Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, K.
Right arrow Articles by Umemura, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, K.
Right arrow Articles by Umemura, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 41, 26487-26496, October 9, 1998


Mechanism of Angiotensin II-mediated Regulation of Fibronectin Gene in Rat Vascular Smooth Muscle Cells*

Kouichi TamuraDagger §, Nobuo NyuiDagger , Nobuko Tamura, Takayuki FujitaDagger , Minoru KiharaDagger , Yoshiyuki ToyaDagger , Izumi TakasakiDagger , Nobuyoshi TakagiDagger , Masao IshiiDagger , Kin-ichiro Odaparallel , Masatsugu Horiuchi**, and Satoshi UmemuraDagger

From the Dagger  Department of Internal Medicine II and  Department of Dermatology, Yokohama City University School of Medicine, Yokohama 236, Japan, the parallel  Department of Biological Science and Technology, Science University of Tokyo, Chiba 278, Japan, and the ** Cardiovascular Division, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts 02115

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

This study was performed to investigate a mechanism of angiotensin II (Ang II)-mediated activation of the fibronectin (FN) gene in rat vascular smooth muscle cells. Actinomycin D and CV11974 completely inhibited Ang II-mediated increase in FN mRNA levels. Inhibitors of protein kinase C (PKC), protein-tyrosine kinase (PTK), phosphatidylinositol-specific phospholipase C, Ras, phosphatidylinositol 3-kinase, p70 S6 kinase, and Ca2+/calmodulin kinase also decreased Ang II-induced activation of FN mRNA. In contrast, cycloheximide; PD123319; or inhibitors of Gi, protein kinase A, or mitogen-activated protein kinase kinase did not affect the induction. FN promoter contained a putative AP-1 binding site (rFN/AP-1; -463 to -437), and the results of a transient transfection and electrophoretic mobility shift assay showed that Ang II enhanced rFN/AP-1 activity. CV11974 and inhibitors of PKC or PTK suppressed Ang II-mediated increases in rFN/AP-1 activity, although neither PD123319 nor a protein kinase A inhibitor affected the induction. Furthermore, mutation of rFN/AP-1 that disrupted nuclear binding suppressed Ang II-induced transcription in the native FN promoter (-1908 to +136) context. Thus, Ang II activates transcription of the FN gene through the Ang II type 1 receptor in vascular smooth muscle cells, at least in part, via the activation of AP-1 by a signaling mechanism dependent on PKC and PTK.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Hemodynamic and endocrine factors are among the most important factors implicated in the physiology and pathophysiology of the vascular wall. Arterial hypertension evokes structural and functional changes of the vascular wall (1, 2). Modifications of the extracellular matrix, including fibronectin (FN)1 and collagen, have been previously reported in vessel walls of hypertensive animals (3-5). Activation and qualitative changes in the extracellular matrix participate in vascular wall remodeling and in the pathogenesis of atherosclerosis. Vascular remodeling in hypertension may be an adaptive response to increased transmural pressure (6-9). Mechanical stress seems to play a direct role in vascular remodeling, since mechanical stretch is able to increase protein synthesis by vascular smooth muscle cells (VSMCs) (10). However, neuronal and humoral factors may be critical in hypertension-induced remodeling of vascular wall. Especially, several in vivo studies have reported that hypertension activates the vascular renin-angiotensin system (RAS) including angiotensin-converting enzyme (ACE) (11), and infusion of pressor and subpressor doses of angiotensin II (Ang II) increases aortic FN mRNA in both hypertensive and normotensive animals (12, 13). Ang II evokes diverse physiological response including arterial vasoconstriction to elevate blood pressure in vivo (14) and increases production of collagen with a growth-promoting effect on VSMCs in vitro (15). Pharmacological evidence has defined at least two subtypes of Ang II receptors, Ang II type 1 (AT1) receptor and Ang II type 2 (AT2) receptor. Previous results of molecular cloning have revealed that both receptor subtypes belong to the superfamily of G protein-coupled receptors with seven transmembrane helices (16-19). According to the recent results of in vitro studies, Ang II initially activates a phosphatidylinositol-specific phospholipase C (PI-PLC) via its binding to AT1 receptor on the surface of VSMCs, leading to the generation of inositol triphosphate and diacylglycerol (20), which are involved in intracellular Ca2+ mobilization (21) and protein kinase C (PKC) activation (22), respectively. In VSMCs, Ang II also induces a rapid increase in expression of the growth-associated nuclear proto-oncogenes and stimulates tyrosine phosphorylation of multiple substrates (23, 24). These findings, taken together with relatively abundant expression of AT1 receptor in vascular wall and VSMCs, indicate that Ang II plays an important role in vascular remodeling via an AT1 receptor pathway. Thus, investigation of the mechanism of Ang II-induced regulation of extracellular matrix and tissue RAS in VSMCs is essential in elucidating the mechanism of vascular remodeling and the pathogenesis of atherosclerosis.

In the present study, we examined the effects of Ang II on gene expression of extracellular matrix components (FN and collagen) and RAS components (angiotensinogen, ACE, and AT1 receptor) in VSMCs. We obtained evidence for induction of expression of FN and collagen but not angiotensinogen, ACE, or AT1 receptor. Furthermore, interactions of several signal transduction pathways were involved in Ang II-induced expression of FN in VSMCs, and a specific promoter region, the AP-1 element, of the FN gene might play an important role in the Ang II-mediated increase in FN mRNA.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- RPMI 1640 medium, fetal calf serum, penicillin, and streptomycin were obtained from Life Technologies, Inc. Ang II, phorbol 12-myristate 13-acetate, A23187, 8-bromo-cAMP, HA-1004, H-7, genistein, pertussis toxin (PTX), manumycin, rapamycin, actinomycin D, and cycloheximide were purchased from Sigma. Calphostin C, herbimycin A, H-89, U-73122, PD98059, BAPTA-AM, and calmidazolium chloride, were obtained from Calbiochem. Wortmannin was purchased from Bio-Mol. AT1 receptor-specific antagonist CV11974 and AT2 receptor-specific antagonist PD123329 were supplied from Takeda Chemical and Perk Davis, respectively.

Cell Culture of VSMCs-- VSMCs were aseptically isolated from thoracic aortic explants of 5-week-old Sprague-Dawley rats. Cells were cultured in RPMI 1640 medium containing 10% fetal calf serum and equilibrated with 95% air, 5% CO2. Subconfluent cells were passaged by trypsinization in 0.05% trypsin in PBS and reseeded in RPMI 1640 medium plus 10% fetal calf serum. VSMCs were identified by their typical hill and valley morphology in culture and their characteristic immunocytochemical staining for alpha -smooth muscle actin (monoclonal anti-smooth muscle alpha -actin antibody, Sigma). Subcultured VSMCs from passages 3-19 were used in the experiments. For the experiments, cells at approximately 80% confluence in dishes were made quiescent by incubation with serum-free RPMI 1640 medium for 24 h, unless otherwise stated.

RNA Isolation and Northern Blot Hybridization-- Northern blot analysis was performed essentially as described previously (25). Total cellular RNA was isolated from VSMCs, using the single-step method by acid guanidinium thiocyanate-phenol chloroform extraction (26). Twenty micrograms of each total RNA sample were denatured with 1 M glyoxal and 50% dimethyl sulfoxide, electrophoresed on a 1.2% agarose gel, and transferred to GeneScreen Plus (Nylon) membrane (DuPont). Filters were prehybridized for 1 h at 65 °C in a solution consisting of 1% SDS, 1 M NaCl, and 10% dextran sulfate. Hybridization proceeded for 24 h at 65 °C in the same solution containing 200 µg/ml denatured salmon sperm DNA and 3 × 105 cpm/ml of the 32P-labeled probes. Filters were washed twice with 2× SSC (1× SSC: 0.15 M NaCl, 0.015 M sodium citrate) for 5 min at room temperature, twice with 2× SSC and 1% SDS for 30 min at 60 °C, and twice with 0.1× SSC for 30 min at room temperature. Dried filters were exposed to x-ray film or to the imaging plate of FUJIX BIO-Imaging Analyzer BAS2000 (Fuji Photo Film).

cDNA Probes-- Rat FN cDNA probes kindly provided by Dr. Hynes were utilized for Northern blot analysis. One probe, which encodes the 10th and 11th type I repeat (a 0.51-kb HindIII/NheI fragment) shared by all isoforms of FN, was used to detect total FN mRNA (27). Other rat FN cDNA probes for EIIIA (a 0.55-kb PvuII/NheI fragment), EIIIB (a 0.59-kb PvuII/NheI fragment), and V region (a 0.60-kb PvuII/NheI fragment) were used to detect only FN mRNA with EIIIA, EIIIB, and V domain, respectively (28). Rat alpha 1 chain of type I collagen cDNA (a 1.3-kb PstI/BamHI fragment) was supplied by Dr. Rowe (29). Rat angiotensinogen cDNA probe (a 1.1-kb AccI/AccI fragment) was generously provided by Drs. Ohkubo and Nakanishi (30). ACE (a 2.3-kb EcoRI/BglII fragment) cDNA was provided by Dr. Corvol (31). AT1 receptor cDNA (a 0.5-kb SacI/SacI fragment) was provided by Dr. Sugaya (32). 18 S ribosomal RNA cDNA probe (a 0.3-kb SmaI/SmaI fragment) was provided by Dr. Raynal (33).

