|
J Biol Chem, Vol. 273, Issue 43, 27809-27815, October 23, 1998
Internalization of the Lymphocytic Surface Protein CD22 Is
Controlled by a Novel Membrane Proximal Cytoplasmic Motif*
Claude H. T.
Chan,
Junsheng
Wang ,
Ruth R.
French, and
Martin J.
Glennie§
From the Lymphoma Research Unit, Tenovus Cancer Laboratory,
Southampton General Hospital, Tremona Rd.,
Southampton SO16 6YD, United Kingdom and the Medical
Research Council Laboratory of Molecular Biology, Hills Road,
Cambridge CB2 2QH, United Kingdom
 |
ABSTRACT |
CD22 is a key receptor on B-lymphocytes that
modulates signaling during antigenic stimulation. We have defined a
novel cytoplasmic motif in human CD22 that controls its unusually rapid
turnover at the plasma membrane. Chimeric and mutated CD22 cDNA
vectors were constructed and stably transfected in CD22-negative Jurkat T-lymphocytic cells. Two assays were employed to measure CD22 internalization: first, cytoplasmic uptake of radioiodinated anti-CD22 monoclonal antibody; and second, lethal targeting of a toxin, saporin,
into cells via CD22 using bispecific F(ab')2
([anti-CD22 × anti-saporin]) antibody. Results showed that
CD22 lacking a cytoplasmic tail was not internalized and that
replacement of the cytoplasmic tail of CD19 with that of CD22
resulted in a chimeric molecule that behaved like CD22 and
internalized rapidly. Step-wise deletion of the cytoplasmic tail of
CD22 located the internalization motif to a polar region of 11 residues (QRRWKRTQSQQ) proximal to the plasma membrane, a part of the
molecule predicted to form a coil or turn structure. Interestingly,
additional CD22 mutants showed that the two glutamine residues
sandwiching the serine are critical to internalization but that the
serine itself is not.
 |
INTRODUCTION |
CD22 is a 135-kDa B-lymphocyte-specific glycoprotein and a member
of the recently described sialoadhesin family of molecules (1-3). It
is a key accessory molecule that first appears at the late pro-B-cell
stage of differentiation as a cytoplasmic protein and is then expressed
simultaneously with IgD as a surface membrane receptor on most mature
B-cells (2). Although the nature of the CD22 ligand(s) is not fully
defined, it is known to bind sialoglycoconjugate NeuAc 2-6Gal 1-4GlcNAc, which is widely distributed on
N-linked carbohydrates (3, 4). The principal function of
CD22 is to regulate B-cell responses, which is probably achieved by
recruiting key signaling molecules to the antigen receptor complex (5, 6). The cytoplasmic domain is rapidly tyrosine-phosphorylated upon
ligation of the B-cell antigen receptor and associates with a range of
intracellular signaling molecules that includes tyrosine phosphatase
SH2-domain containing tyrosine phosphatase-1, tyrosine kinases Lck and
Syk, phospholipase C- 1, and phosphatidylinositol 3-kinase (1, 2, 7).
The importance of CD22 in modulating B-cell responses has recently been
confirmed in knockout mice, which show augmented antibody responses,
expanded peritoneal B-1 cell populations, and increased levels of
circulating autoantibodies (8-10).
In humans, two isoforms of CD22 have been identified (11, 12). A larger
species, CD22 , which has seven extracellular Ig-like domains and a
cytoplasmic domain containing 141 amino acids, and a smaller isoform,
CD22 , which has five extracellular Ig-like domains (domains 3 and 4 are deleted) and a cytoplasmic region that is 23 amino acids shorter
than that of CD22 . Although CD22 is by far the predominant
species, and the only form identified in mouse, a smaller
immunoprecipitate has been found that may correspond to the CD22 in
human (13). Both isoforms contain tyrosine residues in their
cytoplasmic tails, 3 residues in the form and 6 in the form.
Most of these tyrosine residues are arranged to form immunoreceptor
tyrosine-based inhibition motifs (ITIM), consisting of a 6-amino acid
stretch with the consensus sequence
(I/L/V)XYXX(L/V), and/or potential immunoreceptor
tyrosine-base activation motifs (ITAM) (12, 14-16). In addition, CD22
contains a YXXM sequence recognized by the
NH2-terminal SH2 domain of the p85 subunit of
phosphoinositide 3-kinase. Thus, CD22 has the capacity to modulate
B-cell behavior via a wide range of intracellular, tyrosine-dependant
signaling molecules.
In addition to any signaling role, CD22 shows an unusual and
unexplained capability to internalize rapidly from the cell surface to
the cytoplasm. Recent studies have shown that CD22 internalizes constitutively on unstimulated B-cell lines, and this is followed by
degradation without detectable recycling (17). This internalization probably explains, at least in part, the success achieved when CD22 has
been employed as a target molecule for delivering toxins into
neoplastic B-cells using antibody immunotoxins (18, 19) and bispecific
antibodies (BsAbs)1 (20-22).
We find BsAbs with specificity for CD22 and the ribosome-inactivating protein, saporin ([anti-CD22 × anti-saporin]), is unusually
effective at delivering saporin into neoplastic B-cells and thereby
inhibiting protein synthesis and eradicating tumors in animals (21) and patients (22). Most other membrane molecules do not work as efficiently
(20). In the present study, we have investigated the molecular
structure of the cytoplasmic domain of CD22 and identified a new motif
that controls its internalization from the cell surface and may account
for its unusual immunotherapeutic properties.
 |
MATERIALS AND METHODS |
Human Cell Lines--
The Burkitt's lymphoma cell line Daudi
and the acute T-cell leukemia cell line Jurkat were used in these
studies. Both lines were maintained in RPMI 1640 medium containing 10%
fetal calf serum (Life Technologies, Inc.) and supplemented with 1 mM glutamine, 1 mM sodium pyruvate, 100 IU/ml
benzyl penicillin, and 100 µg/ml streptomycin sulfate. Cells were
maintained continuously in the logarithmic phase of growth by passage
at regular intervals.
Antibodies and Preparation of Bispecific Antibodies--
The
mAbs used in this study include anti-CD19 (RFB9) (20), anti-CD22 mAb
(4KB128) (23), anti-CD38 mAb (AT13/5) (24), and anti-saporin mAb
(anti-sap1 and anti-sap5) (25). Hybridoma cells were expanded in
stationary culture using 5% supplemented Dulbecco's modified Eagle's
medium (Life Technologies, Inc.) and IgG purified using protein A
affinity chromatography as described previously (26). Bispecific
F(ab')2 heterodimers were constructed using well
established procedures in which Fab' fragments from two different mAbs
are cross-linked via their hinge region SH groups using the
bis-maleimide linker o-phenylenedimaleimide (26).
cDNA and Construction of CD22 Mutants--
cDNA clones
of human CD19 and CD22 were kind gifts from Dr. Brian Seed. The CD19
clone provided, which will be called CD19BS throughout this
paper, is not the full-length, wild type transcript, but a truncated
version that has its cytoplasmic domain reduced from the normal 242 to
148 amino acids long (27). Fortunately, for the present study we were
only interested in CD19BS as a control surface protein that
could be engineered into a chimeric protein containing the
extracellular and transmembrane region of CD19BS and the
cytoplasmic tail of CD22 .
As discussed above, the CD22 molecule is a minor isoform of CD22
that may not be expressed in normal B-cells. Because of its truncated
cytoplasmic domain and reduced number of tyrosines, it is likely to
have a number of signaling properties that are different from those of
the predominant CD22 isoform. For the purposes of this study, the
membrane proximal regions of the molecule that control internalization
(see under "Results") are identical in CD22 and CD22 .
Both CD19BS and CD22 cDNA clones were subcloned into
pcDNA3 (Invitrogen, San Diego, CA) using the
HindIII-NotI sites for CD19BS and the
XhoI site for CD22 . Deletion of the CD22 cytoplasmic tail was accomplished by PCR using primer pairs 22 F
(TTGAATCTCGAGACGCGGAAACAGGCTTGCAC) and 22 cytR
(TCGCTAGATCTAGAGCCCACAGATTGCCAGGA).
To delete the whole cytoplasmic tail, a stop codon (TAG) was
introduced after Leu510 in the transmembrane region. PCR
was performed in a Protocol Thermal Cycler (AMS Biotechnology Ltd.)
using CD22 full-length cDNA as template. All reagents were from
the Repli-Pack kit (Boehringer Mannheim). The PCR construct generated
contained both the extracellular and transmembrane domains and was then
subcloned into pGEM-T vector (Promega, Madison, WI) for sequencing and
into expression vector pcDNA3 for transfection.
To replace the cytoplasmic region of CD19BS with that of
CD22 , a two-step recombinant PCR strategy was used (28). In this method, a pair of chimeric PCR primers was designed to span the chimeric junctions. The 5'-half of one chimeric primer, 19/22 F (CAACGTCGCTGGAGCTTAAGATGAAGAATGCCCA), bound to the 3'-end of the transmembrane region of the antisense strand of CD19BS
cDNA between base pairs 939 and 954, whereas the 3'-half of the primer bound to the 5'-end of the cytoplasmic region of the antisense strand of CD22 cDNA (base pairs 1622-1638). A second chimeric primer, 19/22 R (TGGGCATTCTTCATCTTAAGCTCCAGCGACGTTG),
the complimentary oligonucleotide to 19/22 F, was made so that
its 5'-end bound to the sense strand of CD22 between base pairs 1622 and 1638 and the 3'-end recognized the sense strand of
CD19BS between base pairs 939 and 954. Appropriate end
primers, 19F (TCATCAAGCTTGGAGAGTCTGACCACCATGC) and
22 R (TCGGAGATCTCCCTGGCCCCCGCTGCCCCAG) were also
designed to hybridize with the 5'-end of the antisense strand of the
full-length CD19BS cDNA (base pairs 1-30) and the
3'-end of the sense strand of CD22 cDNA (base pairs 2072-2093),
respectively. In the first PCR, 2 separate products corresponding to
the CD19BS extracellular region and transmembrane domain
(CD19BS cyt) and the CD22 cytoplasmic domain
(CD22 cyt) were generated using the respective primer pairs of [19F + 19/22 R] and [19/22 F + 22 R]. These PCR fragments were
extracted from agarose gels using Qiaex gel extraction kit (Qiagen
GmbH, Hilden, Germany), and then 100 ng of each was used in a second
PCR. Initially, this reaction was carried out for 10 cycles without end
primers (19F and 22 R) or DNA template. End primers were then added,
and a further 10 cycles were completed to give a full-length chimeric CD19 construct with CD22 cytoplasmic region. The chimeric construct (CD19 cyt/22 cyt) was then cloned into pGEM-T vector via
HindIII and BamHI sites for sequencing and
further subcloned into eukaryotic expression vector pcDNA3 via
HindIII and NotI.
To delete individual tyrosine residues Tyr556,
Tyr566, and Tyr600, 3' primers containing stop
codons were used to amplify CD22 template with the 5' primer 22F via
PCR. This yielded deletion mutants (CD22 Y 556, CD22 Y 566, and
CD22 Y 600) in which stop codons replaced the respective tyrosine
residues. Deletion mutants CD22 Q513, CD22 G524, and
CD22 E527 were constructed in a similar manner using 3' primer to
respectively replace the corresponding amino acid residues with stop
codons. Mutations of Ser521 to Ala521 and
Gln520/Gln522 to
Leu520/Leu522 were carried out using 3' primers
containing the corresponding changes in the codons. The sequences of
all constructs were confirmed by dideoxy DNA sequencing (Sequenase,
version 2.0, Amersham Pharmacia Biotech). All constructs were then
subcloned into pCINEO mammalian expression vector (Promega)
for transfection.
Transfection of Jurkat Cells--
Jurkat cells were transfected
with cDNA constructs by electroporation based on the procedure
described by Andreason and Evans (29). Approximately 5 × 106 cells were pelleted, resuspended in a total volume of
0.8 ml with RPMI, and loaded into a 4-mm electroporation cuvette
together with 50 µg of DNA. After standing for 5 min on ice, cells
were electroporated at 300 V, 960 microfarads using a Gene Pulser
(Bio-Rad), and then the cuvette was returned to an ice bath for a
further 10 min without mixing. The cells were then left at room
temperature for 10 min before adding 30 ml of complete RPMI medium. For
the next 48-72 h, the cells were cultured in 75-cm2 flasks
under standard conditions at 37 °C in a moist atmosphere of 5%
CO2 before being transferred to 96-well plates in complete medium containing 1 mg/ml Geneticin (Life Technologies, Inc.). Emerging
colonies were tested for surface expression by flow cytometry (described previously; Ref. 24) after 3-4 weeks, and positive cells
were cloned by limiting dilution.
Internalization of 125I-Labeled mAbs by Transfected
Cells--
Anti-CD19 and -CD22 mAbs were trace radiolabeled using
carrier free 125I (Radiochemical Center, Amersham Pharmacia
Biotech) and IODO-BEADS (Pierce) as oxidizing reagents according to the
manufacturer's instructions. The radioimmunoassays for evaluating
surface binding and internalization of the 125I-labeled
mAbs were carried out by a method based on that described by
Pelchen-Mattews et al. (30). Cells (107/ml) were
incubated with 125I-labeled mAb (2 µg/ml) at 4 °C for
1 h to allow binding and then warmed to 37 °C to allow
internalization. Aliquots were taken at various intervals, washed twice
in 10% supplemented RPMI medium before centrifugation at 13,000 rpm
for 45 s through a cold solution of 5% bovine serum albumin (in
phosphate-buffered saline) and counting the radioactivity bound to the
pellet. For the internalized count, the medium in the second wash was
replaced by a HCl-titrated buffered RPMI medium (pH2.0), which removes
surface bound activity and thus allows the internalized
125I-antibodies to be measured and surface binding
estimated by subtraction of the internalization counts from the total
counts.
[3H]Leucine Uptake by Cells Cultured with
BsAb·Saporin Complexes--
We have established that a BsAb that is
designed to recognize a toxin, such as saporin, and a suitable cell
surface molecule will target the toxin to the cells and allow efficient
internalization so that the cells are killed. Protein synthesis levels
in target cells exposed to BsAb·saporin complexes were assessed by
measuring incorporation of [3H]leucine uptake according
to methods described previously (20). Briefly, transfected Jurkat cells
(1 × 105/well) were cultured for 24 h in
96-well, flat-bottomed plates with 200 µl of leucine-free RPMI medium
containing 1 µg/ml BsAb and the required concentration of saporin.
Each well was then pulsed with [3H]leucine (1 µCi/well)
for 16 h, and the incorporation of radioactivity into protein was
assessed by harvesting the cells onto glass fibers, washing, and
counting. Throughout the work, a mixture of two BsAbs was used as
described previously (25). Each pair of reagents was selected to bind
to the cell via a single epitope on CD19, CD22, or CD38 and to the
saporin via two different epitopes. This maneuver allows the
BsAb·saporin complexes to be captured bivalently and, due to their
increased avidity, bind 20 times more avidly to the target cells than
with a single BsAb (25).
 |
RESULTS |
Transfection of Jurkat T-cells with Human CD19BS and
CD22 --
We decided to investigate the molecular basis of CD22
internalization and in particular the structural features of the
cytoplasmic tail that control delivery into the cell. Our strategy was
to construct a panel of CD22 cDNA containing vectors in which
the cytoplasmic tail of CD22 had been selectively altered. These vectors were used to make stable tranfectants of CD22-negative Jurkat
cells, which were then investigated, after cloning, for their ability
to internalize the newly expressed CD22 .
Details of all the constructs in this investigation are shown in Fig.
1. A total of 12 cDNA constructs were
made, including molecules in which the cytoplasmic tail of CD22 was
spliced onto the extracellular and transmembrane region of CD19
(CD19 cyt/22 cyt), together with a range of CD22 mutants
containing truncated cytoplasmic tails and molecules in which certain
amino acids were changed.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 1.
Structure of CD22 and mutants of CD22
used in this study. The extracellular domains of
CD19BS (two domains) and CD22 (five domains) are shown
as circles. The transmembrane (TM) domains are
shown as open boxes. The cytoplasmic regions
(lines) show the total number of CD22 -derived amino acids
in parentheses, e.g. 118 in the CD22 . For the
CD22 molecules, the cytoplasmic region starts at amino acid position
510, and for CD19BS it starts at 295. The final amino acid
number is also given. In two CD22 constructs (CD22 S521A and
CD22 Q520L/Q522L), the cytoplasmic region was terminated at amino
acid 526, and then a serine at position 521 was converted to an alanine
(CD 22S521A), or two glutamines at positions 520 and 522 were changed
to leucines (CD 22Q520L/Q522L). a, clone name used to
represent the Jurkat cells transfected and selected with each molecular
construct. b, IC50 values were taken as the
concentration of saporin at which the uptake of
[3H]leucine was inhibited by 50% in the cytotoxicity
assays (e.g. Fig. 4). The IC50 values shown are
representative results (± S.D. of triplicate samples) from two or
three cytotoxicity assays for each transfectant. IC50
values varied by no more than 10-fold between cytotoxicity
assays.
|
|
The Jurkat T-cell leukemia line was chosen as a suitable CD22-negative
lymphoid cell line in which to express these molecules. Jurkat cells
were stably transfected and then screened by flow cytometry to isolate
clones that expressed the various mutated CD22 molecules. As shown
in Fig. 2, both wild type
CD19BS (Fig. 2A) and CD22 (Fig.
2C) were expressed at easily detectable levels, showing that
neither surface B-cell marker required associated B-cell restricted
molecules for their expression. The CD22 clone was employed as a
positive control for assessing CD22 internalization throughout the
remainder of this investigation, whereas CD19BS Jurkat
cells provided our negative controls (see below). Fig. 2 also shows the
levels of mutated CD22 expression for the other transfectants. With
the exception of one clone, CD22 cyt (Fig. 2J), which
gave only weak immunofluorescence staining, relative to other
transfectants, all cells expressed levels of surface CD22 that were
as high as or even higher than that of CD22 generally expressed on
normal B-cells and B-cell lines (data not shown). The expression of all
the constructs was also confirmed by immunoprecipitation of Nonidet
P-40 lysates of the radioiodinated transfectants (results not
shown).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 2.
Levels of CD22 and CD19BS
expression on transfected Jurkat cells. The histograms show
staining patterns for Jurkat cells transfected with the various
molecular constructs (see Fig. 1). Each clone was labeled with a
nonstaining control fluorescein isothiocyanate-IgG mAb (open
histogram) and either fluorescein isothiocyanate-anti-CD22 or
fluorescein isothiocyanate-anti-CD19 mAb, as appropriate for the
transfected molecule (filled histogram).
|
|
The Cytoplasmic Tail of CD22 Controls Its Endocytosis--
To
investigate whether the cytoplasmic tail of CD22 controlled its
internalization, we compared the uptake of 125I-labeled
mAbs by Daudi cells and by Jurkat cells transfected with CD22 ,
CD22 cyt, CD19BS, and CD19 cyt/22 cyt (Fig.
3). Cells were incubated with
radiolabeled anti-CD22 or anti-CD19 mAb for 1 h at 4 °C and
then warmed to 37 °C for various intervals. The cells were then
acid-washed to remove surface bound mAb, and therefore, any increase in
the cell-associated radioactivity must be due to the endocytosis of the
antigen-antibody complex. The results show that both Daudi cells
(CD22 +) and CD22 -expressing Jurkat cells accumulated
125I-labeled anti-CD22 mAb at a similar rate (Fig.
3A). There was a sharp initial uptake of mAb in the first
2 h, after which the level remained quite steady. The accumulation
of intracellular 125I-labeled mAb by these cells was
accompanied by a corresponding loss of surface-associated mAb. In
contrast, the Jurkat cells expressing the CD22 cyt, in which the
cytoplasmic region of the molecule had been removed (Fig. 1), were
unable to accumulate significant levels of intracelluar radiolabel, and
the mAb remained on the surface of the cells. This result is consistent
with the cytoplasmic tail playing a central role in CD22 turnover at
the cell surface and with immunoelectron microscopy data that showed that CD22 is strongly clustered around coated pits in transfected Jurkat cells but that following removal of the cytoplasmic tail the
truncated molecules are evenly distributed along the plasma membrane
(data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3.
Internalization of 125I-labeled
anti-CD19 and anti-CD22 mAb by Daudi and transfected Jurkat cells.
125I-mAb (A, anti-CD22; B, anti-CD19)
was incubated with cells for 1 h at 4 °C to allow binding. The
temperature was then increased to 37 °C, and duplicate aliquots were
taken at the time intervals shown. The total radioactivity associated
with each aliquot of cells, and that remaining inside the cells after
washing in acidic RPMI medium (pH 2) was determined as described under
"Materials and Methods." The levels of intracellular (solid
symbols) and surface (total minus intracellular) (open
symbols) 125I-mAb were calculated as the average
125I-mAb molecules/cell. The levels of intracellular and
surface 125I-mAb are expressed as a percentage of the
surface bound 125I-mAb at time 0. The target cell lines are
as indicated (A, Jurkat cells transfected with
CD22 cyt, Jurkat cells transfected with CD22 , or Daudi cells;
B, Jurkat cells transfected with CD19BS, Jurkat
cells transfected with CD19 cyt/22 cyt, or Daudi cells). This is
one of three similar experiments.
|
|
The importance of the CD22 cytoplasmic tail in mediating
internalization was confirmed using cells expressing the chimeric CD19 cyt/22 cyt molecule in which the CD22 cytoplasmic tail had been grafted onto the extracellular and transmembrane domains of
CD19BS (Fig. 3B). Whereas CD19 (endogenous
expression on Daudi cells) and CD19BS (transfected Jurkat)
were relatively poor at taking up radioiodinated anti-CD19 mAb, once
the cytoplasmic tail of CD19BS was replaced by that of
CD22 , it behaved like the intact CD22 and internalized mAb very
effectively. In fact, for reasons that are not understood, uptake of
125I-labeled mAb by this chimeric molecule was quicker and
more extensive than by the transfected CD22 . These results suggest
that there is an internalization signal within the cytoplasmic region
of CD22 .
The Cytoplasmic Tail of CD22 Controls Effective Delivery of Toxin
into Target Cells--
For the next stage of this investigation we
used the Jurkat transfectants as target cells in an assay which
measures the cytotoxicity of a toxin, saporin, when delivered to the
cells via CD19BS or CD22 . In the assay, cells are
exposed to a BsAb ([anti-CD22 × anti-saporin] or
[anti-CD19 × anti-saporin]) at 1 µg/ml together with saporin
at various concentrations for 24 h at 37 °C, during which
period the BsAb·saporin complexes are taken up by the transfectants according to the readiness of the target antigen (CD22 or
CD19BS) to internalize. The cultures were then pulsed for a
further 12 h with [3H]leucine to establish the level
of protein synthesis in any surviving cells. As a positive control to
show that all Jurkat cells, transfected or not, were sensitive to
killing with BsAb·saporin complexes, we used a BsAb directed at CD38
([anti-CD38 × anti-saporin]), which is expressed constitutively
by these T-cells.
Fig. 4 shows a typical set of results
with transfected Jurkat cells. The CD22 molecule is highly effective
at delivering BsAb·saporin complexes, giving an IC50 for
saporin of approximately 2 × 10 10 M, a
value close to that achieved with the anti-CD38 BsAb. This showed that
saporin delivered by both anti-CD22 and anti-CD38 BsAbs was
approximately 2500-fold more toxic than saporin alone (5 × 10 7 M). The increase in the toxicity of
CD22-specific BsAbs on the CD22 -transfected Jurkat cells was similar
to that observed when B-cell lines were treated with this reagent (20),
suggesting that the transfected CD22 molecules behave similarly to
native CD22 on B-cells. In contrast, when the tail of CD22 was
removed and the truncated molecule expressed in the
CD22 cyt-transfected cells, then the same anti-CD22 BsAb was
completely unable to increase saporin toxicity. This result is
important because it is consistent with the internalization data shown
in Fig. 3 and shows that the rate at which a molecule is internalized
from the cell surface is a key feature in determining whether it will
make an effective target for antibody delivery of toxins.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Cytotoxicity assay testing BsAb·saporin
complexes on Jurkat cells transfected and selected for expression of
CD22 , cytoplasmic tail deletion mutant (CD22 cyt),
CD19BS, and a chimeric molecule containing the
extracellular and transmembrane region of CD19BS and the
cytoplasmic region of CD22 (CD19BS cyt/22 cyt).
Transfected cells (105 cells/well) were cultured for
18 h with BsAb at 1µg/ml and saporin at the concentrations shown
before pulsing with [3H]leucine and harvesting of cells
to assess the level of incorporated radioactivity. Triplicate samples
were assayed for each concentration of saporin investigated, and the
mean values are shown. BsAbs used include saporin alone ( ),
[anti-CD38 × anti-saporin] ( ), [anti-CD22 × anti-saporin] ( ), and [anti-CD19 × anti-saporin] ( ).
This is one set of three similar experiments.
|
|
In Fig. 4, we also see that the cytoplasmic tail of CD22 will transform
CD19BS, a molecule that is unable to deliver saporin with
BsAb (20) into a useful vehicle for delivering BsAb·saporin complexes
for cytotoxicity. Thus, whereas Jurkat cells expressing
CD19BS were not susceptible to anti-CD19-specific
BsAb·saporin complexes, those carrying CD19 cyt/22 cyt were
hypersensitive, with an IC50 for saporin that was
below 10 11 M.
A Turn Structure Motif Is Essential for Internalization--
To
investigate whether the cytoplasmic tail tyrosine residues of CD22
are involved in the internalization, CD22 -mutants were constructed
in which the cytoplasmic tail was truncated fractionally by introducing
a stop codon at the tyrosine residues (CD22 Y556, CD22 Y566,
and CD22 Y600) using PCR-directed mutagenesis. The three
constructs were expressed at a high level in Jurkat cells (Fig. 2).
Cytotoxicity assays showed that these truncated CD22 molecules were
all equally as good as the unmutated CD22 at delivering BsAb·saporin complexes into the cells (Fig. 1), showing that the carboxyl-terminal end of the cytoplasmic tail is not directly involved
in the internalization motif.
The results using tyrosine mutants described above suggested that the
region of cytoplasmic tail nearer to the cell membrane might be
critical in the endocytosis process. Crystallographic work (31) and NMR
studies (32) suggest that a tight-turn structural motif is involved in
the clustering signals for surface molecules, and individual
specificity is conferred by side-chain differences. It is thus
interesting to note that two tight-turn structures are predicted near
to the membrane within the CD22 cytoplasmic tail
(Gln513-Gln523 and
Asn528-Gln532). To determine whether a turn
motif is involved in the endocytosis process, truncated CD22 mutants
were constructed, using PCR-directed mutagenesis, in which a stop codon
was introduced at positions Gln513 (CD22 Q513),
Gly524 (CD22 G524), and Glu527
(CD22 Q527) to yield mutants with two amino acids in the cytoplasm or just one of the turns (Fig. 1). These mutants were transfected and
selected in Jurkat cells (Fig. 2), and the resulting clones were tested
in cytotoxicity assays. The results (Fig.
5) showed that with two amino acids
remaining in the cytoplasmic tail (CD22 Q513), saporin toxicity
was not enhanced by the presence of CD22-specific BsAbs, demonstrating
that the surface CD22 molecule was no longer active for delivery. This
result was the same as that obtained using the cytoplasmic deleted
mutant, CD22 cyt, even though the expression levels were different
(Fig. 2.). This indicated that the motif for internalization lies
further to the COOH-terminal end of the molecule. Interestingly, the
deletion mutants CD22 G524 and CD22 E527, which each contain
one predicted turn in the cytoplasm, were fully active in this assay.
Thus, in the presence of BsAbs, the IC50 values for saporin
toxicity were 1.5 × 10 10 and 5.5 × 10 10 M, respectively, with these two
transfectants (Fig. 5.), comparable to those seen with the CD22
transfectant (Fig. 4) or Daudi cells (20) and indicate quite clearly
that the internalization motif of CD22 lies between residues 512 and
523, just under the membrane.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
BsAb·saporin cytotoxicity assay on Jurkat
cells transfected with CD22 tight turn deletion mutants
CD22 Q513, CD22 G524, and CD22 E527. The
cytotoxicity assays were performed as described in Fig. 4 using
anti-CD22-specific ( ) and anti-CD38-specific ( ) BsAbs to deliver
saporin or with saporin alone ( ). Jurkat cells were transfected with
the three constructs shown. Triplicate samples were assayed for each
concentration of saporin investigated, and the mean values are plotted.
Two other experiments yielded similar results.
|
|
Mutagenesis of the Internalization Motif--
The 11-amino acid
turn structure motif in CD22 is unusual in that, unlike most other
internalization signals described, it contains no tyrosine residues
(33). Examination of the sequence (QRRWKRTQSQQ), however, showed the
presence of a serine bearing a hydroxyl group at position 521. It is
possible that serine replaces a tyrosine residue in this motif and that
the hydroxyl group of both amino acids may play a similar role in the
internalization signal. To investigate this, a mutant was constructed
in which Ser521 was mutated to Ala521 (Fig. 1),
and its ability to endocytose was determined in the cytotoxicity assay.
Surprisingly, this substitution did not affect delivery of
BsAb·saporin complexes (Fig. 6),
indicating that although serine might have replaced tyrosine in the
position of the internalization motif in CD22 , the mechanism of
internalization/endocytosis of CD22 involves interaction with
structures other than the side group of a determinant amino acid.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Cytotoxicity assay for BsAb·saporin
complexes on Jurkat cells carrying CD22 with amino acid
substitutions in the newly identified internalization motif.
Jurkat cells were transfected and selected for expression of two
CD22 constructs, CD22 S521A and CD22 Q520/522L (Fig. 1). The
cytotoxicity assays were performed as described in Fig. 4 using
anti-CD22-specific ( ) or anti-CD38-specific ( ) BsAbs to deliver
saporin or saporin alone ( ). Triplicate samples were assayed for
each concentration of saporin investigated, and the mean values are
plotted. Two other experiments yielded similar results.
|
|
It has been proposed that charged or polar amino acids surrounding the
crucial tyrosine residue in an internalization motif may also be
important for function (34, 35). Of the 11 amino acid residues in the
CD22 motif, 8 are polar or positively charged (Fig.
7). Such a cluster of polar amino acids
clearly suggests that a charged interaction (hydrogen bonding or
electrostatic interaction) is likely to be important for
internalization. Comparison with tyrosine-containing motifs has shown
that amino acids either side of the tyrosine tend to be more
prominently polar and also important for function. It was thus
decided to make a CD22 mutant with amino acid changes on
either side of the serine. This mutant, CD22Q520L/Q522L (Fig. 2), had a
cytoplasmic tail truncated at amino acid 526 with Gln520
and Gln522 mutated to leucine residues. Cytotoxicity assay
results with this mutant showed that it had a greatly reduced ability
to deliver saporin in the presence of BsAb (Fig. 6). The
IC50 value for saporin toxicity was only 3.3 × 10 8 M in the presence BsAb, compared with
2.1 × 10 10 M for the CD22
transfectants, confirming the previous proposal that polar amino acids
are important.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of the tyrosine-based schematic
internalization motif (modified from Ref. 34) and the proposed
internalization motif from CD22 (CD22 and CD22 both carry the
proposed motif). The size of the symbols for polar and basic
residues in the Tyr-based motif indicates relative importance.
Arrows indicate the presence of the important charged
residues in the CD22 motif.
|
|
 |
DISCUSSION |
CD22 plays a key role in the regulation of B-cell responses to
antigen (1, 2). One relatively unexplored mechanism of controlling CD22
function and ensuring that it provides accessory signals at the
appropriate time is by restricting its cellular localization,
i.e. making sure that CD22 is at the right place at the
right time. Recently, Sherbina et al. (36) have shown that
following stimulation of the B-cell antigen receptor, intracellular CD22 moves rapidly from the cytoplasm to the plasma membrane, resulting
in a 50-100% increase in surface expression within 5 min of
stimulation. In addition to membrane delivery, it is clear that CD22
also undergoes rapid and constitutive internalization from the plasma
membrane (17). Shan and Press (17) have reported that CD22 is turning
over at the cell surface with a t1/2 of less than
1 h, that internalization occurs regardless of anti-CD22 mAb
binding, and that the CD22, once internalized, is transported to
lysosomes for degradation rather than being recycled back to the plasma
membrane as occurs with many lymphocyte receptors (17). Although it is
unclear why CD22 transport is controlled in this way, it obviously has
enormous potential for regulating its function.
In the current study, we have investigated the structural basis of
CD22 internalization using chimeric and mutated constructs expressed
in Jurkat T-cells. The results show that the cytoplasmic tail of
CD22 controls its endocytosis into the cells. CD22 molecules without a cytoplasmic tail were not internalized and hence failed to
deliver radioactive mAb or BsAb·saporin complexes inside the cell.
Furthermore, when the cytoplasmic region of a second B-cell marker,
CD19, was replaced by that of CD22 , the resulting chimeric molecule
behaved like CD22 and internalized efficiently (Fig. 1). Step-wise
deletion located the endocytosis motif to an 11-amino acid sequence
(QRRWKRTQSQQ) proximal to the plasma membrane: provided this short
peptide remained on the truncated CD22 , it performed perfectly well
in delivering toxin BsAb·saporin complexes into the transfected
cells. A complete list of all the constructs, together with data on
deliver BsAb·saporin complexes into transfected cells for cell
killing, is summarized in Fig. 1. Because the predominant CD22
isoform has the same membrane proximal 11-amino acid sequence, it seems
reasonable to assume that this motif controls internalization of both
CD22 and CD22 isoforms. Interestingly, the mouse CD22 molecule
shows a very similar sequence in this region (37), with just four
conserved amino acid differences, and consequently may perform the same
function.
Typically plasma membrane receptors are moved into early endosomes via
clathrin-coated pits and vesicles (38). Our immunoelectron microscopy
data confirm that CD22 is strongly clustered around coated-pits.
Identified signal sequences for entry into or formation of
clathrin-coated pits are degenerate and quite variable, making it
difficult to define precise motifs (33, 36, 38). However, generally
they fall in to two classes. The most common are tetra- or hexapeptides
containing an aromatic residue, usually tyrosine or phenylalanine (33),
placed in the context of one or more amino acids with largely
hydrophobic side chains. Typical examples would include
FDNPVY for low-density lipoprotein
receptor (39), YKYSKV for CD-mannose
6-phosphate receptor (40), and YXRF
for the transferrin receptor (31). The second general class of control signals involves adjacent leucine-type residues, which include dileucine or leucine plus a small hydrophobic residue near the carboxyl
terminus of the cytoplasmic domain. The current list of receptors using
these motifs is quite short and tends to include leukocyte receptors,
such as Fc receptor and CD74 (invariant chain of MHC class II) (41).
Clearly the CD22 control sequence, QRRWKRTQSQQ, does not fall easily
into either group and may represent a novel class, or more likely a
modified member of the tyrosine-based signaling motifs. A comprehensive
investigation by Ktistakis et al. (34) has defined two
salient features required for function of these structures: first, they
contain residues that show a preference to "break" regular
structure in protein domains; and second, they have a high
concentration of polar or positively charged residues on both sides of
the tyrosine. A schematic representation of the endocytic
tyrosine-based signals is shown in Fig. 7A. This generic
internalization signal consists of 8-10 cytoplasmic amino acids with
the tyrosine residue present in the membrane distal portion of the
sequence. There appears to be a strong preference for certain types of
amino acid at specific positions, suggesting that the orientation of
the motif with respect to the membrane is critical and that it is
independent of polarity of the protein, and, for both type I and II
transmembrane proteins, extends 6 amino acids membrane proximal and 2 residues membrane distal to the tyrosine. The most critical amino acids
appear to be located at positions +2, +1, 1, 4, and 6 with
respect to the tyrosine. It is thought that the amino acids that
disturb regular structure may be required to disrupt the polypeptide
chain after it leaves the transmembrane sequence and provide a fairly
extended structure immediately proximal to the membrane. Structural
predictions on these internalization motifs suggest that the polar
groups either side of the tyrosine generate hydrogen-bonded tight
turns, membrane proximal to the tyrosine. It is thus predicted that the
recognition sequence for the clathrin adapter protein complex-2 is
simply a small surface loop (34).
Using the Garnier-Gibrat-Robson prediction algorithm (42), we found
that the CD22 motif (Gln513-Gln523) showed a
preference for a turn structure that was strikingly similar to that for
a known tyrosine-based signal (Fig. 7B). It is highly polar
and basic and differs from the schematic tyrosine-based motif only in a
switch of serine for tyrosine. Mutagenesis studies on tyrosine-based
motifs have shown that the tyrosine residue can be substituted with
phenylalanine or tryptophan, suggesting that any aromatic residue could
suffice for the internalization signaling (43). Surprisingly, in the
present study, investigation to determine whether the serine was
critical to the CD22 motif showed that it was not, and substituting the
serine with alanine did not influence internalization of BsAb·saporin
complexes in cytotoxicity assays (Fig. 6). However, in contrast,
mutating the polar groups either side of the serine completely
destroyed function and prevented saporin toxicity, suggesting that
polarity was critical for internalization. Numerous questions remain
about this newly defined internalization motif and its interaction with
the endocytic pathway. However, it appears that internalization is more
dependent on charge and secondary structure than on linear sequence,
and this is consistent with CD22 associating with the
clathrin-associated adapter, clathrin adapter protein complex-2, or an
clathrin adapter protein complex-2-like molecule that recognizes the
membrane proximal, charged loop for constituent delivery of CD22 into
the cell.
 |
ACKNOWLEDGEMENTS |
We thank Brian Seed and Ivan Stamenkovic for
the kind gift of CD19 and CD22 cDNA and George Stevenson and Mark
Marsh for helpful discussion.
 |
FOOTNOTES |
*
This work was supported with funds from the Tenovus Cancer
Charity, Cardiff, United Kingdom and the Leukaemia Research Fund.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 44-1703-796910;
Fax: 44-1703-704061.
The abbreviations used are:
BsAb, bispecific
antibody; mAb, monoclonal antibody; PCR, polymerase chain
reaction.
 |
REFERENCES |
-
Tedder, T. F.,
Tuscano, J.,
Sato, S.,
and Kehrl, J. H.
(1997)
Annu. Rev. Immunol.
15,
481-504[CrossRef][Medline]
[Order article via Infotrieve]
-
Law, C.-L.,
Sidorenko, S. P.,
and Clark, E. A.
(1994)
Immunol. Today
15,
442-449[CrossRef][Medline]
[Order article via Infotrieve]
-
Powell, L. D.,
and Varki, A.
(1995)
J. Biol. Chem.
270,
14243-14246[Free Full Text]
-
van der Merwe, P. A.,
Crocker, P. R.,
Vinson, M.,
Barclay, A. N.,
Schauer, R.,
and Kelm, S.
(1996)
J. Biol. Chem.
271,
9273-9280[Abstract/Free Full Text]
-
Pezzutto, A.,
Rabinovitch, P. S.,
Dorken, B.,
Moldenhauer, G.,
and Clark, E. A.
(1988)
J. Immunol.
140,
1791-1795[Abstract/Free Full Text]
-
Peaker, C. J. G.,
and Neuberger, M. S.
(1993)
Eur. J. Immunol.
23,
1358-1363[Medline]
[Order article via Infotrieve]
-
Law, C.-L.,
Sidorenko, S. P.,
Chandran, K. A.,
Zhao, Z.,
Shen, S.-H.,
Fischer, E. H.,
and Clark, E. A.
(1996)
J. Exp. Med.
183,
547-560[Abstract/Free Full Text]
-
O'Keefe, T. L.,
Williams, G. T.,
Davies, S. L.,
and Neuberger, M. S.
(1996)
Science
274,
798-801[Abstract/Free Full Text]
-
Otipoby, K. L.,
Andersson, K. B.,
Draves, K. E.,
Klaus, S. J.,
Farr, A. G.,
Kerner, J. D.,
Perlmutter, R. M.,
Law, C. L.,
and Clark, E. A.
(1996)
Nature
384,
634-637[CrossRef][Medline]
[Order article via Infotrieve]
-
Sato, S.,
Miller, A. S.,
Inaoki, M.,
Bock, C. B.,
Jansen, P. J.,
Tang, M. L. K.,
and Tedder, T. F.
(1996)
Immunity
5,
551-562[CrossRef][Medline]
[Order article via Infotrieve]
-
Stamenkovic, I.,
and Seed, B.
(1990)
Nature
344,
74-77[Medline]
[Order article via Infotrieve]
-
Wilson, G. L.,
Fox, C. H.,
Fauci, A. S.,
and Kehrl, J.
(1991)
J. Exp. Med.
173,
137-146[Abstract/Free Full Text]
-
Schwartz-Albiez, R.,
Dorken, B.,
Monner, D. A.,
and Moldenhauer, G.
(1991)
Int. Immunol.
3,
623-633[Abstract/Free Full Text]
-
Doody, G. M.,
Justement, L. B.,
Delibrias, C. C.,
Mathews, R. J.,
Lin, J.,
Thomas, M. L.,
and Fearon, D. T.
(1995)
Science
269,
242-244[Abstract/Free Full Text]
-
Vely, F.,
and Vivier, E.
(1997)
I. Immunol.
159,
2075-2077[Abstract/Free Full Text]
-
Reth, M.
(1989)
Nature
338,
383-384[Medline]
[Order article via Infotrieve]
-
Shan, D.,
and Press, O. W.
(1995)
J. Immunol.
154,
4466-4475[Abstract]
-
Ghetie, M. A.,
May, R. D.,
Till, M.,
Uhr, J. W.,
Ghetie, V.,
Knowles, P. P.,
Relf, M.,
Brown, A.,
Wallace, P. M.,
Janossy, G.,
Amlot, P.,
Vitetta, E. S.,
and Thorpe, P. E.
(1988)
Cancer Res.
48,
2610-2617[Abstract/Free Full Text]
-
Amlot, P. L.,
Stone, M. J.,
Cunningham, D.,
Fay, J.,
Newman, J.,
Collins, R.,
May, R.,
McCarthy, M.,
Richardson, J.,
Ghetie, V.,
Ramilo, O.,
Thorpe, P. E.,
Uhr, J. W.,
and Vitetta, E. S.
(1993)
Blood
82,
2624-2633[Abstract/Free Full Text]
-
Bonardi, M. A.,
French, R. R.,
Amlot, P.,
Gromo, G.,
Modena, D.,
and Glennie, M. J.
(1993)
Cancer Res.
53,
3015-3021[Abstract/Free Full Text]
-
Glennie, M. J.,
Brennand, D. M.,
Bryden, F.,
McBride, H. M.,
Stirpe, F.,
Worth, A. T.,
and Stevenson, G. T.
(1988)
J. Immunol.
141,
3662-3670[Abstract]
-
French, R. R.,
Bell, A. J.,
Hamblin, T. J.,
Tutt, A. L.,
and Glennie, M. J.
(1996)
Leuk. Res.
20,
607-617[CrossRef][Medline]
[Order article via Infotrieve]
-
Mason, D. Y.,
Stein, H.,
Gerdes, J.,
Pulford, K. A. F.,
Ralfkiaer, E.,
Falini, B.,
Erber, W. N.,
Micklern, K.,
and Gatter, K. C.
(1987)
Blood
69,
836-840[Abstract/Free Full Text]
-
Ellis, J. H.,
Barber, K. A.,
Tutt, A.,
Hale, C.,
Lewis, A. P.,
Glennie, M. J.,
Stevenson, G. T.,
and Crowe, J. S.
(1995)
J. Immunol.
155,
925-937[Abstract]
-
French, R. R.,
Courtenay, A. E.,
Ingamells, S.,
Stevenson, G. T.,
and Glennie, M. J.
(1991)
Cancer Res.
51,
2353-2361[Abstract/Free Full Text]
-
Glennie, M. J.,
Tutt, A. L.,
and Greenman, J.
(1993)
in
Tumour Immunobiology: A Practical Approach (Gallagher, G., Rees, R. C., and Reynolds, C. W., eds), pp. 225-244, IRL Press, Oxford
-
Tedder, T. F.,
and Isaacs, C. M.
(1989)
J. Immunol.
143,
712-717[Abstract]
-
Higuchi, R.
(1990)
in
PCR Protocols: A Guide to Methods and Applications (Innis, M. A., Geffand, D. H., Sninsky, J. J., and White, T. J., eds), pp. 177-183, Academic Press, San Diego
-
Andreason, G. L.,
and Evans, G. A.
(1988)
BioTechniques
6,
650-660[Medline]
[Order article via Infotrieve]
-
Pelchen-Mattews, A.,
Armes, J. E.,
Griffiths, G.,
and Marsh, M.
(1991)
J. Exp. Med.
173,
578-587
-
Collawn, J. F.,
Stangel, M.,
Kuhn, L. A.,
Esekogwu, V.,
Jing, S.,
Trowbridge, I. S.,
and Tainer, J. A.
(1990)
Cell
63,
1061-1072[CrossRef][Medline]
[Order article via Infotrieve]
-
Eberle, W.,
Sander, C.,
Klaus, W.,
Schmidt, B.,
Von Figura, K.,
and Peters, C.
(1991)
Cell
67,
1203-1209[CrossRef][Medline]
[Order article via Infotrieve]
-
Trowbridge, I. S.,
Collawn, J. F.,
and Hopkins, C. R.
(1993)
Annu. Rev. Cell Biol.
9,
129-161[CrossRef]
-
Ktistakis, N. T.,
Thomas, D.,
and Roth, M. G.
(1990)
J. Cell Biol.
111,
1393-1407[Abstract/Free Full Text]
-
Naim, H. Y.,
and Roth, M. G.
(1994)
J. Biol. Chem.
269,
3928-3933[Abstract/Free Full Text]
-
Sherbina, N. V.,
Linsley, P. S.,
Myrdal, S.,
Grosmaire, L. S.,
Ledbetter, J. A.,
and Schieven, G. L.
(1996)
J. Immunol.
157,
4390-4398[Abstract]
-
Law, C. L.,
Torres, R. M.,
Sundberg, H. A.,
Parkhouse, R. M.,
Brannan, C. I.,
Copeland, N. G.,
Jenkins, N. A.,
and Clark, E. A.
(1993)
J. Immunol.
151,
175-187[Abstract]
-
Mellman, I.
(1996)
Annu. Rev. Cell. Dev. Biol.
12,
575-625[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, W. J.,
Goldstein, J. L.,
and Brown, M. S.
(1990)
J. Biol. Chem.
265,
3116-3123[Abstract/Free Full Text]
-
Canfield, W. M.,
Johnson, K. F.,
Ye, R. D.,
Gregory, W.,
and Kornfeld, S.
(1991)
J. Biol. Chem.
266,
5682-5688[Abstract/Free Full Text]
-
Motta, A.,
Bremnes, B.,
Morelli, M. A. C.,
Frank, R. W.,
Saviano, G.,
and Bakke, O.
(1995)
J. Biol. Chem.
270,
27165-27171[Abstract/Free Full Text]
-
Garnier, J.,
Gibrat, J. F.,
and Robson, B.
(1996)
Methods Enzymol.
266,
540-553[Medline]
[Order article via Infotrieve]
-
Davis, C. G.,
Van Driel, I. R.,
Russel, D. A.,
Anderson, R. G. W.,
Brown, M. S.,
and Goldstein, J. L.
(1987)
J. Biol. Chem.
262,
4075-4082[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. B. Walter, B. W. Raden, R. Zeng, P. Hausermann, I. D. Bernstein, and J. A. Cooper
ITIM-dependent endocytosis of CD33-related Siglecs: role of intracellular domain, tyrosine phosphorylation, and the tyrosine phosphatases, Shp1 and Shp2
J. Leukoc. Biol.,
January 1, 2008;
83(1):
200 - 211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. E. Collins, O. Blixt, S. Han, B. Duong, H. Li, J. K. Nathan, N. Bovin, and J. C. Paulson
High-Affinity Ligand Probes of CD22 Overcome the Threshold Set by cis Ligands to Allow for Binding, Endocytosis, and Killing of B Cells.
J. Immunol.,
September 1, 2006;
177(5):
2994 - 3003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Varki and T. Angata
Siglecs--the major subfamily of I-type lectins
Glycobiology,
January 1, 2006;
16(1):
1R - 27R.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zhang and A. Varki
Cell surface sialic acids do not affect primary CD22 interactions with CD45 and surface IgM nor the rate of constitutive CD22 endocytosis
Glycobiology,
November 1, 2004;
14(11):
939 - 949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. John, B. R. Herrin, C. Raman, Y.-n. Wang, K. R. Bobbitt, B. A. Brody, and L. B. Justement
The B Cell Coreceptor CD22 Associates with AP50, a Clathrin-Coated Pit Adapter Protein, Via Tyrosine-Dependent Interaction
J. Immunol.,
April 1, 2003;
170(7):
3534 - 3543.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|