INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The first differentiation event in mammalian development gives rise to the trophectoderm, which in turn initiates implantation and undergoes regional differentiation to generate different trophoblast cells (1, 2). Trophoblast cells are a group of specialized extra-embryonic cells that play a leading role in the implantation and placentation processes (3, 4). They express metalloproteinases to invade the maternal deciduum, secrete hormones to coordinate pregnancy, form a barrier to prevent immune response from the mother, and provide the embryo access to the maternal blood circulation. These diverse functions are achieved by different subsets of trophoblast cells during development. In the mouse placenta, there are at least three terminally differentiated trophoblast cell types, trophoblast giant cells lining the maternal fetal interface, spongiotrophoblast cells of the junctional zone, and syncytiotrophoblast cells of the labyrinthine zone (5, 6). In humans, abnormalities in trophoblast cells are often associated with pregnancy-related diseases, causing severe consequences to both the mother and the fetus (7). Identification and elucidation of genes that play a primary role in the regulation of placenta-specific gene expression is fundamental to understanding the development of the placenta and its associated diseases.

Adenosine deaminase (ADA)¹ is a purine metabolic enzyme that is enriched in trophoblast cells of the mouse placenta and is essential for proper fetal development (8). Studies in ADA-deficient mice have demonstrated that the absence of ADA in the trophoblast cells is associated with perinatal lethality (9, 10). Furthermore, genetically restoring ADA specifically to trophoblast cells rescued ADA-deficient fetuses from perinatal lethality, verifying the importance of trophoblast ADA for normal fetal development (11, 12). Ada expression in the placenta is under stringent control during trophoblast differentiation (13-15). ADA is first seen in the primary trophoblast giant cells surrounding the gestation site and diploid cells in the ectoplacental cone. Subsequently, the level of Ada expression increases as the diploid trophoblast cells grow and differentiate. In the mature placenta, ADA is enriched in all trophoblast cells with highest level of expression found in the spongiotrophoblast cells of the junctional zone. The expression pattern and functional importance of ADA in the placenta make it a good model to identify transcription factors important in trophoblast gene expression.

The temporal and spatial information for Ada expression in trophoblast cells resides in a 770-bp sequence located 5.4 kilobase pairs upstream of the Ada transcription start site (16, 17). Within this region, there are binding sites for transcription factors including bHLH and GATA factors. Recently, two bHLH factors, Mash-2 and Hand1, have been identified in the mouse placenta (18, 19). Mash-2 is essential for development of spongiotrophoblast cells (20, 21), whereas Hand1 promotes trophoblast differentiation in vitro and is important for trophoblast giant cell formation in the mouse placenta (19, 22, 23). In addition, GATA-2 and GATA-3 are involved in the regulation of the mouse placental lactogen I and the human chorionic gonadotropin gene expression in trophoblast cells (24-26). Possible involvement of bHLH and GATA factors in the regulation of Ada expression in trophoblast cells was supported by deletion and mutational analysis (17). Meanwhile, DNase I footprinting of the 770-bp placental regulatory element revealed three protein-binding regions, one of which was placenta-specific. Here we report a detailed analysis of the placenta-specific footprinting region (FP1), and we provide biochemical and genetic evidence that an AP-2 transcription factor regulates Ada expression in the placenta through its interaction with FP1. Furthermore, we find AP-2 is the most abundant AP-2 factor in the placenta. The expression pattern of AP-2 during placental development suggests that AP-2 may be an important member in the transcription factor cascade that controls trophoblast differentiation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Plasmids-- DNA fragments containing FP1 were amplified by polymerase chain reaction from the plasmid p0.77PCAT using the following primers, CTATGGATCCGAGGAAACAGCGGCTCT and AGCTGCAGAGTACAGATGGTC. The polymerase chain reaction products were cut by BamHI and PstI and subcloned into Bluescript KS vectors (Stratagene) resulting in pFP1. The nucleotide sequence of pFP1 was confirmed by sequence analysis using the Sequenase 2.0 kit (U.S. Biochemical Corp.). Plasmids pAP-2 and pAP-2 were generated by subcloning AP-2 and  cDNAs into EcoRI and HindIII sites of Bluescript KS II vectors. Plasmid pAP-2 (pAP-2.2) contained AP-2 cDNA at the EcoRI site of Bluescript SK vector.

Nuclear Extract Preparation and DNase I Footprinting-- Nuclear extracts were prepared from placentas and adult livers of mid-gestation ICR mice as described (17). For DNase I footprinting, pFP1 was cut with either BamHI or EcoRI. After dephosphorylation, DNA was digested with either EcoRI or BamHI and purified from agarose gels. The fragments were end-labeled by T4 polynucleotide kinase using [-³²P]ATP. Equal amounts of radioactive probes were used in footprinting as described (17). The same probes were used to generate G/A ladders by the Maxam-Gilbert chemical degradation method (27).

Electrophoretic Mobility Shift Assay (EMSA) and Supershift Analysis-- 10 µg of nuclear extracts in 20-µl binding reactions (20 mM HEPES, pH 7.9, 100 mM KCl, 10% glycerol, 0.2 mM EDTA, 0.5 mM dithiothreitol, 2 µg of poly(dI-dC), and 5000 cpm of ³²P-labeled FP1 probes) were incubated with or without unlabeled competitor oligonucleotides as indicated for 30 min at room temperature. The binding mixtures were resolved on nondenaturing 5% polyacrylamide gels containing 5% glycerol in 0.5× TBE (45 mM Tris borate, 1 mM EDTA). For AP-2 supershift assays, 1 µg of polyclonal AP-2 antibody (Santa Cruz Biotechnology) or preimmune sera were added in the binding reactions and incubated at 4 °C for 2 h before electrophoresis.

Site-directed Mutagenesis and Transgenic Mouse Analysis-- An AP-2 motif mutant was generated using the Muta-Gene phagemid in vitro mutagenesis system (Bio-Rad) with a plasmid containing the 770-bp Ada placental regulatory element serving as the template. The mutagenic oligonucleotide was GTGGCCTCAGACAAGCCC. The mutation was confirmed by sequence analysis before subcloned into pPCAT (17) as pAP-2mPCAT. The AP-2mPCAT construct was purified from the vector sequence and introduced into FVB/N zygotes according to established protocols. After 2 weeks, protein extracts were prepared from placentas and embryos of the resulting transgenic mice, and CAT activities were measured as described (17).

RNase Protection Assay-- Total RNA was isolated from placentas and embryos of ICR mice at gestational day 14.5 using TRIzol reagent according to manufacturer's instructions (Life Technologies, Inc.). 50 µg of RNA was hybridized to 3 × 10⁶ cpm ³²P-labeled riboprobes in 15 µl of hybridization buffer (80% formamide, 0.2 M NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA) overnight at 47 °C. After RNase treatment, RNA samples were separated on 6% polyacrylamide gels (12).

Northern Blot Analysis-- Pregnant ICR female mice were sacrificed at gestational day 14.5, and various tissues were collected. Total RNA was isolated using TRIzol reagent (Life Technologies, Inc.). 30 µg of RNA was loaded per lane on 1% agarose-formaldehyde gels and transferred onto MAGANA membranes (MSI). Equal loading was verified by the intensity of ethidium bromide staining of ribosomal RNA. The probe for AP-2 was generated using a random primed DNA labeling kit (Boehringer Mannheim).

In Situ Hybridization-- Embryos together with their extra-embryonic tissues (gestational sites) were isolated from pregnant ICR females at different gestational stages and fixed in 4% paraformaldehyde at 4 °C overnight. After dehydration and clearing, gestational sites were embedded in paraffin, and sections were collected for in situ hybridization (17). -³⁵S-UTP-labeled AP-2 sense and antisense riboprobes were generated by T7 and T3 RNA polymerase-directed synthesis from the same DNA fragments used for RNase protection. The sections were hybridized at 60 °C overnight and washed at high stringency. The slides were coated with Kodak NTB-2 emulsion and exposed for 2 days at room temperature. After development, the slides were stained with Hoechst 33258 to identify nuclei. The slides were viewed using an Olympus BX60 fluorescent microscope equipped with dark-field optics with a red filter and photographed using a SPOT digital camera (Diagnostics).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

An AP-2-binding Site Resides at the Center of the Placenta-specific Footprinting Region FP1-- We have previously shown that Ada expression in the murine placenta is controlled by a 770-bp sequence 5.4 kilobase pairs upstream of the Ada transcription start site (17). Within this region, we identified an essential placenta-specific footprinting region, termed FP1. To delineate precisely the DNA sequence that interacts with the protein(s) present in mouse placenta nuclear extracts, we subcloned an 80-bp fragment encompassing FP1 and used it as a template for high resolution DNase I footprinting (Fig. 1A). This 80-bp fragment was ³²P-labeled at the 5' end of either the sense strand (left) or the antisense strand (right). In the presence of placenta nuclear extracts (Pla lane) but not liver nuclear extracts (Liv lane), FP1 was clearly protected from DNase I digestion when compared with probe alone (P lane). The sequence of FP1 read from both strands (G/A lane) revealed that about 20 nucleotides were protected in each strand with a 12-bp overlap. Sequence analysis of FP1 revealed that the overlapping sequence contained an AP-2 transcription factor-binding site, suggesting that an AP-2 transcription factor may interact with FP1 (Fig. 1B).

View larger version (52K): [in this window] [in a new window]   Fig. 1.   Interaction between proteins in mouse placenta nuclear extracts and the FP1 fragment. A, sequence motif of FP1 identified by DNase I footprinting. 80-bp DNA fragment containing FP1 was 32P-labeled at the 5' ends of either sense strand (left) or antisense strand (right) and is represented at the top. The probes were incubated alone (P) or with nuclear extracts from either placentas (Pla) or livers (Liv). After DNase I digestion, the binding mixtures were resolved on a 6% polyacrylamide gel. The vertical line indicates the major protein-binding region. The corresponding DNA sequences are read from the G/A ladder (G/A) of the probe sequence and shown at the bottom. The capital letters in the sequence indicate the AP-2-binding site. B, sequence comparison of AP-2 motifs present in the regulatory regions of the human metallothionein IIa gene (hMtIIa), the murine adenosine deaminase gene (mADA), and the human chorionic gonadotropin gene  subunit (hCG). Also shown are two AP-2 site mutants in hCG and FP1 with the C to T mutation marked by a triangle.

AP-2 Proteins Are Present in the Mouse Placenta and Interact with FP1-- To examine the potential involvement of AP-2 proteins in the formation of the FP1 protein complex, we used AP-2-binding sites present in the human metallothionein IIa gene (hMtIIa) (28) and the human chorionic gonadotropin  subunit gene (hCG) (29, 30) as competitors in electrophoretic mobility shift assays (Fig. 2A). In the presence of placenta nuclear extracts, a major FP1 protein complex was detected (lane 2). The formation of this FP1 complex was significantly inhibited by the presence of increasing amounts of hMtIIa oligonucleotides. Even stronger inhibition was observed with hCG oligonucleotides. This competitive inhibition was AP-2-specific. The hCG mutant oligonucleotides with a C to T mutation in the AP-2-binding site had no effects on formation of the FP1 complex even at 100-fold excess (lane 9). The electrophoretic mobility shift assay data are in agreement with sequence analysis, pointing to the presence of AP-2-like proteins in the FP1 complex.

View larger version (67K): [in this window] [in a new window]   Fig. 2.   Binding of AP-2 transcription factors to the Ada FP1 site. A, interaction between AP-2 motifs and placenta nuclear extract proteins determined by EMSA. 32P-Labeled FP1 oligonucleotide probes were incubated in the placenta nuclear extracts in the presence of various concentrations of different cold oligonucleotide competitors. The binding complexes were resolved on 5% polyacrylamide gel. The nucleotide sequences of competitor hMtIIa, hCG, FP1, and their mutants are displayed in B. B, binding of AP-2 proteins to FP1. 32P-Labeled FP1 probes were incubated with either AP-2 protein synthesized in vitro in rabbit reticulocyte lysates or placenta nuclear extracts. In addition, an AP-2 polyclonal antibody was added to the binding reactions (lanes 3 and 5). The protein-DNA complexes were revealed on 5% polyacrylamide gel. The rabbit preimmunized sera (sera) were used as a control (lane 6).

The AP-2 Motif Is Essential for Ada Expression in the Placenta-- The importance of the FP1/AP-2 interaction on Ada expression in the placenta was examined in transgenic mice. A C to T point mutation was introduced into the AP-2-binding site of FP1 in the Ada placental regulatory sequence, and the resulting AP-2mPCAT construct was tested for its ability to target CAT reporter gene expression to placentas of transgenic mice. FP1 containing such a mutation no longer bound AP-2 proteins (Fig. 2A, lane 13). Five F₀ transgenic mice were generated, and the CAT activities in the placentas and adjoining embryos were measured at gestational day 14.5 (Fig. 3). Three mice did not show any CAT activity. One showed a low level of CAT activity in both the placenta and the embryo, presumably due to the influences of the integration site. Another showed CAT activity present in the placenta but not in the embryo. However, the level of CAT activity was considerably less than what was typically seen with the wild type 770PCAT construct. Loss of CAT expression in the placenta due to AP-2 site mutation indicates that AP-2 proteins are important in the regulation of Ada expression in the placenta.

View larger version (23K): [in this window] [in a new window]   Fig. 3.   Effect of AP-2 mutation on CAT reporter gene expression in transgenic placentas. The AP-2mPCAT construct contained a single C to T point mutation in the AP-2 motif of the Ada placental regulatory sequence. This AP-2 mutant construct was injected into mouse zygotes. After 14.5 days, the placentas () and embryos () were isolated from the gestation sites, and CAT-specific activities were measured in the resulting transgenic mice. Each triangle represents one transgenic mouse. The bar represents the average CAT activity in transgenic mice. For comparison, the previously reported CAT expression with wild type construct 0.7PCAT is shown on the left.

AP-2 Is Highly Expressed in the Mouse Placenta-- Three AP-2 genes have been identified in mice, termed AP-2, AP-2, and AP-2 (also known as AP2.2) (31-33). All have been reported to be expressed in trophoblast cells (32, 34, 35). However, a detailed analysis of their expression in the placenta is lacking. To address this issue, we examined the relative abundance of AP-2 transcripts present in the mouse placenta at gestational day 14.5 by RNase protection (Fig. 4A). AP-2 transcripts were detected in both the placenta and the embryo. AP-2 expression in the embryo was higher than that in the placenta. The major cell types that expressed high levels of AP-2 were migrating neural crest cells and their derivatives (data not shown). AP-2 was barely detectable in either the placenta or the embryo. In contrast, AP-2 expression was readily detected in the placenta and almost undetectable in the embryo. Furthermore, AP-2 expression in the placenta was much higher than that of AP-2. In short, AP-2 is the major AP-2 transcript present in the placenta.

View larger version (63K): [in this window] [in a new window]   Fig. 4.   The levels of AP-2 transcripts in the placenta, embryo, and adult mouse tissues. A, relative abundance of AP-2 mRNAs in gestational day 14.5 placentas and embryos determined by RNase protection. Total RNA was isolated from gestational day 14.5 placentas and embryos and hybridized with equal amount of radioactivity of antisense riboprobes specific for each of the three AP-2 genes, AP-2, AP-2, AP-2. After RNase digestion, the reaction mixtures were separated on a 6% polyacrylamide gel. The individual AP-2 riboprobes are shown on the left three lanes. Pl, placenta; Em, embryo. B, distribution of AP-2 mRNA in the mouse tissues determined by Northern blot analysis. Total RNA was isolated from adult ICR female mice. Equal amount of RNA were used in the Northern blot and detected by 32P-labeled AP-2-specific probe. The arrows indicate the positions of 28 S and 18 S ribosomal RNA. Pl, placenta; Em, embryo; Br, brain; He, heart; Th, thymus; Li, liver; Ki, kidney; Fs, forestomach; Hs, hindstomach; SI, proximal part of small intestine; SI2, distal part of small intestine; LI, large intestine.

AP-2 Is Present at Every Stage and in Every Branch of Trophoblast Cells during Placental Development-- To assess further the role of AP-2 during placentation, we examined the temporal-spatial pattern of AP-2 expression in the developing placenta by in situ hybridization. On gestational day 6.5, AP-2 transcripts were detected in the primary trophoblast giant cells surrounding the embryo, the diploid cells forming the ectoplacental cone, and the extra-embryonic ectoderm overlaying the proamniotic cavity. No AP-2 expression was detected in the adjoining embryonic ectoderm. AP-2 expression was also absent from the primitive endoderm that formed the yolk sac (Fig. 5B). On gestational day 7.5, AP-2 expression was detected in the ectoplacental cone (Fig. 5D). Meanwhile, AP-2 expression continued to be abundant in the growing and proliferating extra-embryonic ectoderm and in the chorion. The embryo did not show any AP-2 expression. By comparison, Ada expression was sporadic in the ectoplacental cone and absent from extra-embryonic ectoderm (Fig. 5E).

View larger version (134K): [in this window] [in a new window]   Fig. 5.   AP-2 expression during the development of trophoblast lineages. Sections of mouse conceptuses at gestational day 6.5 (A and B) and 7.5 (C--E) were subjected to in situ hybridization using AP-2 sense (A and C), antisense (B and D), and ADA antisense (E) riboprobes. Red represents hybridization signals indicated by the arrows. Blue represents cell nuclei. Orange represents maternal blood. AL, allantois; AM, amnion; CH, chorion; EE, embryonic ectoderm; EEE, extra-embryonic ectoderm; EM, embryo; EPC, ectoplacental cone; TGC, trophoblast giant cell. The white bar represents 100 µm.

View larger version (94K): [in this window] [in a new window]   Fig. 6.   AP-2 expression in the chorioallantoic placenta. Sections of mouse placentas at gestational day 9.5 (A and B) and 11.5 (C and D) were subjected to in situ hybridization using either ADA antisense (A and C) or AP-2 antisense (B and D) riboprobes. Blue represents cell nuclei. Red represents the hybridization signals. EEM, extra-embryonic mesoderm; EM, embryo; JZ, junctional zone; LZ, labyrinthine zone; MD, mesometrial decidua; TGC, trophoblast giant cells; YS, yolk sac. The white bar represents 100 µm.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

As part of our continuing effort to understand gene regulation in trophoblast cells, we report here an initial characterization of the role of transcription factor AP-2 in the regulation of murine ADA gene expression during placental development. The regulatory elements for Ada expression in the placenta resides in a 770-bp fragment 5.4 kilobase pairs upstream of the Ada transcription start site (17). Within this fragment, a protein-binding region termed FP1 was identified and shown to preferentially bind proteins present in placenta nuclear extracts (17). In the present study, the sequence of FP1 was precisely defined, and it matched the consensus sequence for the AP-2 family of transcription factors. The fact that FP1 is a bona fide AP-2-binding site was supported by the following results. The AP-2-binding sites in the human metallothionein IIa gene (hMtIIa) and the  subunit of human chorionic gonadotropin gene (hCG) were potent competitors against FP1 binding to proteins present in placenta nuclear extracts. AP-2 proteins synthesized in vitro bound FP1 and comigated with the FP1 protein complex in placenta nuclear extracts. This FP1 protein complex was also recognized by an AP-2 antibody, indicating the presence of AP-2 protein in the complex. In addition, a high level of AP-2 expression was detected in the mouse placenta. The importance of FP1/AP-2 interaction was further confirmed by mutational analysis. Mutation in the AP-2-binding site of FP1 in the Ada placental regulatory element destroyed its ability to target CAT reporter gene expression to placentas in transgenic mice. Taken together, these results indicate that AP-2 transcription factors are required for Ada expression in the placenta.

The study of gene regulation in trophoblasts has been facilitated by the use of choriocarcinoma cell lines such as JEG-3 cells where particular glycoprotein hormones are produced. In studying transcriptional regulation of the human chorionic gonadotropin gene (hCG) in JEG-3 cells, Steger et al. (29, 36) identified a trophoblast-specific element (TSE) in the promoters of both the  and  subunit genes of hCG, implying that a TSE-binding protein coordinates the expression of these two genes in the trophoblast cells. Subsequently, the TSE-binding protein was elucidated and shown to be a member of the AP-2 family of transcription factors (30). When the sequence of murine Ada FP1 was delineated, a high degree of sequence similarity was observed among FP1 in Ada, TSE in hCG, and AP-2 in hMtIIa. This led to the hypothesis that AP-2 regulates Ada expression in mouse placentas. We have demonstrated the physical interaction between FP1 sequence and AP-2 proteins in vitro by DNase I footprinting, EMSA, and supershift assays. The requirement of such interaction for Ada expression in the placenta was also tested in vivo and confirmed in transgenic mice, further supporting the hypothesis that AP-2 is an important transcription factor for gene expression in trophoblast cells. Our studies are the first to address the functional importance of AP-2 in vivo and thereby provide new insight regarding the function of AP-2 transcription factors during normal trophoblast development.

Three AP-2 genes, AP-2, AP-2 and AP-2, have been identified in both mice and humans (31-33). They exhibit partial overlapping but distinct patterns of expression during development (34-36). All AP-2 transcripts were reported to be present in extra-embryonic trophoblast cells. However, it is not clear whether they exert redundant functions or carry out unique roles in regulation of gene expression in the placenta. Studies using AP-2- and AP-2-deficient mice suggested that each AP-2 protein has its own function important for development. AP-2 is essential for cranial-facial development (38, 39), whereas AP-2 is important for maintaining differentiated kidney cells (40). Both AP-2- and AP-2-deficient mice appear to have normal placentas, questioning the role of AP-2 protein in placental development. To address this concern, the relative amount of AP-2 messengers present in mature mouse placenta was measured. Of the three forms of AP-2, AP-2 was the most abundant mRNA present. In fact, we found AP-2 was expressed at much higher levels in the placenta than any other tissue in the mouse. This high level of AP-2 in the placenta implies that AP-2 may be the AP-2 protein most important for placental development. Generation of AP-2-deficient mice and analysis of their phenotype will test this hypothesis.

Because previous studies were focused on the mouse embryo, AP-2 expression in the placenta was largely ignored (37). Given the abundance of AP-2 in the placenta, detailed analysis of AP-2 expression in the extra-embryonic tissues was performed in order to assess the potential role of AP-2 in placental development. After implantation, AP-2 transcripts were first detected in the primary trophoblast giant cells from the mural trophoectoderm and diploid cells from the polar trophoectoderm. With continuing proliferation of the trophoblast cells, AP-2 was detected in the ectoplacental cone and the extra-embryonic ectoderm. This extra-embryonic expression of AP-2 was restricted to the trophoblast lineage. AP-2 mRNA is absent from the primitive endoderm and the extra-embryonic mesoderm. By the time the allantois reaches and fuses with the chorion to form chorioallantoic placenta, AP-2 was enriched in all trophoblast derivatives including secondary trophoblast giant cells at the maternal-fetal interface, spongiotrophoblast cells of the junctional zone, and trophoblast cells of the labyrinthine zone. The broad expression of AP-2 in all trophoblast lineages suggests that it may regulate expression of a variety of genes in the trophoblast cells. Coincident with this hypothesis, some genes implied in the development and function of the placenta contain AP-2-binding sites in their promoter sequences, such as transforming growth factor  (41, 42), vascular permeability factor/vascular endothelial growth factor (43-45), matrix metalloproteinases (46, 47), tissue inhibitor of metalloproteinases (48, 49), and estrogen receptor (50). AP-2 may be one of the key transcription factors regulating gene expression in the trophoblast cells.

The analysis of early implantation sites revealed that AP-2 transcripts were present in three branches of the developing trophoblast lineage as follows: the primary giant cells, the ectoplacental cone, and the extra-embryonic ectoderm. In contrast, Ada transcripts were absent from the extra-embryonic ectoderm and were only observed sporadically in the ectoplacental cone. The difference in AP-2 and Ada expression persisted during subsequent placental development as AP-2 expression in the labyrinthine zone became much more intense than that of Ada. Thus, AP-2 as a potential key trophoblast transcriptional regulator is present in all trophoblast cells, whereas the target gene Ada is present in a subpopulation of trophoblast cells, mainly from the ectoplacental cone. The difference between expression patterns of AP-2 and Ada in the trophoblasts can be accounted for by two hypotheses. On the one hand, it is possible that Ap-2 is essential but not sufficient to activate Ada expression in the placenta. This view is supported by our previously published evidence (17) that diverse genetic regulatory motifs are required for Ada expression in the placenta. Alternatively, AP-2 transactivation activity may be inhibited by other factors present in the extra-embryonic ectoderm lineage. In this regard, it has been reported that adenovirus E1A represses type IV 72-kDa collagenase expression by binding to AP-2 (51). We are currently investigating the molecular mechanism through which AP-2 exerts its transcriptional control of Ada gene in the trophoblast cells.

The developmental pattern of AP-2 expression in the trophoblast cells is distinct from other transcription factors important for placental development. For example, Mash-2, which is essential for spongiotrophoblast development, is transiently expressed in the developing placenta, mostly in the ectoplacental cone and extra-embryonic ectoderm (20, 21, 52). Hand1 (also known as Hxt, eHand), which is important for secondary trophoblast giant cell formation, is expressed in the ectoplacental cone and in terminally differentiated trophoblast cells (19, 22, 23). Orphan receptor ERR-, whose absence results in loss of diploid trophoblast cells, is transiently expressed in extra-embryonic ectoderm and in the chorion (53). GATA-2 and GATA-3, which regulate mouse placental lactogen I gene expression, are present in the trophoblast giant cells (24, 25). AP-2 is the first transcription factor shown to be enriched in all trophoblast cells throughout placental development. Thus, AP-2 is likely to be a key regulator of trophoblast development and differentiation.