Plasmid Construction, DNA Transfection, and Chloramphenicol Acetyltransferase (CAT) Assay-- pUCSV3CAT contains the coding sequence for CAT with SV40 enhancer/promoter sequence and polyadenylation signal fused in the 5'-end of the CAT coding sequence (34). pUCSV0CAT has a SV40 polyadenylation signal 5' to the CAT coding gene and efficiently terminates the read-through transcription arising from prokaryotic sequences in the constructs (34). pUCSV3CAT was used as a positive control, and pUCSV0CAT was used as a background reference. Construction of TK-CAT, containing the herpes simplex virus-thymidine kinase promoter upstream of the CAT coding gene, was described previously (35). Double-stranded oligonucleotides of the rat FN promoter region carrying a consensus sequence of AP-1 binding site (rat FN promoter AP-1 binding sequences, rFN/AP-1) was linked upstream to TK-CAT in 5' to 3' orientation to construct rFN/AP-1/TK-CAT. The sequences of oligonucleotides were 5'-TTCTCAGAGGTGACGCAATGTTCTCAA-3' (rFN/AP-1, positions -463 to -437 of the rat fibronectin promoter; the AP-1 binding motif is underlined). Plasmid rFN-CAT was constructed by inserting a 2044-bp PstI/PstI rat FN promoter fragment (-1908 to +136 relative to the major transcription start site) excised from pF1900CAT (36) into the BglII/HindIII sites upstream of the CAT coding sequences of pUCSV0CAT (34). rFN-CAT was used as a template to construct mutations in the rFN/AP-1 element (rFN/m[AP-1] element) by oligonucleotide-directed mutagenesis (37). Sequences of the oligonucleotides used to create the rFN/m[AP-1] element were 5'-TTCTCAGAGGTacgtCAATGTTCTCAA-3'. Oligonucleotides were synthesized on a Milligen/Bioresearch CycloneTM Plus oligonucleotide synthesizer and purified on OPC columns (Applied Biosystems) as described by the manufacturer. Once the mutations were obtained and confirmed by sequencing, the altered 2044-bp (-1908 to +136) fragment was subcloned into the BglII/HindIII sites of pUCSV0CAT (rFN/m[AP-1]-CAT).

The FN promoter-CAT chimeric construct (3 µg) and a beta -galactosidase expression plasmid pCH110 (1 µg), which is used to normalize transfection efficiency, were transiently cotransfected into VSMCs as described previously (38, 39). Media were replaced with fresh serum-free media 12 h after the transfection, and cells were incubated for 24 h. VSMCs were then pretreated with Ang II receptor antagonists or signaling inhibitors for 30 min, followed by treatment with Ang II (10-7 M) for 18 h. Aliquots of cell extracts containing equal amounts of total protein (80 µg) were used for CAT assay. CAT assay was performed as described previously (38, 39), and results were normalized on the basis of protein concentration or beta -galactosidase activity to correct for differences in transfection efficiency. The conversion ratios of [14C]chloramphenicol were measured with an image analysis system (BAS2000). All experiments were performed four times for each construct.

Preparation of Nuclear Extracts and Electrophoretic Mobility Shift Assay-- VSMCs were pretreated with Ang II receptor antagonists or signaling inhibitors for 30 min, followed by treatment with Ang II (10-7 M) for 18 h. Nuclear extracts from VSMCs were prepared using a modification of the protocol of Dignam et al. (40, 41). The final protein concentration was 5-7 mg/ml. Electrophoretic mobility shift assay (EMSA) was performed essentially as described previously (25, 39). Briefly, double-stranded rFN/AP-1 sequences were phosphorylated at both ends using T4 polynucleotide kinase and [gamma -32P]ATP. Nuclear extracts were preincubated for 15 min on ice in a 20-µl reaction mixture containing 12 mM HEPES, pH 7.9, 60 mM KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 12% glycerol, and 500 ng of double-stranded poly(dI-dC) in the presence or absence of a 50- or 100-fold excess of a specific double-stranded competitor DNA. 0.1-0.5 ng (approximately 15,000 cpm) of a radiolabeled DNA probe were added, and the incubation continued for 30 min at room temperature. The incubation mixture was loaded on a 5% polyacrylamide gel in 1× TBE and electrophoresed at 140 V for 3 h followed by autoradiography. Oligonucleotides containing the consensus binding sequences for AP-1 (CTAGTGATGAGTCAGCCGGATC) and AP-2 (GATCGAACTGACCGCCCGCGGCCCGT) were obtained from Stratagene (GELSHIFTTM kit) and used for an electrophoretic competition assay.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Effects of Ang II on Expression of Extracellular Matrix and RAS Components mRNA in VSMCs-- To examine whether Ang II was a major activator of FN production in VSMCs, we first assessed effects of serum and several vasoactive substances including Ang II on FN gene expression by Northern blot analysis. After VSMCs were made quiescent by incubation with serum-free medium for 24 h, VSMCs were incubated with the indicated medium for 36 h. As shown in Fig. 1, a low level of FN mRNA could be detected in untreated control VSMCs. The mRNA level was markedly increased after exposure of the cells to FBS (10%), phorbol 12-myristate 13-acetate (10-9 M), or Ang II (10-7 M), whereas treatment with A23187 (10-5 M) or 8-bromo-cAMP (10-4 M) did not affect the FN mRNA levels. Then we examined the concentration dependence of Ang II-induced expression of FN mRNA in VSMCs. As shown in Fig. 2, the activation of FN mRNA expression was dependent on the concentration of Ang II; increased expression was initially detectable at 10-11 M, half-maximal at approximately 5 × 10-10 M, and maximal at 10-7 to 10-6 M.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 1.   Effects of vasoactive substances on expression of FN mRNA in cultured rat VSMCs. VSMCs were stimulated with vasoactive stimulator at the indicated concentrations for 36 h, and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as radioactivities using a BAS 2000 Imaging Analyzer, normalized relative to the radioactivity generated by probing for 18 S expression, and expressed relative to those achieved with RNA from control VSMCs (the mean mRNA expression of control VSMCs is expressed as 100%). Bars represent means of four independent experiments.


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 2.   Concentration-dependent effect of Ang II on expression of FN mRNA in cultured rat VSMCs. VSMCs were stimulated with Ang II at the indicated concentrations for 36 h and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II. Total RNAs from the rat liver (20 µg) and lung (20 µg) were also electrophoresed. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as described in the legend of Fig. 1. Bars represent means of four independent experiments.

We next examined the time course of extracellular matrix and RAS components mRNA expression induced by Ang II (10-7 M). Expression of FN mRNA started to increase 3 h after Ang II treatment and peaked at 36 h, and at 48 h FN mRNA was still elevated compared with control (Fig. 3). We also found an increase in the level of type I collagen mRNA as early as 1 h after treatment, with its peak at 24 h. In contrast, the ACE mRNA level did not show any significant change after exposure to Ang II, and mRNA expression of angiotensinogen and AT1 receptor was decreased after exposure to Ang II. These results indicate that Ang II treatment specifically increases extracellular matrix mRNA expression but not RAS components mRNA expression in VSMCs. Several studies using antagonists of Ang II receptor subtypes and angiotensinogen-deficient mice suggest that Ang II exerts various effects on the expression of major component genes of the RAS by positive or negative feedback mechanisms (42-45). Although we and others showed that angiotensinogen gene expression was up-regulated in response to Ang II in hepatocytes, cardiac myocytes, and renal fibroblasts (46-48), the present results indicate that Ang II decreases expression of angiotensinogen mRNA in VSMCs. In addition, previous studies showed that Ang II down-regulated the vascular smooth muscle AT1 receptor by transcriptional and post-transcriptional mechanisms (49, 50), and the results in this study were consistent with these results. FN exists in several forms as a result of the alternative splicing of a single gene. The different isoforms are distinguished by the presence or absence of exon products and are designated in the rat as FN-EIIIA, FN-EIIIB, and FN-V (29). Changes in FN biosynthesis by VSMCs may have a causative role in hypertension and atherosclerosis (51), and a selective induction of the isoform containing the EIIIA insert, which is a fetal gene transcript, has been shown to occur during the development of vascular hypertrophy in response to hypertension (52, 53). In the present study, Ang II appeared to increase the FN-EIIIA mRNA to a greater extent than the other isoforms (Fig. 4), thereby indicating that Ang II actually changed the phenotype of VSMCs.


View larger version (61K):
[in this window]
[in a new window]
  		Fig. 3.   Time-dependent effect of Ang II on expression of extracellular matrix and RAS component mRNA in cultured rat VSMCs. VSMCs were stimulated with Ang II (10-7 M) for the indicated durations and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN, alpha 1 chain of type I collagen (Col I), angiotensinogen (ATNG), ACE, and AT1 mRNAs and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II. Total RNAs from the rat liver (20 µg) and lung (20 µg) were also electrophoresed. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN, Col I, ATNG, ACE, and AT1 mRNA levels. The levels of mRNA expression were measured as described in the legend of Fig. 1. Bars represent means of four independent experiments.


View larger version (104K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of Ang II on expression of alternative spliced forms of FN mRNA in VSMCs. VSMCs were stimulated with Ang II (10-7 M) for the indicated durations, and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. Representative Northern blots are shown of FN, FN-EIIIA, FN-EIIIB, and FN-V mRNAs and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II. Northern blot hybridization was performed as described under "Experimental Procedures."

Effects of Ang II Receptor Antagonists, Transcriptional Inhibitor, and Protein Synthesis Inhibitor on Ang II-mediated Increase in FN mRNA Expression-- To determine the type of Ang II receptor(s) involved in mediating the enhanced expression of FN mRNA in response to Ang II, the effects of Ang II receptor antagonists were investigated. VSMCs were incubated for 30 min with CV11974 (10-6 and 10-5 M), followed by treatment with Ang II (10-7 M) for 24 h. Treatment of VSMCs with CV11974 abolished the stimulatory effect of Ang II (Fig. 5, lanes 3 and 4). In contrast, incubation of cells with PD123319 (10-6 and 10-5 M) did not affect the response to Ang II at all (Fig. 5, lanes 14 and 15). None of these Ang II receptor antagonists alone increased the expression of FN mRNA (Fig. 5, lanes 5 and 16). These results indicate that Ang II activates FN mRNA expression through an AT1 receptor pathway in VSMCs.


View larger version (52K):
[in this window]
[in a new window]
  		Fig. 5.   Effect of Ang II receptor antagonists, transcriptional inhibitor, and protein synthesis inhibitor on Ang II-induced activation of FN mRNA expression. VSMCs incubated with serum-free medium were preincubated for 30 min with CV11974 (lanes 3 and 4), actinomycin D (lanes 6 and 7), cycloheximide (lanes 9 and 10), or PD123319 (lanes 14 and 15), followed by treatment with Ang II (lanes 2-4, 6, 7, 9, 10, and 13-15, 10-7 M) for 24 h, and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II and inhibitors. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as described in the legend to Fig. 1. Bars represent means of four independent experiments.

Next, to determine whether de novo RNA or protein synthesis was required for Ang II-induced increase in FN mRNA, VSMCs were pretreated with actinomycin D or cycloheximide for 30 min and incubated for 24 h in the presence or absence of Ang II (10-7 M) (Fig. 5). The RNA synthesis inhibitor actinomycin D not only abolished Ang II-mediated increase in FN mRNA but also lowered the basal FN mRNA level (Fig. 5, lanes 6-8), whereas the induction of FN mRNA by Ang II and the basal FN mRNA expression were not significantly altered by cycloheximide in VSMCs (Fig. 5, lanes 9-11). These results indicate that de novo mRNA transcription is required for the induction of FN mRNA expression by Ang II but that the effects of Ang II do not require de novo protein synthesis to stimulate the expression of FN mRNA.

FN mRNA turnover was examined by inhibiting new mRNA transcription with actinomycin D (5 µg/ml; Fig. 6). Half-lives for FN mRNA in control VSMCs were ~6.9 h. Treatment of VSMCs with Ang II for 12 h caused a slight increase (1.1-fold) in the half-life of FN mRNA (~7.3 h). Taken together, these results suggest that up-regulation of FN mRNA is mainly induced by enhancement of gene transcription.


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 6.   Effect of Ang II on FN mRNA stability. VSMCs were incubated in the presence or absence of Ang II (10-7 M) for 12 h, followed by treatment with a transcriptional inhibitor actinomycin D (5 µg/ml) for the indicated durations, and fibronectin mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with actinomycin D in the presence (+) or absence (-) of Ang II. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as described in the legend of Fig. 1. Bars represent means of four independent experiments.

Putative Role of Signal Transduction Pathways in Ang II-mediated Expression of FN mRNA-- The interaction of Ang II with Ang II receptors on VSMCs activates several intracellular signal transduction pathways, which results in increase in [Ca2+]i and activation of PKC and protein-tyrosine kinases (PTKs) (20-24). Therefore, the role of these signal transduction pathways in modulating expression of the FN mRNA was examined (Fig. 7). VSMCs were incubated with signaling inhibitors for 30 min, followed by treatment with Ang II (10-7 M) for 24 h. First, we examined a possible role of protein kinase A in Ang II-mediated up-regulation of FN mRNA. Incubation of VSMCs with protein kinase A inhibitors, HA-1004 (10 µg/ml and 100 µg/ml) or H-89 (10-5 and 10-4 M) had no effect on Ang II-induced FN mRNA levels (Fig. 7, lanes 3-6). Next, involvement of PKC in Ang II-stimulated expression of FN mRNA was assessed by use of two different PKC inhibitors, H-7 (10 and 100 µg/ml) and calphostin C (10-7 and 10-6 M). Both PKC inhibitors significantly decreased the response to Ang II (Fig. 7, lanes 7-10). Third, the role of PTKs in mediating the cellular effects of Ang II was assessed with genistein (10-5 and 10-4 M) and herbimycin A (10-6 and 10-5 M), two different inhibitors of PTKs. Both treatments significantly inhibited the Ang II-mediated increase in FN mRNA (Fig. 7, lanes 11-14). These results indicate that PKC and PTK are involved in the activation of FN mRNA by Ang II.


View larger version (56K):
[in this window]
[in a new window]
  		Fig. 7.   Effect of inhibitors of protein kinase A, PKC, and PTK on Ang II-induced activation of FN mRNA expression. VSMCs were pretreated for 30 min with either protein kinase A inhibitors HA-1004 and H-89, PKC inhibitors H-7 and calphostin C, or PTK inhibitors genistein and herbimycin A, followed by treatment with Ang II (10-7 M) for 24 h, and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II and inhibitors. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as described in the legend to Fig. 1. Bars represent means of four independent experiments.

AT1 receptor has been reported to be coupled to either Gq or Gi, which activates PI-PLC or inhibits adenylate cyclase, respectively (20-24). To determine which G protein-mediated signaling is involved in the FN activation, the effects of a specific PI-PLC inhibitor U-73122 and a Gi inhibitor PTX on Ang II-induced FN activation were studied in VSMCs (Fig. 8). Treatment with a U-73122 (10-6 and 10-5 M) for 24 h significantly inhibited FN activation induced by Ang II, whereas PTX (1 and 10 µg/ml) did not affect Ang II-induced increase in FN mRNA (Fig. 8, lanes 3-6). These data suggest that PI-PLC activation through a PTX-insensitive G protein (probably Gq) plays a critical role in Ang II-induced FN activation in VSMCs. In cultured VSMCs, Ang II also stimulates Ras, phosphatidylinositol 3-kinase (PI3K), mitogen-activated protein (MAP) kinase, and p70 S6 kinase (S6K) (54-56) and has been shown to cause an elevation of cytosolic Ca2+ released from the inositol triphosphate-sensitive intracellular stores by the activation of PI-PLC. Treatment with the Ras farnesyltransferase inhibitor manumycin (10-7 and 10-6 M), the PI3K inhibitor wortmannin (10-7 and 10-6 M), the S6K inhibitor rapamycin (10-6 and 10-5 M), the intracellular Ca2+ chelator BAPTA-AM (10-6 and 10-5 M), or the calmodulin inhibitor calmidazolium chloride for 24 h resulted in significant loss of FN activation induced by Ang II (Fig. 8, lanes 7, 8, and 11-20). In contrast, blockade of MAP kinase kinase with PD98059 failed to inhibit Ang II-induced increase in FN mRNA (Fig. 8, lanes 9 and 10). These results indicate that Ang II-induced FN activation was dependent on Ras, PI3K, and S6K, whereas it was independent of MAP kinase in VSMCs. In addition, although the Ca2+ ionophore A23187 was not able to up-regulate FN mRNA expression, the results suggest that Ang II stimulates FN expression through a Ca2+/calmodulin-dependent mechanism.


View larger version (40K):
[in this window]
[in a new window]
  		Fig. 8.   Effect of inhibitors of PI-PLC, Gi, Ras, MAP kinase, PI3K, S6K, intracellular Ca2+, and calmodulin kinase on Ang II-induced activation of FN mRNA expression. VSMCs were pretreated for 30 min with the PI-PLC inhibitor U-73122, the Gi inhibitor PTX, the Ras farnesyltransferase inhibitor manumycin, the MAP kinase kinase inhibitor PD98059, the PI3K inhibitor wortmannin, the S6K inhibitor rapamycin, the intracellular Ca2+ chelator BAPTA-AM, or the calmodulin inhibitor calmidazolium chloride, followed by treatment with Ang II (10-7 M) for 24 h, and FN mRNA/18 S ribosomal RNA (18S) levels were estimated. A, representative Northern blots of FN mRNA and 18 S ribosomal RNA from VSMCs (total RNA, 20 µg) treated with Ang II and inhibitors. Northern blot hybridization was performed as described under "Experimental Procedures." B, relative FN mRNA levels. The levels of mRNA expression were measured as described in the legend to Fig. 1. Bars represent means of four independent experiments.

Ang II-mediated Activation of AP-1-Binding Site-containing Promoter-- Selective gene expression is mostly controlled at transcriptional level (57), and the above results suggest that the AT1 receptor-mediated activation of transcription via signaling pathways may play an important role in Ang II-induced expression of FN mRNA in VSMCs. The regulation of transcriptional activity is achieved through the binding of a series of transcriptional factors to sequence-specific DNA elements that usually locate in the 5'-flanking region of the gene (58-60). The identification of both cis-acting elements and nuclear factors in the specialized cells would give a clue to understanding of the molecular mechanisms that underlie expression of genes induced by various stimuli. Previous studies showed that the 5'-flanking region of the rat FN gene contained the motifs for transcription factors E4TF1, AP-1, AP-2, PEA2, and cAMP response element (61, 62). Among them, the AP-1-binding motif is known to be one of the targets of Ang II-mediated transcriptional activation via a PKC-dependent pathway (63).

Thus, we examined whether Ang II activates transcription through the AP-1 binding motif of the FN promoter. We transfected a CAT reporter gene containing the rat FN AP-1 binding motif linked upstream of the thymidine kinase minimum promoter (rFN/AP-1/TK-CAT) into VSMCs and stimulated VSMCs with Ang II (Fig. 9). Thirty-six hours after the DNA transfection, transfected VSMCs were incubated with Ang II receptor antagonists or signaling inhibitors for 30 min, followed by treatment with Ang II (10-7 M) for 18 h. Ang II increased CAT activity of rFN/AP-1/TK-CAT by 4.6-fold (Fig. 9, lanes 3 and 4). On the other hand, CAT activity of a CAT reporter gene containing only the thymidine kinase minimum promoter (TK-CAT) was not enhanced by Ang II (data not shown). We also examined what type of Ang II receptor(s) was involved in mediating the enhanced CAT activity through rFN/AP-1 in response to Ang II. Incubation of VSMCs with CV11974 (10-5 M) abolished the stimulatory effect of Ang II (10-7 M), whereas incubation of cells with PD123319 (10-5 M) did not affect the response to Ang II at all (Fig. 9, lanes 5 and 6). In addition, we examined a possible role of several signaling pathways in Ang II-mediated increase in CAT activity of rFN/AP-1/TK-CAT. Although incubation of VSMCs with a protein kinase A inhibitor HA-1004 (100 µg/ml) had no effect on Ang II-induced CAT activity, treatment with the PKC inhibitor calphostin C (10-6 M) or the PTK inhibitor genistein (10-4 M) significantly inhibited the Ang II-mediated increase in CAT activity of rFN/AP-1/TK-CAT (Fig. 9, lanes 7-9). These results indicate that activation of AP-1-binding site-containing promoter through PKC- and PTK-dependent pathways may play an important role in Ang II-induced transcription of the FN gene in VSMCs.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 9.   Effect of Ang II on transcription from AP-1-binding site-containing promoter in VSMCs. VSMCs were transfected with a CAT reporter gene containing the rat FN AP-1 binding motif linked upstream of the thymidine kinase minimum promoter (rFN/AP-1/TK-CAT, 3 µg). Thirty-six hours after the transfection, VSMCs were preincubated for 30 min with CV11974 (lane 5, 10-5 M), PD123319 (lane 6, 10-5 M), HA-1004 (lane 7, 100 µg/ml), calphostin C (lane 8, 10-6 M), or genistein (lane 9, 10-4 M) and treated with Ang II (lanes 4-9, 10-7 M) for an additional 18 h. Promoter activity was estimated by CAT assay. A, representative results of the CAT assay using cell extracts (80 µg) from VSMCs treated with Ang II and inhibitors. The CAT assay was performed as described under "Experimental Procedures." Different forms of acetylated [14C]chloramphenicol (solid arrows) represent promoter activity. The promoterless plasmid pUCSV0CAT (SV0, lane 2) was used as a background reference, and pUCSV3CAT (SV3, lane 1) was used as a positive control including the SV40 enhancer-promoter region. B, relative CAT activities of rFN/AP-1/TK-CAT in VSMCs exposed to Ang II with inhibitors. CAT activities were measured with a BAS2000 imaging analyzer and expressed relative to those achieved with cell extracts from control VSMCs (the mean CAT activity of control VSMCs is expressed as 100%). Bars represent means of four independent transfection experiments.

Ang II-mediated Increase in AP-1 Binding Activity of FN Promoter-- Since the results of the DNA transfection study showed that Ang II stimulated transcription directed by rFN/AP-1 in VSMCs, we carried out EMSA using rFN/AP-1 as the probe to examine the effect of Ang II on nuclear binding activity to rFN/AP-1 (Fig. 10A). VSMCs were treated with Ang II (10-7 M) for 18 h, and nuclear extracts were prepared. Incubation of VSMC nuclear extracts with the 32P-labeled rFN/AP-1 produced a single shifted band, and Ang II significantly increased the intensity of this band (Fig. 10A, lanes 2 and 3). The Ang II-induced nuclear binding activity to rFN/AP-1 was specifically competed by the unlabeled rFN/AP-1 or double-stranded oligonucleotides containing the consensus binding site for AP-1 but not by those for AP-2 (Fig. 10A, lanes 4-7). Then VSMCs were incubated with Ang II receptor antagonists or signaling inhibitors for 30 min, followed by treatment with Ang II (10-7 M) for 18 h (Fig. 10B). Incubation of VSMCs with CV11974 (10-5 M) significantly decreased the stimulatory effect of Ang II (10-7 M), while incubation of cells with PD123319 (10-5 M) did not affect the response to Ang II (Fig. 10B, lanes 3 and 4). Furthermore, incubation of VSMCs with a PKC inhibitor calphostin C (10-6 M) or a PTK inhibitor genistein (10-4 M) significantly decreased the Ang II-mediated enhancement of nuclear binding activity to rFN/AP-1, although treatment with the protein kinase A inhibitor HA-1004 (100 µg/ml) had no effect on the Ang II-induced increase (Fig. 10B, lanes 5-7).


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 10.   Effect of Ang II on AP-1 binding activity of FN promoter and effect of Ang II receptor antagonists and signaling inhibitors on Ang II-induced activation of AP-1 binding activity. A, representative results of EMSA using nuclear extracts from VSMCs treated with Ang II. VSMCs were treated with Ang II (10-7 M) for 18 h, and EMSA of rFN/AP-1 was performed as described under "Experimental Procedures." Nuclear extracts from VSMCs (lanes 2-7, 15 µg) were incubated with the probe (rFN/AP-1). In competition assay, 50- or 100-fold molar excess of the competitor DNA was added to the reaction mixture. Lane 1 contained no nuclear extract. The solid and open arrowheads indicate specific DNA-protein complex and free probe, respectively. B, representative results of EMSA using nuclear extracts from VSMCs treated with Ang II and inhibitors. VSMCs were preincubated for 30 min with CV11974 (lane 3, 10-5 M), PD123319 (lane 4, 10-5 M), HA-1004 (lane 5, 100 µg/ml), calphostin C (lane 6, 10-6 M), or genistein (lane 7, 10-4 M) and treated with Ang II (10-7 M) for 18 h. EMSA of rFN/AP-1 was performed as described under "Experimental Procedures." Nuclear extracts from VSMCs (lanes 1-7, 15 µg) were incubated with the probe (rFN/AP-1). The solid and open arrowheads indicate specific DNA-protein complex and free probe, respectively.

From the above results, rFN/AP-1 seems to exert a critical influence on Ang II-mediated promoter activity of the FN gene in VSMCs. Thus, to evaluate a functional significance of rFN/AP-1 in Ang II-mediated FN promoter activity, we assayed the effects of a mutation in the native FN promoter sequences (from -1908 to +136 of the transcriptional start site) that disrupted binding of nuclear factors to this element. Although the DNA-protein complex formed by the rFN/AP-1 element binding activity could be competed out by a nonlabeled rFN/AP-1 element, the rFN/m[AP-1] element, which contained substitution mutations interrupting the AP-1 binding motif, did not compete out this binding (Fig. 11A, lanes 2-4). In transiently transfected VSMCs, the FN promoter (-1908 to +136)-CAT hybrid gene with this mutated rFN/AP-1 element (rFN/m[AP-1]-CAT) showed a significant decrease in Ang II-mediated promoter activity (Fig. 11B). These data suggest that an AT1 receptor-mediated stimulation of AP-1 binding activity may be involved in Ang II-induced transcription of the FN gene through PKC- and PTK-dependent mechanism in VSMCs.


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 11.   Effect of rFN/AP-1 mutation on nuclear factor binding and on promoter activity of the native FN gene. A, representative results of EMSA using nuclear extracts (15 µg) from VSMCs treated with Ang II (10-7 M) for 18 h. EMSA was performed as described under "Experimental Procedures." Nuclear extracts from VSMCs (lanes 1-4, 15 µg) were incubated with the probe (rFN/AP-1). In competition assay, 100-fold molar excess of the competitor DNA was added to the reaction mixture. Lanes 5 and 6 show the effects of the native rFN/AP-1 and the mutated rFN/AP-1 (rFN/m[AP-1]) as cold competitors of the DNA-protein interaction, respectively. The solid and open arrowheads indicate specific DNA-protein complex and free probe, respectively. B, representative results of the CAT assay using cell extracts (80 µg) from VSMCs subjected to cyclic stretch. VSMCs were transfected with a plasmid rFN-CAT (3 µg) or rFN/m[AP-1]-CAT (3 µg). Thirty-six hours after the transfection, VSMCs were treated with Ang II (lanes 4-9, 10-7 M) for an additional 18 h, and promoter activity was estimated by CAT assay. CAT assay was performed as described under "Experimental Procedures." Relative CAT activities were measured as described in the legend of Fig. 9. Bars represent means of four independent transfection experiments.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Preceding studies have shown that the expression of aortic FN was increased relatively early not only in acute experimental hypertension models induced by Ang II infusion, deoxycorticosterone-salt treatment, or clipping of a renal artery (two-kidney, one-clip hypertension) but also in a chronic hypertension model such as spontaneously hypertensive rats (3, 51-53). These previous results raised a possibility that elevation of blood pressure and activation of the vascular RAS may be synergistically perceived by vascular cells as a signal that is transduced to increase the expression of aortic FN (64).

Ang II, which is a main effector of the RAS, regulates various physiological responses, including electrolyte and water balance, blood pressure, and vascular tone. Ang II is produced both systemically and locally in the vessel wall by the actions of renin, which converts angiotensinogen into angiotensin I (Ang I), and ACE, which cleaves Ang I to form Ang II. Ang II has been shown to act directly, stimulate VSMC growth, and enhance the production of FN and collagen in VSMCs, mesangial cells, and renal fibroblasts (15, 47, 65). Thus, contribution of Ang II in regulating aortic FN expression in vivo was examined by several investigators using a hypertension model induced by continuous infusion of Ang II in Wistar and Sprague-Dawley rats (3, 12, 13). They found that the expression of aortic FN in this model was induced not by blood pressure elevation but mainly by Ang II through an AT1 receptor-pathway. In addition, a recent study examined the effects of AT1 receptor blockade on the gene expression of immediate early genes, including c-jun and c-fos, and FN after endothelial denudation of the left common carotid artery by balloon catheter in Sprague-Dawley rats (66). The results showed that blockade of AT1 receptor inhibited the induction of AP-1 and FN in rat injured artery. These results suggest that Ang II may play a pivotal role through an AT1 receptor pathway in the induction of FN during the process of vascular remodeling in vivo. Previous studies showed that Ang II acted directly and enhanced the production of FN in mesangial cells and renal fibroblasts and demonstrated that Ang II increased synthesis of FN proteins in mesangial cells and renal fibroblasts through induction of TGF-beta expression by Ang II (47, 65). With respect to regulation of the FN gene in VSMCs, a recent study showed that Ang II increased expression of the FN gene in VSMCs (67), and FN converts VSMCs from a contractile to a synthetic phenotype and plays an important role in the proliferative response of VSMCs. However, Ang II-induced mitogenesis and cellular proliferation in VSMCs were not inhibited by either platelet-derived growth factor- or tumor growth factor-beta -neutralizing antibodies, although Ang II stimulation of VSMC growth correlated with the increased expression of platelet-derived growth factor A-chain and tumor growth factor-beta (68). Therefore, the mechanisms that are involved in Ang II-mediated activation of the FN gene are likely to be different between VSMCs and renal mesangial cells, and a possible molecular relationship between the action of Ang II and the induction of FN gene expression in VSMCs remains unclear.

In this study, we showed that Ang II enhanced the expression of FN mRNA in VSMCs in a concentration- and time-dependent manner, while Ang II did not increase mRNA expression of the RAS components. Treatment of hypertensive animals with ACE inhibitors appears to be more effective in causing regression of vascular hypertrophy than other treatments that lead to an equivalent decrease in blood pressure (69). In addition, the steady-state mRNA levels for aortic angiotensinogen, ACE, and AT1 receptor were significantly elevated in experimental hypertensive rats (70, 71), and vascular injury induced angiotensinogen and ACE gene expression in injured vessels (72, 73), thereby suggesting that vascular RAS plays an important role in the vascular hypertrophy in hypertension and in the myointimal proliferation in response to injury. Although the results of this study do not support one possible mechanism for the RAS positive feedback loop in VSMCs in the pathogenesis of vascular hypertrophy, the results may provide a rationale for the use of AT1 receptor antagonists, which is effective in inhibition of extracellular matrix production, in the management of vascular hypertrophy associated with hypertension.

The effects of Ang II on growth, gene expression, and FN production are mediated primarily by AT1 receptor. In this study, CV11974 completely blocked Ang II-mediated expression of the FN mRNA, whereas PD123319 did not interfere with the Ang II response. These results indicated that the AT1 receptor essentially mediates activation of the FN gene by Ang II in VSMCs. We further examined some mechanisms in response to Ang II stimulation in VSMCs. Binding of Ang II to AT1 receptor stimulates PI-PLC, increases protein tyrosine phosphorylation, and activates Ras and several protein kinases, such as PI3K, PKC, MAP kinase, Ca2+/calmodulin kinase, and S6K (24, 74). Previous studies propose an important role for PKC as an intracellular mediator of the effects of several hypertrophic growth stimuli (22), including mesangial cell FN production (75). In this study, we showed that Ang II-mediated expression of FN mRNA was inhibited by PKC inhibitors, suggesting that activation of PKC is involved in Ang II responses. In addition, recent studies in VSMCs suggest that many Ang II effects, such as MAP kinase activity, protein synthesis, and vascular contraction, require tyrosine phosphorylation (76), and we showed that Ang II-induced FN mRNA expression was blocked by PTK inhibitors in this study. Although AT1 receptor is a typical G protein-coupled receptor that lacks tyrosine kinase activity, these results suggest that a receptor-associated tyrosine kinase may be involved in Ang II signaling and propose a potential cross-talk between PKC and PTK in AT1 receptor-mediated activation of FN mRNA expression by Ang II in VSMCs. Furthermore, these results also suggest that Ang II-induced expression of FN mRNA is initiated by stimulation of PI-PLC through a PTX-insensitive G protein (probably Gq) and is dependent on Ras, PI3K, S6K, and Ca2+/calmodulin kinase.

Comparison of the kinetics of FN mRNA expression by treatment with actinomycin D in the presence or absence of Ang II revealed that a Ang II-induced mRNA stabilization process played only a partial role in FN mRNA regulation. Since Ang II-induced increases in the mRNA levels of FN were blocked by pretreatment with actinomycin D but not by cycloheximide, it is unlikely that Ang II treatment induces de novo protein synthesis, whose products function to stabilize FN mRNA. Given that FN expression is mainly regulated at the transcriptional level in VSMCs, it is conceivable that constitutively expressed factors are activated by Ang II treatment through signaling pathways, which in turn induces the expression of FN mRNA transcriptionally.

Another finding of this study was that Ang II treatment increased transcriptional activity through the AP-1 binding site of the FN promoter (rFN/AP-1) and enhanced the binding activity of nuclear factors to rFN/AP-1. In addition, the results of functional analysis by site-directed mutation of rFN/AP-1 site demonstrated that the rFN/AP-1 site plays a critical role in Ang II-induced transcriptional activity in the native FN promoter context. CV11974 significantly inhibited Ang II-mediated stimulation of rFN/AP-1 cis-element activity, whereas PD123319 did not interfere with the Ang II response, thereby confirming that AT1 receptor mainly mediates activation of AP-1 binding activity of the FN gene by Ang II in VSMCs. AP-1 was originally described as a transcriptional activator that is induced as part of the immediate early response to phorbol ester stimulation (77, 78) and was showed to regulate transcriptional activity of genes through binding to AP-1 consensus motif in the promoter region in a PKC-dependent manner in VSMCs (79). In the present study, stimulation of rFN/AP-1 cis-element activity by Ang II was blocked by PKC inhibitors as well as by PTK inhibitors. A previous study using renal mesangial cells also showed that a cross-talk between PKC and PTK contributed to mitogenic signaling by endothelin-1 (80). Although it is suggested that a PTK-sensitive mechanism for recruiting new AP-1 complexes to DNA (e.g. PTK-sensitive c-fos induction by Ang II to form higher affinity AP-1 complexes), further experiments are necessary to determine the mechanism underlying the effects of PTK inhibitors on AP-1 DNA binding and to delineate a role of other protein kinases including PI3K, S6K, and Ca2+/calmodulin kinase in the Ang II-induced activation of the rFN/AP-1 site in VSMCs.

The data presented here demonstrate that Ang II activates expression of FN mRNA in VSMCs and that this effect is mediated mainly via a Gq-coupled AT1 receptor pathway, which involves a signaling mechanism dependent on PI-PLC, Ras, PKC, PTK, PI3K, S6K, and Ca2+/calmodulin kinase. In particular, Ang II appears to increase transcription of the FN gene through AP-1 binding motif of the FN promoter (rFN/AP-1), and Ang II may regulate activity of the rFN/AP-1 element by an AT1 receptor-mediated signaling pathway involving PKC and PTK. Ang II-induced activation of FN gene expression in VSMCs may play a pathophysiological role in the abnormal growth of VSMCs observed in cardiovascular diseases, thereby providing a rationale for the use of AT1 receptor antagonists in the management of vascular hypertrophy in response to hypertension.

    FOOTNOTES

* This work was supported by grants from the Ministry of Education, Science, and Culture of Japan, Uehara Memorial Foundation, Ichiro Kanehara Foundation, and Yokohama Foundation for Advancement of Medical Science.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science. To whom correspondence should be addressed: Dept. of Internal Medicine II, Yokohama City University School of Medicine, 3-9, Fukuura, Kanazawa-ku, Yokohama 236, Japan. Tel.: 81-45-787-2635; Fax: 81-45-701-3738; E-mail: tamukou{at}yellow.med.yokohama-cu.ac.jp.

The abbreviations used are: FN, fibronectin; VSMC, vascular smooth muscle cell; ACE, angiotensin-converting enzyme; Ang II, angiotensin II; AT1, angiotensin II type 1; AT2, angiotensin II type 2; PI-PLC, phosphatidylinositol-specific phospholipase C; PKC, protein kinase C; PTX, pertussis toxin; CAT, chloramphenicol acetyltransferase; rFN/AP-1, rat fibronectin promoter AP-1 binding motif; EMSA, electrophoretic mobility shift assay; PTK, protein-tyrosine kinase; PI3K, phosphatidylinositol 3-kinase; MAP, mitogen-activated protein; S6K, p70 S6 kinase; TK, thymidine kinase; kb, kilobase pair; RAS, renin-angiotensin system.
    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Folkow, B. (1982) Physiol. Rev. 62, 347-504[Free Full Text]
  2. Mulvany, M. J. (1993) Am. J. Med. 94, 20S-23S[Medline] [Order article via Infotrieve]
  3. Takasaki, I., Chobanian, A. V., Sarzani, R., and Brecher, P. (1990) J. Biol. Chem. 265, 21935-21939[Abstract/Free Full Text]
  4. Chobanian, A. V. (1990) Hypertension 15, 666-674[Abstract/Free Full Text]
  5. Contard, F., Sabri, A., Glukhova, M., Sartore, S., Marotte, F,., Pomies, J.-P., Schiavi, P., Guez, D., Samuel, J.-L., and Rappaport, L. (1993) Hypertension 22, 665-676[Abstract/Free Full Text]
  6. Glagov, S., Zarins, C., Giddens, D. P., and Ku, D. N. (1988) Arch. Pathol. Lab. Med. 112, 1018-1031[Medline] [Order article via Infotrieve]
  7. Chobanian, A. V. (1992) Am. J. Cardiol. 69, 3E-7E[CrossRef][Medline] [Order article via Infotrieve]
  8. Dzau, V. J., and Gibbons, G. H. (1993) J. Cardiovasc. Pharmacol. 21, Suppl. 1, 1-5
  9. Glagov, S. (1994) Circulation 89, 2888-2891[Free Full Text]
  10. Grande, J. P., Glagov, S., Bates, S. R., and Horwitz, A. L. (1989) Arteriosclerosis 9, 446-452[Abstract/Free Full Text]
  11. Shiota, N., Miyazaki, M., and Okunishi, H. (1992) Hypertension 20, 168-174[Abstract/Free Full Text]
  12. Himeno, H., Crawford, D. C., Hosoi, M., Chovanian, A. V., and Brecher, P. (1994) Hypertension 23, 823-826[Abstract/Free Full Text]
  13. Kim, S., Ohta, K., Hamaguchi, A., Omura, T., Tominaga, K., Yukimura, T., Miura, K., Tanaka, M., and Iwao, H. (1994) Br. J. Pharmacol. 113, 662-663[Medline] [Order article via Infotrieve]
  14. Tamura, K., Umemura, S., Fukamizu, A., Ishii, M., and Murakami, K. (1995) Hypertens. Res. 18, 7-18[Medline] [Order article via Infotrieve]
  15. Kato, H., Suzuki, H., Tajima, S., Ogata, Y., Tominaga, T., Sato, A., and Saruta, T. (1991) J. Hypertens. 9, 17-22[Medline] [Order article via Infotrieve]
  16. Murphy, T. J., Alexander, R. W., Griendling, K. K., Runge, M. S., and Bernstein, K. E. (1991) Nature 351, 233-235[CrossRef][Medline] [Order article via Infotrieve]
  17. Sasaki, K., Yamano, Y., Bardham, S., Iwai, N., Murray, J. J., Hasegawa, M., Matsuda, Y., and Inagami, T. (1991) Nature 351, 230-232[CrossRef][Medline] [Order article via Infotrieve]
  18. Mukoyama, M., Nakajima, M., Horiuchi, M., Sasamura, H., Pratt, R. E., and Dzau, V. J. (1993) J. Biol. Chem. 268, 24539-24542[Abstract/Free Full Text]
  19. Kambayashi, Y., Bardhan, S., Takahashi, K., Tsuzuki, S., Inui, H., Hamakubo, T., and Inagami, T. (1993) J. Biol. Chem. 268, 24543-24546[Abstract/Free Full Text]
  20. Griendling, K. K., Rittenhouse, S. E., Brock, T. A., Ekstein, L. S., Gimbrone, M. A., Jr., and Alexsander, R. W. (1986) J. Biol. Chem. 261, 5901-5906[Abstract/Free Full Text]
  21. Berridge, M. J. (1987) Annu. Rev. Biochem. 56, 59-193
  22. Nishizuka, Y. (1988) Nature 351, 662-665
  23. Naftilan, A. J., Pratt, R. E., and Dzau, V. J. (1989) J. Clin. Invest. 83, 1419-1424
  24. Berk, B. C., and Corson, M. A. (1997) Circ. Res. 80, 607-616[Abstract/Free Full Text]
  25. Tamura, K., Tanimoto, K., Ishii, M., Murakami, K., and Fukamizu, A. (1993) J. Biol. Chem. 268, 15024-15032[Abstract/Free Full Text]
  26. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
  27. Schwarzbauer, J. E., Tamkun, J. W., Lemischka, I. R., and Hynes, R. O. (1983) Cell 35, 421-431[CrossRef][Medline] [Order article via Infotrieve]
  28. Odermatt, E., Tamkun, J. W., and Hynes, R. O. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 6571-6575[Abstract/Free Full Text]
  29. Genovese, C., Rowe, D., and Kream, B. (1984) Biochemistry 23, 6210-6216[CrossRef][Medline] [Order article via Infotrieve]
  30. Ohkubo, H., Kageyama, R., Ujihara, M., Hirose, T., Inayama, S., and Nakanishi, S. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 2196-2200[Abstract/Free Full Text]
  31. Soubrier, F., Alhenc-Gelas, F., Hubert, C., Allegrini, J., John, M., Tregear, G., and Corvol, P. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 9386-9390[Abstract/Free Full Text]
  32. Sugaya, T., Nishimatsu, S., Tanimoto, K., Takimoto, E., Yamagishi, T., Imamura, K., Goto, S., Imaizumi, K., Hisada, Y., Otsuka, A., Uchida, H., Sugiura, M., Fukuta, K., Fukamizu, A., and Murakami, K. (1995) J. Biol. Chem. 270, 18719-18722[Abstract/Free Full Text]
  33. Raynal, F., Michot, B., and Bachellerie, J.-P. (1984) FEBS Lett. 167, 263-268[CrossRef][Medline] [Order article via Infotrieve]
  34. Fukamizu, A., Tanimoto, K., Uehara, S., Seo, M. S., Handa, S., Sagara, M., Takahashi, S., Imai, T., and Murakami, K. (1991) Biomed. Biochim. Acta 50, 659-663[Medline] [Order article via Infotrieve]
  35. Tanimoto, K., Murakami, K., and Fukamizu, A. (1993) Arch. Biochem. Biophys. 302, 409-416[CrossRef][Medline] [Order article via Infotrieve]
  36. Nakajima, T., Nakamura, T., Tsunoda, S., Nakada, S., and Oda, K. (1992) Mol. Cell. Biol. 12, 2837-2846[Abstract/Free Full Text]
  37. Higuchi, R., Krummel, B., and Saiki, R. K. (1988) Nucleic Acids Res. 16, 7351-7367[Abstract/Free Full Text]
  38. Tamura, K., Umemura, S., Ishii, M., Tanimoto, K., Murakami, K., and Fukamizu, A. (1994) J. Clin. Invest. 93, 1370-1379
  39. Tamura, K., Umemura, S., Nyui, N., Yamaguchi, S., Ishigami, T., Hibi, K., Yabana, M., Kihara, M., Fukamizu, A., Murakami, K., and Ishii, M. (1997) J. Biol. Chem. 272, 16845-16851[Abstract/Free Full Text]
  40. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
  41. Swick, A. G., Blake, M. C., Kahn, J. W., and Azizkhan, J. C. (1989) Nucleic Acids Res. 17, 9291-9304[Abstract/Free Full Text]
  42. Kohara, K., Brosnihan, K. B., Ferrario, C. M., and Milsted, A. (1992) Am. J. Physiol. 262, E651-E657[Abstract/Free Full Text]
  43. Tanimoto, K., Sugiyama, F., Goto, Y., Ishida, J., Takimoto, E., Yagami, K., Fukamizu, A., and Murakami, K. (1994) J. Biol. Chem. 269, 31334-31337[Abstract/Free Full Text]
  44. Kijima, K., Matsubara, H., Murasawa, S., Maruyama, K., Mori, Y., Ohkubo, N., Komuro, I., Yazaki, Y., Iwasaka, T., and Inada, M. (1996) Circ. Res. 79, 887-897[Abstract/Free Full Text]
  45. Tamura, K., Umemura, S., Sumida, Y., Nyui, N., Kobayashi, S., Ishigami, T., Kihara, M., Sugaya, T., Fukamizu, A., Miyazaki, H., Murakami, K., and Ishii, M. (1998) Hypertension 32, 223-227[Abstract/Free Full Text]
  46. Li, J., and Brasier, A. R. (1996) Mol. Endocrinol. 10, 252-264[Abstract/Free Full Text]
  47. Ruiz-Ortega, M., and Egido, J. (1997) Kidney Int. 52, 1497-1510[Medline] [Order article via Infotrieve]
  48. Tamura, K., Umemura, S., Nyui, N., Hibi, K., Ishigami, T., Kihara, M., Toya, Y., and Ishii, M. (1998) Am. J. Physiol. 275, R1-R9
  49. Lassegue, B., Alexander, R. W., Nickenig, G., Clark, M., Murphy, T. J., and Griendling, K. K. (1995) Mol. Pharmacol. 48, 601-609[Abstract]
  50. Wang, D. H., and Du, Y. (1998) J. Hypertens. 16, 467-475[CrossRef][Medline] [Order article via Infotrieve]
  51. Takasaki, I., Chobanian, A. V., and Brecher, P. (1991) J. Biol. Chem. 266, 17686-17694[Abstract/Free Full Text]
  52. Mamuya, W., Chobanian, A., and Brecher, P. (1992) Circ. Res. 71, 1341-1350[Abstract/Free Full Text]
  53. Takasaki, I., Chobanian, A. V., Sarzani, R., and Brecher, P. (1992) Hypertension 20, 20-25[Abstract/Free Full Text]
  54. Sadoshima, J., and Izumo, S. (1995) Circ. Res. 77, 1040-1052[Abstract/Free Full Text]
  55. Saward, L., and Zahradka, P. (1997) Circ. Res. 81, 249-257[Abstract/Free Full Text]
  56. Seewald, S., Seul, C., Kettenhofen, R., Bokemeyer, D., Ko, Y., Vetter, H., and Sachinidis, A. (1998) Hypertension 31, 1151-1156[Abstract/Free Full Text]
  57. Maniatis, T., Goodbourn, S., and Fischer, J. A. (1987) Science 236, 1237-1245[Abstract/Free Full Text]
  58. Johnson, P. F., and McKnight, S. L. (1989) Annu. Rev. Biochem. 58, 799-839[CrossRef][Medline] [Order article via Infotrieve]
  59. Wingender, E. (1988) Nucleic Acids Res. 16, 1879-1902[Free Full Text]
  60. Mitchell, P. J., and Tjian, R. (1989) Science 245, 371-378[Abstract/Free Full Text]
  61. Patel, R. S., Odermatt, E., Schwarzbauer, J. E., and Hynes, R. O. (1987) EMBO J. 6, 2565-2572[Medline] [Order article via Infotrieve]
  62. Nakajima, T., Nakamura, T., Tsunoda, S., Nakada, S., and Oda, K. (1992) Mol. Cell. Biol. 12, 2837-2846
  63. Takeuchi, K., Nakamura, N., Cook, N. S., Pratt, R. E., and Dzau, V. J. (1990) Biochem. Biophys. Res. Commun. 172, 1189-1194[CrossRef][Medline] [Order article via Infotrieve]
  64. Bardy, N., Merval, R., Benessiano, J., Samuel, J. -L., and Tedgui, A. (1996) Circ. Res. 79, 70-78[Abstract/Free Full Text]
  65. Kagami, S., Border, W. A., Miller, D. E., and Noble, N. A. (1994) J. Clin. Invest. 93, 2431-2437
  66. Kim, S., Kawamura, M., Wanibuchi, H., Ohta, K., Hamaguchi, A., Omura, T., Yukimura, T., Miura, K., and Iwao, H. (1995) Circulation 92, 88-95[Abstract/Free Full Text]
  67. Dunn, F. W., Roux, M. H., Farhadian, F., Sabri, K., Ossart, C., Samuel, J. L., Rappaport, L., and Hamon, G. (1997) J. Pharmacol. Exp. Ther. 280, 447-453[Abstract/Free Full Text]
  68. Weber, H., Taylor, D. S., and Molloy, C. J. (1994) J. Clin. Invest. 93, 788-798
  69. Lévy, B. I., Michel, J.-B., Salzmann, J.-L., Azizi, M., Poitevin, P., Safar, M., and Camilleri, J.-P. (1988) Circ. Res. 63, 227-239[Abstract/Free Full Text]
  70. Shiota, N., Miyazaki, M., and Okunishi, H. (1992) Hypertension 20, 168-174
  71. Wang, D. H., Yao, A., Zhao, H., and DiPette, D. J. (1997) Hypertension 29, 1104-1108[Abstract/Free Full Text]
  72. Rakugi, H., Jacob, H. J., Krieger, J. E., Ingelfinger, J. R., and Pratt, R. E. (1993) Circulation 87, 283-290[Abstract/Free Full Text]
  73. Rakugi, H., Wang, D. S., Dzau, V. J., and Pratt, R. E. (1994) Circulation 90, 449-455[Abstract/Free Full Text]
  74. Griendling, K. K., Ushio-Fukai, M., Lassegue, B., and Alexander, R. W. (1997) Hypertension 29, 366-373[Abstract/Free Full Text]
  75. Studer, R. K., Negrete, H., Craven, P. A., and Derubertis, F. R. (1995) Kidney Int. 48, 422-430[Medline] [Order article via Infotrieve]
  76. Eguchi, S., Matsumoto, T., Motley, E. D., Utsunomiya, H., and Inagami, T. (1996) J. Biol. Chem. 271, 14169-14175[Abstract/Free Full Text]
  77. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 49, 729-739[CrossRef][Medline] [Order article via Infotrieve]
  78. Lamph, W. W., Wamsley, P., Sassone-Corsi, P., and Verma, I. M. (1988) Nature 334, 629-631[CrossRef][Medline] [Order article via Infotrieve]
  79. Holzmeister, J., Graf, K., Warnecke, C., Fleck, E., and Regitz-Zagrosek, V. (1997) Am. J. Physiol. 273, H655-H664[Abstract/Free Full Text]
  80. Simonson, M. S., and Herman, W. (1993) J. Biol. Chem. 268, 9347-9357[Abstract/Free Full Text]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
E. M. de Cavanagh, M. Ferder, F. Inserra, and L. Ferder
Angiotensin II, mitochondria, cytoskeletal, and extracellular matrix connections: an integrating viewpoint
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H550 - H558.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
W. Qi, X. Chen, J. Holian, E. Mreich, S. Twigg, R. E. Gilbert, and C. A. Pollock
Transforming growth factor-beta1 differentially mediates fibronectin and inflammatory cytokine expression in kidney tubular cells
Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1070 - F1077.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Otis, S. Campbell, M. D. Payet, and N. Gallo-Payet
Angiotensin II Stimulates Protein Synthesis and Inhibits Proliferation in Primary Cultures of Rat Adrenal Glomerulosa Cells
Endocrinology, February 1, 2005; 146(2): 633 - 642.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
M. Ruperez, O. Lorenzo, L. M. Blanco-Colio, V. Esteban, J. Egido, and M. Ruiz-Ortega
Connective Tissue Growth Factor Is a Mediator of Angiotensin II-Induced Fibrosis
Circulation, September 23, 2003; 108(12): 1499 - 1505.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
S. Chen, Z. A. Khan, M. Cukiernik, and S. Chakrabarti
Differential activation of NF-kappa B and AP-1 in increased fibronectin synthesis in target organs of diabetic complications
Am J Physiol Endocrinol Metab, June 1, 2003; 284(6): E1089 - E1097.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
S. Chen, S. Mukherjee, C. Chakraborty, and S. Chakrabarti
High glucose-induced, endothelin-dependent fibronectin synthesis is mediated via NF-kappa B and AP-1
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C263 - C272.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
N. J. Laping, E. Grygielko, A. Mathur, S. Butter, J. Bomberger, C. Tweed, W. Martin, J. Fornwald, R. Lehr, J. Harling, et al.
Inhibition of Transforming Growth Factor (TGF)-beta 1-Induced Extracellular Matrix with a Novel Inhibitor of the TGF-beta Type I Receptor Kinase Activity: SB-431542
Mol. Pharmacol., July 1, 2002; 62(1): 58 - 64.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. Yokoi, M. Mukoyama, A. Sugawara, K. Mori, T. Nagae, H. Makino, T. Suganami, K. Yahata, Y. Fujinaga, I. Tanaka, et al.
Role of connective tissue growth factor in fibronectin expression and tubulointerstitial fibrosis
Am J Physiol Renal Physiol, May 1, 2002; 282(5): F933 - F942.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
Y. Suzuki, O. Lopez-Franco, D. Gomez-Garre, N. Tejera, C. Gomez-Guerrero, T. Sugaya, R. Bernal, J. Blanco, L. Ortega, and J. Egido
Renal Tubulointerstitial Damage Caused by Persistent Proteinuria Is Attenuated in AT1-Deficient Mice : Role of Endothelin-1
Am. J. Pathol., November 1, 2001; 159(5): 1895 - 1904.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
T. Fujita, Y. Toya, K. Iwatsubo, T. Onda, K. Kimura, S. Umemura, and Y. Ishikawa
Accumulation of molecules involved in {alpha}1-adrenergic signal within caveolae: caveolin expression and the development of cardiac hypertrophy
Cardiovasc Res, September 1, 2001; 51(4): 709 - 716.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
A. Fiebeler, F. Schmidt, D. N. Muller, J.-K. Park, R. Dechend, M. Bieringer, E. Shagdarsuren, V. Breu, H. Haller, and F. C. Luft
Mineralocorticoid Receptor Affects AP-1 and Nuclear Factor-{{kappa}}B Activation in Angiotensin II-Induced Cardiac Injury
Hypertension, February 1, 2001; 37(2): 787 - 793.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
M. Mifune, H. Sasamura, R. Shimizu-Hirota, H. Miyazaki, and T. Saruta
Angiotensin II Type 2 Receptors Stimulate Collagen Synthesis in Cultured Vascular Smooth Muscle Cells
Hypertension, November 1, 2000; 36(5): 845 - 850.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Wang, X. Yu, R. A. Cohen, and P. Brecher
Distinct Effects of N-Acetylcysteine and Nitric Oxide on Angiotensin II-induced Epidermal Growth Factor Receptor Phosphorylation and Intracellular Ca2+ Levels
J. Biol. Chem., April 14, 2000; 275(16): 12223 - 12230.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
S. Kim and H. Iwao
Molecular and Cellular Mechanisms of Angiotensin II-Mediated Cardiovascular and Renal Diseases
Pharmacol. Rev., March 1, 2000; 52(1): 11 - 34.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Tamura, Y. E. Chen, M. Lopez-Ilasaca, L. Daviet, N. Tamura, T. Ishigami, M. Akishita, I. Takasaki, Y. Tokita, R. E. Pratt, et al.
Molecular Mechanism of Fibronectin Gene Activation by Cyclic Stretch in Vascular Smooth Muscle Cells
J. Biol. Chem., October 27, 2000; 275(44): 34619 - 34627.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, K.
Right arrow Articles by Umemura, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, K.
Right arrow Articles by Umemura, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement