Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rhodes, K.
Right arrow Articles by Oshima, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rhodes, K.
Right arrow Articles by Oshima, R. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 41, 26534-26542, October 9, 1998


A Regulatory Element of the Human Keratin 18 Gene with AP-1-dependent Promoter Activity*

Katherine RhodesDagger and Robert G. Oshima§

From The Burnham Institute, La Jolla, California 92037

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The human keratin 18 (K18) gene is expressed in a restricted but diverse subset of differentiated epithelial tissues and carcinomas. The 10-kilobase pair K18 gene contains all of the genetic information necessary for tissue-specific, copy number-dependent and integration site-independent expression in transgenic mice. We identified a 100-base pair regulatory element that activates the K18 proximal promoter in the presence of the previously identified first intron enhancer. Deletion of the element greatly diminished K18 expression. This regulatory element also has cryptic, AP-1-dependent promoter activity in the absence of the normal promoter, which results in 10-40-fold higher levels of K18 RNA expression in transgenic mice. The high activity of this cryptic promoter is dependent upon the first intron enhancer. These experiments define interactive regulatory regions of the K18 gene that modulate expression in diverse epithelial cell types and identify an unusual regulatory element with promoter activity that may be useful for high level heterologous gene expression in transgenic animals.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Keratin 18 (K18)1 is a type I keratin intermediate filament protein, which is first expressed at the eight-cell stage of mouse embryogenesis and then is restricted to the trophectodermal epithelium of the blastocyst stage mouse embryo. In adult organisms, K18 is restricted in expression to "simple" or single layered epithelia including intestine, lung, liver, breast, and uterus and is usually not found in skeletal muscle, heart, or lymphoid tissues such as spleen (1, 2). The persistent expression of K18 in cancers derived from such tissues, even when other differentiated functions diminish, is a useful diagnostic tool for carcinomas (3). The tissue-restricted expression of K18 is of particular interest because of the broad diversity of K18-positive epithelial cells.

In transgenic mice, the 10-kb K18 gene is expressed in an appropriate tissue-specific and copy number-dependent manner, independent of integration site (1, 4, 5). The 10-kb K18 gene contains sufficient genetic information for both qualitatively and quantitatively appropriate tissue-specific regulation. However, the same gene sequence is promiscuously expressed when transiently transfected into cultured cells that do not express the endogenous mouse K18 (6, 7). Accurate control of K18 gene regulation requires a normal developmental environment and a cis-acting mechanism of restriction apparently not active in transfected fibroblasts (8, 9).

Multiple regions of the K18 gene have been implicated in its regulation. The previously characterized 250-bp proximal promoter utilizes a TATA box for accurate initiation and multiple Sp1 binding sites and has been implicated in differential expression in certain tumor cells (6, 10). The first intron contains a 100-bp enhancer element with binding sites of the AP-1 and Ets transcription factors (11) and mediates increased expression by the Ras-mitogen-activated protein kinase signal transduction pathway (7). DNA methylation of a CpG dinucleotide in the Ets binding site of the first intron enhancer is correlated with the transcriptional silence of K18 in transgenic mice. Changing 2 bp of this Ets binding site, which abolishes its methylation potential but retains its enhancer activity, results in greatly elevated expression in normally nonpermissive tissues of transgenic mice (9). This alteration in the tissue-biased expression of transgenic K18 indicates that methylation of the Ets binding site within the first intron enhancer may be essential for initiating or maintaining the repressed state of the K18 gene.

The first intron also contains three silencer elements, which act primarily in undifferentiated stem cells (12). Furthermore, the sixth exon contains a complex regulatory element located within a coding portion of the gene that cooperates with the first intron enhancer to modulate K18 expression (13, 14). The 5'- and 3'-flanking regions of the gene are important for position-independent and copy number-dependent expression of the K18 gene (4, 5). These characteristics appear to be independent of the 250-bp proximal promoter, the first intron, and exon 6, because heterologous genes containing just the extreme flanking regions of the K18 gene acquire the properties of position-independent and copy number-dependent expression in transgenic mice (5, 15).

We have now confirmed the central importance of the first intron enhancer in vivo. In addition, we have identified an unusual new regulatory element upstream of the K18 250-bp proximal promoter region, which cooperates with the first intron enhancer. Surprisingly, this element can act as a promoter in the absence of the normal K18 proximal promoter, both in transgenic mice and in transfected cells. The activity of this promoter is abolished by mutagenesis of an AP-1/ATF binding site. Within the context of the remaining regulatory elements of the K18 gene, this cryptic promoter can result in an extremely high level of epithelial specific gene expression in transgenic mice.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Recombinant DNA Constructs

The K18 gene contained in plasmid pGC1853 was described previously (GenBankTM accession number M24842) (16). The transcriptional start site of K18 is bp 2537. pGC1853d47, used to make K18d47 mice, was also described previously (12). The K18dP1 vector represents a deletion of K18 bp 2286-2658. K18dP2 contains a substitution of GGCCTGCA in place of bp 1372-2658. K18dP3 and K18dP4 were derived from the previously described K18-TATA vector (12) by deleting sequences corresponding to K18 bp 1372-2496 and 2286-2496, respectively. The sequence TGCAGATC was left in place of the deletion of K18dP3. K18dP5 and K18dP7 were derived from K18-dB and K18-dAB, respectively (5), by deleting the sequences between the unique XhoI site and the XmaIII sites. K18dP6 represents a deletion of bp 2113-2658. K18dP1d47 was derived from pGC1853d47 (12) by digestion of pGC1853d47 with XhoI and XmaIII ligating the filled sites, resulting in a deletion from bp 2286-2658.

LsCAT was constructed from K18dP7. A 91-bp fragment (K18 bp 2191-2282) of the K18 gene (Fig. 2) was isolated from K18dP7 by digestion with BglII and XhoI, blunt-ended with mung bean nuclease (New England Biolabs), and cloned into a promoterless CAT expression vector, KOCATspa (11). LsCATE was made from LsCAT and XKCATE (12) by switching vector backbones using EcoRI and NotI sites present on both vectors. This results in a vector with both the 91-bp cryptic promoter and the 100-bp first intron enhancer fragment.

To generate the K18LL plasmid, a K18 fragment (bp 1457-2181) was amplified using two primers: K18-1429S (GGT GAT ATA CCG GTG TGC AGA AGT CAG) and XhoI-2180A (GCG CTC GAG CTT GAC CGG GCG CAG TGG). The amplified fragment was digested with NsiI and XhoI and cloned into pGC1853 cut with the same enzymes. The resulting K18LL plasmid contains a deletion of 87 bp (K18 bp 2199-2286) as well as a deletion between the two upstream NsiI sites (bp 1372-1457), sequences previously shown not to affect expression of the gene (4). K18LLd47 was constructed in the same way, utilizing pGC1853d47.

LsXKCAT and LaXKCAT-- A K18 fragment was amplified with two primers, XhoI-2189S (CCG CTC GAG CCG GTC AAG ACT CCC AAA) and XhoI-2288A (CGC CTC GAG CCT CGA GGC TGC TTT CAG). The XhoI product was ligated to the similarly digested XKCAT vector. The same procedure was used to construct LsXKCATE and LaXKCATE, except that the starting vector was XKCATE instead of XKCAT.

XKCATLs and XKCATLa-- A K18 fragment amplified with two primers, BamHI-2189S (CCG GGA TCC CCG GTC AAG ACT CCC AAA) and BamHI-2288A (CGC GGA TCC CCT CGA GGC TGC TTT CAG), was cut with BamHI and ligated to the similarly digested XKCAT vector. The same procedure was used to construct XKCATLsE and XKCATLaE, except that the starting vector was XKCATE instead of XKCAT.

The mutation in the AP-1/ATF binding motif was made using the Quik-Change site-directed mutagenesis kit (Stratagene). Oligonucleotides were used that changed the sequence from TAACGTCATTTCC to TAGATCTATTTCC. This change created a BglII restriction site, and mutagenesis was confirmed by digestion of the resulting plasmid with BglII and sequencing. The wild type and mutant sequences were analyzed using Transcription Element Search Software (TESS) from the Computation Biology and Informatics Laboratory at the University of Pennsylvania.2 The mutated sequence was not identified as a binding site for AP-1, ATF, or cAMP response element-binding protein by the same program. Transfections and CAT assays were performed as previously described (11, 13).

RNase Protection Assays

RNA was isolated from transfected cells with the use of the acidic phenol method (17). RNA was digested with RNase-free DNase I (Promega) to eliminate possible contaminating vector DNA (12, 18). RNase protection analysis was performed by standard methods (18). The RNA probe was transcribed in vitro from pK18EBrp, which contains the 470-bp EcoRI-BglII first exon fragment from pK187. This fragment was cloned into pBluescript (Stratagene), linearized with EcoRI, and transcribed with T7 RNA polymerase (Stratagene) to produce a radioactive 519-nucleotide probe. Total RNA was isolated from transgenic mouse organs by the guanidinium isothiocyanate-cesium chloride method (19) as described previously (1). The L32 ribosomal protein RNA was measured as described previously (14).

Primer Extension

An oligonucleotide complementary to the first exon (TGAAGCTGGTGGAGCGGGACACGGAGATCCGG) was labeled to a high specific activity (5 × 106 cpm/pmol) with T4 polynucleotide kinase (Amersham Pharmacia Biotech). 2 × 105 cpm of oligonucleotide was coprecipitated with indicated amounts of RNA or with 20 µg of tRNA as a carrier. The resulting pellet was dissolved in 20 µl of 80 mM Tris-HCl, pH 8.3, 80 mM KCl; incubated at 95 °C; and allowed to cool slowly to 67 °C. After incubation for 1 h at 44 °C, an equal volume of buffer containing first strand buffer (Life Technologies, Inc.); a 1 mM concentration each of dCTP, dATP, dTTP, and 7-deaza-dGTP; 1 unit/µl RNase Block (Stratagene); 0.1 µg/µl actinomycin D; 10 mM dithiothreitol; and 200 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) were added for each reaction. The samples were incubated for 1 h at 44 °C. The diluted samples were extracted with phenol/chloroform, ethanol-precipitated, and resolved on a 6% polyacrylamide gel containing 8 M urea. Radioactivity was detected by autoradiography or with a phosphor imager (Bio-Rad).

Transgenic Mice

K18dP1d47 and K18d47 transgenic mice were generated by injection of vector-free DNA fragments into the pronucleus of fertilized eggs of the FVB/N strain of mice by standard methods (20). The transgenic mice were produced by the Burnham Institute Mouse Genetics Shared Service and were identified by dot blot hybridization of tail DNA. Nucleic acid analysis was performed on F1 generation mice as described previously (1, 5, 13, 21). K18dP1 mice were produced by the same methods by the NICHD (National Institutes of Health) Transgenic Mouse Development Facility and DNX Inc. (Princeton, NJ). The founder animals were C57BL/6 × SJL F2 hybrids. Subsequent breeding was performed with the FVB/N strain of mice.

Electronic Image Presentation

Autoradiograph film exposures were digitized with the use of a flat bed scanner (HP ScanJet IIC) and Adobe Photoshop software. Quantitation of radioactivity was performed with a Bio-Rad phosphor imager.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A Cryptic Promoter Upstream of the K18 Promoter-- A deletion analysis of the K18 promoter region (Fig. 1A) was performed to identify a transcriptionally inactive K18 gene. Multiple constructs were transfected into HR9 parietal endodermal cells, which express endogenous mouse K18, and RNA was analyzed by RNase protection using probes for both the K18 and the co-transfected pMC1Neo gene (Fig. 1B). The Neo transcript protects 240 nucleotides of the Neo probe. K18 RNA containing all of the first exon protects 470 nucleotides of the K18 probe. Surprisingly, deletion of the entire 250-bp K18 proximal promoter region, including the TATA box, does not abolish transcription of the gene (Fig. 1A, dP1; Fig. 1B, lane 6). The K18dP1 construct yields a fragment of 338 nucleotides, corresponding to the size of the truncated exon 1. This suggests that there is a cryptic promoter upstream of the K18 promoter (designated the Lazarus promoter).


View larger version (44K):
[in this window]
[in a new window]
  		Fig. 1.   Defining the Lazarus promoter. Panel A, the structure of the seven recombinant constructs derived from the K18 gene. Only the 5' portion and first exons (filled box) of the gene are shown. The constructs are identical downstream of the indicated deletions. K18dP constructs are abbreviated dP due to space limitations. Open boxes with two dark stripes represent the Alu repetitive elements, with the position of the stripes indicating the A and B box promoter elements. Deleted sequences are indicated by thin lines joining the ends of the deleted region. In K18dP3 and K18dP4, the entire first exon and upstream sequence are present up to the TATA box, which is mutated to a BglII restriction site (B). In K18dP5, the B box in the first Alu element has been mutated to a BglII site. Otherwise, K18dP5 is identical to K18dP1. In K18dP6 and K18dP7, the region between and including the A and B boxes was deleted and replaced by a BglII site. K18dP6 and K18dP7 are identical, except that K18dP7 contains the 100 bp between the XhoI site and the A box. Other restriction sites are: XhoI (X), XmaIII (Xm), and NsiI (N). The probe used for RNase protection is indicated above the constructs. The probe is 519 bp long; it contains the entire first exon of the K18 gene and the transcribed polylinker sequence derived from the plasmid. The protected fragments in constructs with a full-size exon (470 bp) and a partially deleted exon (338 bp) are indicated. Plus and minus signs indicate the activity of each construct after transient transfection into L cells. Panel B, activity of the Lazarus constructs after transient transfection into L cells assayed by RNase protection. Lanes 1-3, K18 RNA transcribed in vitro is included as a size standard and for approximate quantitation of expression. Lane 4, RNA isolated from control L cells. Lanes 5-12, RNA isolated from L cells transiently transfected with the indicated constructs. Cells were co-transfected with pMC1Neo for normalization. Protected fragments derived from K18, K18dPl (dp), and Neo RNA are indicated on the right.

K18dP3 (Fig. 1A, dP3), which differs from K18dP1 by the inclusion of the region downstream of the TATA box (bp 2496-2658), had activity similar to that of K18dP1 (Fig. 1B, lane 8). The protected fragment size of K18dP3 is similar to wild type K18 because the 5'-end of exon 1 is included in the construct. Thus, the sequences downstream of the TATA box in the proximal promoter and the first 137 bp of exon 1 are not necessary for the activity of the Lazarus promoter. Transfection of constructs K18dP2, K18dP4, and K18dP6 did not result in detectable K18 RNA (Fig. 3B, lanes 7, 9, and 11). Thus, the 170 bp contained in K18dP1, but not in K18dP2, K18dP4, or K18dP6, is necessary for transcription from the Lazarus promoter.

Possible Interaction of the Lazarus Promoter and an Alu Promoter-- The close juxtaposition of the Lazarus promoter region and the oppositely oriented RNA polymerase III promoter of the proximal Alu sequence (Fig. 1A) prompted consideration of whether the A and B box elements of the Alu promoter (5) might influence the activity of the Lazarus promoter. To test this, K18dP5 and K18dP7 were constructed from two previously characterized mutant forms of K18 that contained either a mutation of the B box or a deletion of both the A and B boxes and the intervening sequences. Both of these mutations inactivated the polymerase III promoter (5). The deletion of the sequences between the A and B boxes in K18dP7 also removed several potential regulatory elements (Fig. 2). Both K18dP5 and K18dP7 were capable of expressing K18 RNA (Fig. 1B, lanes 10 and 12). However, K18dP5, in which the B box is mutated, was consistently more active than K18dP1, in which the Alu promoter would be expected to be active. An active Alu polymerase III promoter may be detrimental to optimal activity of the Lazarus promoter in transfected cells. The lower activity of K18dP7, which contains a deletion of the region between and including the A and B boxes, compared with K18dP5 and K18dP1 could reflect the use of the factor binding sites such as that for Sp1, located between the A and B boxes when the polymerase III promoter is inactive. Importantly, the results from K18dP7 indicate that the 100 bp region between the XhoI site and the A box element is necessary for the Lazarus promoter activity.


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 2.   A schematic map of the 5'-end of the K18dP1 gene and the sequence of the Lazarus promoter area. Exon 1 is shown as a large rectangle. The smaller rectangles with two bars indicate the two Alu sequences. Restriction enzyme sites are as follows: NsiI (N); XhoI (X); XmaIII (Xm). Sequence elements for the A and B box RNA polymerase III promoter elements, potential Sp1, PPAR, Lyf-1, TFIID, Ets, AP-1, ATF, and cAMP response element-binding protein transcription factor binding sites are indicated. Asterisks indicate conserved residues found in the same region of the mouse K18 gene. The positions of the five transcriptional start sites (Fig. 6) are marked by number and by short bars. The sequences deleted in the construct K18LL are overlined from position 2298 to 2282.

Sequence analysis of the Lazarus promoter region (Fig. 2) shows that there is no apparent similarity of the Lazarus promoter with the sequence of the K18 proximal promoter. However, potential binding sites for AP-1, ATF, Ets, and Sp1 transcription factors are found in the Lazarus promoter sequence. AP-1 factors are involved in the activation of the K18 gene through two other regulatory regions of the K18 gene (intron 1 and exon 6), Ets activates K18 through the enhancer in intron 1, and Sp1 acts on the proximal promoter (10).

The Lazarus Promoter Can Direct Expression of a Heterologous Gene and Is Dependent on the Presence of Consensus Binding Sequences for AP-1-- In order to determine whether the Lazarus promoter can drive expression of a heterologous gene and to determine the region sufficient for promoter activity, putative promoter fragments of between 100 and 2000 bp were placed upstream of a CAT reporter gene. The 100 bp just upstream of the deletion junction, including the transcription start sites but not the Alu sequences, were found to be sufficient for promoter activity in transient transfection of HR9 cells. Constructs containing longer fragments of 800 or 2000 bp had activity similar to or slightly lower than that of constructs containing only 100 bp (data not shown). Therefore, LsCAT (Fig. 3, construct 12), which contained only this fragment, was used in further experiments.


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 3.   Activity and activation of the Lazarus promoter attached to a heterologous gene. All constructs were derived from KOCATspa, which contains the CAT gene followed by the SV40 T-antigen intron and polyadenylation signals (11). Transfections were made into HR9 cells. Promoter sequences from the K18 promoter (XKCAT and XKCATE), the Lazarus promoter (LsCAT and LsCATE), or both (LsXKCAT through LsmAXKCATE) were introduced in front of or downstream of the CAT gene as indicated. Ls indicates that the Lazarus sequences were in the same orientation as found in the wild type K18 gene (as denoted by arrow direction). La indicates reverse orientation. mA indicates that the AP-1/ATF binding consensus sequence is mutated. The first intron enhancer (E) containing Ets and AP-1 binding sites was introduced downstream of the polyadenylation site in the constructs indicated. CAT activity normalized to beta -galactosidase activity is shown.

Lazarus promoter constructs were transiently transfected into HR9 cells (Fig. 3, lines 12-15). The Lazarus promoter was more active than the K18 proximal promoter (Fig. 3, constructs 1 and 12). The K18 promoter was further activated by the addition of the first intron enhancer, whereas the Lazarus promoter was not (Fig. 3, constructs 6 and 14). Mutating the AP-1/ATF binding element in the Lazarus promoter greatly reduced its activity (Fig. 3, constructs 13 and 15).

Regulatory Activity of the Lazarus Element-- We have not detected transcripts attributable to the Lazarus promoter when the K18 proximal promoter is present in any transgenic mouse line or tissue, by either RNase or S1 protection analysis (6, 11, 21). To determine if the Lazarus element has additional regulatory properties, it was tested in different positions and orientations in the presence of the normal K18 proximal promoter and the CAT reporter gene (Fig. 3, constructs 1-11) and with or without the intron enhancer (Fig. 3). The Lazarus regulatory element does not increase expression of the CAT gene driven by the K18 proximal promoter in the absence of the first intron enhancer (Fig. 3, constructs 2-5). However, when the 100-bp first intron enhancer is present, the addition of the Lazarus element upstream further increases CAT activity 2-3-fold (Fig. 3, constructs 7 and 8). When placed downstream of the CAT gene next to the enhancer (Fig. 3, constructs 9 and 10), the Lazarus element appeared neutral. Therefore, the Lazarus element acts as a positive regulatory element in the presence of the K18 first intron enhancer and in the position it is found in the K18 gene, upstream of the K18 proximal promoter. Mutation of the AP-1/ATF binding site of the Lazarus element decreases its enhancer activity modestly. The same mutation nearly eliminates promoter activity of the Lazarus element. Additional experiments confirmed that this mutation abolished AP-1 binding, as indicated by oligonucleotide mobility shift experiments with purified c-Jun and c-Fos or with liver nuclear extracts (data not shown).

The Lazarus Element Is Important for K18 Gene Expression-- To evaluate the potential importance of the Lazarus element to K18 expression within the context of the multiple regulatory elements of the whole gene, the Lazarus element was deleted from the K18 gene and tested by transfection analysis (Fig. 4A). In K18LL, only the 87 bp of the Lazarus promoter were deleted, leaving the K18 proximal promoter and the Alu element upstream intact. In K18LLd47, the inactivating deletion of the first intron enhancer was included. The results of transient transfection analysis of HR9 cells are shown in Fig. 4B. The protected fragments from lanes 9, 11, 13, 15, 17, and 19 were quantitated by phosphor imager analysis, and the results are shown in Fig. 4C. Alternative lanes (Fig. 4B, lanes 10, 12, 14, 16, 18, and 20) confirm that additional Ets2 and AP-1 do not result in higher expression, presumably because the activities of these two transcription factor families are not limiting in these cells (14). Deletion of the intron enhancer element reduced the expression of K18 and K18dP1 by 62 and 56%, respectively (Fig. 4C, K18d47 and K18dP1d47). The deletion of the Lazarus element alone (K18LL) reduces the expression of the K18 gene by 64%, to a level equivalent to that seen when the first intron enhancer alone is deleted. This reinforces the view that the Lazarus element has a positive regulatory function. Deletion of both the Lazarus element and the first intron enhancer decreases expression 81%. These results confirm that both the Lazarus element and the intron enhancer contribute significantly to the expression of the K18 gene in differentiated endodermal cells.


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 4.   Activity of the Lazarus sequences as a regulatory element. A, K18 constructs. The K18 gene consists of seven exons (black filled boxes), 2.5 kb of 5'-flanking sequence, and 3.6 kb of 3'-flanking sequence (6, 16). Two Alu elements reside upstream of the K18 promoter (gray filled boxes). In the construct K18d47, 54 bp of the first intron were deleted, removing all 47 conserved base pairs and the Ets and AP-1 binding sites. In construct K18dP1, the sequences between the XhoI and XmaIII sites were deleted, removing the K18 proximal promoter elements, including the TATA box and transcription start site. In K18dP1d47, both the K18 proximal promoter elements and the first intron enhancer are deleted. In K18LL, 100 bp upstream of the K18 proximal promoter were deleted (see "Materials and Methods" and Fig. 2). In K18LLd47, both the upstream sequences and the first intron enhancer were deleted. B, RNase protection assay of RNA isolated from transient transfected HR9 cells. Lane 1, size marker pBR322 cut with restriction enzyme HaeIII. Lane 2, undigested probes for K18 and Neo were described in Fig. 3. Lanes 3-7, synthetic K18 RNA (syn K18) is included as a size standard and for the approximate quantitation of expression. Lane 8, tRNA control. Lanes 9, 11, 13, 15, 17, and 19 contain RNA from cells transfected with the six indicated constructs. Lanes 10, 12, 14, 16, 18, and 20 contain RNA from cells transfected with the six indicated constructs and additional expression vectors for Ets2 and/or c-Jun as indicated. C, relative RNA expression from transfected HR9 cells after normalization to the co-transfected Neo signal.

K18d47 Transgenic Mice-- The importance of the intron enhancer had not been tested in vivo; therefore, a construct in which 54 base pairs of the 100-bp enhancer region were deleted (including all 47 base pairs that are conserved between the mouse and human genes) (12) (Fig. 4A) was used to generate three new transgenic mouse strains. This deletion completely inactivated the enhancer in transfection experiments (11). All three strains transmitted the gene to offspring. Southern blot analysis confirmed the presence of the 54-bp deletion and was used to estimate copy number (data not shown; Table I). All three mouse lines integrated the construct in the normal head to tail array without apparent rearrangements (data not shown). RNase protection and analysis of RNA isolated from each strain was used to determine expression levels of the gene in eight different organs or tissues that have been extensively analyzed for normal K18 expression (1, 4). Northern blot analysis detected the expected length of the mRNAs, confirming previous findings that the intron deletion did not lead to major alterations in splicing (data not shown). All three strains of K18d47 mice showed greatly reduced expression of K18 in normally permissive liver, kidney, and intestine. However, the levels of K18 RNA were still proportional to the copy number of each construction, which varied between 6 and 66 genes/cell. Thus, the inactivation of the enhancer decreased expression of K18 but did not abolish its copy number dependence. Levels of K18 expression in all organs except kidney were less than 2 pg of K18 RNA/10 µg of RNA/gene. In normally nonpermissive tissues such as spleen, heart, and muscle, levels of K18d47 RNA were near the limits of detection by RNase protection. The average level of expression of K18 and K18d47 RNA are compared in Fig. 5A. The deletion of the enhancer resulted in a decrease of between 45 and 85% in permissive tissues. Expression in liver was influenced most, and kidney was least affected.

                              
View this table:
[in this window]
[in a new window]
 
Table I
K18 expression in transgenic mice


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 5.   Summary of average transgenic RNA expression from K18, K18d47, K18dP1, and K18dP1d47. A, comparison of the average expression of K18 RNA (pg of K18 RNA/10 µg of total RNA/gene) for K18 and K18d47 transgenic mice. B, comparison of the average expression of K18 RNA per gene (pg of K18 RNA/10 µg of total RNA/gene) for K18dP1 and K18dP1d47.

K18dP1 and K18dP1d47 Transgenic Mice-- K18dP1 and K18dP1d47 transgenic mice were analyzed as well. Two of three transgenic mice generated from the injection of K18dP1 DNA into mouse embryos transmitted the gene through subsequent breeding and were analyzed in detail. The third line did not transmit the transgene in the first litter and was presumed to be mosaic due to DNA integration after the first cell division. All K18dP1 and K18dP1d47 mice integrated the constructs in the normal head to tail array without apparent rearrangements (data not shown). Surprisingly, K18 RNA expression from both K18dP1 lines of mice was particularly high (Fig. 5B, Table I). Since the two lines were independently derived, the abnormally high expression probably was not due to a fortuitous integration event. None of the 47 previous transgenic mouse lines derived from the K18 gene have expressed the K18 gene at levels approaching these K18dP1 mice (4, 5, 21). Expression per K18dP1 gene was 10-30-fold higher than wild type K18 in simple epithelial tissues (Fig. 5B, Table I). Combined with the number of gene copies integrated in the two strains of mice (25 and 31 copies/cell), efficient expression of the K18dP1 genes led to levels of K18 RNA that approached 3% of total mRNA in liver and kidney (6 ng of K18 RNA/10 µg of total RNA). Expression was also elevated in heart and detectable in spleen and muscle (Table I). However, expression in spleen and muscle was less than 1% of that found in liver. Therefore, the K18dP1 gene maintains the tissue-biased expression of the K18 gene, but levels of expressed RNA are elevated in all tissues.

RNA from two independent K18dP1d47 mouse lines were 20-50-fold lower than K18dP1 in all tissues (Table I). Thus, the intron enhancer is essential for the high level expression of the K18dP1 gene. A comparison of K18dP1 and K18dP1d47 is shown in Fig. 5B. Very low levels of RNA were detected (less than 1 pg/10 µg of RNA/gene) in heart, spleen, or muscle. Thus, the tissue-specific profile of expression of K18dP1d47 still resembles that found for K18, although the absolute level of expression was much lower. The first intron enhancer element is necessary for elevated but not basal expression.

Staggered Start Sites of the Lazarus Promoter-- A primer from the K18 first exon was used to map the start site of the RNA transcripts from K18dP1 transgenic liver by the method of primer extension. Instead of a predominant single initiation site for K18 RNA, five start sites approximately 10 bp apart were detected in the K18dP1 RNA (Figs. 2 and 6). The smaller size of the primer extension products, relative to K18, reflects the partial deletion of exon 1. The sum of the RNA transcripts from all five start sites of the K18dP1 promoter were consistent with the elevated levels of K18dP1 RNA detected by RNase protection. The five start sites cluster around the deletion junction in a region rich in potential transcription factor binding sites (Fig. 2).


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 6.   Mapping the start sites of the Lazarus promoter by primer extension. Lane 2, control primer reaction without RNA. Lane 3, RNA transcribed in vitro from BSpMC1rp, a plasmid containing the neomycin resistance gene driven by a T7 promoter, was primed with an oligonucleotide that hybridizes 249 bp from its transcription start site and was included as a size standard and as an internal experimental control. Lane 4, K18 RNA (K) transcribed in vitro from a K18 riboprobe vector was used as a size standard and internal control. The K18 primer generates a longer product with the synthetic K18 transcripts because of the additional polylinker sequences. Lanes 5 and 6, RNA isolated from the liver of a transgenic mouse carrying the entire K18 gene (K18-TG2). The primer hybridizes to sequences 210 bp downstream from the K18 RNA start site. Lanes 7-9, RNA isolated from the livers of two transgenic mice carrying the K18dP1 construct. The five start sites are indicated at the right. Lane 1, pBR322 vector cut with MspI and labeled as a size marker.

One possible explanation for the high level of RNA transcripts detected from the K18dP1 construct in transgenic mice is decreased RNA turnover (22-24). Increased RNA turnover contributes to the low level of expression of a 4-bp insertion mutation of exon 6 of K18 (14). However, analysis of K18 RNA expressed from transiently transfected cells treated with actinomycin D revealed that the wild type K18 RNA is very stable, with little turnover detected up to 4 h after drug treatment (14) (additional data not shown). Thus, it is unlikely that the K18dP1 RNA is significantly more stable than wild type K18 RNA.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have discovered a novel regulatory element upstream of the K18 proximal promoter that cooperates with the first intron enhancer. Surprisingly, this element is capable of driving very high expression of the K18 gene in the absence of the K18 proximal promoter sequences in transgenic mice. In addition, we have confirmed that a complex 100-bp enhancer in the first intron is central for efficient expression of the gene in transgenic mice.

The Regulatory Activity of the Lazarus Element-- Deletion of the Lazarus element reduces the activity of the K18 gene in transfected cells by 64%. Reciprocally, the Lazarus element increased activity of the K18 promoter in transfection analysis, but only in the presence of the first intron enhancer. This cooperative characteristic is shared with an additional element within exon 6 (14). The Lazarus element, the intron enhancer, and exon 6 contain confirmed binding sites for AP-1. However, the Lazarus AP-1 binding site is of the cAMP response element type possibly capable of binding factors of the ATF family as well as heterodimers of AP-1/ATF (25, 26). The enhancing activity of the Lazarus sequences in the presence of the first intron enhancer is only modestly decreased when the AP-1/ATF binding sequence is mutated, in contrast to its promoter activity, which is nearly abolished. The paradoxical resistance of the enhancer activity of the Lazarus element to the AP-1/ATF mutation probably reflects the cooperation of additional transcription factors bound to the Lazarus element with factors bound to the first intron and exon 6 and their interaction with the TATA box promoter. Apparently the Lazarus promoter activity is dependent upon proximal AP-1/ATF factors, while the enhancer activity is not. The Lazarus element, in coordination with the first intron region and exon 6, provides multiple opportunities for activating K18 transcription in diverse tissues. However, the large number of AP-1 and ATF members, the possible heterodimers between the two families, and the well known cooperation between AP-1/ATF and other activators makes it extremely difficult to predict what transcription factors may successfully compete to occupy these sites and cooperate in vivo.

The Promoter Activity of the Lazarus Element-- While there are a number of examples of cryptic promoters, most appear to function in expressing an alternative product of the specific gene (27-32). However, results of S1 nuclease and RNase protection analysis of the RNA of human cells (11), transfected mouse cells (6), and transgenic mice (21) indicate that levels of Lazarus promoter-initiated RNA could not represent more than a small percentage of the normal K18 signal. Thus, the Lazarus regulatory element does not appear to act as a promoter in the presence of the normal proximal promoter in either transgenic mice or transfected cultured cells.

The K18 proximal promoter is essential for designating the correct position of initiation necessary to generate an mRNA that is translated efficiently. Given the existence of housekeeping promoters that lack TATA boxes, it is perhaps not surprising that transcription could be initiated near an element potentially capable of binding multiple transcription factors, some of which have been implicated in non-TATA box initiation (33). Other examples of promoters that are very active in transgenic mice but only modestly active in transfection analysis have been reported; one example is the H2k mouse major histocompatibility antigen promoter (34). However, if the Lazarus promoter is as active or more active than the normal promoter, why is its promoter activity suppressed in the presence of the TATA promoter? In the case of the K18 gene, the fidelity of the RNA start is particularly important, because RNAs initiated by the Lazarus promoter on the wild type gene would produce RNAs with an ATG in an inappropriate reading frame. The dual role of the TATA box may be to fix the transcriptional initiation site and suppress the potential promoter activity of the Lazarus element by recruiting it to the TATA box transcription complex as a positive regulatory component. Support for the existence of two different complexes on the Lazarus element, one with initiation activity and one with positive regulatory activity, is provided by the differential effect of the AP-1/ATF mutation of the Lazarus element.

Why is the K18dP1 gene expressed much better in transgenic mice than in transfection experiments? The basal transcription complexes of different promoters can contain different components (35). Also, basal complex formation in the absence of TATA binding protein has been reported for promoters that lack a TATA box (36), so it is possible that the Lazarus promoter may not be limited by the same factors as the normal proximal promoter. Alternatively or additionally, high activity of the K18dP1 transgene may reflect its close proximity to K18 sequences responsible for protection against position effects (5, 15). Recent results indicate that the Lazarus element is not required for protection of a heterologous transgene from position effects in transgenic mice.3 However, sequences immediately upstream of the Lazarus element retain protective characteristics for transgenes. Perhaps the close proximity of the Lazarus promoter to the protective effects of the upstream cis-acting elements provides an unusually permissive chromatin environment not provided to the TATA promoter several hundred bp downstream. This would provide a possible explanation for the dramatic difference seen in transgenic mice and transfected cells. Clearly, transient expression in transfection experiments does not accurately reflect the activity of K18 constructions in vivo.

Regardless of the complexities of multiple related transcription factors and multiple regulatory elements, the extraordinary level of expression of the K18dP1 gene in transgenic mice and the retention of differential expression may be of value in obtaining high level expression in epithelial tissues in either transgenic or gene therapy applications.

The First Intron Enhancer-- Here we have shown that deletion of the first intron enhancer reduces expression of the K18 gene in normally permissive tissues in transgenic mice and greatly decreases but does not abolish activity in transfection experiments. The K18 first intron element has been shown to bind AP-1 and Ets and to facilitate Ras responsiveness of the gene (7, 8). However, AP-1 and Ets activities are well documented in tissues that express K18 poorly (37-40). Both factors represent families of multiple individual gene products that may vary greatly in composition, concentration, and activity. It is likely that the abundance and activity of specific members of individual transcription factor families influence the level of K18 transcription in vivo. However, it is now clear that the same gene may be limited by different transcription factors in different tissues. For example, the targeted mutation of mouse Ets2 limits the expression of certain matrix metalloproteases but only in particular tissues (41). Ets factors are probably important for mouse K18 expression in early development (12), but mouse K18 expression is unaffected in adult Ets2-deficient mice (41). The methylation of the Ets site in the first intron enhancer appears to play a pivotal role in the determination of whether the gene is active (9). The importance of a repressive mechanism for tissue-biased expression is indicated by the promiscuous expression of K18 when transfected directly into nonepithelial cell types that do not express the endogenous K18 gene (6) and by the failure to activate silent K18 alleles in somatic cell hybrids of fibroblastic and epithelial cells (8). Thus, the first intron enhancer appears to be pivotal for modulating the activity in permissive tissues by interaction with the Lazarus element, exon 6, and the proximal promoter and for restricting expression by a methylation-dependent mechanism in at least some nonpermissive tissues.

    ACKNOWLEDGEMENTS

We thank Jacqueline Avis of The Burnham Institute Transgenic Mouse Facility for expert assistance in generating transgenic mice. We thank Roumen Pankov for constructing pK18dP1 and Grace Ceceña for expert technical assistance.

    FOOTNOTES

* This work was supported by NCI, National Institutes of Health (NIH), Grant 5 R01 CA42302 and Cancer Center Support Grant 5 P30 CA30199. K18dP1 mice were produced by DNX Inc. under NICHD (NIH) Contract NO1 HD-0-2911.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by NIH Postdoctoral Fellowship 1 F32 CA66305.

§ To whom correspondence should be addressed: The Burnham Institute, 10901 North Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-455-6480; Fax: 619-646-3193; E-mail: rgoshima{at}ljcrf.edu.

The abbreviations used are: K18, keratin 18; kb, kilobase pair(s); CAT, chloramphenicol acetyltransferase; bp, base pair(s).

2 Available on the World Wide Web at http://agave.humgen.upenn.edu/utess/tess32.

3 D. Willoughby and R. G. Oshima, unpublished results.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

  1. Abe, M., and Oshima, R. G. (1990) J. Cell Biol. 111, 1197-1206[Abstract/Free Full Text]
  2. Moll, R., Franke, W. W., Schiller, D. L., Geiger, B., and Krepler, R. (1982) Cell 31, 11-24[CrossRef][Medline] [Order article via Infotrieve]
  3. Oshima, R. G., Baribault, H., and Caulin, C. (1996) Cancer Metastasis Rev. 15, 445-471[CrossRef][Medline] [Order article via Infotrieve]
  4. Neznanov, N., Thorey, I. S., Ceceña, G., and Oshima, R. G. (1993) Mol. Cell. Biol. 13, 2214-2223[Abstract/Free Full Text]
  5. Thorey, I. S., Ceceña, G., Reynolds, W., and Oshima, R. G. (1993) Mol. Cell. Biol. 13, 6742-6751[Abstract/Free Full Text]
  6. Kulesh, D. A., and Oshima, R. G. (1988) Mol. Cell. Biol. 8, 1540-1550[Abstract/Free Full Text]
  7. Pankov, R., Umezawa, A., Maki, R., Der, C. J., Hauser, C. A., and Oshima, R. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 873-877[Abstract/Free Full Text]
  8. Oshima, R. G., Trevor, K., Shevinsky, L. H., Ryder, O. A., and Ceceña, G. (1988) Genes Dev. 2, 505-516[Abstract/Free Full Text]
  9. Umezawa, A., Yamamoto, H., Rhodes, K., Klemsz, M. J., Maki, R. A., and Oshima, R. G. (1997) Mol. Cell. Biol. 17, 4885-4894[Abstract]
  10. Gunther, M., Frebourg, T., Laithier, M., Fossar, N., Bouziane-Ouartini, M., Lavialle, C., and Brison, O. (1995) Mol. Cell. Biol. 15, 2490-2499[Abstract]
  11. Oshima, R. G., Abrams, L., and Kulesh, D. (1990) Genes Dev. 4, 835-848[Abstract/Free Full Text]
  12. Pankov, R., Neznanov, N., Umezawa, A., and Oshima, R. G. (1994) Mol. Cell. Biol. 14, 7744-7757[Abstract/Free Full Text]
  13. Neznanov, N. S., and Oshima, R. G. (1993) Mol. Cell. Biol. 13, 1815-1823[Abstract/Free Full Text]
  14. Neznanov, N., Umezawa, A., and Oshima, R. G. (1997) J. Biol. Chem. 272, 27549-27557[Abstract/Free Full Text]
  15. Neznanov, N., Kohwi-Shigematsu, T., and Oshima, R. G. (1996) Mol. Biol. Cell. 7, 541-554[Abstract]
  16. Kulesh, D. A., and Oshima, R. G. (1989) Genomics 4, 339-346[CrossRef][Medline] [Order article via Infotrieve]
  17. Chomczynski, P., and Sacchi, N. (1997) Anal. Biochem. 162, 156-159[CrossRef]
  18. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, pp. 71-78, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  19. Turpen, T. H., and Griffith, O. M. (1986) BioTechniques 4, 11-15
  20. Hogan, B., Constantini, F., and Lacy, E. (1987) Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  21. Thorey, I. S., Meneses, J., Neznanov, N., Kulesh, D., Pedersen, R., and Oshima, R. G. (1993) Dev. Biol. 160, 519-534[CrossRef][Medline] [Order article via Infotrieve]
  22. Beelman, C. A., and Parker, R. (1995) Cell 81, 179-183[CrossRef][Medline] [Order article via Infotrieve]
  23. Pachter, J. S., Yen, T. J., and Cleveland, D. W. (1987) Cell 51, 283-292[CrossRef][Medline] [Order article via Infotrieve]
  24. Hagan, K. W., Ruiz-Echevarria, M. J., Quan, Y., and Peltz, S. W. (1995) Mol. Cell. Biol. 15, 809-823[Abstract]
  25. Hai, T., and Curran, T. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3720-3724[Abstract/Free Full Text]
  26. Hsu, J., Laz, T., Mohn, K., and Taub, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3511-3515[Abstract/Free Full Text]
  27. Tee, M. K., Babalola, G. O., Aza-Blanc, P., Speek, M., Gitelman, S. E., and Miller, W. L. (1995) Hum. Mol. Genet. 4, 2109-2116[Abstract/Free Full Text]
  28. Mullick, J., Addya, S., Sucharov, C., and Avadhani, N. G. (1995) Biochemistry 34, 13729-13742[CrossRef][Medline] [Order article via Infotrieve]
  29. Lepage, P., Underhill, D. A., and Gros, P. (1995) Virology 210, 244-253[CrossRef][Medline] [Order article via Infotrieve]
  30. Fourel, G., Transy, C., Tennant, B. C., and Buendia, M. A. (1992) Mol. Cell. Biol. 12, 5336-5344[Abstract/Free Full Text]
  31. Irniger, S., Egli, C. M., Kuenzler, M., and Braus, G. H. (1992) Nucleic Acids Res. 20, 4733-4739[Abstract/Free Full Text]
  32. Al-Shawi, R., Burke, J., Wallace, H., Jones, C., Harrison, S., Buxton, D., Maley, S., Chandley, A., and Bishop, J. O. (1991) Mol. Cell. Biol. 11, 4207-4216[Abstract/Free Full Text]
  33. Ghysdael, J., and Boureux, A. (1997) in Oncogenes as Transcriptional Regulators (Yaniv, B., and Ghysdael, J., eds), pp. 29-80, Verlag, Basel, Switzerland
  34. Morello, D., Moore, G., Salmon, A. M., Yaniv, M., and Babinet, C. (1997) EMBO J. 5, 1877-1883[Medline] [Order article via Infotrieve]
  35. Hansen, S. K., Takada, S., Jacobs, R. H., Lis, J. T., and Tjian, R. (1998) Cell 91, 71-83
  36. Wieczorek, E., Brand, M., Jacq, X., and Tora, L. (1998) Nature 393, 187-191[CrossRef][Medline] [Order article via Infotrieve]
  37. Rincon, M., and Flavell, R. A. (1994) EMBO J. 13, 4370-4381[Medline] [Order article via Infotrieve]
  38. Wasylyk, B., Hahn, S. L., and Giovane, A. (1993) Eur. J. Biochem. 211, 7-18[Medline] [Order article via Infotrieve]
  39. Osbaldeston, N. J., Lee, D. M., Cox, V. M., Hesketh, J. E., Morrison, J. F., Blair, G. E., and Goldspink, D. F. (1995) Biochem. J. 308, 465-471
  40. Taylor, J. M., Davies, J. D., and Peterson, C. A. (1995) J. Biol. Chem. 270, 2535-2540[Abstract/Free Full Text]
  41. Yamamoto, H., Flannery, M. L., Kupriyanov, S., Pearce, J., McKercher, S., Henkel, G. W., Maki, R. A., Werb, Z., and Oshima, R. G. (1998) Genes Dev. 12, 1315-1326[Abstract/Free Full Text]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Neurosci.Home page
T. E. Uveges, Y. Shan, B. E. Kramer, D. C. Wight, and L. M. Parysek
Intron 1 Is Required for Cell Type-Specific, But Not Injury-Responsive, Peripherin Gene Expression
J. Neurosci., September 15, 2002; 22(18): 7959 - 7967.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. E. Rutberg, T. L. Adams, A. Glick, M. T. Bonovich, C. Vinson, and S. H. Yuspa
Activator Protein 1 Transcription Factors Are Fundamental to v-rasHa-induced Changes in Gene Expression in Neoplastic Keratinocytes
Cancer Res., November 1, 2000; 60(22): 6332 - 6338.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
D. A. Willoughby, A. Vilalta, and R. G. Oshima
An Alu Element from the K18 Gene Confers Position-independent Expression in Transgenic Mice
J. Biol. Chem., January 14, 2000; 275(2): 759 - 768.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rhodes, K.
Right arrow Articles by Oshima, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rhodes, K.
Right arrow Articles by Oshima, R. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement