that fVII levels may be reciprocally involved in coronary heart disease, perhaps through a linkage with hypertriglyceridemia (26). The prospective Northwick Park Heart (27), PROCAM (28), and PROCAM follow-up studies (29) suggest that elevated plasma levels of fVII coagulant activity constitute an independent risk factor for fatal outcomes of coronary heart disease in middle-aged men, the chances of which worsen when other risk factors are present. In addition, severe arterial thrombosis in a fVII-deficient patient was observed after infusion of fVII (21), showing that even artificial elevation of fVII levels can result in thrombotic complications.

To investigate the role of fVII in embryonic development and survival, mice were generated with a complete fVII deficiency (30). Unlike genetic deficiency of TF, which results in embryonic lethality at approximately 10.5 days post coitum, fVII-deficient mice develop normally. However, the fVII-deficient mice suffer severe perinatal lethality mainly from intra-abdominal bleeding. Those surviving birth expire within the next several weeks, primarily from intracranial bleeding (30). Since human clinical data, as well as the fVII-deficiency state produced in mice, indicates that fVII activity levels are important in hemostatic and cardiovascular pathology, we undertook an investigation aimed at defining the factors that regulate transcription of the fVII gene. The results of this study constitute the present contribution.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Proteins-- Recombinant transcription factors C/EBPalpha and C/EBPbeta were gifts from Dr. Peter F. Johnson (NCI, National Institutes of Health, Frederick, MD). Sp1 was a product of Promega (Madison, WI).

The rabbit C/EBPbeta polyclonal antibody was produced against a peptide corresponding to amino acids 258-276 of rat C/EBPbeta (Santa Cruz Biotechnology, Santa Cruz, CA). The rabbit Sp1 antibody (Santa Cruz Biotechnology) was raised against a peptide corresponding to amino acids 520-538 of human Sp1, a region with an identical sequence to the mouse protein. The NF-kappa B control polyclonal antibody (Santa Cruz Biotechnology) was generated against a peptide corresponding to amino acids 350-363 of human p50. HNF4 rabbit antiserum, raised against a peptide corresponding to amino acids 445-455 of rat HNF4, was obtained from Dr. Frances Sladek (University of California, Riverside, CA).

Aprotinin and leupeptin were products of Sigma. Proteinase K was a product of Boehringer Mannheim. DNase I was obtained from Worthington.

Expression Vectors-- The expression vectors, pSV-beta -gal control (C) vector and pCAT-control (C) vector, pCAT-enhancer (E) vector, and pCAT-basic vector were purchased from Promega. pSV-beta -gal-C vector is a 6.8-kb plasmid containing the lacZ gene, transcription of which is driven by the SV40 promoter/enhancer. pCAT-C vector is a 4.8-kb plasmid containing the CAT gene driven by the SV40 promoter/enhancer. pCAT-E vector is a 4.6-kb plasmid containing the SV40 enhancer, whereas pCAT-B vector is a 4.4-kb plasmid without the enhancer sequences.

Cell Lines and Nuclear Extracts-- Mouse Hepa 1-6 cells (American Type Culture Collection, Rockville, MD) were maintained in DMEM containing 1.45 g of glucose/liter (Sigma), supplemented with 2 mM glutamine, 50 µg/ml gentamycin sulfate, and 10% (v/v) heat-inactivated fetal calf serum (Life Technologies, Inc.). The cultures were incubated at 6.6% CO2, 37 °C, in a humidified atmosphere in 150-cm2 flasks. The cells were grown to confluence in DMEM with 4.5 g/liter glucose.

Mouse S194 cells (American Type Culture Collection) were grown in DMEM supplemented with 2 mM glutamine, 50 µg/ml gentamycin sulfate, and 10% (v/v) heat-inactivated horse serum (Life Technologies, Inc.).

Nuclear extracts were prepared as described (31). All solutions contained 0.05 mM dithiothreitol, and the protease inhibitors aprotinin (1 µg/ml), leupeptin (1 µg/ml), and phenylmethylsulfonyl fluoride (0.5 mM). Protein concentrations were measured with the Bradford assay. Cell extracts were frozen in 100-µl aliquots and stored at -70 °C.

lambda Genomic Clones Containing Murine fVII Inserts-- pND95 is a 16.0-kb HindIII-NotI fragment generated from murine fVII lambda  genomic clone lambda E.80.11C (16), which was reinserted in the HindIII-NotI sites of pBSKII+ (Stratagene, La Jolla, CA). This plasmid contains 7.0 kb of 5'-flanking sequences of the murine fVII gene and proceeds downstream through exon 5 of this gene.

pND73 is a 2.0-kb NotI-BamHI fragment of lambda  clone lambda E.50.4A1 (16) subcloned in the NotI-BamHI sites of pBSKII+. The DNA insert of this plasmid contains 45 bp of the FIXII polylinker lambda DNA, 1.1 kb of the 5'-flanking region of the murine fVII gene, and 0.7 kb of the coding region of the gene, terminating at a location between genomic exons 1 and 2.

CAT Expression Plasmids-- A variety of plasmid inserts containing 5' DNA sequences of the fVII gene were placed in the pCAT-E and pCAT-B plasmids. Different standard strategies with pND95 and pND73 were used for these purposes, employing both convenient restriction sites in the fVII 5' genomic region and restriction sites cloned into the fVII 5' region, as well as PCR amplifications with appropriate primers. These protocols generated plasmid inserts containing 7000 bp (pCAT-7000), 1100 bp (pCAT-1100), 200 bp (pCAT-200), 140 bp (pCAT-140), 97 bp (PCAT-97), 85 bp (pCAT-85), 56 bp (pCAT-56), 37 bp (pCAT-37), 19 bp (pCAT-19), and 4 bp (pCAT-4) beginning at the 5'-end and terminating at the ATG translation initiation codon. In addition, another plasmid, pCAT-900', was generated that was derived from pCAT-1100, with a 200-bp deletion at the 3' end of this segment. Nucleotide sequences were obtained for the fVII DNA inserts of all of these constructs, except for pCAT-7000.

Preparation of Cell Lysates for beta -Gal Assays-- Adherent cells were washed three times with a solution of 0.05 M sodium phosphate, 0.1 M NaCl, pH 7.5, and harvested by incubating the cells for 5 min at room temperature with a buffer containing 0.04 M Tris-HCl, 0.01 M EDTA, 1.5 M NaCl, pH 7.5. The cells were scraped from the bottom of the Petri dish with tissue culture cell lifter (Fisher) and transferred to a microcentrifuge tube. After centrifugation for 1.5 min (10,000 rpm at 4 °C), the cells were resuspended in 0.25 mM Tris-HCl, pH 7.7, and lysed by three cycles of liquid N2 freeze-thaw steps. The cell debris were pelleted at 4 °C for 2.5 min at 10,000 rpm. One-third of the cell lysate was transferred to sterile Eppendorf tubes and stored at -70 °C for beta -galactosidase enzyme assays. The remaining cell lysate was heated at 60 °C for 10 min. The denatured proteins were pelleted for 2.5 min at 10,000 rpm at 4 °C. The resulting supernatant was stored at -70 °C for CAT assays.

Reporter Gene Assays-- beta -Gal assays using the substrate, p-nitrophenyl-beta -D-galactopyranoside, were performed with protein extracts of transfected hepatocytes to quantify transfection efficiency.

Assays for CAT activity were conducted with approximately 50 µg of cell extract protein in a 150-µl reaction mixture consisting of 35 µl of 1 M Tris-HCl, pH 7.7, 5 µl [14C]chloramphenicol, 20 µl of acetyl-CoA (3.5 µg/µl), and an amount of water required to bring the reaction mixture to 150 µl. These components were incubated at 37 °C for 4 h. The extent of acetylation of the substrate was analyzed on thin layer chromatography plates (J.T. Baker) using a phosphorimager screen (Eastman Kodak Co., Rochester, NY). Normalizations of the CAT assays for transfection efficiencies were accomplished using the cotransfected beta -gal activity.

