|
Characterization of Transcriptional Regulatory Elements in the
Promoter Region of the Murine Blood Coagulation Factor VII Gene*
Daniel R.
Stauffer,
Beatrice N.
Chukwumezie,
Julie A.
Wilberding,
Elliot D.
Rosen, and
Francis J.
Castellino
From the Department of Chemistry and Biochemistry and the Center
for Transgene Research, University of Notre Dame,
Notre Dame, Indiana 46556
 |
ABSTRACT |
To identify the 5 sequences of the murine
coagulation factor VII (fVII) gene that resulted in its efficient
transcription, a variety of 5 -flanking sequences up to 7 kilobase
pairs upstream of the translation ATG initiation codon were fused to
the reporter gene, bacterial chloramphenicol acetyltransferase, and
relative expression levels of this gene in mouse Hepa 1-6 cells were
determined. It was found that the 5 region extending approximately 85 base pairs (bp) upstream of the transcriptional initiation site served as the minimal DNA region that provided full relative promoter activity
for chloramphenicol acetyltransferase expression. This region of the
gene also contains consensus sequences for liver-enriched transcription
factors, C/EBP and HNF4, as well as for the ubiquitous protein
factors, AP1, H4TF1, NF1, and Sp1. In vitro DNase I
footprinting of the 200-bp proximal region of the promoter with a
murine Hepa 1-6 cell nuclear extract revealed a clear footprint of a
region corresponding to 80 to 28 bp of the murine fVII gene,
suggesting that liver factors interact with this region of the DNA.
Competitive gel shift and supershift assays with different synthetic
oligonucleotide probes demonstrate that proteins contained in the
nuclear extract, identified as C/EBP , H4TF1, and HNF4, bind to a
region of the murine fVII DNA from 85 to 32 bp upstream of the
transcription start site. Purified Sp1 also interacts with this region
of the DNA at a site that substantially overlaps, but is not identical to, the H4TF1 binding locus. Binding of Sp1 to the mouse DNA was not
observed with the nuclear extract as the source of the transcription factors, suggesting that Sp1 is likely displaced from its binding site
by H4TF1 in the crude extract. In vivo dimethyl sulfate
footprint analysis confirmed the existence of these sites and
additionally revealed two other binding regions slightly upstream of
the CCAAT/enhancer-binding protein (C/EBP) binding locus that are
homologous to NF1 binding sequences. The data demonstrate that
appropriate transcription factor binding sites exist in the proximal
promoter region of the murine fVII gene that are consistent with its
strong liver-based expression in a highly regulated manner.
 |
INTRODUCTION |
Factor VII (fVII)1 is a
vitamin K-dependent plasma protein that serves as the
precursor for fVIIa, a serine protease that functions as a procoagulant
in the extrinsic blood coagulation pathway. This latter activity is
derived in part from the ability of fVIIa to activate the coagulation
zymogens, fIX and fX to their respective enzymes, fIXa and fXa (1, 2).
The presence of a cofactor for fVII, TF, along with Ca2+,
creates optimal conditions for the functioning of fVIIa. Tissue factor
pathway inhibitor serves to down-regulate this coagulation pathway by
inactivating both fXa and the fVIIa·TF complex (3).
Human fVII is synthesized in liver as a single-chain protein containing
406 amino acids. Activation of this zymogen occurs consequent to
cleavage of the Arg152-Ile153 peptide bond.
This step is catalyzed by fXa (4), thrombin (4), TF·fVIIa (5), or
hepsin (6), and leads to an enzyme composed of a 152-amino acid light
chain, disulfide-linked to a 254-residue heavy chain. Factor VII is
organized as a series of domain units (7) that are common to fIX (8),
fX (9), and protein C (10). Specifically, the light chain of fVIIa
consists of a Gla-containing domain, followed by a short helical spacer region and two epidermal growth factor-like motifs. The functions of
these modules are to provide binding sites for regulators of fVII
activity, such as TF (11, 12). The heavy chain of fVIIa contains the
serine protease catalytic machinery, as well as binding sites for TF
(13-15).
The intron-exon organization of the human fVII gene (7) and the entire
genomic sequence of murine fVII (16) have been established. Both of
these genes contain approximately 12 kb, and include transcriptional
and translation start sites, 5 -flanking transcriptional regulatory
regions, and 3 -capping polyadenylation sites and polyadenylation
enhancer elements. The positions of the introns in these genes are in
identical locations, and splice the exonic regions that encode the
protein domains. The human fVII DNA is organized in eight exons, with
an optional exon in the leader peptide region. The murine fVII gene
possesses seven introns and eight exons. The major transcriptional
start site of murine fVII has been located nine nucleotides upstream of
the ATG translation initiation site (16). This short transcriptional initiator site in murine fVII presents a similar situation to that of
the human gene, where in this latter case the major transcriptional start site was located 51 nucleotides 5 of the translational initiation site (17).
Although genetic deficiencies of human fVII have been reported, few
patients present total fVII deficiency states. However, very low levels
of this zymogen (<2% of normal) are associated with severe
coagulation disorders (18-22). The clinical manifestations of less
severe deficiencies are variable (18, 19, 23-25). Such observations
suggest that only low levels of fVII activity are required to maintain
hemostasis in unchallenged patients. Other data suggest that fVII
levels may be reciprocally involved in coronary heart disease, perhaps
through a linkage with hypertriglyceridemia (26). The prospective
Northwick Park Heart (27), PROCAM (28), and PROCAM follow-up studies
(29) suggest that elevated plasma levels of fVII coagulant activity
constitute an independent risk factor for fatal outcomes of coronary
heart disease in middle-aged men, the chances of which worsen when
other risk factors are present. In addition, severe arterial thrombosis
in a fVII-deficient patient was observed after infusion of fVII (21),
showing that even artificial elevation of fVII levels can result in
thrombotic complications.
To investigate the role of fVII in embryonic development and survival,
mice were generated with a complete fVII deficiency (30). Unlike
genetic deficiency of TF, which results in embryonic lethality at
approximately 10.5 days post coitum, fVII-deficient mice develop
normally. However, the fVII-deficient mice suffer severe perinatal
lethality mainly from intra-abdominal bleeding. Those surviving birth
expire within the next several weeks, primarily from intracranial
bleeding (30). Since human clinical data, as well as the
fVII-deficiency state produced in mice, indicates that fVII activity
levels are important in hemostatic and cardiovascular pathology, we
undertook an investigation aimed at defining the factors that regulate
transcription of the fVII gene. The results of this study constitute
the present contribution.
 |
EXPERIMENTAL PROCEDURES |
Proteins--
Recombinant transcription factors C/EBP and
C/EBP were gifts from Dr. Peter F. Johnson (NCI, National Institutes
of Health, Frederick, MD). Sp1 was a product of Promega (Madison,
WI).
The rabbit C/EBP polyclonal antibody was produced against a peptide
corresponding to amino acids 258-276 of rat C/EBP (Santa Cruz
Biotechnology, Santa Cruz, CA). The rabbit Sp1 antibody (Santa Cruz
Biotechnology) was raised against a peptide corresponding to amino
acids 520-538 of human Sp1, a region with an identical sequence to the
mouse protein. The NF- B control polyclonal antibody (Santa Cruz
Biotechnology) was generated against a peptide corresponding to amino
acids 350-363 of human p50. HNF4 rabbit antiserum, raised against a
peptide corresponding to amino acids 445-455 of rat HNF4, was obtained
from Dr. Frances Sladek (University of California, Riverside, CA).
Aprotinin and leupeptin were products of Sigma. Proteinase K was a
product of Boehringer Mannheim. DNase I was obtained from Worthington.
Expression Vectors--
The expression vectors, pSV- -gal
control (C) vector and pCAT-control (C) vector, pCAT-enhancer (E)
vector, and pCAT-basic vector were purchased from Promega.
pSV- -gal-C vector is a 6.8-kb plasmid containing the lacZ
gene, transcription of which is driven by the SV40 promoter/enhancer.
pCAT-C vector is a 4.8-kb plasmid containing the CAT gene driven by the
SV40 promoter/enhancer. pCAT-E vector is a 4.6-kb plasmid containing
the SV40 enhancer, whereas pCAT-B vector is a 4.4-kb plasmid without
the enhancer sequences.
Cell Lines and Nuclear Extracts--
Mouse Hepa 1-6 cells
(American Type Culture Collection, Rockville, MD) were maintained in
DMEM containing 1.45 g of glucose/liter (Sigma), supplemented with
2 mM glutamine, 50 µg/ml gentamycin sulfate, and 10%
(v/v) heat-inactivated fetal calf serum (Life Technologies, Inc.). The
cultures were incubated at 6.6% CO2, 37 °C, in a
humidified atmosphere in 150-cm2 flasks. The cells were
grown to confluence in DMEM with 4.5 g/liter glucose.
Mouse S194 cells (American Type Culture Collection) were grown in DMEM
supplemented with 2 mM glutamine, 50 µg/ml gentamycin sulfate, and 10% (v/v) heat-inactivated horse serum (Life
Technologies, Inc.).
Nuclear extracts were prepared as described (31). All solutions
contained 0.05 mM dithiothreitol, and the protease
inhibitors aprotinin (1 µg/ml), leupeptin (1 µg/ml), and
phenylmethylsulfonyl fluoride (0.5 mM). Protein
concentrations were measured with the Bradford assay. Cell extracts
were frozen in 100-µl aliquots and stored at 70 °C.
Genomic Clones Containing Murine fVII Inserts--
pND95 is
a 16.0-kb HindIII-NotI fragment generated from
murine fVII genomic clone E.80.11C (16), which was reinserted in
the HindIII-NotI sites of pBSKII+ (Stratagene, La
Jolla, CA). This plasmid contains 7.0 kb of 5 -flanking sequences of
the murine fVII gene and proceeds downstream through exon 5 of this
gene.
pND73 is a 2.0-kb NotI-BamHI fragment of clone E.50.4A1 (16) subcloned in the
NotI-BamHI sites of pBSKII+. The DNA insert of
this plasmid contains 45 bp of the FIXII polylinker DNA, 1.1 kb of
the 5 -flanking region of the murine fVII gene, and 0.7 kb of the
coding region of the gene, terminating at a location between genomic
exons 1 and 2.
CAT Expression Plasmids--
A variety of plasmid inserts
containing 5 DNA sequences of the fVII gene were placed in the pCAT-E
and pCAT-B plasmids. Different standard strategies with pND95 and pND73
were used for these purposes, employing both convenient restriction
sites in the fVII 5 genomic region and restriction sites cloned into
the fVII 5 region, as well as PCR amplifications with appropriate
primers. These protocols generated plasmid inserts containing 7000 bp
(pCAT-7000), 1100 bp (pCAT-1100), 200 bp (pCAT-200), 140 bp (pCAT-140),
97 bp (PCAT-97), 85 bp (pCAT-85), 56 bp (pCAT-56), 37 bp (pCAT-37), 19 bp (pCAT-19), and 4 bp (pCAT-4) beginning at the 5 -end and terminating
at the ATG translation initiation codon. In addition, another plasmid, pCAT-900 , was generated that was derived from pCAT-1100, with a 200-bp
deletion at the 3 end of this segment. Nucleotide sequences were
obtained for the fVII DNA inserts of all of these constructs, except
for pCAT-7000.
Preparation of Cell Lysates for -Gal Assays--
Adherent
cells were washed three times with a solution of 0.05 M
sodium phosphate, 0.1 M NaCl, pH 7.5, and harvested by
incubating the cells for 5 min at room temperature with a buffer
containing 0.04 M Tris-HCl, 0.01 M EDTA, 1.5 M NaCl, pH 7.5. The cells were scraped from the bottom of
the Petri dish with tissue culture cell lifter (Fisher) and transferred
to a microcentrifuge tube. After centrifugation for 1.5 min (10,000 rpm
at 4 °C), the cells were resuspended in 0.25 mM
Tris-HCl, pH 7.7, and lysed by three cycles of liquid N2
freeze-thaw steps. The cell debris were pelleted at 4 °C for 2.5 min
at 10,000 rpm. One-third of the cell lysate was transferred to sterile
Eppendorf tubes and stored at 70 °C for -galactosidase enzyme
assays. The remaining cell lysate was heated at 60 °C for 10 min.
The denatured proteins were pelleted for 2.5 min at 10,000 rpm at
4 °C. The resulting supernatant was stored at 70 °C for CAT
assays.
Reporter Gene Assays--
-Gal assays using the substrate,
p-nitrophenyl- -D-galactopyranoside, were
performed with protein extracts of transfected hepatocytes to quantify
transfection efficiency.
Assays for CAT activity were conducted with approximately 50 µg of
cell extract protein in a 150-µl reaction mixture consisting of 35 µl of 1 M Tris-HCl, pH 7.7, 5 µl
[14C]chloramphenicol, 20 µl of acetyl-CoA (3.5 µg/µl), and an amount of water required to bring the reaction
mixture to 150 µl. These components were incubated at 37 °C for
4 h. The extent of acetylation of the substrate was analyzed on
thin layer chromatography plates (J.T. Baker) using a phosphorimager
screen (Eastman Kodak Co., Rochester, NY). Normalizations of the CAT
assays for transfection efficiencies were accomplished using the
cotransfected -gal activity.
Electrophoretic Mobility Shift Assays--
Oligonucleotides for
mobility shift assays were end-labeled with [ -32P]dATP
and [ -32P]dCTP (>3,000 Ci/mM; ICN, Costa
Mesa, CA), using the Klenow fragment of DNA polymerase (Promega). The
binding reactions were carried out in a total volume of 25 µl
containing 50,000 cpm of the labeled probe, 1 µg of poly (dI-dC)
(Pharmacia Biotech Inc.), 12 µg of nuclear extract, 1 mM
EDTA, 5 mM MgCl2, 10 µM
ZnCl2, 1 mM -mercaptoethanol, 4% (v/v)
glycerol, 100 mM KCl, in 10 mM Tris-HCl, pH
7.5. The reaction mixtures were incubated for 30 min at room
temperature and loaded onto a 6% polyacrylamide gel
(acrylamide:bisacrylamide ratio, 19:1, w/w) in running buffer (50 mM Tris-HCl, 0.38 M glycine, 2 mM
EDTA, pH 8.0). The samples were subjected to electrophoresis at 8 V/cm.
The resulting gels were dried and exposed to the x-ray film with an
intensifying screen overnight at 80 °C. In competition experiments, oligonucleotide competitors were added in the amounts indicated in the figure legends. Reactions containing recombinant C/EBP (30 µg/ml) or C/EBP (26 µg/ml) contained 2.0 µl of
the protein and 1.0 µl of normal rabbit serum/25 µl of binding
reaction. Reaction mixtures with Sp1 included 1.0 footprint unit (fpu)
of purified Sp1 (1 fpu is defined as the amount of Sp1 needed to give
full protection against DNase 1 digestion on the SV40 early promoter).
Sp1-containing mobility shift assays were performed on 6%
polyacrylamide gels in 0.5 × Tris borate/EDTA (44.5 mM Tris-HCl, pH 8.0, 44.5 mM boric acid, 1 mM EDTA). In supershift experiments, the antibodies were
added 15 min after the initiation of the 30-min incubation period of
the probe with the nuclear extract mixture.
The sequences of double-stranded oligonucleotides used in the assays
are as follows (the consensus sequences are indicated in bold
lettering, the lowercase letters represent overhangs, the mutant
sequences are indicated with an "m," and the mutated bases
are underlined): M7H4 ( 44 to 66, mouse fVII promoter): gatcACCCCTCTCCCCTCCCCCCTGA; mM7H4:
gatcACCTCTCTCTCCTCTCCTCTGA; HSp1 ( 83 to 108, human fVII promoter): GTGTCCTCCCCTCCCCCATCCCTCT; mHSp1: GTGTCCTCCCCTCCACCATCCCTCT; M7HNF4: ( 33 to 50,
mouse fVII promoter): tcgaGGAGGGCAAAGGTCAGGG; HNF4 consensus (32):
CTGGGCAAAGGTCATCTG; mHNF4 site:
CTGGATAAACGTCATCTG; M7C/H: ( 47 to
78, mouse fVII promoter): tcgaCCAGCTTTCTCCACCCCTCTCCCCTCCCCCCT;
M7mC/H: tcgaCCAGCACTATCCACCCCTCTCCCCTCCCCCCT;
Sp1 consensus, gatcGCTCGCCCCGCCCCGATCGAAT; H4TF1 consensus
(33): CCCGGTGGGGGAGGGGAA.
The wild-type and mutant Sp1 site oligonucleotides from the human fVII
promoter (17) were gifts from Dr. Eleanor Pollak (University of
Pennsylvania, Philadelphia, PA).
DNase I Footprint Analysis--
The DNase I footprint analysis
was carried essentially as described (34). A quantity of 20 pmol of
pCAT-200, containing 200 bp of the murine fVII promoter ( 200 bp to
1 bp), was linearized with either restriction endonucleases
HindIII or XbaI, end-labeled as described above
with [ -32P]dATP and [ -32P]dCTP
(>3,000 Ci/mmol; ICN), and digested with the second enzyme to release
the oligonucleotide insert. The 32P-labeled DNA was
fractionated electrophoretically on a 5% polyacrylamide gel in TBE
buffer (89 mM Tris-HCl, 89 mM boric acid, 2 mM EDTA, pH 8.0). The 32P-labeled DNA insert
was electroeluted from an excised gel slice, extracted with
phenol/CHCl3 (1:1, v/v) followed by
CHCl3/isoamyl alcohol (24:1, v/v), and precipitated by
addition of 1 ml of 100% ethanol. The pellet was washed with 1 ml of
80% ethanol, dried, and resuspended in 50 µl of a solution of 10 mM Tris-HCl, 1 mM EDTA, pH 8.0.
An amount of 20,000 cpm of probe was incubated for 15 min on ice with
50 µg of nuclear extract protein in 50 µl of a solution containing
50 mM KCl, 10% (v/v) glycerol, 1.0 mM
dithiothreitol, 2.5 mM MgCl2, 0.02% Nonidet
P-40 (Sigma), 2.0% polyvinyl alcohol, 1 µg of poly(dI-dC), in 10 mM sodium Hepes, pH 7.6. A volume of 50 µl of 5 mM CaCl2, 10 mM MgCl2
was included in the reaction mixture and incubated for 1 min at room
temperature. This was followed by the addition of 2 µl of a 0.016 mg/ml (or 0.0025 mg/ml for the control without nuclear extract) stock
solution of DNase I (Worthington). The mixture was incubated for 1 min
and followed by addition of 90 µl of DNase I stop buffer (1%, w/v,
sodium dodecyl sulfate, 0.2 M NaCl, 250 µg/ml glycogen,
20 mM EDTA, pH 8.0). The samples were then digested with 10 µl of 2.5 mg/ml proteinase K for 5 min at room temperature. The
solution was extracted with phenol/chloroform (1:1, v/v) and
precipitated by addition of 1 ml of 100% ethanol. The samples were the
resuspended in formamide loading buffer (80% formamide, 1 mM EDTA, 0.1% xylene cyanol, 0.1% bromphenol blue) at
1,500 cpm/µl, and a total of 5,000 cpm was loaded on a 6%
polyacrylamide sequencing gel. The corresponding murine fVII sequence
generated by the Maxam and Gilbert method (35) was placed in a lane
alongside the reactions.
Methylation Interference Assays--
Methylation interference
was conducted as described previously (34). A 30-bp fragment extending
from bp 45 to bp 66 of the mouse fVII promoter was subcloned into
the SmaI site of the pBSKII+ vector (Stratagene). The
resulting plasmid was linearized with either EcoRI or
BamHI. A quantity of 20 pmol of plasmid was end-labeled with
[ -32P]dATP and [ -32P]dCTP (>3,000
Ci/mmol), as described above. The labeled plasmid was then digested
with the second enzyme to release the oligonucleotide insert. Labeled
DNA was purified by polyacrylamide gel electrophoresis. An amount of
1 × 107 cpm of labeled probe was mixed with 0.5 µl
of DMS in 200 µl of DMS reaction buffer (50 mM sodium
cacodylate, 1 mM EDTA, pH 8.0) for 2.5 min at room
temperature. This was followed immediately by the addition of 40 µl
of DMS stop buffer (1.5 M NaOAc, 1 M -mercaptoethanol, pH 7.0), 1 µl of 10 mg/ml yeast tRNA solution, and 600 µl of 100% ethanol. This solution was mixed and placed for
10 min in a dry ice/ethanol bath and microcentrifuged for 15 min at
4 °C. The supernatant was discarded. This step was repeated three
times, and the final pellet obtained was dried and resuspended in a
buffer containing 10 mM Tris-HCl, 1 mM EDTA, pH
8.0, at 100,000 cpm/µl. Five standard gel shift reactions using
either Hepa 1-6 nuclear extract or purified Sp1 were conducted as
described above. Following electrophoresis, the gels were exposed to
film overnight at room temperature. Gel slices containing the bound and
free probe were removed. The probe was then electroeluted from the slices, extracted with phenol/CHCl3 (1:1, v/v), and
precipitated with 100% ethanol. The probe was then incubated with 1 M piperidine at 95 °C for 30 min, followed by three
rounds of lyophilization, and resuspended in formamide loading dye (see
previous section) at 1,500 cpm/µl. A total of 5,000 cpm was loaded
onto a 12% sequencing gel for electrophoretic analysis at 1500 V for
1.5 h. The gel was exposed to x-ray film overnight at 80 °C
with an intensifying screen.
Primers for LMPCR--
For footprinting the bottom
(non-coding) strand, the following primers were employed: 1, 5 -ATATGGACATCCATCGGTGG; 2, 5 -TGTTCACACCTCCGGTCTGA; 3, 5 -CGGTCTGAGCCCACATTGCC.
The primers used to footprint the top (coding) strand were: 4, 5 -TTCCTGTTGATGTCCCAGCT; 5, 5 -ACTCCGTGCACAGAGAAACC; 6, 5 -CCCTGGAGCTGGAGCAGAAA.
For the unidirectional linker mix, the following
oligonucleotides were used: 7, 5 -GCGGTGACCCGGGAGATCTGAATTC; 8, 5 -GAATTCAGATC.
Primers 3 and 6 were then end-labeled with polynucleotide kinase
(Amersham Life Science) in the following manner. A concentration of 20 pmol of primer was combined with 2 µl of 10 × kinase buffer, 120 µCi of [ -32P]ATP (ICN, Costa Mesa, CA; 4500 Ci/mmol), and water to a final volume of 20 µl. A 1:10 dilution of
polynucleotide kinase (30 units/ml) was prepared with kinase buffer,
and 1 µl of this solution was added to the reaction tube. The
reaction was incubated at 37 °C for 30 min, after which a second
1-µl aliquot of enzyme was added and incubation allowed to proceed
for another 30 min. Next, water was added to bring the total volume to
50 µl, followed by 50 µl of 5 M NH4OAc. The
reaction was then extracted with one volume of phenol-CHCl3
(1:1, v/v) followed by another extraction with an equal volume of
CHCl3-isoamyl alcohol (24:1, v/v), and then precipitated
twice with 100% ethanol. The pellet was washed in 80% ethanol, dried,
and resuspended in 20 µl of autoclaved distilled water. A total of 1 µl was removed and counted in a liquid scintillation counter.
In Vivo DNA Methylation--
Hepa 1-6 cells (5 × 107 cells) were centrifuged at 1500 rpm, resuspended in 2 ml of complete medium, and treated with 0.1% (v/v) DMS for 10 min at
room temperature. The reaction was quenched by 10-fold dilution with
cold PBS (0.137 M NaCl, 2.6 mM KCl, 10 mM Na2HPO4, 1.8 mM
KH2PO4, pH 7.4), and the cells pelleted by centrifugation at 1500 rpm for 10 min at 4 °C. The cell pellet was
washed two additional times with 20 ml of 1 × PBS and lysed overnight in 1.5 ml of harvest buffer containing 20 mM
Tris-HCl, 20 mM NaCl, 20 mM EDTA, 0.1% SDS,
and 300 µg/ml proteinase K, pH 8.0, at 37 °C. The methylated DNA
was diluted to 3 ml with a buffer containing 10 mM Tris, 1 mM EDTA, pH 8.0, and then extracted once with an equal
volume of phenol-CHCl3 (1:1, v/v) and once with one volume
of CHCl3-isoamyl alcohol (24:1, v/v). The DNA was
precipitated with 100% ethanol (2.5 volumes), and the precipitate then
washed with 80% ethanol, dried, and resuspended in 200 µl of 1 M piperidine. Cleavage was accomplished at 95 °C for 30 min, after which the sample was lyophilized, resuspended in 10 mM Tris, 1 mM EDTA, pH 8.0, and precipitated
with ethanol as above. The DNA was then resuspended in 500 µl of
water and lyophilized for three cycles. After lyophilization, the DNA
was resuspended in 200 µl of water and its concentration determined
by fluorimetry.
In Vitro Methylation of Genomic DNA--
Genomic DNA was
isolated from 2.5 × 107 cells by centrifugation at
1500 rpm for 10 min and washing the pellet twice with 10 ml of 1 × PBS. The resulting pellet was resuspended in 2 ml of harvest buffer
and incubated overnight at 37 °C. The sample was extracted with an
equal volume of phenol/CHCl3 (1:1, v/v), followed by 1 volume of CHCl3: isoamylalcohol (24:1, v/v), and
precipitated with 2.5 volumes of 100% ethanol. The resulting DNA was
methylated by treating 200 µg of genomic DNA with 5 µl of 20% DMS,
80% ethanol (v/v), followed by incubation at room temperature for
30 s. The methylation reaction was terminated by the addition of
50 µl of cold stop buffer (1.5 M NaOAc, 1.0 M
2-mercaptoethanol, 100 µg/ml yeast t-RNA) and 750 µl of 100%
ethanol. The DNA was pelleted, washed with 80% ethanol, dried, and
resuspended in 200 µl of 1.0 M piperidine. The cleavage
reaction and lyophilizations were as listed in the preceding
section.
LMPCR Protocol--
This procedure was conducted as described
(34), except that during exponential amplification, the time of
extensions were increased by increments of 3 s/cycle, and during primer
extension two to four cycles of PCR were completed, depending on the
extent of labeling of the primers.
Analytical Techniques--
Oligonucleotides were synthesized
using the phosphoramidite method on a Beckman Oligo 1000M DNA
synthesizer. DNA samples were sequenced by the dideoxy method (36)
using the Sequenase version 2.0 DNA sequencing kit (U. S. Biochemical
Corp.). For the larger pCAT constructs, nucleotide sequences were
determined using the Automated Laser Fluorescent (ALF) Express DNA
sequencer (Pharmacia) employing Cyp-5 -dATP labeling with two primers
constructed within the pCAT vector sequences flanking the inserts on
both sides. Electroelution of DNA samples was conducted in a
Electrophoretic Concentrator Series 1750-100 (ISCO, Inc., Lincoln,
NE), according to product protocols.
 |
RESULTS |
CAT expression plasmids containing as possible promoter elements a
variety of 5 sequences immediately upstream of the transcription initiation site of the murine fVII gene (16) were constructed, and
their comparative abilities to drive expression of the CAT gene were
assessed. The 5 -flanking constructs ranged in size from 7000 bp to 4 bp. Since fVII is present at a very low concentration in plasma, it is
not surprising that its gene possesses a weak promoter, and only low
expression levels of CAT were observed when the CAT gene was linked to
the fVII 5 regions using the pCAT-B vector. Thus, all of the
investigations reported herein were accomplished with the SV40 enhancer
element as part of the CAT constructs (CAT-E vector). CAT assays were
performed on each of the samples and the resulting thin layer
chromatography data quantitated by phosphorimaging. All CAT activities
of individual constructs were normalized for individual transfection
efficiencies by determination of -gal activities resulting from
cotransfection of the murine Hepa 1-6 cells with the lacZ
gene. Two separate expression experiments were performed on each
construct, with the variation not greater than 10%. The construct with
the highest expression, pCAT-97, was assigned a value of 100% (which
was 9-fold over promoterless pCAT-E), with all other values relative to
this construct. The final data are illustrated in Fig.
1 and show that a region 200 bp upstream
of the ATG site contains the minimal promoter for the fVII gene. In
confirmation of this point, removal of this 200-bp segment from the
1100-bp 5 -flanking region of the fVII DNA (providing pCAT-900 )
reduced the promoter activity to base-line levels. This 200-bp DNA
segment also contains the major transcription initiation site, which is
positioned 9 bp upstream of the initiator ATG codon (16).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Relative promoter activities of 5 -regions of
the murine fVII gene. CAT assay products were separated on thin
layer chromatography plates using the standard assay with the substrate [14C]chloramphenicol, and the radioactive contents of
each of the monoacetyl and diacetyl product bands were determined using
phosphorimaging. Corrections for transfection efficiencies in Hepa 1-6
cells of each of the plasmids were made by cotransfections with the
lacZ gene and subsequent determinations of the -gal
activity of cell lysates by spectrophotometric measurements of
-nitrophenolate release from the substrate
p-nitrophenyl- -D-galactopyranoside. Relative
promoter activities were calculated relative to the highest promoter
activity (100%) assigned to the plasmid, pCAT-97. The plasmids are
named for the length (in base pairs) of the fVII 5 -flanking DNA
insert, which begin at the ATG initiation codon. The exception is
pCAT-900 , which starts 200 bp ( 1100 bp to 201 bp) upstream of this
ATG locus.
|
|
Several of the high probability transcription factor binding sites that
reside within the 200-bp promoter region, as predicted by the
MatInspector data base search (37), are depicted in Fig. 2, along with the nucleotide sequence of
this segment of the fVII 5 -flanking DNA region. Notably, the area
beginning around bp 120 is particularly well endowed with consensus
sites for the liver-enriched transcription factors C/EBP and HNF4,
and the ubiquitous factors Sp1, H4TF1, and NF1.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
Putative transcription factor sites as
detected from a consensus binding site search of the 300 bp sequence
upstream of the ATG translation start site (§). The transcription
initiation site is also indicated (*). The MatInspector data base
search (37) was employed, and only the highest probability sites are indicated. Searches were conducted in both the forward or reverse directions. AP1, activator protein 1; EF1,
-crystallin enhancer-binding protein.
|
|
DNase I footprinting of the 200-bp proximal region of the promoter with
a mouse Hepa 1-6 liver cell nuclear extract showed a clear protection
of a DNA segment encompassing 80 to 28 bp (Fig.
3), suggesting that liver factors are
binding to this region of the fVII DNA. This footprint was observed on
both the sense and antisense strands (Fig. 3), thus confirming the
observation. This is the same region predicted from Fig. 2 to contain
an array of potential transcription factor binding sites.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 3.
DNase I footprinting analysis of the proximal
200 bp of the murine fVII promoter using Hepa 1-6 nuclear extract show
a large protected region at 28 bp to 76 bp of the coding strand and
32 bp to 80 bp of the non-coding strand. Lanes 1,
4, 5, and 8 are Maxam and Gilbert G/A
sequencing ladders of the murine fVII promoter coding and non-coding
strands. Lane 2, coding strand DNA digested with 5 ng of
DNase I in the absence of nuclear extracts. Lane 3, coding
strand DNA digested with 36 ng of DNase I in the presence of 50 µg of
Hepa 1-6 nuclear extract. Lane 6, non-coding strand DNA
digested with 5 ng of DNase I in the absence of nuclear extracts.
Lane 7, non-coding strand DNA digested with 36 ng of DNase I
in the presence of 50 µg of Hepa 1-6 nuclear extract. The nucleotide
sequences of the protected region including putative transcription
factor binding sites are shown below the gels.
|
|
A synthetic oligonucleotide (M7H4) corresponding to nucleotides 44 to
66 of the gene, which contains the potential H4TF1 site, has been
synthesized and labeled with 32P. A gel shift assay with
Hepa 1-6 cells (Fig. 4) demonstrated that this oligonucleotide binds to the cell extract (lane 2)
and is effectively competed by the same unlabeled oligonucleotide (lanes 3 and 4). However, a synthetic unlabeled
oligonucleotide (mM7H4) containing mutations in the H4TF1 consensus
region did not compete for this same interaction (lanes 5 and 6). The corresponding sequence of the human fVII
promoter (HSp1) also competed with labeled M7H4 for binding to the Hepa
1-6 nuclear extract (lanes 7 and 8), but a
synthetic oligonucleotide with a mutation in the G-rich area (mHSp1)
did not compete effectively with [32P]M7H4 (lanes
9 and 10). Similarly, a synthetic unlabeled
oligonucleotide containing the H4TF1 consensus sequence (33) was
competitive in this assay (lanes 11 and 12),
whereas a similar oligonucleotide containing the Sp1 consensus sequence
was not competitive (lanes 13 and 14). This
suggests that Sp1 is not a functional transcription factor in Hepa 1-6
cell extracts for regulation of the proximal murine fVII promoter
element.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 4.
Gel mobility shift assay confirms the binding
of H4TF1 or a highly related factor, but not Sp1, to the region 44 to
66 of the murine fVII promoter. A probe consisting of bp 44 to
66, a region protected in the DNase I footprint analysis (Fig. 2),
was tested for its ability to bind specifically to Hepa 1-6 nuclear
extract. Panel A, the sequences of oligonucleotides used for
competition are indicated. Regions very similar or identical to the
H4TF1 consensus, 5 -GGGGGAGGGG-3 , were aligned and are indicated by
the boxed region. Panel B, competition experiment using a labeled probe consisting of bp 44 to 66 and various unlabeled competitor oligonucleotides with Hepa 1-6 nuclear extract. Lane 1 contains probe with no nuclear extract, whereas
lane 2 contains probe with 12 µg of Hepa 1-6 nuclear
extract. A specific complex was formed, which is indicated by an
arrow and was only competed by unlabeled M7H4 (lanes
3 and 4), by bp 83 to 108 of the fVII promoter,
HSP1 (lanes 7 and 8), and the H4TF1 consensus oligonucleotide, H4TF1 (lanes 11 and 12). Mutant
probes of the respective mouse (mM7H4) and human
(mHSp1) sites showed no competition (lanes 5,
6, 9, and 10). In addition, a high
affinity Sp1 oligonucleotide (Sp1) probe was unable to
compete for this complex (lanes 13 and 14).
|
|
To strengthen the finding that H4TF1 binds to this region of the
promoter, and to differentiate between H4TF1 and Sp1 activities in Hepa
1-6 nuclear extract, the oligonucleotide containing the Sp1 consensus
sequence was radiolabeled with 32P and used in gel shifts
with Hepa 1-6 nuclear extract (Fig. 5). In competition experiments, the unlabeled probe effectively displaced the labeled oligonucleotide (lanes 3 and 4),
while the probe containing the H4TF1 consensus sequence did not
(lanes 5 and 7). The M7H4 oligonucleotide from
the mouse fVII promoter slightly displaced the labeled probe
(lanes 7 and 8), but the synthetic
oligonucleotide containing the sequence from 83 to 108 of the human
fVII promoter, which was proposed to contain the Sp1 transcription
factor site (17), did not compete at all (lanes 9 and 10). This
experiment, in combination with the results in Fig. 4, clearly showed a
distinction between Sp1 and H4TF1 activities in Hepa 1-6 nuclear
extract. The 44 to 66 bp region of the mouse promoter weakly
competed for the Sp1 complex, although not as efficiently as the Sp1
consensus oligonucleotide, suggesting that transcription factor Sp1 may have a weak affinity for this site on the murine fVII promoter.

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 5.
Gel shift assay using an Sp1 consensus
oligonucleotide reveals the formation of a specific Sp1 complex with
Hepa 1-6 nuclear extract (indicated by arrows). Lane
1 contains probe with no nuclear extract, and lane 2 contains the labeled Sp1 consensus oligonucleotide with 12 µg of Hepa
1-6 nuclear extract. This complex is competed by the addition of
excess unlabeled Sp1 consensus oligonucleotide (lanes 3 and
4), but not by the addition of a unlabeled H4TF1 consensus
oligonucleotide, H4TF1 (lanes 5 and 6). Neither
the addition of the unlabeled murine fVII H4TF1 site oligonucleotide,
M7H4 (lanes 7 and 8), nor the addition of the unlabeled human fVII SP1 site oligonucleotide, HSP1 (lanes 9 and 10), resulted in efficient competition of this complex.
The exact sequences of these oligonucleotides are provided in
panel A of Fig. 3.
|
|
To identify further which of the two factors, viz. Sp1 or
H4TF1, interacted with this region of the promoter of fVII, the 44 to
66 bp synthetic oligonucleotide (M7H4) of the murine fVII gene was
labeled and used in gel supershifts with human factor Sp1 and mouse
Hepa 1-6 nuclear extract (Fig. 6). The
presence of the anti-human Sp1 antibody (which cross-reacts with murine Sp1) does indeed supershift the M7H4-human Sp1 complex (lanes 1-4), but does not supershift the M7H4-Hepa 1-6 complex
(lanes 5-7). The data strengthen the claim that the complex
formed with mouse Hepa 1-6 nuclear extract and the murine fVII
proximal promoter element does not contain a contribution from Sp1.
However, it does appear that purified Sp1 can bind to this sequence.
One possible resolution of this apparent conflict is that H4TF1
possesses a higher affinity than Sp1 for the mouse-derived
oligonucleotide probe and is responsible for the observed shift when
using nuclear extract, whereas pure Sp1 is capable of interacting with
this site only in the absence of H4TF1.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 6.
Anti-Sp1 antibodies supershift the binding of
purified human Sp1 to bp 44 to 66 of the murine fVII promoter but
do not supershift the complex formed from Hepa 1-6 nuclear
extract. The murine fVII H4TF1 site (bp 44 to 66) was labeled
and used in an antibody supershift experiment with purified human Sp1
and Hepa 1-6 nuclear extract. Lane 1 contains probe with no
nuclear extract. Lane 2 contains probe and 1 fpu of purified
human Sp1. Lanes 3 and 4 contain probe and 1 fpu
of purified human Sp1 followed by the addition of 1 and 2 µl of
anti-Sp1-IgG, respectively. Lane 5 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lanes 6 and 7 contain probe with 12 µg of Hepa 1-6 nuclear extract followed by the
addition of 1 and 2 µl of anti-Sp1-IgG, respectively.
|
|
An extension of this experiment was performed to determine whether
differences existed between the guanosine contacts observed in the
M7H4-Hepa 1-6 nuclear extract complex and the M7H4-purified Sp1
complex. To address this question, methylation interference analysis
was performed. The gels of Fig. 7 clearly
indicate that the Hepa 1-6 nuclear extract (lanes 1-3) and
purified Sp1 (lanes 4-6) do not generate identical
methylation protection patterns. Although they are very similar, it is
seen from Fig. 7 that Sp1 does not protect the 5 -terminal guanosine
(lane 5), while the Hepa 1-6 nuclear extract does. As
expected, methylation interference was not observed in the coding
strand (data not shown). Overall, these data indicate that the
guanosine contacts supplied by H4TF1 in Hepa 1-6 nuclear extract with
M7H4, and those of purified Sp1 and M7H4, are very similar, but not
identical.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 7.
Identification of the contact sites for Hepa
1-6 nuclear extract and purified human Sp1 on the 44 to 66 region
of the murine fVII promoter by methylation interference
footprinting. The partially methylated, radiolabeled, murine fVII
H4TF1 site probe (bp 44 to 66) was incubated with Hepa 1-6 nuclear
extract (lanes 1-3) or purified human Sp1 (lanes
4-6). Free and bound probes were separated on a 6% nondenaturing
polyacrylamide gel, isolated, and cleaved with piperidine. Cleavage
products of both free (lanes 1, 3, 4,
and 6) and bound probe (lanes 2 and 5)
were analyzed on a 12% sequencing gel. The non-coding strand is
shown.
|
|
A putative HNF4 site is present in the mouse fVII proximal promoter in
the region of nucleotides 33 to 50 (Fig. 2). To examine whether
this factor actually interacted with this promoter element in nuclear
extracts, a 32P-labeled synthetic oligonucleotide (M7HNF4)
corresponding to residues 33 to 50 of the mfVII gene was prepared
and subjected to competition experiments with Hepa 1-6 nuclear
extract. The results are shown in Fig. 8.
Unlabeled M7HNF4 effectively competed for the observed complex
(lanes 2-4). Additionally, an oligonucleotide containing a
consensus HNF4 binding site (32) effectively competed with the
radiolabeled M7HNF4 for the complex, as observed in lanes 5 and 6. However, a synthetic mutant HNF4 consensus
oligonucleotide (mHNF4, Fig. 8) was not competitive for this binding.
These results suggest that a HNF4 transcription site is harbored in
residues 33 to 50 of the murine fVII gene. These results were
verified by the antibody supershift experiments illustrated in Fig.
9, using the same 32P-labeled
M7HNF4 probe and nuclear extract. Lanes 3 and 4 of Fig. 9 show that addition of HNF4 antibody resulted in a supershift of the complex of M7HNF4 with Hepa 1-6 extract. This confirms that
HNF4 binds to this region of the fVII gene.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 8.
Gel mobility shift assay confirms the binding
of HNF4 to the 33 to 50 bp region of the murine fVII promoter.
A probe consisting of bp 33 to 50 of the mouse fVII promoter,
containing a putative HNF4 site, was tested for its ability to bind
specifically to Hepa 1-6 nuclear extract. Lane 1 contains
probe with no protein. Lane 2 contains probe with 12 µg of
Hepa 1-6 nuclear extract. A specific complex is formed (indicated by
the arrow), which is competed by the addition of unlabeled
self, M7HNF4 (lanes 3 and 4), and by the addition
of a unlabeled HNF4 consensus oligonucleotide probe, HNF4 (lanes
5 and 6). The complex is not competed, however, by the
addition of an unlabeled mutant HNF4 consensus probe, mHNF4 (lanes 7 and 8). The sequences of the probes used
in the competition experiments are shown above.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 9.
Anti-HNF4 antibodies supershift the binding
of Hepa 1-6 nuclear extract to the 33 to 50 bp region of the
murine fVII promoter. The murine fVII HNF4 site (bp, 33 to 50)
was labeled and used in an antibody supershift experiment with Hepa
1-6 nuclear extract. Lane 1 contains probe without nuclear
extract. Lane 2 contains probe with 12 µg of Hepa 1-6
nuclear extract. Lanes 3 and 4 contain probe with
12 µg of Hepa 1-6 nuclear extract and 1 and 2 µl of rabbit
anti-HNF4 polyclonal serum, respectively. The supershift is indicated
by an arrow.
|
|
Although a highly probable C/EBP transcription site was identified
by the consensus search at residues 47 to 78 of the mouse fVII gene
(Fig. 2), the use of a 32P-labeled synthetic
oligonucleotide (M7C/H) containing this region of the murine fVII
promoter as a probe in gel shifts with nuclear extract did not reveal a
specific complex (data not shown). However, the data of Fig.
10 show that when the Hepa 1-6 nuclear
extract is supplemented with Escherichia coli-expressed
recombinant C/EBP , an additional complex was formed with M7C/H
(lane 4). On the other hand, addition of bacterially
expressed recombinant C/EBP did not result in a complex with M7C/H.
When a probe (M7mC/H) is used in which the C/EBP site has been
mutated, no new complex is observed upon addition of recombinant
C/EBP (lane 8). That the complex observed in the presence of
C/EBP represents specific binding of this protein factor is
confirmed from the antibody supershift data of Fig.
11. Here, the entire complex formed
(lane 3) after addition of nuclear extract, C/EBP , and
radiolabeled M7C/H, is supershifted by the addition of C/EBP
antibody (lane 4), whereas that is not the case when a
control antibody is added (lane 5). These experiments show
that C/EBP can form a complex with the murine fVII promoter in a
sequence-specific manner. The observation that a specific C/EBP
complex was not observed when using Hepa 1-6 extract alone may be the
result of the fact that C/EBP is present at low concentrations in
mature liver cells. Thus, its concentration in Hepa 1-6 nuclear
extracts may be too low for such a complex to be observed. Such a
precedent with this transcription factor has been established (32).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 10.
Gel mobility shift assay confirms the
binding of C/EBP to the 47 to 78 bp region of the murine fVII
promoter. A probe consisting of bp 47 to 78 of the murine fVII
promoter, and containing a putative C/EBP site, was tested for its
ability to bind specifically to Hepa 1-6 nuclear extract alone or Hepa 1-6 nuclear extract plus 100 ng of recombinant C/EBP or C/EBP . Lane 1 contains probe without protein. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear extract. Lane
3 contains probe with 12 µg of Hepa 1-6 nuclear extract, plus
100 ng of recombinant C/EBP . Lane 4 contains probe with
12 µg of Hepa 1-6 nuclear extract, plus 100 ng of recombinant
C/EBP . The C/EBP -DNA complex is indicated by an arrow.
Lanes 5-8 are identical to lanes 1-4 but
contain a probe consisting of bp 47 to 78 of the murine fVII
promoter with a mutant C/EBP site. The sequences of the
oligonucleotide probes used are shown above the gels.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 11.
Anti-C/EBP antibodies supershift the
binding of recombinant C/EBP to bp 47 to 78 of the murine fVII
promoter. A probe consisting or bp 47 to 78 of the murine fVII
promoter and containing a putative C/EBP site was labeled and used
in an antibody supershift experiment with Hepa 1-6 nuclear extract and
recombinant C/EBP . Lane 1 contains probe without protein. Lane 2 contains probe with 12 µg of Hepa 1-6 nuclear
extract. Lane 3 contains probe with 12 µg of Hepa 1-6
nuclear extract plus 100 ng of recombinant C/EBP . Lane 4 is identical to lane 3, except that 2 µl of anti C/EBP
polyclonal antibody was added to the binding reaction. Lane
5 is identical to lane 3, except that 2 µl of anti
NF- B polyclonal antibody was added to the binding reaction. The
C/EBP -DNA complex and supershift are indicated by
arrows.
|
|
The importance of these transcription factors in the in vivo
regulation of the fVII gene was assessed by in vivo DMS
methylation and analysis of the resulting genomic footprints by LMPCR.
Autoradiograms of these experiments are provided in Fig.
12 and show protection of several G
residues in each of the sites assigned by the above in vitro
data to C/EBP , H4TF1/Sp1, and HNF4. In addition, clear footprints
have been found upstream of the C/EBP site. These protected G
residues, at sequence locations 89, 90, 108, and 109, are
contained within two DNA segments (residues 81 to 98 and 106 to
121) predicted in Fig. 2 to be capable of binding to NF1. These
latter two regions were not revealed in the in vitro footprint of Fig. 3. Additionally, in vitro gel shift
experiments with synthetic oligonucleotides encompassing this region of
the gene, as well as with NF1 consensus oligonucleotides, did not confirm the presence of NF1 sites. These negative results may be due to
the experimental conditions chosen for the in vitro binding
assays, or NF1 binding to the murine fVII promoter may require that
other regions of the gene are brought into proximity through folding.
In similar experiments with the top strand of DNA, no footprints were
observed.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 12.
In vivo methylation pattern of the
lower strand DNA using primers 1, 2, and 3, located 5 of the
transcription factor binding sites. Along side each symbol or
marker denoting protection is the corresponding nucleotide number of
the G residue on the promoter sequence. Control DNA was derived from a
murine B lymphocyte cell line (S194), which is identical in sequence to
the HEP 1-6 cells in the areas studied. The location of each
transcription factor binding site is denoted by solid bars,
and the identity of each is listed.
|
|
 |
DISCUSSION |
Coagulation fVII is a member of a closely related group of
proteins, which also include fIX, fX, and PC and which share
considerable homology in their domain organizations. These proteins
play different roles in blood coagulation and anticoagulation,
suggesting that only minor overall evolutionary changes have occurred
in diversifying their functions. The correspondence of the domain
structures of the proteins and the exon placements within the genes
demonstrate that evolution of this family of proteins probably occurred
by exon shuffling among their genes, perhaps facilitated by intronic recombination mechanisms (38). Other proteins that contain some of
these domains, such as those containing kringle and epidermal growth
factor modules, may also have evolved, at least in part, in this
manner.
It is relevant to determine whether expression of genes of these
related proteins is regulated by similar factors, and whether tissue-specific factors are obvious regulatory elements. In this regard, fVII is an excellent paradigm for such an investigation because, unlike fX (39) and PC (40), and similar to fIX (41), fVII
biosynthesis is much more highly confined to the liver. In addition,
steady state mRNA levels of fVII appear to correlate well with the
plasma concentration of this protein (17). The recent characterization
of mice containing a targeted deletion of the fVII gene (30) provides
further impetus for an understanding of the transcription factors that
regulate fVII gene transcription in order that the full applicability
of this murine system to that of humans can be more completely
assessed. This investigation has been accomplished, and the totality of
in vitro and in vivo data present in this
manuscript show that H4TF1, HNF4, and C/EBP potentially function as
transcriptional regulators of the murine fVII gene. There also exists a
strong possibility that two additional NF1 sites are present in the
5 -flanking DNA region. All of these factor binding sites exist within
130 bp upstream of the transcription initiation site, thus showing that
defined regulatory elements for expression of murine fVII are present
in a relatively small region of the 5 -flank of this gene.
H4TF1 was first identified as a factor that binds the human histone H4
promoter (33). It was later partially purified and shown to be distinct
from Sp1 (42), although its recognition sequence, 5 -GGGGGAGGGG, is
very similar to that of Sp1, 5 -GGGGCGGGG. H4TF1 has been implicated as
an important regulatory element in the promoters of human eosinophil
peroxidase (43), and human pyruvate dehydrogenase- (44). In
addition, a non-Sp1 factor that recognizes the sequence 5 -GGGGGAGGGG
has been described as regulating the human -enolase gene (ENO-3)
(45) and the immunoglobulin heavy chain enhancer, 3 - E(hsl,2) (46).
A G-rich factor binding element, 5 GGGGGAGGGG, was identified in the
human fVII promoter, which matches the consensus sequences for both H4TF1 and Sp1 (17). Gel shift analysis revealed two closely spaced
complexes (A and B), both shown to be specific. The slower moving
complex A was shown to contain Sp1, while complex B did not contain
this factor. A single point mutation completely abolished the formation
of both complexes. It was concluded that the loss of both complexes on
a gel shift assay with the mutation of a single nucleotide was
consistent with the existence of overlapping binding sites for Sp1 and
another nuclear protein. A separate study identified the same G-rich
sequence as being important in transcription factor binding to human
fVII (47). This latter group found that when a Sp1 sequence from the
human metallothionein IIA gene (MIIA probe) was labeled, unlabeled MIIA
probe efficiently competed for the complex formed, but the fVII
oligonucleotide probe of the putative Sp1 site did not. This is
difficult to reconcile if this site is in fact a Sp1 binding locus, but
not if it is a H4TF1 site. Our results clearly show the existence of a
specific complex on gel shifts, the formation of which is inhibited by a H4TF1 consensus oligonucleotide, but not by one containing the Sp1
consensus sequence (Fig. 4). We also show that a monoclonal antibody to
Sp1 did not react with this complex formed from Hepa 1-6 cell nuclear
extract. This antibody, does, however, completely supershift
recombinant human Sp1 bound to the fVII G-rich element (Fig. 6). Thus,
while recombinant human Sp1 can bind to this sequence in the absence of
Hepa 1-6 nuclear extract, it appears that H4TF1 in Hepa 1-6 nuclear
extract has a much higher affinity for the G-rich element in the murine
fVII promoter, thereby effectively precluding Sp1 binding. It was
possible to effectively distinguish between the binding activities of
Sp1 and H4TF1 in nuclear extract by using a labeled Sp1 consensus
oligonucleotide in gel shifts. In this case, unlabeled Sp1
oligonucleotide was able to compete for the complex, whereas the H4TF1
consensus oligonucleotide did not. In addition, the mouse fVII G-rich
element competed very poorly, and the human G-rich element did not
compete at all in this set of experiments. Methylation interference
assays (Fig. 7), using Hepa 1-6 extract and recombinant human Sp1,
showed that although both H4TF1 in Hepa 1-6 nuclear extract and
recombinant Sp1 recognize overlapping regions of the fVII promoter,
these binding sites are not identical. Taken together, these data
strongly implicate the binding of H4TF1, and not Sp1, to this sequence in nuclear extracts.
HNF4 is a novel member of the steroid hormone receptor superfamily and
is expressed in liver, kidney, and intestine (32, 48). It has been
described as a factor crucial for the liver-selective transcription of
genes encoding ornithine transcarbamylase (49), transthyretin (50), and
apolipoprotein CIII (51). This transcription factor binds to the
promoter region of the human fX gene and has been shown to be required
for its expression (52). Disruption of a binding site for HNF4 in the
human fIX promoter results in one of the hemophilia B-Leiden variants
(53). HNF4 also functionally binds to a similar region of the promoter
of human fVII (17, 47). We have clearly identified a HNF4 site within
nucleotides 33 to 50 of the murine fVII promoter through gel
mobility shift assays (Fig. 8) and antibody supershift assays (Fig. 9).
The importance of this site resides in the liver-specific expression of
this gene and shows that the necessary machinery for this critical property of the gene is indeed present.
C/EBP is a liver-enriched member of the basic domain-leucine zipper
protein family (54). The originally identified member of this family,
which is also liver-enriched, is C/EBP (55). Other designations for
C/EBP are NF-IL6 (56), LAP (57), IL-6DBP (58), AGP/EBP (59), and
CRP2 (60). Regulation of the expression of this transcription factor is
involved in the expression of several liver-specific genes since
C/EBP is not highly expressed in adult hepatocytes but is expressed
in the hepatoma cell lines, HepG2 and Hepa3B (61). In adult
hepatocytes, however, it is strongly induced after lipopolysaccharide,
IL-1, or IL-6 stimulation, suggesting that it may be involved in acute
phase gene induction (56, 59, 62). In confirmation of this, C/EBP
has been shown to bind to promoters of certain human acute phase
responsive proteins, such as albumin (61), 1-antitrypsin
(50), 1-acid glycoprotein (63), C-reactive protein (62),
haptoglobin (62), and hemopexin (64). Additionally, a switch from
C/EBP to C/EBP as a transcriptional regulatory element
accompanies the acute phase induction of 1-acid glycoprotein (50). The induction of C/EBP could also explain the
higher concentration of this factor in HepG2 and Hepa3B cells, as a
response to the transformation events required to establish these cell
lines. We have assigned a C/EBP site within the 47 to 78 region of
the gene of the murine fVII promoter by gel shift (Fig. 10) and
antibody supershift (Fig. 11) assays. In addition, we have shown that
recombinant C/EBP , but not recombinant C/EBP , binds to this site
(Fig. 10). A specific C/EBP complex with nuclear extract from the
murine hepatoma cell line Hepa 1-6 was not observed, but unlike HepG2
and Hepa3B, Hepa 1-6 may more accurately reflect the physiological
expression pattern of C/EBP in that little or no C/EBP is present
in adult liver cells prior to induction with lipopolysaccharide or
cytokines. The fact that C/EBP binds the murine fVII promoter raises
the possibility that murine fVII may be an inducible protein (65, 66),
and responsive to the state of differentiation of cells and to hormones
(54).
In addition to these sites, which have been confirmed through in
vitro experiments, in vivo DMS footprint analyses (Fig.
12) showed protection of G residues involved in each of the C/EBP , H4TF1, and HNF4 binding sites (Fig. 2). In addition, four other G
residues upstream of the C/EBP site were protected from methylation, two each of which are contained in separate regions of the promoter. These two 5 regions include TGG sequences, which are located near the
protected G residues. These TGG sequences have been found to be
important in recognition of the NF1 family of transcription factors
(67).
Finally, an illustration of the transcription factors that have been
identified to be potentially functional in liver as regulators of
transcription of the genes of this gene family, including fVII, fIX,
fX, and PC, is provided in Fig. 13.
These sites have all been identified through in vitro
studies. The only exception to this is the murine fVII gene in the
current investigation, wherein in vivo experiments (Fig. 12)
confirm the sites identified in vitro and locate additional
factor sites. There are many similarities in the genes in the
regulatory elements in this general location, which are within ±200 bp
of their major transcription start sites. Specifically, a HNF4 binding
site is found within 60 bp of the major transcription initiation site
in all of the genes, except that of human PC. However, in this case,
both HNF1 and HNF3 sites are present in this region. Thus, there is an
obvious basis for liver-enriched transcription of these genes.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 13.
Comparison of the known transcription factor
binding sites within the genes of vitamin K-dependent
coagulation factors related to fVII. Only those sites present
within approximately 200 bp upstream and 70 bp downstream of the major
transcription initiation site are shown. Since the human fX gene does
not have a defined major transcription start site, but multiple
initiation sites, the numbering in this case was from the translation
start site. The lengths of the ovals represent the
nucleotides involved in binding of that particular factor.
DBP, D-site-binding protein; NF1L, nuclear factor
1-liver specific; NFY, nuclear factor Y; Sp1,
stimulating protein 1. The unfilled ovals represent factors that bind to the indicated regions of the genes that have not been
identified. The following sources were used to prepare this illustration; human fVII (17, 47, 73), murine fVII (this study); human
fIX (74-76), human fX (52) (77, 78), and human PC (79).
|
|
Only two of the genes possess C/EBP binding sites, viz.
mouse fVII (C/EBP ) and human fIX (C/EBP ). The importance of this transcription factor in liver expression of genes is underpinned by the
finding that disruption of its binding site in the fIX gene results in
a hemophilia B-Leiden variant (68). Additionally, because of the
existence of the C/EBP transcription factor binding site in the
murine fVII gene, it is possible that fVII is an acute phase protein in
the mouse. The proximal promoter region of human fVII does not interact
with this transcription factor, perhaps indicative of a species
difference in the acute phase response of fVII.
A site for the ubiquitous H4TF1 transcription factor overlaps with that
of a Sp1 site in the murine fVII gene. A Sp1 site is present in a
similar location in the human fVII and human fX genes, with another
further downstream in the human PC gene. It is possible that this
overlapping H4TF1 site is present in the Sp1 location in these other
genes, especially that of human fVII, since the properties described in
the relevant papers for the Sp1 site would be consistent with
additional binding of H4TF1, or with H4TF1 as a replacement for Sp1.
Additionally, the oligonucleotide corresponding to this region of the
human fVII gene did not appear to react with purified Sp1 protein (Fig.
5).
Of the fVII-related genes discussed in this report, only human fIX, and
possibly murine fVII, possess NF1 binding sites, and these exist in
similar locations in the promoter element. This additional
transcription factor binding site(s) in these genes may partly explain
their strong liver expression capabilities, especially since at least
one member of this family of proteins, murine NF1-B3 (identical to the
rat and chicken isoforms, NF1-L and cNF1-A1.1, respectively), is a
liver-enriched transcription factor. Also, it is known that NF1
cooperates with other liver factors, such as HNF1, HNF3, and HNF4, to
enhance target gene transcription (69-71), or transcription of genes
for other regulatory factors, such as C/EBP (72). Thus, NF1 may play
these types of direct or indirect roles in human fIX and mouse fVII
expression.
In summary, we have shown that HNF4, C/EBP , H4TF1, and possibly NF1
binding sites exist within the minimal promoter region of the murine
fVII gene, as defined in mouse Hepa 1-6 liver cells. It is likely that
other positive and negative regulatory factors that bind further
upstream or downstream of the region investigated also influence
transcription of this gene. However, those factors that have been
identified herein are capable of eliciting the known expression pattern
of the gene, and further suggest directions for investigation of other
regulatory properties of fVII gene expression.
 |
ACKNOWLEDGEMENT |
We thank Dr. Esohe Idusogie for provision of
the 7.0-kb 5 -flanking sequence of the murine fVII gene.
 |
FOOTNOTES |
*
This work was supported by Grant HL-19982 from the National
Institutes of Health, by a Kleiderer-Pezold Family endowed
professorship (to F. J. C.), and by a grant from the American
Heart Association, Indiana Affiliate (to E. D. R.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 219-631-6456;
Fax: 219-631-8149; E-mail: castellino.1{at}nd.edu.
1
The abbreviations used are: fVII, fIX, and fX,
coagulation factors VII, IX, and X, respectively; fVIIa, fIXa, and fXa,
activated coagulation factors VII, IX, and X, respectively; PC,
anticoagulant protein C; TF, tissue factor; Gla, -carboxyglutamic
acid; C/EBP , CCAAT/enhancer-binding protein- ; C/EBP ,
CCAAT/enhancer-binding protein- ; HNF1/2/3/4, hepatocyte nuclear
factors 1/2/3/4, respectively; H4TF1, histone H4 gene transcription
factor-1; NF1, nuclear factor 1; Sp1, stimulating protein 1; CAT,
chloramphenicol acetyltransferase; DMS, dimethyl sulfate; -gal,
-galactosidase; DMEM, Dulbecco's modified Eagle's medium; PCR,
polymerase chain reaction; LMPCR, ligand-mediated polymerase chain
reaction; fpu, footprint unit(s); bp, base pair(s); kb, kilobase(s);
PBS, phosphate-buffered saline; IL, interleukin.
 |
REFERENCES |
-
Komiyama, Y.,
Pedersen, A. H.,
and Kisiel, W.
(1990)
Biochemistry
29,
9418-9425[CrossRef][Medline]
[Order article via Infotrieve]
-
Bom, V. J. J.,
van Hinsberg, V. W. M.,
Reinalda-Poot, H. H.,
Mohanlal, R. W.,
Bertina, R. M.
(1991)
Thromb. Haemostasis
66,
283-291[Medline]
[Order article via Infotrieve]
-
Broze, G. J. J.,
and Miletich, J. P.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
1886-1890[Abstract/Free Full Text]
-
Radcliffe, R.,
and Nemerson, Y.
(1975)
J. Biol. Chem.
250,
388-395[Abstract/Free Full Text]
-
Nakagaki, T.,
Foster, D. C.,
Berkner, K. L.,
Kisiel, W.
(1991)
Biochemistry
30,
10819-10824[CrossRef][Medline]
[Order article via Infotrieve]
-
Kazama, Y.,
Hamamoto, T.,
Foster, D. C.,
Kisiel, W.
(1995)
J. Biol. Chem.
270,
66-72[Abstract/Free Full Text]
-
O'Hara, P. J.,
Grant, F. J.,
Haldeman, B. A.,
Gray, C. L.,
Insley, M. Y.,
Hagen, F. S.,
Murray, M. J.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5158-5162[Abstract/Free Full Text]
-
Yoshitake, S.,
Schach, B. G.,
Foster, D. C.,
Davie, E. W.,
Kurachi, K.
(1985)
Biochemistry
24,
3736-3750[CrossRef][Medline]
[Order article via Infotrieve]
-
Leytus, S. P.,
Foster, D. C.,
Kurachi, K.,
and Davie, E. W.
(1986)
Biochemistry
25,
5098-5102[CrossRef][Medline]
[Order article via Infotrieve]
-
Foster, D. C.,
Yoshitake, S.,
and Davie, E. W.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
4673-4677[Abstract/Free Full Text]
-
Toomey, J. R.,
Smith, K. J.,
and Stafford, D. W.
(1991)
J. Biol. Chem.
266,
19198-19202[Abstract/Free Full Text]
-
Ruf, W.,
Kalnik, M. W.,
Lund-Hansen, T.,
and Edgington, T. S.
(1991)
J. Biol. Chem.
266,
15719-15725[Abstract/Free Full Text]
-
Matsushita, T.,
Kojima, T.,
Emi, N.,
Takahashi, I.,
and Saito, H.
(1994)
J. Biol. Chem.
269,
7355-7363[Abstract/Free Full Text]
-
Banner, D. W.,
D'Arcy, A.,
Chene, C.,
Winkler, F. K.,
Guha, A.,
Konigsberg, W. H.,
Nemerson, Y.,
Kirchofer, D.
(1996)
Nature
380,
41-46[CrossRef][Medline]
[Order article via Infotrieve]
-
Bhardwaj, D.,
Iino, M.,
Kontoyianni, M.,
Smith, K. J.,
Foster, D. C.,
Kisiel, W.
(1996)
J. Biol. Chem.
271,
30685-30691[Abstract/Free Full Text]
-
Idusogie, E.,
Rosen, E. D.,
Carmeliet, P.,
Collen, D.,
and Castellino, F. J.
(1996)
Thromb. Haemostasis
76,
957-964[Medline]
[Order article via Infotrieve]
-
Pollak, E. S.,
Hung, H.-L.,
Godin, W.,
Overton, G. C.,
High, K. A.
(1996)
J. Biol. Chem.
271,
1738-1747[Abstract/Free Full Text]
-
Zimmermann, R.,
Ehlers, G.,
Ehlers, W.,
von Voss, H.,
Gobel, U.,
Wahn, U.
(1979)
Blut
38,
119-125[CrossRef][Medline]
[Order article via Infotrieve]
-
Mariani, G.,
and Mazzucconi, M. G.
(1983)
Haemostasis
13,
169-177[Medline]
[Order article via Infotrieve]
-
Chaing, S.,
Clarke, B.,
Sridhara, S.,
Chu, K.,
Friedman, P.,
VanDusen, W.,
Roberts, H. R.,
Blajchman, M.,
Monroe, D. M.,
High, K. A.
(1994)
Blood
83,
3524-3535[Abstract/Free Full Text]
-
Escoffre, M.,
Zini, J. M.,
Schliamser, L.,
Mazoyer, E.,
Soria, C.,
Tobelem, G.,
and Dupuy, E.
(1995)
Br. J. Haematol.
91,
739-741[Medline]
[Order article via Infotrieve]
-
Arbini, A. A.,
Pollak, E. S.,
Bayleran, J. K.,
High, K. A.,
Bauer, K. A.
(1997)
Blood
89,
176-182[Abstract/Free Full Text]
-
Kazama, Y.,
Foster, D. C.,
and Kisiel, W.
(1992)
Blood Coag. Fibrinol.
3,
697-702[Medline]
[Order article via Infotrieve]
-
Bernardi, F.,
Castaman, G.,
Redaelli, R.,
Pinotti, M.,
Lunghi, B.,
Rodeghiero, F.,
and Marchetti, G.
(1994)
Hum. Mol. Genet.
3,
1175-1177[Free Full Text]
-
Bernardi, F.,
Castaman, G.,
Pinotti, M.,
Ferraresi, P.,
Di Iasio, M. G.,
Lunghi, B.,
Rodeghiero, F.,
Marchetti, G.
(1996)
Hum. Mutat.
8,
108-115[CrossRef][Medline]
[Order article via Infotrieve]
-
Lane, A.,
Cruickshank, J. K.,
Mitchell, J.,
Henderson, A.,
Humphries, S.,
and Green, F.
(1992)
Atherosclerosis
94,
43-50[CrossRef][Medline]
[Order article via Infotrieve]
-
Meade, T. W.,
Mellows, S.,
Brozovic, M.,
Miller, G. J.,
Chakrabarti, R. R.,
North, W. R. S.,
Haines, A. P.,
Stirling, Y.,
Imeson, J. D.,
Thompson, S. G.
(1986)
Lancet
2,
533-537[Medline]
[Order article via Infotrieve]
-
Heinrich, J.,
Balleisen, L.,
Schulte, H.,
Assmann, G.,
and Vandeloo, J.
(1994)
Arterioscler. Thromb.
14,
54-59[Abstract/Free Full Text]
-
Junker, R.,
Heinrich, J.,
Shulte, H.,
van de Loo, J.,
Assmann, G.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
1539-1544[Abstract/Free Full Text]
-
Rosen, E.,
Chan, J. C. Y.,
Idusogie, E.,
Clotman, F.,
Vlasuk, G.,
Luther, T.,
Jalbert, J.,
Albrecht, S.,
Zhong, L.,
Lissens, A.,
Schoojans, L.,
Moons, L.,
Collen, D.,
Castellino, F. J.,
Carmeliet, P.
(1997)
Nature
390,
290-293[CrossRef][Medline]
[Order article via Infotrieve]
-
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489[Abstract/Free Full Text]
-
Sladek, F. M.,
Zhong, W. M.,
Lai, E.,
and Darnell, J. E., Jr.
(1990)
Genes Dev.
4,
2353-2365[Abstract/Free Full Text]
-
Dailey, L.,
Hanly, S. M.,
Roeder, R. G.,
Heintz, N.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
7241-7245[Abstract/Free Full Text]
-
Galas, D. J.,
and Schmitz, A.
(1978)
Nucleic Acids Res.
5,
3157-3170[Abstract/Free Full Text]
-
Maxam, A. M.,
and Gilbert, W.
(1980)
Methods Enzymol.
65,
499-560[Medline]
[Order article via Infotrieve]
-
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
-
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884[Abstract/Free Full Text]
-
Patthy, L.
(1996)
Matrix Biol.
15,
301-310[CrossRef][Medline]
[Order article via Infotrieve]
-
Hung, H.-L.,
and High, K. A.
(1996)
J. Biol. Chem.
271,
2323-2331[Abstract/Free Full Text]
-
Tanabe, S.,
Sugo, T.,
and Matsuda, M.
(1991)
J. Biochem. (Tokyo)
109,
924-928[Abstract/Free Full Text]
-
Salier, J.-P.,
Hirosawa, S.,
and Kurachi, K.
(1990)
J. Biol. Chem.
265,
7062-7068[Abstract/Free Full Text]
-
Dailey, L.,
Roberts, S. B.,
and Heintz, N.
(1988)
Genes Dev.
2,
1700-1712[Abstract/Free Full Text]
-
Yamaguchi, Y.,
Zhang, D. E.,
Sun, Z.,
Albee, E. A.,
Nagata, S.,
Tenen, D. G.,
Ackerman, S. J.
(1994)
J. Biol. Chem.
269,
19410-19419[Abstract/Free Full Text]
-
Madhusudhan, K. T.,
Naik, S. S.,
and Patel, M. S.
(1995)
Biochemistry
34,
1288-1294[CrossRef][Medline]
[Order article via Infotrieve]
-
Feo, S.,
Antona, V.,
Barbieri, G.,
Passantino, R.,
Cali, L.,
and Giallongo, A.
(1995)
Mol. Cell. Biol.
15,
5991-6002[Abstract]
-
Singh, M.,
and Birshtein, B. K.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
4392-4397[Abstract/Free Full Text]
-
Greenberg, D.,
Miao, C. H.,
Ho, W. T.,
Chung, D. W.,
Davie, E. W.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
12347-12351[Abstract/Free Full Text]
-
Zhong, W.,
Mirkovitch, J.,
and Darnell, J. E., Jr.
(1994)
Mol. Cell. Biol.
14,
7276-7284[Abstract/Free Full Text]
-
Nishiyori, A.,
Tashiro, H.,
Kimura, A.,
Akagi, K.,
Yamamura, K.,
Mori, M.,
and Takiguchi, M.
(1994)
J. Biol. Chem.
269,
1323-1331[Abstract/Free Full Text]
-
Costa, R. H.,
Grayson, D. R.,
Xanthopoulos, K. G.,
Darnell, J. E. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
3840-3844[Abstract/Free Full Text]
-
Mietus-Snyder, M.,
Sladek, F. M.,
Ginsburg, G. S.,
Kuo, C. F.,
Ladias, J. A.,
Darnell, J. E. J.,
Karathanasis, S. K.
(1992)
Mol. Cell. Biol.
12,
1708-1718[Abstract/Free Full Text]
-
Miao, C. H.,
Leytus, S. P.,
Chung, D. W.,
Davie, E. W.
(1992)
J. Biol. Chem.
267,
7395-7401[Abstract/Free Full Text]
-
Reijnen, M. J.,
Sladek, F. M.,
Bertina, R. M.,
Reitsma, P. H.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6300-6303[Abstract/Free Full Text]
-
Cao, Z.,
Umek, R. M.,
and McKnight, S. L.
(1991)
Genes Dev.
5,
1538-1552[Abstract/Free Full Text]
-
Landschulz, W. H.,
Johnson, P. F.,
Adashi, E. Y.,
Graves, B. J.,
McKnight, S. L.
(1988)
Genes Dev.
2,
786-800[Abstract/Free Full Text]
-
Akira, S.,
Isshiki, H.,
Sugita, T.,
Tanabe, O.,
Kinoshita, S.,
Nishio, Y.,
Nakajima, T.,
Hirano, T.,
and Kishimoto, T.
(1990)
EMBO J.
9,
1897-1906[Medline]
[Order article via Infotrieve]
-
Descombes, P.,
Chojkier, M.,
Lichtsteiner, S.,
Falvey, E.,
and Schibler, U.
(1990)
Genes Dev.
4,
1541-1551[Abstract/Free Full Text]
-
Poli, V.,
Mancini, F. P.,
and Cortese, R.
(1990)
Cell
63,
643-653[CrossRef][Medline]
[Order article via Infotrieve]
-
Chang, C. J.,
Chen, T. T.,
Lei, H. Y.,
Chen, D. S.,
Lee, S. C.
(1990)
Mol. Cell. Biol.
10,
6642-6653[Abstract/Free Full Text]
-
Williams, S. C.,
Cantwell, C. A.,
and Johnson, P. F.
(1991)
Genes Dev.
5,
1553-1567[Abstract/Free Full Text]
-
Friedman, A. D.,
Landschulz, W. H.,
McKnight, S. L.
(1989)
Genes Dev.
3,
1314-1322[Abstract/Free Full Text]
-
Isshiki, H.,
Akira, S.,
Sugita, T.,
Nishio, Y.,
Hashimoto, S.,
Pawlowski, T.,
Suematsu, S.,
and Kishimoto, T.
(1991)
New Biol.
3,
63-70[Medline]
[Order article via Infotrieve]
-
Alam, T.,
and Papaconstantinou, J.
(1992)
Biochemistry
31,
1928-1936[CrossRef][Medline]
[Order article via Infotrieve]
-
Poli, V.,
and Cortese, R.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
8202-8206[Abstract/Free Full Text]
-
Birkenmeier, E. H.,
Gwynn, B.,
Howard, S.,
Jerry, J.,
Gordon, J. I.,
Landschulz, W. H.,
McKnight, S. L.
(1989)
Genes Dev.
3,
1146-1156[Abstract/Free Full Text]
-
Umek, R. M.,
Friedman, A. D.,
and McKnight, S. L.
(1991)
Science
251,
288-292[Abstract/Free Full Text]
-
Gil, G.,
Smith, J. R.,
Goldstein, J. L.,
Slaughter, C. A.,
Orth, K.,
Brown, M. S.,
Osborne, T. F.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8963-8967[Abstract/Free Full Text]
-
Reitsma, P. H.,
Mandalaki, T.,
Kasper, C. K.,
Bertina, R. M.,
Briet, E.
(1989)
Blood
73,
743-746[Abstract/Free Full Text]
-
Tronche, F.,
Rollier, A.,
Sourdive, D.,
Cereghini, S.,
and Yaniv, M.
(1991)
J. Mol. Biol.
222,
31-43[CrossRef][Medline]
[Order article via Infotrieve]
-
Jackson, D. A.,
Rowader, K. E.,
Stevens, K.,
Jiang, C.,
Milos, P.,
and Zaret, K. S.
(1993)
Mol. Cell. Biol.
13,
2401-2410[Abstract/Free Full Text]
-
Xanthopoulos, K. G.,
and Mirkovitch, J.
(1993)
Eur. J. Biochem.
216,
353-360[Medline]
[Order article via Infotrieve]
-
Arenzana, N.,
and Rodriguez de Cordoba, S.
(1996)
J. Immunol.
156,
168-175[Abstract]
-
Erdmann, D.,
and Heim, J.
(1995)
J. Biol. Chem.
270,
22988-22996[Abstract/Free Full Text]
-
Crossley, M.,
and Brownlee, G. G.
(1990)
Nature
345,
444-446[CrossRef][Medline]
[Order article via Infotrieve]
-
Picketts, D. J.,
Mueller, C. R.,
and Lillicrap, D.
(1994)
Blood
84,
2992-3000[Abstract/Free Full Text]
-
Kurachi, S.,
Furukawa, M.,
Salier, J. P.,
Wu, C. T.,
Wilson, E. J.,
French, F. S.,
Kurachi, K.
(1994)
Biochemistry
33,
1580-1591[CrossRef][Medline]
[Order article via Infotrieve]
-
Huang, L. H.,
Ke, X. H.,
Sweeney, W.,
and Tam, J. P.
(1989)
Biochem. Biophys. Res. Commun.
160,
133-139[CrossRef][Medline]
[Order article via Infotrieve]
-
Huang, N.-M.,
Hung, H.-L.,
Stanfield-Oakley, S. A.,
High, K. A.
(1992)
J. Biol. Chem.
267,
15440-15446[Abstract/Free Full Text]
-
Miao, C. H.,
Ho, W. T.,
Greenberg, D. L.,
Davie, E. W.
(1996)
J. Biol. Chem.
271,
9587-9594[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Bertolucci, N. Cavallari, I. Colognesi, J. Aguzzi, Z. Chen, P. Caruso, A. Foa, G. Tosini, F. Bernardi, and M. Pinotti
Evidence for an Overlapping Role of CLOCK and NPAS2 Transcription Factors in Liver Circadian Oscillators
Mol. Cell. Biol.,
May 1, 2008;
28(9):
3070 - 3075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Jackson, K. R. Cronin, R. Zachariah, and J. A. Carew
CCAAT/Enhancer-binding Protein-beta Participates in Insulin-responsive Expression of the Factor VII Gene
J. Biol. Chem.,
October 26, 2007;
282(43):
31156 - 31165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Barbier, H. Girard, Y. Inoue, H. Duez, L. Villeneuve, A. Kamiya, J.-C. Fruchart, C. Guillemette, F. J. Gonzalez, and B. Staels
Hepatic Expression of the UGT1A9 Gene Is Governed by Hepatocyte Nuclear Factor 4{alpha}
Mol. Pharmacol.,
January 1, 2005;
67(1):
241 - 249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Reinhart, S. C. Williams, B. J. Clark, and D. M. Stocco
SF-1 (Steroidogenic Factor-1) and C/EBP{beta} (CCAAT/Enhancer Binding Protein-{beta}) Cooperate to Regulate the Murine StAR (Steroidogenic Acute Regulatory) Promoter
Mol. Endocrinol.,
May 1, 1999;
13(5):
729 - 741.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. A. Carew, E. S. Pollak, K. A. High, and K. A. Bauer
Severe Factor VII Deficiency Due to a Mutation Disrupting an Sp1 Binding Site in the Factor VII Promoter
Blood,
September 1, 1998;
92(5):
1639 - 1645.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|