JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, C. H. T.
Right arrow Articles by Glennie, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, C. H. T.
Right arrow Articles by Glennie, M. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 43, 27809-27815, October 23, 1998


Internalization of the Lymphocytic Surface Protein CD22 Is Controlled by a Novel Membrane Proximal Cytoplasmic Motif*

Claude H. T. Chan, Junsheng WangDagger , Ruth R. French, and Martin J. Glennie§

From the Lymphoma Research Unit, Tenovus Cancer Laboratory, Southampton General Hospital, Tremona Rd., Southampton SO16 6YD, United Kingdom and the Dagger  Medical Research Council Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, United Kingdom

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

CD22 is a key receptor on B-lymphocytes that modulates signaling during antigenic stimulation. We have defined a novel cytoplasmic motif in human CD22 that controls its unusually rapid turnover at the plasma membrane. Chimeric and mutated CD22alpha cDNA vectors were constructed and stably transfected in CD22-negative Jurkat T-lymphocytic cells. Two assays were employed to measure CD22alpha internalization: first, cytoplasmic uptake of radioiodinated anti-CD22 monoclonal antibody; and second, lethal targeting of a toxin, saporin, into cells via CD22 using bispecific F(ab')2 ([anti-CD22 × anti-saporin]) antibody. Results showed that CD22alpha lacking a cytoplasmic tail was not internalized and that replacement of the cytoplasmic tail of CD19 with that of CD22alpha resulted in a chimeric molecule that behaved like CD22alpha and internalized rapidly. Step-wise deletion of the cytoplasmic tail of CD22alpha located the internalization motif to a polar region of 11 residues (QRRWKRTQSQQ) proximal to the plasma membrane, a part of the molecule predicted to form a coil or turn structure. Interestingly, additional CD22 mutants showed that the two glutamine residues sandwiching the serine are critical to internalization but that the serine itself is not.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

CD22 is a 135-kDa B-lymphocyte-specific glycoprotein and a member of the recently described sialoadhesin family of molecules (1-3). It is a key accessory molecule that first appears at the late pro-B-cell stage of differentiation as a cytoplasmic protein and is then expressed simultaneously with IgD as a surface membrane receptor on most mature B-cells (2). Although the nature of the CD22 ligand(s) is not fully defined, it is known to bind sialoglycoconjugate NeuAcalpha 2-6Galbeta 1-4GlcNAc, which is widely distributed on N-linked carbohydrates (3, 4). The principal function of CD22 is to regulate B-cell responses, which is probably achieved by recruiting key signaling molecules to the antigen receptor complex (5, 6). The cytoplasmic domain is rapidly tyrosine-phosphorylated upon ligation of the B-cell antigen receptor and associates with a range of intracellular signaling molecules that includes tyrosine phosphatase SH2-domain containing tyrosine phosphatase-1, tyrosine kinases Lck and Syk, phospholipase C-gamma 1, and phosphatidylinositol 3-kinase (1, 2, 7). The importance of CD22 in modulating B-cell responses has recently been confirmed in knockout mice, which show augmented antibody responses, expanded peritoneal B-1 cell populations, and increased levels of circulating autoantibodies (8-10).

In humans, two isoforms of CD22 have been identified (11, 12). A larger species, CD22beta , which has seven extracellular Ig-like domains and a cytoplasmic domain containing 141 amino acids, and a smaller isoform, CD22alpha , which has five extracellular Ig-like domains (domains 3 and 4 are deleted) and a cytoplasmic region that is 23 amino acids shorter than that of CD22beta . Although CD22beta is by far the predominant species, and the only form identified in mouse, a smaller immunoprecipitate has been found that may correspond to the CD22alpha in human (13). Both isoforms contain tyrosine residues in their cytoplasmic tails, 3 residues in the alpha  form and 6 in the beta  form. Most of these tyrosine residues are arranged to form immunoreceptor tyrosine-based inhibition motifs (ITIM), consisting of a 6-amino acid stretch with the consensus sequence (I/L/V)XYXX(L/V), and/or potential immunoreceptor tyrosine-base activation motifs (ITAM) (12, 14-16). In addition, CD22 contains a YXXM sequence recognized by the NH2-terminal SH2 domain of the p85 subunit of phosphoinositide 3-kinase. Thus, CD22 has the capacity to modulate B-cell behavior via a wide range of intracellular, tyrosine-dependant signaling molecules.

In addition to any signaling role, CD22 shows an unusual and unexplained capability to internalize rapidly from the cell surface to the cytoplasm. Recent studies have shown that CD22 internalizes constitutively on unstimulated B-cell lines, and this is followed by degradation without detectable recycling (17). This internalization probably explains, at least in part, the success achieved when CD22 has been employed as a target molecule for delivering toxins into neoplastic B-cells using antibody immunotoxins (18, 19) and bispecific antibodies (BsAbs)1 (20-22). We find BsAbs with specificity for CD22 and the ribosome-inactivating protein, saporin ([anti-CD22 × anti-saporin]), is unusually effective at delivering saporin into neoplastic B-cells and thereby inhibiting protein synthesis and eradicating tumors in animals (21) and patients (22). Most other membrane molecules do not work as efficiently (20). In the present study, we have investigated the molecular structure of the cytoplasmic domain of CD22 and identified a new motif that controls its internalization from the cell surface and may account for its unusual immunotherapeutic properties.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Human Cell Lines-- The Burkitt's lymphoma cell line Daudi and the acute T-cell leukemia cell line Jurkat were used in these studies. Both lines were maintained in RPMI 1640 medium containing 10% fetal calf serum (Life Technologies, Inc.) and supplemented with 1 mM glutamine, 1 mM sodium pyruvate, 100 IU/ml benzyl penicillin, and 100 µg/ml streptomycin sulfate. Cells were maintained continuously in the logarithmic phase of growth by passage at regular intervals.

Antibodies and Preparation of Bispecific Antibodies-- The mAbs used in this study include anti-CD19 (RFB9) (20), anti-CD22 mAb (4KB128) (23), anti-CD38 mAb (AT13/5) (24), and anti-saporin mAb (anti-sap1 and anti-sap5) (25). Hybridoma cells were expanded in stationary culture using 5% supplemented Dulbecco's modified Eagle's medium (Life Technologies, Inc.) and IgG purified using protein A affinity chromatography as described previously (26). Bispecific F(ab')2 heterodimers were constructed using well established procedures in which Fab' fragments from two different mAbs are cross-linked via their hinge region SH groups using the bis-maleimide linker o-phenylenedimaleimide (26).

cDNA and Construction of CD22 Mutants-- cDNA clones of human CD19 and CD22alpha were kind gifts from Dr. Brian Seed. The CD19 clone provided, which will be called CD19BS throughout this paper, is not the full-length, wild type transcript, but a truncated version that has its cytoplasmic domain reduced from the normal 242 to 148 amino acids long (27). Fortunately, for the present study we were only interested in CD19BS as a control surface protein that could be engineered into a chimeric protein containing the extracellular and transmembrane region of CD19BS and the cytoplasmic tail of CD22alpha .

As discussed above, the CD22alpha molecule is a minor isoform of CD22 that may not be expressed in normal B-cells. Because of its truncated cytoplasmic domain and reduced number of tyrosines, it is likely to have a number of signaling properties that are different from those of the predominant CD22beta isoform. For the purposes of this study, the membrane proximal regions of the molecule that control internalization (see under "Results") are identical in CD22alpha and CD22beta .

Both CD19BS and CD22alpha cDNA clones were subcloned into pcDNA3 (Invitrogen, San Diego, CA) using the HindIII-NotI sites for CD19BS and the XhoI site for CD22alpha . Deletion of the CD22alpha cytoplasmic tail was accomplished by PCR using primer pairs 22alpha F (TTGAATCTCGAGACGCGGAAACAGGCTTGCAC) and 22alpha Delta cytR (TCGCTAGATCTAGAGCCCACAGATTGCCAGGA). To delete the whole cytoplasmic tail, a stop codon (TAG) was introduced after Leu510 in the transmembrane region. PCR was performed in a Protocol Thermal Cycler (AMS Biotechnology Ltd.) using CD22alpha full-length cDNA as template. All reagents were from the Repli-Pack kit (Boehringer Mannheim). The PCR construct generated contained both the extracellular and transmembrane domains and was then subcloned into pGEM-T vector (Promega, Madison, WI) for sequencing and into expression vector pcDNA3 for transfection.

To replace the cytoplasmic region of CD19BS with that of CD22alpha , a two-step recombinant PCR strategy was used (28). In this method, a pair of chimeric PCR primers was designed to span the chimeric junctions. The 5'-half of one chimeric primer, 19/22alpha F (CAACGTCGCTGGAGCTTAAGATGAAGAATGCCCA), bound to the 3'-end of the transmembrane region of the antisense strand of CD19BS cDNA between base pairs 939 and 954, whereas the 3'-half of the primer bound to the 5'-end of the cytoplasmic region of the antisense strand of CD22alpha cDNA (base pairs 1622-1638). A second chimeric primer, 19/22alpha R (TGGGCATTCTTCATCTTAAGCTCCAGCGACGTTG), the complimentary oligonucleotide to 19/22alpha F, was made so that its 5'-end bound to the sense strand of CD22alpha between base pairs 1622 and 1638 and the 3'-end recognized the sense strand of CD19BS between base pairs 939 and 954. Appropriate end primers, 19F (TCATCAAGCTTGGAGAGTCTGACCACCATGC) and 22alpha R (TCGGAGATCTCCCTGGCCCCCGCTGCCCCAG) were also designed to hybridize with the 5'-end of the antisense strand of the full-length CD19BS cDNA (base pairs 1-30) and the 3'-end of the sense strand of CD22alpha cDNA (base pairs 2072-2093), respectively. In the first PCR, 2 separate products corresponding to the CD19BS extracellular region and transmembrane domain (CD19BSDelta cyt) and the CD22alpha cytoplasmic domain (CD22alpha cyt) were generated using the respective primer pairs of [19F + 19/22alpha R] and [19/22alpha F + 22alpha R]. These PCR fragments were extracted from agarose gels using Qiaex gel extraction kit (Qiagen GmbH, Hilden, Germany), and then 100 ng of each was used in a second PCR. Initially, this reaction was carried out for 10 cycles without end primers (19F and 22alpha R) or DNA template. End primers were then added, and a further 10 cycles were completed to give a full-length chimeric CD19 construct with CD22 cytoplasmic region. The chimeric construct (CD19Delta cyt/22alpha cyt) was then cloned into pGEM-T vector via HindIII and BamHI sites for sequencing and further subcloned into eukaryotic expression vector pcDNA3 via HindIII and NotI.

To delete individual tyrosine residues Tyr556, Tyr566, and Tyr600, 3' primers containing stop codons were used to amplify CD22alpha template with the 5' primer 22F via PCR. This yielded deletion mutants (CD22alpha YDelta 556, CD22alpha YDelta 566, and CD22alpha YDelta 600) in which stop codons replaced the respective tyrosine residues. Deletion mutants CD22alpha Delta Q513, CD22alpha Delta G524, and CD22alpha Delta E527 were constructed in a similar manner using 3' primer to respectively replace the corresponding amino acid residues with stop codons. Mutations of Ser521 to Ala521 and Gln520/Gln522 to Leu520/Leu522 were carried out using 3' primers containing the corresponding changes in the codons. The sequences of all constructs were confirmed by dideoxy DNA sequencing (Sequenase, version 2.0, Amersham Pharmacia Biotech). All constructs were then subcloned into pCINEO mammalian expression vector (Promega) for transfection.

Transfection of Jurkat Cells-- Jurkat cells were transfected with cDNA constructs by electroporation based on the procedure described by Andreason and Evans (29). Approximately 5 × 106 cells were pelleted, resuspended in a total volume of 0.8 ml with RPMI, and loaded into a 4-mm electroporation cuvette together with 50 µg of DNA. After standing for 5 min on ice, cells were electroporated at 300 V, 960 microfarads using a Gene Pulser (Bio-Rad), and then the cuvette was returned to an ice bath for a further 10 min without mixing. The cells were then left at room temperature for 10 min before adding 30 ml of complete RPMI medium. For the next 48-72 h, the cells were cultured in 75-cm2 flasks under standard conditions at 37 °C in a moist atmosphere of 5% CO2 before being transferred to 96-well plates in complete medium containing 1 mg/ml Geneticin (Life Technologies, Inc.). Emerging colonies were tested for surface expression by flow cytometry (described previously; Ref. 24) after 3-4 weeks, and positive cells were cloned by limiting dilution.

Internalization of 125I-Labeled mAbs by Transfected Cells-- Anti-CD19 and -CD22 mAbs were trace radiolabeled using carrier free 125I (Radiochemical Center, Amersham Pharmacia Biotech) and IODO-BEADS (Pierce) as oxidizing reagents according to the manufacturer's instructions. The radioimmunoassays for evaluating surface binding and internalization of the 125I-labeled mAbs were carried out by a method based on that described by Pelchen-Mattews et al. (30). Cells (107/ml) were incubated with 125I-labeled mAb (2 µg/ml) at 4 °C for 1 h to allow binding and then warmed to 37 °C to allow internalization. Aliquots were taken at various intervals, washed twice in 10% supplemented RPMI medium before centrifugation at 13,000 rpm for 45 s through a cold solution of 5% bovine serum albumin (in phosphate-buffered saline) and counting the radioactivity bound to the pellet. For the internalized count, the medium in the second wash was replaced by a HCl-titrated buffered RPMI medium (pH2.0), which removes surface bound activity and thus allows the internalized 125I-antibodies to be measured and surface binding estimated by subtraction of the internalization counts from the total counts.

[3H]Leucine Uptake by Cells Cultured with BsAb·Saporin Complexes-- We have established that a BsAb that is designed to recognize a toxin, such as saporin, and a suitable cell surface molecule will target the toxin to the cells and allow efficient internalization so that the cells are killed. Protein synthesis levels in target cells exposed to BsAb·saporin complexes were assessed by measuring incorporation of [3H]leucine uptake according to methods described previously (20). Briefly, transfected Jurkat cells (1 × 105/well) were cultured for 24 h in 96-well, flat-bottomed plates with 200 µl of leucine-free RPMI medium containing 1 µg/ml BsAb and the required concentration of saporin. Each well was then pulsed with [3H]leucine (1 µCi/well) for 16 h, and the incorporation of radioactivity into protein was assessed by harvesting the cells onto glass fibers, washing, and counting. Throughout the work, a mixture of two BsAbs was used as described previously (25). Each pair of reagents was selected to bind to the cell via a single epitope on CD19, CD22, or CD38 and to the saporin via two different epitopes. This maneuver allows the BsAb·saporin complexes to be captured bivalently and, due to their increased avidity, bind 20 times more avidly to the target cells than with a single BsAb (25).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Transfection of Jurkat T-cells with Human CD19BS and CD22alpha -- We decided to investigate the molecular basis of CD22alpha internalization and in particular the structural features of the cytoplasmic tail that control delivery into the cell. Our strategy was to construct a panel of CD22alpha cDNA containing vectors in which the cytoplasmic tail of CD22alpha had been selectively altered. These vectors were used to make stable tranfectants of CD22-negative Jurkat cells, which were then investigated, after cloning, for their ability to internalize the newly expressed CD22alpha .

Details of all the constructs in this investigation are shown in Fig. 1. A total of 12 cDNA constructs were made, including molecules in which the cytoplasmic tail of CD22alpha was spliced onto the extracellular and transmembrane region of CD19 (CD19Delta cyt/22alpha cyt), together with a range of CD22alpha mutants containing truncated cytoplasmic tails and molecules in which certain amino acids were changed.


View larger version (46K):
[in this window]
[in a new window]
  		Fig. 1.   Structure of CD22alpha and mutants of CD22alpha used in this study. The extracellular domains of CD19BS (two domains) and CD22alpha (five domains) are shown as circles. The transmembrane (TM) domains are shown as open boxes. The cytoplasmic regions (lines) show the total number of CD22alpha -derived amino acids in parentheses, e.g. 118 in the CD22alpha . For the CD22alpha molecules, the cytoplasmic region starts at amino acid position 510, and for CD19BS it starts at 295. The final amino acid number is also given. In two CD22alpha constructs (CD22alpha S521A and CD22alpha Q520L/Q522L), the cytoplasmic region was terminated at amino acid 526, and then a serine at position 521 was converted to an alanine (CDalpha 22S521A), or two glutamines at positions 520 and 522 were changed to leucines (CDalpha 22Q520L/Q522L). a, clone name used to represent the Jurkat cells transfected and selected with each molecular construct. b, IC50 values were taken as the concentration of saporin at which the uptake of [3H]leucine was inhibited by 50% in the cytotoxicity assays (e.g. Fig. 4). The IC50 values shown are representative results (± S.D. of triplicate samples) from two or three cytotoxicity assays for each transfectant. IC50 values varied by no more than 10-fold between cytotoxicity assays.

The Jurkat T-cell leukemia line was chosen as a suitable CD22-negative lymphoid cell line in which to express these molecules. Jurkat cells were stably transfected and then screened by flow cytometry to isolate clones that expressed the various mutated CD22alpha molecules. As shown in Fig. 2, both wild type CD19BS (Fig. 2A) and CD22alpha (Fig. 2C) were expressed at easily detectable levels, showing that neither surface B-cell marker required associated B-cell restricted molecules for their expression. The CD22alpha clone was employed as a positive control for assessing CD22alpha internalization throughout the remainder of this investigation, whereas CD19BS Jurkat cells provided our negative controls (see below). Fig. 2 also shows the levels of mutated CD22alpha expression for the other transfectants. With the exception of one clone, CD22alpha Delta cyt (Fig. 2J), which gave only weak immunofluorescence staining, relative to other transfectants, all cells expressed levels of surface CD22alpha that were as high as or even higher than that of CD22beta generally expressed on normal B-cells and B-cell lines (data not shown). The expression of all the constructs was also confirmed by immunoprecipitation of Nonidet P-40 lysates of the radioiodinated transfectants (results not shown).


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 2.   Levels of CD22alpha and CD19BS expression on transfected Jurkat cells. The histograms show staining patterns for Jurkat cells transfected with the various molecular constructs (see Fig. 1). Each clone was labeled with a nonstaining control fluorescein isothiocyanate-IgG mAb (open histogram) and either fluorescein isothiocyanate-anti-CD22 or fluorescein isothiocyanate-anti-CD19 mAb, as appropriate for the transfected molecule (filled histogram).

The Cytoplasmic Tail of CD22alpha Controls Its Endocytosis-- To investigate whether the cytoplasmic tail of CD22alpha controlled its internalization, we compared the uptake of 125I-labeled mAbs by Daudi cells and by Jurkat cells transfected with CD22alpha , CD22alpha Delta cyt, CD19BS, and CD19Delta cyt/22alpha cyt (Fig. 3). Cells were incubated with radiolabeled anti-CD22 or anti-CD19 mAb for 1 h at 4 °C and then warmed to 37 °C for various intervals. The cells were then acid-washed to remove surface bound mAb, and therefore, any increase in the cell-associated radioactivity must be due to the endocytosis of the antigen-antibody complex. The results show that both Daudi cells (CD22beta +) and CD22alpha -expressing Jurkat cells accumulated 125I-labeled anti-CD22 mAb at a similar rate (Fig. 3A). There was a sharp initial uptake of mAb in the first 2 h, after which the level remained quite steady. The accumulation of intracellular 125I-labeled mAb by these cells was accompanied by a corresponding loss of surface-associated mAb. In contrast, the Jurkat cells expressing the CD22alpha Delta cyt, in which the cytoplasmic region of the molecule had been removed (Fig. 1), were unable to accumulate significant levels of intracelluar radiolabel, and the mAb remained on the surface of the cells. This result is consistent with the cytoplasmic tail playing a central role in CD22alpha turnover at the cell surface and with immunoelectron microscopy data that showed that CD22alpha is strongly clustered around coated pits in transfected Jurkat cells but that following removal of the cytoplasmic tail the truncated molecules are evenly distributed along the plasma membrane (data not shown).


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 3.   Internalization of 125I-labeled anti-CD19 and anti-CD22 mAb by Daudi and transfected Jurkat cells. 125I-mAb (A, anti-CD22; B, anti-CD19) was incubated with cells for 1 h at 4 °C to allow binding. The temperature was then increased to 37 °C, and duplicate aliquots were taken at the time intervals shown. The total radioactivity associated with each aliquot of cells, and that remaining inside the cells after washing in acidic RPMI medium (pH 2) was determined as described under "Materials and Methods." The levels of intracellular (solid symbols) and surface (total minus intracellular) (open symbols) 125I-mAb were calculated as the average 125I-mAb molecules/cell. The levels of intracellular and surface 125I-mAb are expressed as a percentage of the surface bound 125I-mAb at time 0. The target cell lines are as indicated (A, Jurkat cells transfected with CD22alpha Delta cyt, Jurkat cells transfected with CD22alpha , or Daudi cells; B, Jurkat cells transfected with CD19BS, Jurkat cells transfected with CD19Delta cyt/22alpha cyt, or Daudi cells). This is one of three similar experiments.

The importance of the CD22alpha cytoplasmic tail in mediating internalization was confirmed using cells expressing the chimeric CD19Delta cyt/22alpha cyt molecule in which the CD22alpha cytoplasmic tail had been grafted onto the extracellular and transmembrane domains of CD19BS (Fig. 3B). Whereas CD19 (endogenous expression on Daudi cells) and CD19BS (transfected Jurkat) were relatively poor at taking up radioiodinated anti-CD19 mAb, once the cytoplasmic tail of CD19BS was replaced by that of CD22alpha , it behaved like the intact CD22alpha and internalized mAb very effectively. In fact, for reasons that are not understood, uptake of 125I-labeled mAb by this chimeric molecule was quicker and more extensive than by the transfected CD22alpha . These results suggest that there is an internalization signal within the cytoplasmic region of CD22alpha .

The Cytoplasmic Tail of CD22 Controls Effective Delivery of Toxin into Target Cells-- For the next stage of this investigation we used the Jurkat transfectants as target cells in an assay which measures the cytotoxicity of a toxin, saporin, when delivered to the cells via CD19BS or CD22alpha . In the assay, cells are exposed to a BsAb ([anti-CD22 × anti-saporin] or [anti-CD19 × anti-saporin]) at 1 µg/ml together with saporin at various concentrations for 24 h at 37 °C, during which period the BsAb·saporin complexes are taken up by the transfectants according to the readiness of the target antigen (CD22alpha or CD19BS) to internalize. The cultures were then pulsed for a further 12 h with [3H]leucine to establish the level of protein synthesis in any surviving cells. As a positive control to show that all Jurkat cells, transfected or not, were sensitive to killing with BsAb·saporin complexes, we used a BsAb directed at CD38 ([anti-CD38 × anti-saporin]), which is expressed constitutively by these T-cells.

Fig. 4 shows a typical set of results with transfected Jurkat cells. The CD22alpha molecule is highly effective at delivering BsAb·saporin complexes, giving an IC50 for saporin of approximately 2 × 10-10 M, a value close to that achieved with the anti-CD38 BsAb. This showed that saporin delivered by both anti-CD22 and anti-CD38 BsAbs was approximately 2500-fold more toxic than saporin alone (5 × 10-7 M). The increase in the toxicity of CD22-specific BsAbs on the CD22alpha -transfected Jurkat cells was similar to that observed when B-cell lines were treated with this reagent (20), suggesting that the transfected CD22alpha molecules behave similarly to native CD22beta on B-cells. In contrast, when the tail of CD22alpha was removed and the truncated molecule expressed in the CD22alpha Delta cyt-transfected cells, then the same anti-CD22 BsAb was completely unable to increase saporin toxicity. This result is important because it is consistent with the internalization data shown in Fig. 3 and shows that the rate at which a molecule is internalized from the cell surface is a key feature in determining whether it will make an effective target for antibody delivery of toxins.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 4.   Cytotoxicity assay testing BsAb·saporin complexes on Jurkat cells transfected and selected for expression of CD22alpha , cytoplasmic tail deletion mutant (CD22alpha Delta cyt), CD19BS, and a chimeric molecule containing the extracellular and transmembrane region of CD19BS and the cytoplasmic region of CD22alpha (CD19BSDelta cyt/22alpha cyt). Transfected cells (105 cells/well) were cultured for 18 h with BsAb at 1µg/ml and saporin at the concentrations shown before pulsing with [3H]leucine and harvesting of cells to assess the level of incorporated radioactivity. Triplicate samples were assayed for each concentration of saporin investigated, and the mean values are shown. BsAbs used include saporin alone (), [anti-CD38 × anti-saporin] (diamond ), [anti-CD22 × anti-saporin] (bullet ), and [anti-CD19 × anti-saporin] (black-triangle). This is one set of three similar experiments.

In Fig. 4, we also see that the cytoplasmic tail of CD22 will transform CD19BS, a molecule that is unable to deliver saporin with BsAb (20) into a useful vehicle for delivering BsAb·saporin complexes for cytotoxicity. Thus, whereas Jurkat cells expressing CD19BS were not susceptible to anti-CD19-specific BsAb·saporin complexes, those carrying CD19Delta cyt/22alpha cyt were hypersensitive, with an IC50 for saporin that was below 10-11 M.

A Turn Structure Motif Is Essential for Internalization-- To investigate whether the cytoplasmic tail tyrosine residues of CD22alpha are involved in the internalization, CD22alpha -mutants were constructed in which the cytoplasmic tail was truncated fractionally by introducing a stop codon at the tyrosine residues (CD22alpha Delta Y556, CD22alpha Delta Y566, and CD22alpha Delta Y600) using PCR-directed mutagenesis. The three constructs were expressed at a high level in Jurkat cells (Fig. 2). Cytotoxicity assays showed that these truncated CD22alpha molecules were all equally as good as the unmutated CD22alpha at delivering BsAb·saporin complexes into the cells (Fig. 1), showing that the carboxyl-terminal end of the cytoplasmic tail is not directly involved in the internalization motif.

The results using tyrosine mutants described above suggested that the region of cytoplasmic tail nearer to the cell membrane might be critical in the endocytosis process. Crystallographic work (31) and NMR studies (32) suggest that a tight-turn structural motif is involved in the clustering signals for surface molecules, and individual specificity is conferred by side-chain differences. It is thus interesting to note that two tight-turn structures are predicted near to the membrane within the CD22alpha cytoplasmic tail (Gln513-Gln523 and Asn528-Gln532). To determine whether a turn motif is involved in the endocytosis process, truncated CD22alpha mutants were constructed, using PCR-directed mutagenesis, in which a stop codon was introduced at positions Gln513 (CD22alpha Delta Q513), Gly524 (CD22alpha Delta G524), and Glu527 (CD22alpha Delta Q527) to yield mutants with two amino acids in the cytoplasm or just one of the turns (Fig. 1). These mutants were transfected and selected in Jurkat cells (Fig. 2), and the resulting clones were tested in cytotoxicity assays. The results (Fig. 5) showed that with two amino acids remaining in the cytoplasmic tail (CD22alpha Delta Q513), saporin toxicity was not enhanced by the presence of CD22-specific BsAbs, demonstrating that the surface CD22 molecule was no longer active for delivery. This result was the same as that obtained using the cytoplasmic deleted mutant, CD22alpha Delta cyt, even though the expression levels were different (Fig. 2.). This indicated that the motif for internalization lies further to the COOH-terminal end of the molecule. Interestingly, the deletion mutants CD22alpha Delta G524 and CD22alpha Delta E527, which each contain one predicted turn in the cytoplasm, were fully active in this assay. Thus, in the presence of BsAbs, the IC50 values for saporin toxicity were 1.5 × 10-10 and 5.5 × 10-10 M, respectively, with these two transfectants (Fig. 5.), comparable to those seen with the CD22alpha transfectant (Fig. 4) or Daudi cells (20) and indicate quite clearly that the internalization motif of CD22 lies between residues 512 and 523, just under the membrane.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 5.   BsAb·saporin cytotoxicity assay on Jurkat cells transfected with CD22alpha tight turn deletion mutants CD22alpha Delta Q513, CD22alpha Delta G524, and CD22alpha Delta E527. The cytotoxicity assays were performed as described in Fig. 4 using anti-CD22-specific (bullet ) and anti-CD38-specific (diamond ) BsAbs to deliver saporin or with saporin alone (). Jurkat cells were transfected with the three constructs shown. Triplicate samples were assayed for each concentration of saporin investigated, and the mean values are plotted. Two other experiments yielded similar results.

Mutagenesis of the Internalization Motif-- The 11-amino acid turn structure motif in CD22 is unusual in that, unlike most other internalization signals described, it contains no tyrosine residues (33). Examination of the sequence (QRRWKRTQSQQ), however, showed the presence of a serine bearing a hydroxyl group at position 521. It is possible that serine replaces a tyrosine residue in this motif and that the hydroxyl group of both amino acids may play a similar role in the internalization signal. To investigate this, a mutant was constructed in which Ser521 was mutated to Ala521 (Fig. 1), and its ability to endocytose was determined in the cytotoxicity assay. Surprisingly, this substitution did not affect delivery of BsAb·saporin complexes (Fig. 6), indicating that although serine might have replaced tyrosine in the position of the internalization motif in CD22alpha , the mechanism of internalization/endocytosis of CD22alpha involves interaction with structures other than the side group of a determinant amino acid.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   Cytotoxicity assay for BsAb·saporin complexes on Jurkat cells carrying CD22alpha with amino acid substitutions in the newly identified internalization motif. Jurkat cells were transfected and selected for expression of two CD22alpha constructs, CD22alpha S521A and CD22alpha Q520/522L (Fig. 1). The cytotoxicity assays were performed as described in Fig. 4 using anti-CD22-specific (bullet ) or anti-CD38-specific (diamond ) BsAbs to deliver saporin or saporin alone (). Triplicate samples were assayed for each concentration of saporin investigated, and the mean values are plotted. Two other experiments yielded similar results.

It has been proposed that charged or polar amino acids surrounding the crucial tyrosine residue in an internalization motif may also be important for function (34, 35). Of the 11 amino acid residues in the CD22alpha motif, 8 are polar or positively charged (Fig. 7). Such a cluster of polar amino acids clearly suggests that a charged interaction (hydrogen bonding or electrostatic interaction) is likely to be important for internalization. Comparison with tyrosine-containing motifs has shown that amino acids either side of the tyrosine tend to be more prominently polar and also important for function. It was thus decided to make a CD22alpha mutant with amino acid changes on either side of the serine. This mutant, CD22Q520L/Q522L (Fig. 2), had a cytoplasmic tail truncated at amino acid 526 with Gln520 and Gln522 mutated to leucine residues. Cytotoxicity assay results with this mutant showed that it had a greatly reduced ability to deliver saporin in the presence of BsAb (Fig. 6). The IC50 value for saporin toxicity was only 3.3 × 10-8 M in the presence BsAb, compared with 2.1 × 10-10 M for the CD22alpha transfectants, confirming the previous proposal that polar amino acids are important.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 7.   Comparison of the tyrosine-based schematic internalization motif (modified from Ref. 34) and the proposed internalization motif from CD22 (CD22alpha and CD22beta both carry the proposed motif). The size of the symbols for polar and basic residues in the Tyr-based motif indicates relative importance. Arrows indicate the presence of the important charged residues in the CD22 motif.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

CD22 plays a key role in the regulation of B-cell responses to antigen (1, 2). One relatively unexplored mechanism of controlling CD22 function and ensuring that it provides accessory signals at the appropriate time is by restricting its cellular localization, i.e. making sure that CD22 is at the right place at the right time. Recently, Sherbina et al. (36) have shown that following stimulation of the B-cell antigen receptor, intracellular CD22 moves rapidly from the cytoplasm to the plasma membrane, resulting in a 50-100% increase in surface expression within 5 min of stimulation. In addition to membrane delivery, it is clear that CD22 also undergoes rapid and constitutive internalization from the plasma membrane (17). Shan and Press (17) have reported that CD22 is turning over at the cell surface with a t1/2 of less than 1 h, that internalization occurs regardless of anti-CD22 mAb binding, and that the CD22, once internalized, is transported to lysosomes for degradation rather than being recycled back to the plasma membrane as occurs with many lymphocyte receptors (17). Although it is unclear why CD22 transport is controlled in this way, it obviously has enormous potential for regulating its function.

In the current study, we have investigated the structural basis of CD22alpha internalization using chimeric and mutated constructs expressed in Jurkat T-cells. The results show that the cytoplasmic tail of CD22alpha controls its endocytosis into the cells. CD22alpha molecules without a cytoplasmic tail were not internalized and hence failed to deliver radioactive mAb or BsAb·saporin complexes inside the cell. Furthermore, when the cytoplasmic region of a second B-cell marker, CD19, was replaced by that of CD22alpha , the resulting chimeric molecule behaved like CD22alpha and internalized efficiently (Fig. 1). Step-wise deletion located the endocytosis motif to an 11-amino acid sequence (QRRWKRTQSQQ) proximal to the plasma membrane: provided this short peptide remained on the truncated CD22alpha , it performed perfectly well in delivering toxin BsAb·saporin complexes into the transfected cells. A complete list of all the constructs, together with data on deliver BsAb·saporin complexes into transfected cells for cell killing, is summarized in Fig. 1. Because the predominant CD22beta isoform has the same membrane proximal 11-amino acid sequence, it seems reasonable to assume that this motif controls internalization of both CD22alpha and CD22beta isoforms. Interestingly, the mouse CD22 molecule shows a very similar sequence in this region (37), with just four conserved amino acid differences, and consequently may perform the same function.

Typically plasma membrane receptors are moved into early endosomes via clathrin-coated pits and vesicles (38). Our immunoelectron microscopy data confirm that CD22alpha is strongly clustered around coated-pits. Identified signal sequences for entry into or formation of clathrin-coated pits are degenerate and quite variable, making it difficult to define precise motifs (33, 36, 38). However, generally they fall in to two classes. The most common are tetra- or hexapeptides containing an aromatic residue, usually tyrosine or phenylalanine (33), placed in the context of one or more amino acids with largely hydrophobic side chains. Typical examples would include FDNPVY for low-density lipoprotein receptor (39), YKYSKV for CD-mannose 6-phosphate receptor (40), and YXRF for the transferrin receptor (31). The second general class of control signals involves adjacent leucine-type residues, which include dileucine or leucine plus a small hydrophobic residue near the carboxyl terminus of the cytoplasmic domain. The current list of receptors using these motifs is quite short and tends to include leukocyte receptors, such as Fc receptor and CD74 (invariant chain of MHC class II) (41). Clearly the CD22 control sequence, QRRWKRTQSQQ, does not fall easily into either group and may represent a novel class, or more likely a modified member of the tyrosine-based signaling motifs. A comprehensive investigation by Ktistakis et al. (34) has defined two salient features required for function of these structures: first, they contain residues that show a preference to "break" regular structure in protein domains; and second, they have a high concentration of polar or positively charged residues on both sides of the tyrosine. A schematic representation of the endocytic tyrosine-based signals is shown in Fig. 7A. This generic internalization signal consists of 8-10 cytoplasmic amino acids with the tyrosine residue present in the membrane distal portion of the sequence. There appears to be a strong preference for certain types of amino acid at specific positions, suggesting that the orientation of the motif with respect to the membrane is critical and that it is independent of polarity of the protein, and, for both type I and II transmembrane proteins, extends 6 amino acids membrane proximal and 2 residues membrane distal to the tyrosine. The most critical amino acids appear to be located at positions +2, +1, -1, -4, and -6 with respect to the tyrosine. It is thought that the amino acids that disturb regular structure may be required to disrupt the polypeptide chain after it leaves the transmembrane sequence and provide a fairly extended structure immediately proximal to the membrane. Structural predictions on these internalization motifs suggest that the polar groups either side of the tyrosine generate hydrogen-bonded tight turns, membrane proximal to the tyrosine. It is thus predicted that the recognition sequence for the clathrin adapter protein complex-2 is simply a small surface loop (34).

Using the Garnier-Gibrat-Robson prediction algorithm (42), we found that the CD22 motif (Gln513-Gln523) showed a preference for a turn structure that was strikingly similar to that for a known tyrosine-based signal (Fig. 7B). It is highly polar and basic and differs from the schematic tyrosine-based motif only in a switch of serine for tyrosine. Mutagenesis studies on tyrosine-based motifs have shown that the tyrosine residue can be substituted with phenylalanine or tryptophan, suggesting that any aromatic residue could suffice for the internalization signaling (43). Surprisingly, in the present study, investigation to determine whether the serine was critical to the CD22 motif showed that it was not, and substituting the serine with alanine did not influence internalization of BsAb·saporin complexes in cytotoxicity assays (Fig. 6). However, in contrast, mutating the polar groups either side of the serine completely destroyed function and prevented saporin toxicity, suggesting that polarity was critical for internalization. Numerous questions remain about this newly defined internalization motif and its interaction with the endocytic pathway. However, it appears that internalization is more dependent on charge and secondary structure than on linear sequence, and this is consistent with CD22 associating with the clathrin-associated adapter, clathrin adapter protein complex-2, or an clathrin adapter protein complex-2-like molecule that recognizes the membrane proximal, charged loop for constituent delivery of CD22 into the cell.

    ACKNOWLEDGEMENTS

We thank Brian Seed and Ivan Stamenkovic for the kind gift of CD19 and CD22 cDNA and George Stevenson and Mark Marsh for helpful discussion.

    FOOTNOTES

* This work was supported with funds from the Tenovus Cancer Charity, Cardiff, United Kingdom and the Leukaemia Research Fund.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed. Tel.: 44-1703-796910; Fax: 44-1703-704061.

The abbreviations used are: BsAb, bispecific antibody; mAb, monoclonal antibody; PCR, polymerase chain reaction.
    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

  1. Tedder, T. F., Tuscano, J., Sato, S., and Kehrl, J. H. (1997) Annu. Rev. Immunol. 15, 481-504[CrossRef][Medline] [Order article via Infotrieve]
  2. Law, C.-L., Sidorenko, S. P., and Clark, E. A. (1994) Immunol. Today 15, 442-449[CrossRef][Medline] [Order article via Infotrieve]
  3. Powell, L. D., and Varki, A. (1995) J. Biol. Chem. 270, 14243-14246[Free Full Text]
  4. van der Merwe, P. A., Crocker, P. R., Vinson, M., Barclay, A. N., Schauer, R., and Kelm, S. (1996) J. Biol. Chem. 271, 9273-9280[Abstract/Free Full Text]
  5. Pezzutto, A., Rabinovitch, P. S., Dorken, B., Moldenhauer, G., and Clark, E. A. (1988) J. Immunol. 140, 1791-1795[Abstract/Free Full Text]
  6. Peaker, C. J. G., and Neuberger, M. S. (1993) Eur. J. Immunol. 23, 1358-1363[Medline] [Order article via Infotrieve]
  7. Law, C.-L., Sidorenko, S. P., Chandran, K. A., Zhao, Z., Shen, S.-H., Fischer, E. H., and Clark, E. A. (1996) J. Exp. Med. 183, 547-560[Abstract/Free Full Text]
  8. O'Keefe, T. L., Williams, G. T., Davies, S. L., and Neuberger, M. S. (1996) Science 274, 798-801[Abstract/Free Full Text]
  9. Otipoby, K. L., Andersson, K. B., Draves, K. E., Klaus, S. J., Farr, A. G., Kerner, J. D., Perlmutter, R. M., Law, C. L., and Clark, E. A. (1996) Nature 384, 634-637[CrossRef][Medline] [Order article via Infotrieve]
  10. Sato, S., Miller, A. S., Inaoki, M., Bock, C. B., Jansen, P. J., Tang, M. L. K., and Tedder, T. F. (1996) Immunity 5, 551-562[CrossRef][Medline] [Order article via Infotrieve]
  11. Stamenkovic, I., and Seed, B. (1990) Nature 344, 74-77[Medline] [Order article via Infotrieve]
  12. Wilson, G. L., Fox, C. H., Fauci, A. S., and Kehrl, J. (1991) J. Exp. Med. 173, 137-146[Abstract/Free Full Text]
  13. Schwartz-Albiez, R., Dorken, B., Monner, D. A., and Moldenhauer, G. (1991) Int. Immunol. 3, 623-633[Abstract/Free Full Text]
  14. Doody, G. M., Justement, L. B., Delibrias, C. C., Mathews, R. J., Lin, J., Thomas, M. L., and Fearon, D. T. (1995) Science 269, 242-244[Abstract/Free Full Text]
  15. Vely, F., and Vivier, E. (1997) I. Immunol. 159, 2075-2077[Abstract/Free Full Text]
  16. Reth, M. (1989) Nature 338, 383-384[Medline] [Order article via Infotrieve]
  17. Shan, D., and Press, O. W. (1995) J. Immunol. 154, 4466-4475[Abstract]
  18. Ghetie, M. A., May, R. D., Till, M., Uhr, J. W., Ghetie, V., Knowles, P. P., Relf, M., Brown, A., Wallace, P. M., Janossy, G., Amlot, P., Vitetta, E. S., and Thorpe, P. E. (1988) Cancer Res. 48, 2610-2617[Abstract/Free Full Text]
  19. Amlot, P. L., Stone, M. J., Cunningham, D., Fay, J., Newman, J., Collins, R., May, R., McCarthy, M., Richardson, J., Ghetie, V., Ramilo, O., Thorpe, P. E., Uhr, J. W., and Vitetta, E. S. (1993) Blood 82, 2624-2633[Abstract/Free Full Text]
  20. Bonardi, M. A., French, R. R., Amlot, P., Gromo, G., Modena, D., and Glennie, M. J. (1993) Cancer Res. 53, 3015-3021[Abstract/Free Full Text]
  21. Glennie, M. J., Brennand, D. M., Bryden, F., McBride, H. M., Stirpe, F., Worth, A. T., and Stevenson, G. T. (1988) J. Immunol. 141, 3662-3670[Abstract]
  22. French, R. R., Bell, A. J., Hamblin, T. J., Tutt, A. L., and Glennie, M. J. (1996) Leuk. Res. 20, 607-617[CrossRef][Medline] [Order article via Infotrieve]
  23. Mason, D. Y., Stein, H., Gerdes, J., Pulford, K. A. F., Ralfkiaer, E., Falini, B., Erber, W. N., Micklern, K., and Gatter, K. C. (1987) Blood 69, 836-840[Abstract/Free Full Text]
  24. Ellis, J. H., Barber, K. A., Tutt, A., Hale, C., Lewis, A. P., Glennie, M. J., Stevenson, G. T., and Crowe, J. S. (1995) J. Immunol. 155, 925-937[Abstract]
  25. French, R. R., Courtenay, A. E., Ingamells, S., Stevenson, G. T., and Glennie, M. J. (1991) Cancer Res. 51, 2353-2361[Abstract/Free Full Text]
  26. Glennie, M. J., Tutt, A. L., and Greenman, J. (1993) in Tumour Immunobiology: A Practical Approach (Gallagher, G., Rees, R. C., and Reynolds, C. W., eds), pp. 225-244, IRL Press, Oxford
  27. Tedder, T. F., and Isaacs, C. M. (1989) J. Immunol. 143, 712-717[Abstract]
  28. Higuchi, R. (1990) in PCR Protocols: A Guide to Methods and Applications (Innis, M. A., Geffand, D. H., Sninsky, J. J., and White, T. J., eds), pp. 177-183, Academic Press, San Diego
  29. Andreason, G. L., and Evans, G. A. (1988) BioTechniques 6, 650-660[Medline] [Order article via Infotrieve]
  30. Pelchen-Mattews, A., Armes, J. E., Griffiths, G., and Marsh, M. (1991) J. Exp. Med. 173, 578-587
  31. Collawn, J. F., Stangel, M., Kuhn, L. A., Esekogwu, V., Jing, S., Trowbridge, I. S., and Tainer, J. A. (1990) Cell 63, 1061-1072[CrossRef][Medline] [Order article via Infotrieve]
  32. Eberle, W., Sander, C., Klaus, W., Schmidt, B., Von Figura, K., and Peters, C. (1991) Cell 67, 1203-1209[CrossRef][Medline] [Order article via Infotrieve]
  33. Trowbridge, I. S., Collawn, J. F., and Hopkins, C. R. (1993) Annu. Rev. Cell Biol. 9, 129-161[CrossRef]
  34. Ktistakis, N. T., Thomas, D., and Roth, M. G. (1990) J. Cell Biol. 111, 1393-1407[Abstract/Free Full Text]
  35. Naim, H. Y., and Roth, M. G. (1994) J. Biol. Chem. 269, 3928-3933[Abstract/Free Full Text]
  36. Sherbina, N. V., Linsley, P. S., Myrdal, S., Grosmaire, L. S., Ledbetter, J. A., and Schieven, G. L. (1996) J. Immunol. 157, 4390-4398[Abstract]
  37. Law, C. L., Torres, R. M., Sundberg, H. A., Parkhouse, R. M., Brannan, C. I., Copeland, N. G., Jenkins, N. A., and Clark, E. A. (1993) J. Immunol. 151, 175-187[Abstract]
  38. Mellman, I. (1996) Annu. Rev. Cell. Dev. Biol. 12, 575-625[CrossRef][Medline] [Order article via Infotrieve]
  39. Chen, W. J., Goldstein, J. L., and Brown, M. S. (1990) J. Biol. Chem. 265, 3116-3123[Abstract/Free Full Text]
  40. Canfield, W. M., Johnson, K. F., Ye, R. D., Gregory, W., and Kornfeld, S. (1991) J. Biol. Chem. 266, 5682-5688[Abstract/Free Full Text]
  41. Motta, A., Bremnes, B., Morelli, M. A. C., Frank, R. W., Saviano, G., and Bakke, O. (1995) J. Biol. Chem. 270, 27165-27171[Abstract/Free Full Text]
  42. Garnier, J., Gibrat, J. F., and Robson, B. (1996) Methods Enzymol. 266, 540-553[Medline] [Order article via Infotrieve]
  43. Davis, C. G., Van Driel, I. R., Russel, D. A., Anderson, R. G. W., Brown, M. S., and Goldstein, J. L. (1987) J. Biol. Chem. 262, 4075-4082[Abstract/Free Full Text]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
R. B. Walter, B. W. Raden, R. Zeng, P. Hausermann, I. D. Bernstein, and J. A. Cooper
ITIM-dependent endocytosis of CD33-related Siglecs: role of intracellular domain, tyrosine phosphorylation, and the tyrosine phosphatases, Shp1 and Shp2
J. Leukoc. Biol., January 1, 2008; 83(1): 200 - 211.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. E. Collins, O. Blixt, S. Han, B. Duong, H. Li, J. K. Nathan, N. Bovin, and J. C. Paulson
High-Affinity Ligand Probes of CD22 Overcome the Threshold Set by cis Ligands to Allow for Binding, Endocytosis, and Killing of B Cells.
J. Immunol., September 1, 2006; 177(5): 2994 - 3003.
[Abstract] [Full Text] [PDF]

<