Electrophoretic Mobility Shift Assays-- Oligonucleotides for mobility shift assays were end-labeled with [alpha -32P]dATP and [alpha -32P]dCTP (>3,000 Ci/mM; ICN, Costa Mesa, CA), using the Klenow fragment of DNA polymerase (Promega). The binding reactions were carried out in a total volume of 25 µl containing 50,000 cpm of the labeled probe, 1 µg of poly (dI-dC) (Pharmacia Biotech Inc.), 12 µg of nuclear extract, 1 mM EDTA, 5 mM MgCl2, 10 µM ZnCl2, 1 mM beta -mercaptoethanol, 4% (v/v) glycerol, 100 mM KCl, in 10 mM Tris-HCl, pH 7.5. The reaction mixtures were incubated for 30 min at room temperature and loaded onto a 6% polyacrylamide gel (acrylamide:bisacrylamide ratio, 19:1, w/w) in running buffer (50 mM Tris-HCl, 0.38 M glycine, 2 mM EDTA, pH 8.0). The samples were subjected to electrophoresis at 8 V/cm. The resulting gels were dried and exposed to the x-ray film with an intensifying screen overnight at -80 °C. In competition experiments, oligonucleotide competitors were added in the amounts indicated in the figure legends. Reactions containing recombinant C/EBPalpha (30 µg/ml) or C/EBPbeta (26 µg/ml) contained 2.0 µl of the protein and 1.0 µl of normal rabbit serum/25 µl of binding reaction. Reaction mixtures with Sp1 included 1.0 footprint unit (fpu) of purified Sp1 (1 fpu is defined as the amount of Sp1 needed to give full protection against DNase 1 digestion on the SV40 early promoter). Sp1-containing mobility shift assays were performed on 6% polyacrylamide gels in 0.5 × Tris borate/EDTA (44.5 mM Tris-HCl, pH 8.0, 44.5 mM boric acid, 1 mM EDTA). In supershift experiments, the antibodies were added 15 min after the initiation of the 30-min incubation period of the probe with the nuclear extract mixture.

The sequences of double-stranded oligonucleotides used in the assays are as follows (the consensus sequences are indicated in bold lettering, the lowercase letters represent overhangs, the mutant sequences are indicated with an "m," and the mutated bases are underlined): M7H4 (-44 to -66, mouse fVII promoter): gatcACCCCTCTCCCCTCCCCCCTGA; mM7H4: gatcACCTCTCTCTCCTCTCCTCTGA; HSp1 (-83 to -108, human fVII promoter): GTGTCCTCCCCTCCCCCATCCCTCT; mHSp1: GTGTCCTCCCCTCCACCATCCCTCT; M7HNF4: (-33 to -50, mouse fVII promoter): tcgaGGAGGGCAAAGGTCAGGG; HNF4 consensus (32): CTGGGCAAAGGTCATCTG; mHNF4 site: CTGGATAAACGTCATCTG; M7C/H: (-47 to -78, mouse fVII promoter): tcgaCCAGCTTTCTCCACCCCTCTCCCCTCCCCCCT; M7mC/H: tcgaCCAGCACTATCCACCCCTCTCCCCTCCCCCCT; Sp1 consensus, gatcGCTCGCCCCGCCCCGATCGAAT; H4TF1 consensus (33): CCCGGTGGGGGAGGGGAA.

The wild-type and mutant Sp1 site oligonucleotides from the human fVII promoter (17) were gifts from Dr. Eleanor Pollak (University of Pennsylvania, Philadelphia, PA).

DNase I Footprint Analysis-- The DNase I footprint analysis was carried essentially as described (34). A quantity of 20 pmol of pCAT-200, containing 200 bp of the murine fVII promoter (-200 bp to -1 bp), was linearized with either restriction endonucleases HindIII or XbaI, end-labeled as described above with [alpha -32P]dATP and [alpha -32P]dCTP (>3,000 Ci/mmol; ICN), and digested with the second enzyme to release the oligonucleotide insert. The 32P-labeled DNA was fractionated electrophoretically on a 5% polyacrylamide gel in TBE buffer (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA, pH 8.0). The 32P-labeled DNA insert was electroeluted from an excised gel slice, extracted with phenol/CHCl3 (1:1, v/v) followed by CHCl3/isoamyl alcohol (24:1, v/v), and precipitated by addition of 1 ml of 100% ethanol. The pellet was washed with 1 ml of 80% ethanol, dried, and resuspended in 50 µl of a solution of 10 mM Tris-HCl, 1 mM EDTA, pH 8.0.

An amount of 20,000 cpm of probe was incubated for 15 min on ice with 50 µg of nuclear extract protein in 50 µl of a solution containing 50 mM KCl, 10% (v/v) glycerol, 1.0 mM dithiothreitol, 2.5 mM MgCl2, 0.02% Nonidet P-40 (Sigma), 2.0% polyvinyl alcohol, 1 µg of poly(dI-dC), in 10 mM sodium Hepes, pH 7.6. A volume of 50 µl of 5 mM CaCl2, 10 mM MgCl2 was included in the reaction mixture and incubated for 1 min at room temperature. This was followed by the addition of 2 µl of a 0.016 mg/ml (or 0.0025 mg/ml for the control without nuclear extract) stock solution of DNase I (Worthington). The mixture was incubated for 1 min and followed by addition of 90 µl of DNase I stop buffer (1%, w/v, sodium dodecyl sulfate, 0.2 M NaCl, 250 µg/ml glycogen, 20 mM EDTA, pH 8.0). The samples were then digested with 10 µl of 2.5 mg/ml proteinase K for 5 min at room temperature. The solution was extracted with phenol/chloroform (1:1, v/v) and precipitated by addition of 1 ml of 100% ethanol. The samples were the resuspended in formamide loading buffer (80% formamide, 1 mM EDTA, 0.1% xylene cyanol, 0.1% bromphenol blue) at 1,500 cpm/µl, and a total of 5,000 cpm was loaded on a 6% polyacrylamide sequencing gel. The corresponding murine fVII sequence generated by the Maxam and Gilbert method (35) was placed in a lane alongside the reactions.

Methylation Interference Assays-- Methylation interference was conducted as described previously (34). A 30-bp fragment extending from bp -45 to bp -66 of the mouse fVII promoter was subcloned into the SmaI site of the pBSKII+ vector (Stratagene). The resulting plasmid was linearized with either EcoRI or BamHI. A quantity of 20 pmol of plasmid was end-labeled with [alpha -32P]dATP and [alpha -32P]dCTP (>3,000 Ci/mmol), as described above. The labeled plasmid was then digested with the second enzyme to release the oligonucleotide insert. Labeled DNA was purified by polyacrylamide gel electrophoresis. An amount of 1 × 107 cpm of labeled probe was mixed with 0.5 µl of DMS in 200 µl of DMS reaction buffer (50 mM sodium cacodylate, 1 mM EDTA, pH 8.0) for 2.5 min at room temperature. This was followed immediately by the addition of 40 µl of DMS stop buffer (1.5 M NaOAc, 1 M beta -mercaptoethanol, pH 7.0), 1 µl of 10 mg/ml yeast tRNA solution, and 600 µl of 100% ethanol. This solution was mixed and placed for 10 min in a dry ice/ethanol bath and microcentrifuged for 15 min at 4 °C. The supernatant was discarded. This step was repeated three times, and the final pellet obtained was dried and resuspended in a buffer containing 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, at 100,000 cpm/µl. Five standard gel shift reactions using either Hepa 1-6 nuclear extract or purified Sp1 were conducted as described above. Following electrophoresis, the gels were exposed to film overnight at room temperature. Gel slices containing the bound and free probe were removed. The probe was then electroeluted from the slices, extracted with phenol/CHCl3 (1:1, v/v), and precipitated with 100% ethanol. The probe was then incubated with 1 M piperidine at 95 °C for 30 min, followed by three rounds of lyophilization, and resuspended in formamide loading dye (see previous section) at 1,500 cpm/µl. A total of 5,000 cpm was loaded onto a 12% sequencing gel for electrophoretic analysis at 1500 V for 1.5 h. The gel was exposed to x-ray film overnight at -80 °C with an intensifying screen.

Primers for LMPCR-- For footprinting the bottom (non-coding) strand, the following primers were employed: 1, 5'-ATATGGACATCCATCGGTGG; 2, 5'-TGTTCACACCTCCGGTCTGA; 3, 5'-CGGTCTGAGCCCACATTGCC.

The primers used to footprint the top (coding) strand were: 4, 5'-TTCCTGTTGATGTCCCAGCT; 5, 5'-ACTCCGTGCACAGAGAAACC; 6, 5'-CCCTGGAGCTGGAGCAGAAA.

For the unidirectional linker mix, the following oligonucleotides were used: 7, 5'-GCGGTGACCCGGGAGATCTGAATTC; 8, 5'-GAATTCAGATC.

Primers 3 and 6 were then end-labeled with polynucleotide kinase (Amersham Life Science) in the following manner. A concentration of 20 pmol of primer was combined with 2 µl of 10 × kinase buffer, 120 µCi of [gamma -32P]ATP (ICN, Costa Mesa, CA; 4500 Ci/mmol), and water to a final volume of 20 µl. A 1:10 dilution of polynucleotide kinase (30 units/ml) was prepared with kinase buffer, and 1 µl of this solution was added to the reaction tube. The reaction was incubated at 37 °C for 30 min, after which a second 1-µl aliquot of enzyme was added and incubation allowed to proceed for another 30 min. Next, water was added to bring the total volume to 50 µl, followed by 50 µl of 5 M NH4OAc. The reaction was then extracted with one volume of phenol-CHCl3 (1:1, v/v) followed by another extraction with an equal volume of CHCl3-isoamyl alcohol (24:1, v/v), and then precipitated twice with 100% ethanol. The pellet was washed in 80% ethanol, dried, and resuspended in 20 µl of autoclaved distilled water. A total of 1 µl was removed and counted in a liquid scintillation counter.

In Vivo DNA Methylation-- Hepa 1-6 cells (5 × 107 cells) were centrifuged at 1500 rpm, resuspended in 2 ml of complete medium, and treated with 0.1% (v/v) DMS for 10 min at room temperature. The reaction was quenched by 10-fold dilution with cold PBS (0.137 M NaCl, 2.6 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4), and the cells pelleted by centrifugation at 1500 rpm for 10 min at 4 °C. The cell pellet was washed two additional times with 20 ml of 1 × PBS and lysed overnight in 1.5 ml of harvest buffer containing 20 mM Tris-HCl, 20 mM NaCl, 20 mM EDTA, 0.1% SDS, and 300 µg/ml proteinase K, pH 8.0, at 37 °C. The methylated DNA was diluted to 3 ml with a buffer containing 10 mM Tris, 1 mM EDTA, pH 8.0, and then extracted once with an equal volume of phenol-CHCl3 (1:1, v/v) and once with one volume of CHCl3-isoamyl alcohol (24:1, v/v). The DNA was precipitated with 100% ethanol (2.5 volumes), and the precipitate then washed with 80% ethanol, dried, and resuspended in 200 µl of 1 M piperidine. Cleavage was accomplished at 95 °C for 30 min, after which the sample was lyophilized, resuspended in 10 mM Tris, 1 mM EDTA, pH 8.0, and precipitated with ethanol as above. The DNA was then resuspended in 500 µl of water and lyophilized for three cycles. After lyophilization, the DNA was resuspended in 200 µl of water and its concentration determined by fluorimetry.

In Vitro Methylation of Genomic DNA-- Genomic DNA was isolated from 2.5 × 107 cells by centrifugation at 1500 rpm for 10 min and washing the pellet twice with 10 ml of 1 × PBS. The resulting pellet was resuspended in 2 ml of harvest buffer and incubated overnight at 37 °C. The sample was extracted with an equal volume of phenol/CHCl3 (1:1, v/v), followed by 1 volume of CHCl3: isoamylalcohol (24:1, v/v), and precipitated with 2.5 volumes of 100% ethanol. The resulting DNA was methylated by treating 200 µg of genomic DNA with 5 µl of 20% DMS, 80% ethanol (v/v), followed by incubation at room temperature for 30 s. The methylation reaction was terminated by the addition of 50 µl of cold stop buffer (1.5 M NaOAc, 1.0 M 2-mercaptoethanol, 100 µg/ml yeast t-RNA) and 750 µl of 100% ethanol. The DNA was pelleted, washed with 80% ethanol, dried, and resuspended in 200 µl of 1.0 M piperidine. The cleavage reaction and lyophilizations were as listed in the preceding section.

LMPCR Protocol-- This procedure was conducted as described (34), except that during exponential amplification, the time of extensions were increased by increments of 3 s/cycle, and during primer extension two to four cycles of PCR were completed, depending on the extent of labeling of the primers.

Analytical Techniques-- Oligonucleotides were synthesized using the phosphoramidite method on a Beckman Oligo 1000M DNA synthesizer. DNA samples were sequenced by the dideoxy method (36) using the Sequenase version 2.0 DNA sequencing kit (U. S. Biochemical Corp.). For the larger pCAT constructs, nucleotide sequences were determined using the Automated Laser Fluorescent (ALF) Express DNA sequencer (Pharmacia) employing Cyp-5'-dATP labeling with two primers constructed within the pCAT vector sequences flanking the inserts on both sides. Electroelution of DNA samples was conducted in a Electrophoretic Concentrator Series 1750-100 (ISCO, Inc., Lincoln, NE), according to product protocols.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

CAT expression plasmids containing as possible promoter elements a variety of 5' sequences immediately upstream of the transcription initiation site of the murine fVII gene (16) were constructed, and their comparative abilities to drive expression of the CAT gene were assessed. The 5'-flanking constructs ranged in size from 7000 bp to 4 bp. Since fVII is present at a very low concentration in plasma, it is not surprising that its gene possesses a weak promoter, and only low expression levels of CAT were observed when the CAT gene was linked to the fVII 5' regions using the pCAT-B vector. Thus, all of the investigations reported herein were accomplished with the SV40 enhancer element as part of the CAT constructs (CAT-E vector). CAT assays were performed on each of the samples and the resulting thin layer chromatography data quantitated by phosphorimaging. All CAT activities of individual constructs were normalized for individual transfection efficiencies by determination of beta -gal activities resulting from cotransfection of the murine Hepa 1-6 cells with the lacZ gene. Two separate expression experiments were performed on each construct, with the variation not greater than 10%. The construct with the highest expression, pCAT-97, was assigned a value of 100% (which was 9-fold over promoterless pCAT-E), with all other values relative to this construct. The final data are illustrated in Fig. 1 and show that a region 200 bp upstream of the ATG site contains the minimal promoter for the fVII gene. In confirmation of this point, removal of this 200-bp segment from the 1100-bp 5'-flanking region of the fVII DNA (providing pCAT-900') reduced the promoter activity to base-line levels. This 200-bp DNA segment also contains the major transcription initiation site, which is positioned 9 bp upstream of the initiator ATG codon (16).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1.   Relative promoter activities of 5'-regions of the murine fVII gene. CAT assay products were separated on thin layer chromatography plates using the standard assay with the substrate [14C]chloramphenicol, and the radioactive contents of each of the monoacetyl and diacetyl product bands were determined using phosphorimaging. Corrections for transfection efficiencies in Hepa 1-6 cells of each of the plasmids were made by cotransfections with the lacZ gene and subsequent determinations of the beta -gal activity of cell lysates by spectrophotometric measurements of beta -nitrophenolate release from the substrate p-nitrophenyl-beta -D-galactopyranoside. Relative promoter activities were calculated relative to the highest promoter activity (100%) assigned to the plasmid, pCAT-97. The plasmids are named for the length (in base pairs) of the fVII 5'-flanking DNA insert, which begin at the ATG initiation codon. The exception is pCAT-900', which starts 200 bp (-1100 bp to -201 bp) upstream of this ATG locus.

Several of the high probability transcription factor binding sites that reside within the 200-bp promoter region, as predicted by the MatInspector data base search (37), are depicted in Fig. 2, along with the nucleotide sequence of this segment of the fVII 5'-flanking DNA region. Notably, the area beginning around bp -120 is particularly well endowed with consensus sites for the liver-enriched transcription factors C/EBPbeta and HNF4, and the ubiquitous factors Sp1, H4TF1, and NF1.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.   Putative transcription factor sites as detected from a consensus binding site search of the 300 bp sequence upstream of the ATG translation start site (§). The transcription initiation site is also indicated (*). The MatInspector data base search (37) was employed, and only the highest probability sites are indicated. Searches were conducted in both the forward or reverse directions. AP1, activator protein 1; delta EF1, delta -crystallin enhancer-binding protein.

DNase I footprinting of the 200-bp proximal region of the promoter with a mouse Hepa 1-6 liver cell nuclear extract showed a clear protection of a DNA segment encompassing -80 to -28 bp (Fig. 3), suggesting that liver factors are binding to this region of the fVII DNA. This footprint was observed on both the sense and antisense strands (Fig. 3), thus confirming the observation. This is the same region predicted from Fig. 2 to contain an array of potential transcription factor binding sites.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3.   DNase I footprinting analysis of the proximal 200 bp of the murine fVII promoter using Hepa 1-6 nuclear extract show a large protected region at -28 bp to -76 bp of the coding strand and -32 bp to -80 bp of the non-coding strand. Lanes 1, 4, 5, and 8 are Maxam and Gilbert G/A sequencing ladders of the murine fVII promoter coding and non-coding strands. Lane 2, coding strand DNA digested with 5 ng of DNase I in the absence of nuclear extracts. Lane 3, coding strand DNA digested with 36 ng of DNase I in the presence of 50 µg of Hepa 1-6 nuclear extract. Lane 6, non-coding strand DNA digested with 5 ng of DNase I in the absence of nuclear extracts. Lane 7, non-coding strand DNA digested with 36 ng of DNase I in the presence of 50 µg of Hepa 1-6 nuclear extract. The nucleotide sequences of the protected region including putative transcription factor binding sites are shown below the gels.

A synthetic oligonucleotide (M7H4) corresponding to nucleotides -44 to -66 of the gene, which contains the potential H4TF1 site, has been synthesized and labeled with 32P. A gel shift assay with Hepa 1-6 cells (Fig. 4) demonstrated that this oligonucleotide binds to the cell extract (lane 2) and is effectively competed by the same unlabeled oligonucleotide (lanes 3 and 4). However, a synthetic unlabeled oligonucleotide (mM7H4) containing mutations in the H4TF1 consensus region did not compete for this same interaction (lanes 5 and 6). The corresponding sequence of the human fVII promoter (HSp1) also competed with labeled M7H4 for binding to the Hepa 1-6 nuclear extract (lanes 7 and 8), but a synthetic oligonucleotide with a mutation in the G-rich area (mHSp1) did not compete effectively with [32P]M7H4 (lanes 9 and 10). Similarly, a synthetic unlabeled oligonucleotide containing the H4TF1 consensus sequence (33) was competitive in this assay (lanes 11 and 12), whereas a similar oligonucleotide containing the Sp1 consensus sequence was not competitive (lanes 13 and 14). This suggests that Sp1 is not a functional transcription factor in Hepa 1-6 cell extracts for regulation of the proximal murine fVII promoter element.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4.   Gel mobility shift assay confirms the binding of H4TF1 or a highly related factor, but not Sp1, to the region -44 to -66 of the murine fVII promoter. A probe consisting of bp -44 to -66, a region protected in the DNase I footprint analysis (Fig. 2), was tested for its ability to bind specifically to Hepa 1-6 nuclear extract. Panel A, the sequences of oligonucleotides used for competition are indicated. Regions very similar or identical to the H4TF1 consensus, 5'-GGGGGAGGGG-3', were aligned and are indicated by the boxed region. Panel B, competition experiment using a labeled probe consisting of bp -44 to -66 and various unlabeled competitor oligonucleotides with Hepa 1-6 nuclear extract. Lane 1 contains probe with no nuclear extract, whereas lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. A specific complex was formed, which is indicated by an arrow and was only competed by unlabeled M7H4 (lanes 3 and 4), by bp -83 to -108 of the fVII promoter, HSP1 (lanes 7 and 8), and the H4TF1 consensus oligonucleotide, H4TF1 (lanes 11 and 12). Mutant probes of the respective mouse (mM7H4) and human (mHSp1) sites showed no competition (lanes 5, 6, 9, and 10). In addition, a high affinity Sp1 oligonucleotide (Sp1) probe was unable to compete for this complex (lanes 13 and 14).

To strengthen the finding that H4TF1 binds to this region of the promoter, and to differentiate between H4TF1 and Sp1 activities in Hepa 1-6 nuclear extract, the oligonucleotide containing the Sp1 consensus sequence was radiolabeled with 32P and used in gel shifts with Hepa 1-6 nuclear extract (Fig. 5). In competition experiments, the unlabeled probe effectively displaced the labeled oligonucleotide (lanes 3 and 4), while the probe containing the H4TF1 consensus sequence did not (lanes 5 and 7). The M7H4 oligonucleotide from the mouse fVII promoter slightly displaced the labeled probe (lanes 7 and 8), but the synthetic oligonucleotide containing the sequence from -83 to -108 of the human fVII promoter, which was proposed to contain the Sp1 transcription factor site (17), did not compete at all (lanes 9 and 10). This experiment, in combination with the results in Fig. 4, clearly showed a distinction between Sp1 and H4TF1 activities in Hepa 1-6 nuclear extract. The -44 to -66 bp region of the mouse promoter weakly competed for the Sp1 complex, although not as efficiently as the Sp1 consensus oligonucleotide, suggesting that transcription factor Sp1 may have a weak affinity for this site on the murine fVII promoter.


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 5.   Gel shift assay using an Sp1 consensus oligonucleotide reveals the formation of a specific Sp1 complex with Hepa 1-6 nuclear extract (indicated by arrows). Lane 1 contains probe with no nuclear extract, and lane 2 contains the labeled Sp1 consensus oligonucleotide with 12 µg of Hepa 1-6 nuclear extract. This complex is competed by the addition of excess unlabeled Sp1 consensus oligonucleotide (lanes 3 and 4), but not by the addition of a unlabeled H4TF1 consensus oligonucleotide, H4TF1 (lanes 5 and 6). Neither the addition of the unlabeled murine fVII H4TF1 site oligonucleotide, M7H4 (lanes 7 and 8), nor the addition of the unlabeled human fVII SP1 site oligonucleotide, HSP1 (lanes 9 and 10), resulted in efficient competition of this complex. The exact sequences of these oligonucleotides are provided in panel A of Fig. 3.

To identify further which of the two factors, viz. Sp1 or H4TF1, interacted with this region of the promoter of fVII, the -44 to -66 bp synthetic oligonucleotide (M7H4) of the murine fVII gene was labeled and used in gel supershifts with human factor Sp1 and mouse Hepa 1-6 nuclear extract (Fig. 6). The presence of the anti-human Sp1 antibody (which cross-reacts with murine Sp1) does indeed supershift the M7H4-human Sp1 complex (lanes 1-4), but does not supershift the M7H4-Hepa 1-6 complex (lanes 5-7). The data strengthen the claim that the complex formed with mouse Hepa 1-6 nuclear extract and the murine fVII proximal promoter element does not contain a contribution from Sp1. However, it does appear that purified Sp1 can bind to this sequence. One possible resolution of this apparent conflict is that H4TF1 possesses a higher affinity than Sp1 for the mouse-derived oligonucleotide probe and is responsible for the observed shift when using nuclear extract, whereas pure Sp1 is capable of interacting with this site only in the absence of H4TF1.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 6.   Anti-Sp1 antibodies supershift the binding of purified human Sp1 to bp -44 to -66 of the murine fVII promoter but do not supershift the complex formed from Hepa 1-6 nuclear extract. The murine fVII H4TF1 site (bp -44 to -66) was labeled and used in an antibody supershift experiment with purified human Sp1 and Hepa 1-6 nuclear extract. Lane 1 contains probe with no nuclear extract. Lane 2 contains probe and 1 fpu of purified human Sp1. Lanes 3 and 4 contain probe and 1 fpu of purified human Sp1 followed by the addition of 1 and 2 µl of anti-Sp1-IgG, respectively. Lane 5 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lanes 6 and 7 contain probe with 12 µg of Hepa 1-6 nuclear extract followed by the addition of 1 and 2 µl of anti-Sp1-IgG, respectively.

An extension of this experiment was performed to determine whether differences existed between the guanosine contacts observed in the M7H4-Hepa 1-6 nuclear extract complex and the M7H4-purified Sp1 complex. To address this question, methylation interference analysis was performed. The gels of Fig. 7 clearly indicate that the Hepa 1-6 nuclear extract (lanes 1-3) and purified Sp1 (lanes 4-6) do not generate identical methylation protection patterns. Although they are very similar, it is seen from Fig. 7 that Sp1 does not protect the 5'-terminal guanosine (lane 5), while the Hepa 1-6 nuclear extract does. As expected, methylation interference was not observed in the coding strand (data not shown). Overall, these data indicate that the guanosine contacts supplied by H4TF1 in Hepa 1-6 nuclear extract with M7H4, and those of purified Sp1 and M7H4, are very similar, but not identical.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 7.   Identification of the contact sites for Hepa 1-6 nuclear extract and purified human Sp1 on the -44 to -66 region of the murine fVII promoter by methylation interference footprinting. The partially methylated, radiolabeled, murine fVII H4TF1 site probe (bp -44 to -66) was incubated with Hepa 1-6 nuclear extract (lanes 1-3) or purified human Sp1 (lanes 4-6). Free and bound probes were separated on a 6% nondenaturing polyacrylamide gel, isolated, and cleaved with piperidine. Cleavage products of both free (lanes 1, 3, 4, and 6) and bound probe (lanes 2 and 5) were analyzed on a 12% sequencing gel. The non-coding strand is shown.

A putative HNF4 site is present in the mouse fVII proximal promoter in the region of nucleotides -33 to -50 (Fig. 2). To examine whether this factor actually interacted with this promoter element in nuclear extracts, a 32P-labeled synthetic oligonucleotide (M7HNF4) corresponding to residues -33 to -50 of the mfVII gene was prepared and subjected to competition experiments with Hepa 1-6 nuclear extract. The results are shown in Fig. 8. Unlabeled M7HNF4 effectively competed for the observed complex (lanes 2-4). Additionally, an oligonucleotide containing a consensus HNF4 binding site (32) effectively competed with the radiolabeled M7HNF4 for the complex, as observed in lanes 5 and 6. However, a synthetic mutant HNF4 consensus oligonucleotide (mHNF4, Fig. 8) was not competitive for this binding. These results suggest that a HNF4 transcription site is harbored in residues -33 to -50 of the murine fVII gene. These results were verified by the antibody supershift experiments illustrated in Fig. 9, using the same 32P-labeled M7HNF4 probe and nuclear extract. Lanes 3 and 4 of Fig. 9 show that addition of HNF4 antibody resulted in a supershift of the complex of M7HNF4 with Hepa 1-6 extract. This confirms that HNF4 binds to this region of the fVII gene.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 8.   Gel mobility shift assay confirms the binding of HNF4 to the -33 to -50 bp region of the murine fVII promoter. A probe consisting of bp -33 to -50 of the mouse fVII promoter, containing a putative HNF4 site, was tested for its ability to bind specifically to Hepa 1-6 nuclear extract. Lane 1 contains probe with no protein. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. A specific complex is formed (indicated by the arrow), which is competed by the addition of unlabeled self, M7HNF4 (lanes 3 and 4), and by the addition of a unlabeled HNF4 consensus oligonucleotide probe, HNF4 (lanes 5 and 6). The complex is not competed, however, by the addition of an unlabeled mutant HNF4 consensus probe, mHNF4 (lanes 7 and 8). The sequences of the probes used in the competition experiments are shown above.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 9.   Anti-HNF4 antibodies supershift the binding of Hepa 1-6 nuclear extract to the -33 to -50 bp region of the murine fVII promoter. The murine fVII HNF4 site (bp, -33 to -50) was labeled and used in an antibody supershift experiment with Hepa 1-6 nuclear extract. Lane 1 contains probe without nuclear extract. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lanes 3 and 4 contain probe with 12 µg of Hepa 1-6 nuclear extract and 1 and 2 µl of rabbit anti-HNF4 polyclonal serum, respectively. The supershift is indicated by an arrow.

Although a highly probable C/EBPbeta transcription site was identified by the consensus search at residues -47 to -78 of the mouse fVII gene (Fig. 2), the use of a 32P-labeled synthetic oligonucleotide (M7C/H) containing this region of the murine fVII promoter as a probe in gel shifts with nuclear extract did not reveal a specific complex (data not shown). However, the data of Fig. 10 show that when the Hepa 1-6 nuclear extract is supplemented with Escherichia coli-expressed recombinant C/EBPbeta , an additional complex was formed with M7C/H (lane 4). On the other hand, addition of bacterially expressed recombinant C/EBPalpha did not result in a complex with M7C/H. When a probe (M7mC/H) is used in which the C/EBPbeta site has been mutated, no new complex is observed upon addition of recombinant C/EBPbeta (lane 8). That the complex observed in the presence of C/EBPbeta represents specific binding of this protein factor is confirmed from the antibody supershift data of Fig. 11. Here, the entire complex formed (lane 3) after addition of nuclear extract, C/EBPbeta , and radiolabeled M7C/H, is supershifted by the addition of C/EBPbeta antibody (lane 4), whereas that is not the case when a control antibody is added (lane 5). These experiments show that C/EBPbeta can form a complex with the murine fVII promoter in a sequence-specific manner. The observation that a specific C/EBPbeta complex was not observed when using Hepa 1-6 extract alone may be the result of the fact that C/EBPbeta is present at low concentrations in mature liver cells. Thus, its concentration in Hepa 1-6 nuclear extracts may be too low for such a complex to be observed. Such a precedent with this transcription factor has been established (32).


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 10.   Gel mobility shift assay confirms the binding of C/EBPbeta to the -47 to -78 bp region of the murine fVII promoter. A probe consisting of bp -47 to -78 of the murine fVII promoter, and containing a putative C/EBPbeta site, was tested for its ability to bind specifically to Hepa 1-6 nuclear extract alone or Hepa 1-6 nuclear extract plus 100 ng of recombinant C/EBPalpha or C/EBPbeta . Lane 1 contains probe without protein. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lane 3 contains probe with 12 µg of Hepa 1-6 nuclear extract, plus 100 ng of recombinant C/EBPalpha . Lane 4 contains probe with 12 µg of Hepa 1-6 nuclear extract, plus 100 ng of recombinant C/EBPbeta . The C/EBPbeta -DNA complex is indicated by an arrow. Lanes 5-8 are identical to lanes 1-4 but contain a probe consisting of bp -47 to -78 of the murine fVII promoter with a mutant C/EBPbeta site. The sequences of the oligonucleotide probes used are shown above the gels.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 11.   Anti-C/EBPbeta antibodies supershift the binding of recombinant C/EBPbeta to bp -47 to -78 of the murine fVII promoter. A probe consisting or bp -47 to -78 of the murine fVII promoter and containing a putative C/EBPbeta site was labeled and used in an antibody supershift experiment with Hepa 1-6 nuclear extract and recombinant C/EBPbeta . Lane 1 contains probe without protein. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lane 3 contains probe with 12 µg of Hepa 1-6 nuclear extract plus 100 ng of recombinant C/EBPbeta . Lane 4 is identical to lane 3, except that 2 µl of anti C/EBPbeta polyclonal antibody was added to the binding reaction. Lane 5 is identical to lane 3, except that 2 µl of anti NF-kappa B polyclonal antibody was added to the binding reaction. The C/EBPbeta -DNA complex and supershift are indicated by arrows.

The importance of these transcription factors in the in vivo regulation of the fVII gene was assessed by in vivo DMS methylation and analysis of the resulting genomic footprints by LMPCR. Autoradiograms of these experiments are provided in Fig. 12 and show protection of several G residues in each of the sites assigned by the above in vitro data to C/EBPbeta , H4TF1/Sp1, and HNF4. In addition, clear footprints have been found upstream of the C/EBPbeta site. These protected G residues, at sequence locations -89, -90, -108, and -109, are contained within two DNA segments (residues -81 to -98 and -106 to -121) predicted in Fig. 2 to be capable of binding to NF1. These latter two regions were not revealed in the in vitro footprint of Fig. 3. Additionally, in vitro gel shift experiments with synthetic oligonucleotides encompassing this region of the gene, as well as with NF1 consensus oligonucleotides, did not confirm the presence of NF1 sites. These negative results may be due to the experimental conditions chosen for the in vitro binding assays, or NF1 binding to the murine fVII promoter may require that other regions of the gene are brought into proximity through folding. In similar experiments with the top strand of DNA, no footprints were observed.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 12.   In vivo methylation pattern of the lower strand DNA using primers 1, 2, and 3, located 5' of the transcription factor binding sites. Along side each symbol or marker denoting protection is the corresponding nucleotide number of the G residue on the promoter sequence. Control DNA was derived from a murine B lymphocyte cell line (S194), which is identical in sequence to the HEP 1-6 cells in the areas studied. The location of each transcription factor binding site is denoted by solid bars, and the identity of each is listed.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Coagulation fVII is a member of a closely related group of proteins, which also include fIX, fX, and PC and which share considerable homology in their domain organizations. These proteins play different roles in blood coagulation and anticoagulation, suggesting that only minor overall evolutionary changes have occurred in diversifying their functions. The correspondence of the domain structures of the proteins and the exon placements within the genes demonstrate that evolution of this family of proteins probably occurred by exon shuffling among their genes, perhaps facilitated by intronic recombination mechanisms (38). Other proteins that contain some of these domains, such as those containing kringle and epidermal growth factor modules, may also have evolved, at least in part, in this manner.

It is relevant to determine whether expression of genes of these related proteins is regulated by similar factors, and whether tissue-specific factors are obvious regulatory elements. In this regard, fVII is an excellent paradigm for such an investigation because, unlike fX (39) and PC (40), and similar to fIX (41), fVII biosynthesis is much more highly confined to the liver. In addition, steady state mRNA levels of fVII appear to correlate well with the plasma concentration of this protein (17). The recent characterization of mice containing a targeted deletion of the fVII gene (30) provides further impetus for an understanding of the transcription factors that regulate fVII gene transcription in order that the full applicability of this murine system to that of humans can be more completely assessed. This investigation has been accomplished, and the totality of in vitro and in vivo data present in this manuscript show that H4TF1, HNF4, and C/EBPbeta potentially function as transcriptional regulators of the murine fVII gene. There also exists a strong possibility that two additional NF1 sites are present in the 5'-flanking DNA region. All of these factor binding sites exist within 130 bp upstream of the transcription initiation site, thus showing that defined regulatory elements for expression of murine fVII are present in a relatively small region of the 5'-flank of this gene.

H4TF1 was first identified as a factor that binds the human histone H4 promoter (33). It was later partially purified and shown to be distinct from Sp1 (42), although its recognition sequence, 5'-GGGGGAGGGG, is very similar to that of Sp1, 5'-GGGGCGGGG. H4TF1 has been implicated as an important regulatory element in the promoters of human eosinophil peroxidase (43), and human pyruvate dehydrogenase-beta (44). In addition, a non-Sp1 factor that recognizes the sequence 5'-GGGGGAGGGG has been described as regulating the human beta -enolase gene (ENO-3) (45) and the immunoglobulin heavy chain enhancer, 3'-alpha E(hsl,2) (46). A G-rich factor binding element, 5'GGGGGAGGGG, was identified in the human fVII promoter, which matches the consensus sequences for both H4TF1 and Sp1 (17). Gel shift analysis revealed two closely spaced complexes (A and B), both shown to be specific. The slower moving complex A was shown to contain Sp1, while complex B did not contain this factor. A single point mutation completely abolished the formation of both complexes. It was concluded that the loss of both complexes on a gel shift assay with the mutation of a single nucleotide was consistent with the existence of overlapping binding sites for Sp1 and another nuclear protein. A separate study identified the same G-rich sequence as being important in transcription factor binding to human fVII (47). This latter group found that when a Sp1 sequence from the human metallothionein IIA gene (MIIA probe) was labeled, unlabeled MIIA probe efficiently competed for the complex formed, but the fVII oligonucleotide probe of the putative Sp1 site did not. This is difficult to reconcile if this site is in fact a Sp1 binding locus, but not if it is a H4TF1 site. Our results clearly show the existence of a specific complex on gel shifts, the formation of which is inhibited by a H4TF1 consensus oligonucleotide, but not by one containing the Sp1 consensus sequence (Fig. 4). We also show that a monoclonal antibody to Sp1 did not react with this complex formed from Hepa 1-6 cell nuclear extract. This antibody, does, however, completely supershift recombinant human Sp1 bound to the fVII G-rich element (Fig. 6). Thus, while recombinant human Sp1 can bind to this sequence in the absence of Hepa 1-6 nuclear extract, it appears that H4TF1 in Hepa 1-6 nuclear extract has a much higher affinity for the G-rich element in the murine fVII promoter, thereby effectively precluding Sp1 binding. It was possible to effectively distinguish between the binding activities of Sp1 and H4TF1 in nuclear extract by using a labeled Sp1 consensus oligonucleotide in gel shifts. In this case, unlabeled Sp1 oligonucleotide was able to compete for the complex, whereas the H4TF1 consensus oligonucleotide did not. In addition, the mouse fVII G-rich element competed very poorly, and the human G-rich element did not compete at all in this set of experiments. Methylation interference assays (Fig. 7), using Hepa 1-6 extract and recombinant human Sp1, showed that although both H4TF1 in Hepa 1-6 nuclear extract and recombinant Sp1 recognize overlapping regions of the fVII promoter, these binding sites are not identical. Taken together, these data strongly implicate the binding of H4TF1, and not Sp1, to this sequence in nuclear extracts.

HNF4 is a novel member of the steroid hormone receptor superfamily and is expressed in liver, kidney, and intestine (32, 48). It has been described as a factor crucial for the liver-selective transcription of genes encoding ornithine transcarbamylase (49), transthyretin (50), and apolipoprotein CIII (51). This transcription factor binds to the promoter region of the human fX gene and has been shown to be required for its expression (52). Disruption of a binding site for HNF4 in the human fIX promoter results in one of the hemophilia B-Leiden variants (53). HNF4 also functionally binds to a similar region of the promoter of human fVII (17, 47). We have clearly identified a HNF4 site within nucleotides -33 to -50 of the murine fVII promoter through gel mobility shift assays (Fig. 8) and antibody supershift assays (Fig. 9). The importance of this site resides in the liver-specific expression of this gene and shows that the necessary machinery for this critical property of the gene is indeed present.

C/EBPbeta is a liver-enriched member of the basic domain-leucine zipper protein family (54). The originally identified member of this family, which is also liver-enriched, is C/EBPalpha (55). Other designations for C/EBPbeta are NF-IL6 (56), LAP (57), IL-6DBP (58), AGP/EBP (59), and CRP2 (60). Regulation of the expression of this transcription factor is involved in the expression of several liver-specific genes since C/EBPbeta is not highly expressed in adult hepatocytes but is expressed in the hepatoma cell lines, HepG2 and Hepa3B (61). In adult hepatocytes, however, it is strongly induced after lipopolysaccharide, IL-1, or IL-6 stimulation, suggesting that it may be involved in acute phase gene induction (56, 59, 62). In confirmation of this, C/EBPbeta has been shown to bind to promoters of certain human acute phase responsive proteins, such as albumin (61), alpha 1-antitrypsin (50), alpha 1-acid glycoprotein (63), C-reactive protein (62), haptoglobin (62), and hemopexin (64). Additionally, a switch from C/EBPalpha to C/EBPbeta as a transcriptional regulatory element accompanies the acute phase induction of alpha 1-acid glycoprotein (50). The induction of C/EBPbeta could also explain the higher concentration of this factor in HepG2 and Hepa3B cells, as a response to the transformation events required to establish these cell lines. We have assigned a C/EBP site within the -47 to -78 region of the gene of the murine fVII promoter by gel shift (Fig. 10) and antibody supershift (Fig. 11) assays. In addition, we have shown that recombinant C/EBPbeta , but not recombinant C/EBPalpha , binds to this site (Fig. 10). A specific C/EBPbeta complex with nuclear extract from the murine hepatoma cell line Hepa 1-6 was not observed, but unlike HepG2 and Hepa3B, Hepa 1-6 may more accurately reflect the physiological expression pattern of C/EBPbeta in that little or no C/EBPbeta is present in adult liver cells prior to induction with lipopolysaccharide or cytokines. The fact that C/EBPbeta binds the murine fVII promoter raises the possibility that murine fVII may be an inducible protein (65, 66), and responsive to the state of differentiation of cells and to hormones (54).

In addition to these sites, which have been confirmed through in vitro experiments, in vivo DMS footprint analyses (Fig. 12) showed protection of G residues involved in each of the C/EBPbeta , H4TF1, and HNF4 binding sites (Fig. 2). In addition, four other G residues upstream of the C/EBPbeta site were protected from methylation, two each of which are contained in separate regions of the promoter. These two 5' regions include TGG sequences, which are located near the protected G residues. These TGG sequences have been found to be important in recognition of the NF1 family of transcription factors (67).

Finally, an illustration of the transcription factors that have been identified to be potentially functional in liver as regulators of transcription of the genes of this gene family, including fVII, fIX, fX, and PC, is provided in Fig. 13. These sites have all been identified through in vitro studies. The only exception to this is the murine fVII gene in the current investigation, wherein in vivo experiments (Fig. 12) confirm the sites identified in vitro and locate additional factor sites. There are many similarities in the genes in the regulatory elements in this general location, which are within ±200 bp of their major transcription start sites. Specifically, a HNF4 binding site is found within 60 bp of the major transcription initiation site in all of the genes, except that of human PC. However, in this case, both HNF1 and HNF3 sites are present in this region. Thus, there is an obvious basis for liver-enriched transcription of these genes.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 13.   Comparison of the known transcription factor binding sites within the genes of vitamin K-dependent coagulation factors related to fVII. Only those sites present within approximately 200 bp upstream and 70 bp downstream of the major transcription initiation site are shown. Since the human fX gene does not have a defined major transcription start site, but multiple initiation sites, the numbering in this case was from the translation start site. The lengths of the ovals represent the nucleotides involved in binding of that particular factor. DBP, D-site-binding protein; NF1L, nuclear factor 1-liver specific; NFY, nuclear factor Y; Sp1, stimulating protein 1. The unfilled ovals represent factors that bind to the indicated regions of the genes that have not been identified. The following sources were used to prepare this illustration; human fVII (17, 47, 73), murine fVII (this study); human fIX (74-76), human fX (52) (77, 78), and human PC (79).

Only two of the genes possess C/EBP binding sites, viz. mouse fVII (C/EBPbeta ) and human fIX (C/EBPalpha ). The importance of this transcription factor in liver expression of genes is underpinned by the finding that disruption of its binding site in the fIX gene results in a hemophilia B-Leiden variant (68). Additionally, because of the existence of the C/EBPbeta transcription factor binding site in the murine fVII gene, it is possible that fVII is an acute phase protein in the mouse. The proximal promoter region of human fVII does not interact with this transcription factor, perhaps indicative of a species difference in the acute phase response of fVII.

A site for the ubiquitous H4TF1 transcription factor overlaps with that of a Sp1 site in the murine fVII gene. A Sp1 site is present in a similar location in the human fVII and human fX genes, with another further downstream in the human PC gene. It is possible that this overlapping H4TF1 site is present in the Sp1 location in these other genes, especially that of human fVII, since the properties described in the relevant papers for the Sp1 site would be consistent with additional binding of H4TF1, or with H4TF1 as a replacement for Sp1. Additionally, the oligonucleotide corresponding to this region of the human fVII gene did not appear to react with purified Sp1 protein (Fig. 5).

Of the fVII-related genes discussed in this report, only human fIX, and possibly murine fVII, possess NF1 binding sites, and these exist in similar locations in the promoter element. This additional transcription factor binding site(s) in these genes may partly explain their strong liver expression capabilities, especially since at least one member of this family of proteins, murine NF1-B3 (identical to the rat and chicken isoforms, NF1-L and cNF1-A1.1, respectively), is a liver-enriched transcription factor. Also, it is known that NF1 cooperates with other liver factors, such as HNF1, HNF3, and HNF4, to enhance target gene transcription (69-71), or transcription of genes for other regulatory factors, such as C/EBPbeta (72). Thus, NF1 may play these types of direct or indirect roles in human fIX and mouse fVII expression.

In summary, we have shown that HNF4, C/EBPbeta , H4TF1, and possibly NF1 binding sites exist within the minimal promoter region of the murine fVII gene, as defined in mouse Hepa 1-6 liver cells. It is likely that other positive and negative regulatory factors that bind further upstream or downstream of the region investigated also influence transcription of this gene. However, those factors that have been identified herein are capable of eliciting the known expression pattern of the gene, and further suggest directions for investigation of other regulatory properties of fVII gene expression.

    ACKNOWLEDGEMENT

We thank Dr. Esohe Idusogie for provision of the 7.0-kb 5'-flanking sequence of the murine fVII gene.

    FOOTNOTES

* This work was supported by Grant HL-19982 from the National Institutes of Health, by a Kleiderer-Pezold Family endowed professorship (to F. J. C.), and by a grant from the American Heart Association, Indiana Affiliate (to E. D. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 219-631-6456; Fax: 219-631-8149; E-mail: castellino.1{at}nd.edu.

1 The abbreviations used are: fVII, fIX, and fX, coagulation factors VII, IX, and X, respectively; fVIIa, fIXa, and fXa, activated coagulation factors VII, IX, and X, respectively; PC, anticoagulant protein C; TF, tissue factor; Gla, gamma -carboxyglutamic acid; C/EBPalpha , CCAAT/enhancer-binding protein-alpha ; C/EBPbeta , CCAAT/enhancer-binding protein-beta ; HNF1/2/3/4, hepatocyte nuclear factors 1/2/3/4, respectively; H4TF1, histone H4 gene transcription factor-1; NF1, nuclear factor 1; Sp1, stimulating protein 1; CAT, chloramphenicol acetyltransferase; DMS, dimethyl sulfate; beta -gal, beta -galactosidase; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; LMPCR, ligand-mediated polymerase chain reaction; fpu, footprint unit(s); bp, base pair(s); kb, kilobase(s); PBS, phosphate-buffered saline; IL, interleukin.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Komiyama, Y., Pedersen, A. H., and Kisiel, W. (1990) Biochemistry 29, 9418-9425[CrossRef][Medline] [Order article via Infotrieve]
  2. Bom, V. J. J., van Hinsberg, V. W. M., Reinalda-Poot, H. H., Mohanlal, R. W., Bertina, R. M. (1991) Thromb. Haemostasis 66, 283-291[Medline] [Order article via Infotrieve]
  3. Broze, G. J. J., and Miletich, J. P. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1886-1890[Abstract/Free Full Text]
  4. Radcliffe, R., and Nemerson, Y. (1975) J. Biol. Chem. 250, 388-395[Abstract/Free Full Text]
  5. Nakagaki, T., Foster, D. C., Berkner, K. L., Kisiel, W. (1991) Biochemistry 30, 10819-10824[CrossRef][Medline] [Order article via Infotrieve]
  6. Kazama, Y., Hamamoto, T., Foster, D. C., Kisiel, W. (1995) J. Biol. Chem. 270, 66-72[Abstract/Free Full Text]
  7. O'Hara, P. J., Grant, F. J., Haldeman, B. A., Gray, C. L., Insley, M. Y., Hagen, F. S., Murray, M. J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5158-5162[Abstract/Free Full Text]
  8. Yoshitake, S., Schach, B. G., Foster, D. C., Davie, E. W., Kurachi, K. (1985) Biochemistry 24, 3736-3750[CrossRef][Medline] [Order article via Infotrieve]
  9. Leytus, S. P., Foster, D. C., Kurachi, K., and Davie, E. W. (1986) Biochemistry 25, 5098-5102[CrossRef][Medline] [Order article via Infotrieve]
  10. Foster, D. C., Yoshitake, S., and Davie, E. W. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 4673-4677[Abstract/Free Full Text]
  11. Toomey, J. R., Smith, K. J., and Stafford, D. W. (1991) J. Biol. Chem. 266, 19198-19202[Abstract/Free Full Text]
  12. Ruf, W., Kalnik, M. W., Lund-Hansen, T., and Edgington, T. S. (1991) J. Biol. Chem. 266, 15719-15725[Abstract/Free Full Text]
  13. Matsushita, T., Kojima, T., Emi, N., Takahashi, I., and Saito, H. (1994) J. Biol. Chem. 269, 7355-7363[Abstract/Free Full Text]
  14. Banner, D. W., D'Arcy, A., Chene, C., Winkler, F. K., Guha, A., Konigsberg, W. H., Nemerson, Y., Kirchofer, D. (1996) Nature 380, 41-46[CrossRef][Medline] [Order article via Infotrieve]
  15. Bhardwaj, D., Iino, M., Kontoyianni, M., Smith, K. J., Foster, D. C., Kisiel, W. (1996) J. Biol. Chem. 271, 30685-30691[Abstract/Free Full Text]
  16. Idusogie, E., Rosen, E. D., Carmeliet, P., Collen, D., and Castellino, F. J. (1996) Thromb. Haemostasis 76, 957-964[Medline] [Order article via Infotrieve]
  17. Pollak, E. S., Hung, H.-L., Godin, W., Overton, G. C., High, K. A. (1996) J. Biol. Chem. 271, 1738-1747[Abstract/Free Full Text]
  18. Zimmermann, R., Ehlers, G., Ehlers, W., von Voss, H., Gobel, U., Wahn, U. (1979) Blut 38, 119-125[CrossRef][Medline] [Order article via Infotrieve]
  19. Mariani, G., and Mazzucconi, M. G. (1983) Haemostasis 13, 169-177[Medline] [Order article via Infotrieve]
  20. Chaing, S., Clarke, B., Sridhara, S., Chu, K., Friedman, P., VanDusen, W., Roberts, H. R., Blajchman, M., Monroe, D. M., High, K. A. (1994) Blood 83, 3524-3535[Abstract/Free Full Text]
  21. Escoffre, M., Zini, J. M., Schliamser, L., Mazoyer, E., Soria, C., Tobelem, G., and Dupuy, E. (1995) Br. J. Haematol. 91, 739-741[Medline] [Order article via Infotrieve]
  22. Arbini, A. A., Pollak, E. S., Bayleran, J. K., High, K. A., Bauer, K. A. (1997) Blood 89, 176-182[Abstract/Free Full Text]
  23. Kazama, Y., Foster, D. C., and Kisiel, W. (1992) Blood Coag. Fibrinol. 3, 697-702[Medline] [Order article via Infotrieve]
  24. Bernardi, F., Castaman, G., Redaelli, R., Pinotti, M., Lunghi, B., Rodeghiero, F., and Marchetti, G. (1994) Hum. Mol. Genet. 3, 1175-1177[Free Full Text]
  25. Bernardi, F., Castaman, G., Pinotti, M., Ferraresi, P., Di Iasio, M. G., Lunghi, B., Rodeghiero, F., Marchetti, G. (1996) Hum. Mutat. 8, 108-115[CrossRef][Medline] [Order article via Infotrieve]
  26. Lane, A., Cruickshank, J. K., Mitchell, J., Henderson, A., Humphries, S., and Green, F. (1992) Atherosclerosis 94, 43-50[CrossRef][Medline] [Order article via Infotrieve]
  27. Meade, T. W., Mellows, S., Brozovic, M., Miller, G. J., Chakrabarti, R. R., North, W. R. S., Haines, A. P., Stirling, Y., Imeson, J. D., Thompson, S. G. (1986) Lancet 2, 533-537[Medline] [Order article via Infotrieve]
  28. Heinrich, J., Balleisen, L., Schulte, H., Assmann, G., and Vandeloo, J. (1994) Arterioscler. Thromb. 14, 54-59[Abstract/Free Full Text]
  29. Junker, R., Heinrich, J., Shulte, H., van de Loo, J., Assmann, G. (1997) Arterioscler. Thromb. Vasc. Biol. 17, 1539-1544[Abstract/Free Full Text]
  30. Rosen, E., Chan, J. C. Y., Idusogie, E., Clotman, F., Vlasuk, G., Luther, T., Jalbert, J., Albrecht, S., Zhong, L., Lissens, A., Schoojans, L., Moons, L., Collen, D., Castellino, F. J., Carmeliet, P. (1997) Nature 390, 290-293[CrossRef][Medline] [Order article via Infotrieve]
  31. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
  32. Sladek, F. M., Zhong, W. M., Lai, E., and Darnell, J. E., Jr. (1990) Genes Dev. 4, 2353-2365[Abstract/Free Full Text]
  33. Dailey, L., Hanly, S. M., Roeder, R. G., Heintz, N. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7241-7245[Abstract/Free Full Text]
  34. Galas, D. J., and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170[Abstract/Free Full Text]
  35. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65, 499-560[Medline] [Order article via Infotrieve]
  36. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467[Abstract/Free Full Text]
  37. Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995) Nucleic Acids Res. 23, 4878-4884[Abstract/Free Full Text]
  38. Patthy, L. (1996) Matrix Biol. 15, 301-310[CrossRef][Medline] [Order article via Infotrieve]
  39. Hung, H.-L., and High, K. A. (1996) J. Biol. Chem. 271, 2323-2331[Abstract/Free Full Text]
  40. Tanabe, S., Sugo, T., and Matsuda, M. (1991) J. Biochem. (Tokyo) 109, 924-928[Abstract/Free Full Text]
  41. Salier, J.-P., Hirosawa, S., and Kurachi, K. (1990) J. Biol. Chem. 265, 7062-7068[Abstract/Free Full Text]
  42. Dailey, L., Roberts, S. B., and Heintz, N. (1988) Genes Dev. 2, 1700-1712[Abstract/Free Full Text]
  43. Yamaguchi, Y., Zhang, D. E., Sun, Z., Albee, E. A., Nagata, S., Tenen, D. G., Ackerman, S. J. (1994) J. Biol. Chem. 269, 19410-19419[Abstract/Free Full Text]
  44. Madhusudhan, K. T., Naik, S. S., and Patel, M. S. (1995) Biochemistry 34, 1288-1294[CrossRef][Medline] [Order article via Infotrieve]
  45. Feo, S., Antona, V., Barbieri, G., Passantino, R., Cali, L., and Giallongo, A. (1995) Mol. Cell. Biol. 15, 5991-6002[Abstract]
  46. Singh, M., and Birshtein, B. K. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4392-4397[Abstract/Free Full Text]
  47. Greenberg, D., Miao, C. H., Ho, W. T., Chung, D. W., Davie, E. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 12347-12351[Abstract/Free Full Text]
  48. Zhong, W., Mirkovitch, J., and Darnell, J. E., Jr. (1994) Mol. Cell. Biol. 14, 7276-7284[Abstract/Free Full Text]
  49. Nishiyori, A., Tashiro, H., Kimura, A., Akagi, K., Yamamura, K., Mori, M., and Takiguchi, M. (1994) J. Biol. Chem. 269, 1323-1331[Abstract/Free Full Text]
  50. Costa, R. H., Grayson, D. R., Xanthopoulos, K. G., Darnell, J. E. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3840-3844[Abstract/Free Full Text]
  51. Mietus-Snyder, M., Sladek, F. M., Ginsburg, G. S., Kuo, C. F., Ladias, J. A., Darnell, J. E. J., Karathanasis, S. K. (1992) Mol. Cell. Biol. 12, 1708-1718[Abstract/Free Full Text]
  52. Miao, C. H., Leytus, S. P., Chung, D. W., Davie, E. W. (1992) J. Biol. Chem. 267, 7395-7401[Abstract/Free Full Text]
  53. Reijnen, M. J., Sladek, F. M., Bertina, R. M., Reitsma, P. H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6300-6303[Abstract/Free Full Text]
  54. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
  55. Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., McKnight, S. L. (1988) Genes Dev. 2, 786-800[Abstract/Free Full Text]
  56. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906[Medline] [Order article via Infotrieve]
  57. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schibler, U. (1990) Genes Dev. 4, 1541-1551[Abstract/Free Full Text]
  58. Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 63, 643-653[CrossRef][Medline] [Order article via Infotrieve]
  59. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., Lee, S. C. (1990) Mol. Cell. Biol. 10, 6642-6653[Abstract/Free Full Text]
  60. Williams, S. C., Cantwell, C. A., and Johnson, P. F. (1991) Genes Dev. 5, 1553-1567[Abstract/Free Full Text]
  61. Friedman, A. D., Landschulz, W. H., McKnight, S. L. (1989) Genes Dev. 3, 1314-1322[Abstract/Free Full Text]
  62. Isshiki, H., Akira, S., Sugita, T., Nishio, Y., Hashimoto, S., Pawlowski, T., Suematsu, S., and Kishimoto, T. (1991) New Biol. 3, 63-70[Medline] [Order article via Infotrieve]
  63. Alam, T., and Papaconstantinou, J. (1992) Biochemistry 31, 1928-1936[CrossRef][Medline] [Order article via Infotrieve]
  64. Poli, V., and Cortese, R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8202-8206[Abstract/Free Full Text]
  65. Birkenmeier, E. H., Gwynn, B., Howard, S., Jerry, J., Gordon, J. I., Landschulz, W. H., McKnight, S. L. (1989) Genes Dev. 3, 1146-1156[Abstract/Free Full Text]
  66. Umek, R. M., Friedman, A. D., and McKnight, S. L. (1991) Science 251, 288-292[Abstract/Free Full Text]
  67. Gil, G., Smith, J. R., Goldstein, J. L., Slaughter, C. A., Orth, K., Brown, M. S., Osborne, T. F. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8963-8967[Abstract/Free Full Text]
  68. Reitsma, P. H., Mandalaki, T., Kasper, C. K., Bertina, R. M., Briet, E. (1989) Blood 73, 743-746[Abstract/Free Full Text]
  69. Tronche, F., Rollier, A., Sourdive, D., Cereghini, S., and Yaniv, M. (1991) J. Mol. Biol. 222, 31-43[CrossRef][Medline] [Order article via Infotrieve]
  70. Jackson, D. A., Rowader, K. E., Stevens, K., Jiang, C., Milos, P., and Zaret, K. S. (1993) Mol. Cell. Biol. 13, 2401-2410[Abstract/Free Full Text]
  71. Xanthopoulos, K. G., and Mirkovitch, J. (1993) Eur. J. Biochem. 216, 353-360[Medline] [Order article via Infotrieve]
  72. Arenzana, N., and Rodriguez de Cordoba, S. (1996) J. Immunol. 156, 168-175[Abstract]
  73. Erdmann, D., and Heim, J. (1995) J. Biol. Chem. 270, 22988-22996[Abstract/Free Full Text]
  74. Crossley, M., and Brownlee, G. G. (1990) Nature 345, 444-446[CrossRef][Medline] [Order article via Infotrieve]
  75. Picketts, D. J., Mueller, C. R., and Lillicrap, D. (1994) Blood 84, 2992-3000[Abstract/Free Full Text]
  76. Kurachi, S., Furukawa, M., Salier, J. P., Wu, C. T., Wilson, E. J., French, F. S., Kurachi, K. (1994) Biochemistry 33, 1580-1591[CrossRef][Medline] [Order article via Infotrieve]
  77. Huang, L. H., Ke, X. H., Sweeney, W., and Tam, J. P. (1989) Biochem. Biophys. Res. Commun. 160, 133-139[CrossRef][Medline] [Order article via Infotrieve]
  78. Huang, N.-M., Hung, H.-L., Stanfield-Oakley, S. A., High, K. A. (1992) J. Biol. Chem. 267, 15440-15446[Abstract/Free Full Text]
  79. Miao, C. H., Ho, W. T., Greenberg, D. L., Davie, E. W. (1996) J. Biol. Chem. 271, 9587-9594[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
C. Bertolucci, N. Cavallari, I. Colognesi, J. Aguzzi, Z. Chen, P. Caruso, A. Foa, G. Tosini, F. Bernardi, and M. Pinotti
Evidence for an Overlapping Role of CLOCK and NPAS2 Transcription Factors in Liver Circadian Oscillators
Mol. Cell. Biol., May 1, 2008; 28(9): 3070 - 3075.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Jackson, K. R. Cronin, R. Zachariah, and J. A. Carew
CCAAT/Enhancer-binding Protein-beta Participates in Insulin-responsive Expression of the Factor VII Gene
J. Biol. Chem., October 26, 2007; 282(43): 31156 - 31165.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
O. Barbier, H. Girard, Y. Inoue, H. Duez, L. Villeneuve, A. Kamiya, J.-C. Fruchart, C. Guillemette, F. J. Gonzalez, and B. Staels
Hepatic Expression of the UGT1A9 Gene Is Governed by Hepatocyte Nuclear Factor 4{alpha}
Mol. Pharmacol., January 1, 2005; 67(1): 241 - 249.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. J. Reinhart, S. C. Williams, B. J. Clark, and D. M. Stocco
SF-1 (Steroidogenic Factor-1) and C/EBP{beta} (CCAAT/Enhancer Binding Protein-{beta}) Cooperate to Regulate the Murine StAR (Steroidogenic Acute Regulatory) Promoter
Mol. Endocrinol., May 1, 1999; 13(5): 729 - 741.
[Abstract] [Full Text]


Home page
BloodHome page
J. A. Carew, E. S. Pollak, K. A. High, and K. A. Bauer
Severe Factor VII Deficiency Due to a Mutation Disrupting an Sp1 Binding Site in the Factor VII Promoter
Blood, September 1, 1998; 92(5): 1639 - 1645.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stauffer, D. R.
Right arrow Articles by Castellino, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stauffer, D. R.
Right arrow Articles by Castellino, F. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement