Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ventoso, I.
Right arrow Articles by Carrasco, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ventoso, I.
Right arrow Articles by Carrasco, L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 43, 27960-27967, October 23, 1998


Mutational Analysis of Poliovirus 2Apro
DISTINCT INHIBITORY FUNCTIONS OF 2Apro ON TRANSLATION AND TRANSCRIPTION*

Iván VentosoDagger , Angel Barco§, and Luis Carrasco

From the Centro de Biología Molecular (Consejo Superior de Investigaciones Científicas), Universidad Autónoma de Madrid, Canto Blanco, 28049 Madrid, Spain

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Transient expression of poliovirus 2Apro in mammalian cells by means of the recombinant vaccinia virus vT7 expression system leads to drastic inhibition of both cellular and vaccinia virus gene expression (Aldabe, R., Feduchi, E., Novoa, I., and Carrasco, L. (1995) FEBS Lett. 377, 1-5; Aldabe, R., Feduchi, E., Novoa, I., and Carrasco, L. (1995) Biochem. Biophys. Res. Commun. 215, 928-936). To obtain further insights into the molecular basis of this inhibition, a number of 2Apro variants were generated and expressed in COS-1 cells. The effect of these variants on cellular translation, on vaccinia virus-specific translation, and on transcription of the reporter gene luciferase was analyzed. The ability of the different 2Apro variants to block cellular translation depends on their capacities to cleave eIF-4G. The blockade exerted by 2Apro on transcription of the luciferase gene reinforces the notion that this protease is a potent inhibitor of RNA polymerase II-mediated transcription. Some of the 2Apro variants tested failed to block luciferase transcription, despite the fact that eIF-4G cleavage and inhibition of translation were observed. Two reconstituted polioviruses mutated in 2Apro were defective in inhibiting luciferase transcription, yet were still able to cleave eIF-4G and block translation. These findings indicate that 2Apro interferes with cellular gene expression at both the transcriptional and translational levels. Moreover, these two effects probably reflect the inactivation of different host proteins by poliovirus 2Apro.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Infection of susceptible cells by poliovirus, a representative member of the Picornaviridae family, induces drastic alterations in cellular metabolism and morphology. Thus, RNA synthesis by the three cellular RNA polymerases, as well as mRNA translation, are severely impaired soon after poliovirus infection of cultured fibroblasts (1, 2). The availability of the poliovirus genome as cDNA permitted the identification of gene products responsible for these phenomena. A number of studies have focused on the action of two poliovirus proteases, 2Apro and 3Cpro, on cellular macromolecular synthesis. The finding that 2Apro bisected initiation factor eIF-4G1 suggested that this protease is responsible for the inhibition of cellular mRNA translation (3-5). Indeed, several recombinant picornavirus 2Apro directly cleave eIF-4G when this factor forms part of the eIF-4F complex (6-8). Inactivation of eIF-4F leads to a drastic inhibition of mRNA translation in cell-free systems (6-9). However, under some experimental situations, ongoing cellular translation continues for hours at substantial levels in cells containing cleaved eIF-4G, whereas translation of newly made mRNAs in this situation is drastically blocked (10-14). Therefore, it is possible that, in addition to the bisection of eIF-4G, some other event contributes to the complete shut-off of ongoing translation after poliovirus infection (10, 12). Translation of poliovirus RNA escapes this inhibition because picornavirus RNA utilizes the COOH-terminal moiety of eIF-4G bound to eIF-4A, instead of an intact eIF-4F complex (15-17).

Poliovirus 3Cpro has been linked to the inhibition of cellular transcription by RNA polymerases II and III after proteolytic inactivation of several components of the cellular transcriptional machinery. Thus, purified 3Cpro cleaves and inactivates a subunit of transcription factor IID, the TATA-binding protein (TBP), and the cAMP-responsive element-binding protein (CREB) (18-20). Likewise, cleavage of transcription factor IIC subunit by poliovirus 3Cpro leading to the shut-off of RNA polymerase III transcription in vitro has been documented (21, 22). However, the relevance of these cleavages for the inhibition of cellular transcription by poliovirus infection remains to be established. In addition to 3Cpro, transient expression of poliovirus 2Apro in COS-1 cells also blocks transcription of a reporter gene by RNA polymerase II (23, 24). Recently, in vitro cleavage of TBP by recombinant poliovirus 2Apro has been documented, although the functional significance of this event remains obscure (25). Therefore, the possibility that 2Apro interferes with cellular gene expression at both the transcriptional and translational levels is an attractive suggestion.

Poliovirus 2Apro is a small cysteine protease that exhibits homology to trypsin-like proteases (26). 2Apro cleaves at two different Tyr-Gly bonds present in the poliovirus polyprotein. The first cleavage occurs in cis, while the polyprotein is still being synthesized on polysomes, separating the precursor of structural protein P1 from 2Apro itself (27). The second 2Apro-mediated cleavage is less efficient and occurs on the 3CDpro precursor to generate two alternative products, 3C' and 3D', of still unknown function (28, 29). The catalytic triad of 2Apro is formed by His-20, Asp-38, and Cys-109. Some mutations in this catalytic triad, particularly in Cys-109, render the protease fully inactive, while other mutations outside this triad generate a 2Apro still active in cis, but incapable of bisecting eIF-4G (30-32). In addition to the functioning of 2Apro in poliovirus polyprotein processing and cytotoxicity, 2Apro has been implicated in other steps of the poliovirus replicative cycle, such as enhancement of poliovirus mRNA translation and participation in the RNA replication apparatus, and as a determinant of the mouse neurovirulent phenotype (29, 33-36). It is remarkable that a protein as small as 2Apro (only 149 amino acids) carries out multiple functions during the virus life cycle, perhaps reflecting a common strategy followed by viruses to condense their genetic information.

Recently, we reported that transient expression of poliovirus 2Apro in mammalian cells using recombinant vaccinia virus (vT7), efficiently cleaves eIF-4G, leading to a drastic reduction of both cellular and viral translation (37, 38). To obtain further insight into the molecular mechanism of this inhibition, a number of 2Apro variants were generated and expressed in COS-1 cells. The proteolytic activities of these mutants on eIF-4G and their effects on cellular and vaccinia virus translation, as well as their action on transcription and translation of a reporter gene, were tested. Our present results indicate that 2Apro blocks gene expression at both transcriptional and translational levels.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cells and Viruses-- COS and HeLa cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% newborn calf serum. Stably transfected HeLa cells (clone X1/5) carrying the luciferase gene under the human cytomegalovirus promotor EI(PhCMV) and the tetracycline-controlled operator was generously provided by H. Bujard (Heidelberg, Germany) (39). These cells were grown in DMEM supplemented with 10% newborn calf serum in the presence of 0.02 µg/ml tetracycline until the induction. To this end, tetracycline was removed and the luciferase activity was measured 6 h later. Recombinant vaccinia virus expressing the T7 RNA polymerase (vT7) was amplified in HeLa cells growing in DMEM supplemented with 2% newborn calf serum. Poliovirus type 1 (Mahoney strain) was obtained and used as described previously (29). Poliovirus mutants bearing substitutions in 2Apro, named as M3 (SS6F), M6 (D135N), and M7 (V119M) were obtained as described previously (40).

DNA Recombinant Technology-- All the plasmids were amplified in Escherichia coli DH5alpha according to standard procedures (41). Restriction enzymes, Klenow fragment, mung bean nuclease, and T4 DNA ligase were purchased from New England Biolabs. Avian myeloblastosis virus reverse transcriptase and RNasin were from Promega. pSVL-Luc plasmid was constructed by inserting a BamHI fragment encompassing the entire coding region of the firefly luciferase gene into plasmid pSVL (Amersham Pharmacia Biotech) digested with the same enzyme. pKS-Luc plasmid was constructed by inserting the BamHI fragment mentioned above into Bluescript KS vector (Stratagene). In this case, the luciferase gene is under the control of T7 RNA polymerase promotor and is induced after infection with vT7 virus.

Construction of Poliovirus 2Apro Mutants-- Deletion mutants were obtained from pTM1-2A vector using restriction enzymes that cleave within the 2Apro gene as follows. For pTM12A Delta 1-22, pTM1-2A vector was partially digested with MscI and completely digested with SalI. The fragment of 0.385 kb, which results from a single cleavage of MscI at position 3447, was isolated from the agarose gel and ligated with pTM1 vector previously digested with SmaI and SalI. The resulting 2Apro lacks the 22 NH2-terminal amino acids. For pTM12A Delta 66-79, pTM1-2A plasmid was fully digested with NdeI enzyme and partially digested with XbaI. The DNA fragment of 5.8 kb was isolated from the agarose gel, treated with Klenow fragment, and religated. The resulting 2Apro gene contains an internal deletion of 30 codons. For pTM1-2A Delta 101-146, pTM1-2A vector was partially digested with MscI, and the fragment of 5.8 kb, resulting from a single cleavage of MscI at position 3682, was isolated from the agarose gel. Then, the plasmid was digested with NcoI, incubated with Klenow enzyme, and religated. The resulting 2Apro contains a carboxyl-terminal deletion of 45 amino acids. For pTM1-2A Delta 118-147, pTM1-2A plasmid was digested with DraIII enzyme and the resulting 3' protruding ends were removed by treatment with mung bean nuclease. This plasmid was digested with PstI enzyme and the resulting 0.31-kbp DNA fragment was isolated from the agarose gel. Additionally, pTM1-2A was digested with NcoI and treated with mung bean nuclease to remove its 5' protruding extreme and digested with PstI enzyme. The resulting vector was isolated and ligated to the 0.31-kbp DNA fragment mentioned above. The resulting 2Apro contains a carboxyl-terminal deletion of 30 amino acids. Mutant 2A-1, which contains a leucine inserted at position 103 of 2Apro, was obtained by subcloning a 0.137-kbp NcoI-fragment obtained from plasmid pHF121pXA (generously given by N. Sonenberg, McGill University, Canada) into plasmid pTM12A previously digested with NcoI. Point mutations Y88S, Y88P, and Y88F in 2Apro have been described previously (29). Mutants N18K, A22T, L39F, C55Y, G60R, S66F, G100N, G110S, V119M, G121E, A125V, G126D, S134L, and D135N were obtained by random mutagenesis and genetic selection in yeast as indicated (40).

Transient Expression of 2Apro Variants in COS-1 Cells-- COS-1 cells growing in 24-well dishes at 70% confluence were infected with vT7 virus at 5 pfu/cell in DMEM without serum. Twenty minutes later, the cells were transfected with 0.5 µg of the indicated plasmid using Lipofectin (Life Technologies, Inc.) as described previously (37). Depending on cell confluence, the percentage of transfected cells varied from 70% to 90%, as judged by eIF-4G cleavage.

Analysis of Protein Synthesis by SDS-PAGE and by Immunoblot-- At 16 h after transfection, the cells were metabolically labeled with [35S]methionine (25 µCi/ml, Amersham Pharmacia Biotech) for 1 h, recovered in lysis buffer, and analyzed by SDS-PAGE (29). Immunoblot analyses were carried out as described previously using the ECL Western blotting detection kit (Amersham Pharmacia Biotech). Rabbit antisera against eIFG-4G or anti-3Cpro proteins were used at 1:1000 dilutions.

Isolation of RNA and RT-PCR Analysis-- To analyze transcription of the luciferase gene, 1.5 × 106 COS cells were co-transfected with 1 µg of reporter plasmids (pSVL-Luc or pKS-Luc) and 3 µg of effector plasmid (pTM12A or its 2Apro variants) using Lipofectin in medium without serum. After 12 h, expression of 2Apro was induced by infection with vT7 at 5 pfu/cell. The cells were also treated with 40 µg/ml AraC to prevent the replication of vaccinia virus DNA. Twenty hours later (32 h after transfection), cell monolayers were washed with phosphate-buffered saline and cytoplasmic extracts were collected in buffer A (10 mM Tris-HCl (pH 7.8), 1 mM EDTA, 150 mM NaCl, and 0.65% Nonidet P-40). An aliquot of 20 µl was taken to measure luciferase activity of each sample (42), and the remainder was used for isolation of cytoplasmic RNA as described (43). The RNA pellets were dissolved in buffer P (20 mM Tris-HCl (pH 7.6), 60 mM NaCl, 10 mM MgCl2 and 2 mM 1,4-dithiothreitol) and treated with 20 units of RQ1 RNase-free DNase (Promega) for 1 h at 37 °C. The RNA solutions were extracted three times with phenol and once with chloroform:isoamyl alcohol (24:1). The RNA was precipitated with two volumes of ethanol at -20 °C. Finally, RNA concentration was quantified by absorbance at 260 nm and by agarose gel electrophoresis.

To detect specific transcripts derived from the luciferase gene, retrotranscription and subsequent PCR amplification were performed (RT-PCR). To this end, 1 µg of total RNA from each sample were heated at 90 °C in 50 mM Tris-HCl (pH 8.3), 50 mM KCl, 10 mM MgCl2, 10 mM 1,4-dithiothreitol, and 0.5 mM spermidine in the presence of 2 µM reverse primer (3'LUC: CCGCAATATTTGGACTTTCCGCCC) and cooled slowly to 42 °C. Ten units of avian myeloblastosis virus reverse transcriptase (Promega), 0.5 mM dNTPs, and 4 units of RNasin (Promega) were added, and the reactions were incubated at 42 °C for 1 h. One half of the reaction volume was used for amplification of a 0.5-kb fragment by PCR using the 3' LUC primer, and the internal primer encompassing nucleotides 2811-2830 of luciferase gene (5' LUC primer: GGCGTTAATCAGAGAGGCGA). Finally, the amplified fragments were separated in a 0.8% agarose gel and visualized by staining with ethidium bromide. The intensities of the DNA bands were quantified by densitometry using a Molecular Dynamics 300A computing densitometer. In some cases, it was not possible to visualize directly the amplified products after agarose gel electrophoresis. In these cases, the nucleic acids were transferred to a nitrocellulose membrane and probed with a specific biotinylated riboprobe against luciferase gene as described previously (29).

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Construction and Expression of Poliovirus 2Apro Variants in COS Cells-- Expression of 2Apro using the vT7 system in COS-1 cells induces a marked inhibition of cellular translation (37). To analyze this effect in more detail, the 2Apro variants depicted in Fig. 1 were generated and cloned in pTM1 plasmid as indicated under "Experimental Procedures." The pTM1-based expression system provides a high level of expression at only a few hours after transfection and infection of COS-1 cells with VT7. 2Apro mutants with deletions at the amino terminus (Delta 1-22), at the carboxyl terminus (Delta 101-146; Delta 124-146), as well as internally (Delta 66-97) were generated. In addition, 17 point mutations in 2Apro were obtained, some of them by site-directed mutagenesis (Y88S, Y88P, and Y88L) and the rest using a recently described genetic system to select cytotoxic-deficient 2Apro mutants in yeast cells (40). Mutant 2A-1 contains a leucine insertion at position 103 as described (44). Two questions were addressed with this collection of 2Apro variants. 1) Is there a correlation between eIF-4G cleavage and the blockade of protein synthesis? 2) To what extent are transcription and translation differentially affected, particularly by the 2Apro variants deficient in cleavage of eIF-4G?


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   A, schematic representation of the poliovirus genome showing the point mutations in the 2Apro sequence. The amino acids mutated are boxed: N18K, A22T, L39F, C55Y, G60R, S66F, Y88S, Y88P, Y88F, G100N, G110S, V119M, G121E, A125V, G126D, S134L, and D135N. 2Apro cleavage sites in the polyprotein are denoted by a triangle (triangle ). Asterisks show the amino acids forming the catalytic triad of 2Apro (His-20, Asp-35, and Cys-109). B, diagram of deletion mutants generated in 2Apro. Mutant 2A-1 (44) is also shown.

Action of 2Apro Variants on eIF-4G Cleavage and Cellular Translation-- Infection of COS-1 cells with vaccinia virus (vT7) inhibits the translation of cellular mRNA (45). However, if cells are treated with AraC after infection, the replication of vaccinia virus is blocked and cellular translation continues at substantial levels (60-80% of control) for several hours. Consequently, the use of AraC offers the possibility to test the action of poliovirus 2Apro on cellular protein synthesis in cells infected with vT7 and transfected with pTM1-2Apro. Initially, pTM1 constructs bearing the different 2Apro variants were transfected, infected with VT7, and treated with 40 µg/ml AraC. After 16 h of incubation, protein synthesis was estimated by [35S]methionine labeling of transfected COS-1 cells. An aliquot of each sample was immunoreacted with anti-eIF-4G antibodies. Expression of wt poliovirus 2Apro reduced cellular protein synthesis by 80% as estimated by densitometric quantitation of actin synthesis (Fig. 2). Analysis of eIF-4G cleavage in these cells shows that most of this factor has been degraded, although 10-20% of eIF-4G remains intact, most probably corresponding to untransfected cells. Notably, the level of expression was very variable for the different 2Apro mutants. In general there is an inverse correlation between 2Apro synthesis and the capacity to block protein synthesis and to cleave eIF-4G. For most of the variants, the major protein synthesized by transfected cells corresponds to 2Apro.


View larger version (79K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of 2Apro expression on cellular protein synthesis. COS-1 cells were first infected with vT7 virus (5 pfu/cell) in the presence of AraC (40 µg/ml) and transfected with pTM1 (vector) or with wt pTM1-2Apro or its variants as indicated. Sixteen hours h later, the cells were labeled for 1 h with [35S]methionine and analyzed by SDS-PAGE and autoradiography (A). The position of actin and 2Apro protein bands are indicated. B, aliquots of the same samples were analyzed by Western blotting using a polyclonal rabbit serum against eIF-4G. Intact eIF-4G protein and its cleavage products (CP) are indicated. C, quantitation of cellular inhibition induced by the expression of different 2Apro proteins. Actin bands shown in A were quantitated by densitometry and expressed as percentage of control cells (transfected with pTM1 vector, 100%). MOCK, uninfected cells.

The 2Apro deletion mutants tested were devoid of eIF-4G cleavage activity and did not significantly affect protein synthesis. The Delta 1-22 and Delta 66-97 variants were synthesized at very low levels, and they were detectable only after prolonged gel exposures. At present we do not know the reason for this low expression, but one possibility is that these proteins are very unstable and are rapidly degraded. The 2Apro with point mutations cleaved eIF-4G to varying degrees. Some variants such as A22T, L39F, S66F, Y88S, Y88P, Y88F, G110S, V119M, G126D, and D135N hydrolyzed eIF-4G and blocked protein synthesis at levels comparable to wt 2Apro. However, other variants such as N18K, G60R, and G121E showed weak proteolytic activity on eIF-4G and did not significantly reduce cellular translation. Particularly striking is the G121E variant, which synthesizes 2Apro at very high levels and yet cellular translation is not affected. G121E together with N18K are the least efficient variants as regards eIF-4G cleavage. Interestingly, mutant 2A-1, which was described as devoid of eIF-4G cleavage activity, showed significant proteolytic activity on this factor when assayed by the vT7 transient expression system. This apparent discrepancy may reflect the different systems used to detect eIF-4G cleavage.

Inhibition of Vaccinia Virus Translation by Several Poliovirus 2Apro Variants-- Poliovirus 2Apro is very toxic for vaccinia virus, such that it was impossible to obtain recombinant vaccinia viruses bearing the 2Apro gene (46, 47). Further work analyzing the action of this protease on vaccinia virus gene expression indicated that 2Apro profoundly interferes with vaccinia virus replication, such that no viral protein synthesis is detected at late times of infection (48). Therefore, the action of the different 2Apro variants described above was tested on vaccinia virus late translation. An aliquot was taken to assay the extent of eIF-4G cleavage in order to estimate the percentage of transfected cells. The experiment was carried out as indicated in Fig. 2, but AraC was omitted. The percentage of transfection achieved was about 95% as judged by eIF-4G cleavage induced by wt 2Apro (Fig. 3B). This result is consistent with the level of translation inhibition obtained, which was above 90% (Fig. 3, A and C). The higher inhibition of vaccinia virus protein synthesis obtained as compared with the experiment shown in Fig. 2 may correspond in part to a more efficient transfection. The point mutants that showed less inhibitory potency on vaccinia virus translation (Fig. 3A), such as G60R, N18K, C55Y, and G121E, left more eIF-4G uncleaved (Fig. 3B). However, with other 2Apro variants there is not an evident correlation between eIF-4G cleavage and inhibition of late viral protein synthesis. For instance, this is the case for the N18K variant, which reduces viral translation by 75-80%, leaving part of eIF-4G uncleaved. This inhibition of translation may be explained by the fact that vaccinia virus late translation requires the synthesis of early and intermediate proteins. Therefore, it may be that even partial cleavage of eIF-4G interferes with viral protein synthesis at earlier times of infection, amplifying the inhibition of late viral translation. Alternatively, it is possible that poliovirus 2Apro blocks an as yet unidentified vaccinia virus function unrelated to eIF-4G cleavage, which may lead to inhibition of late translation. This possibility agrees well with the toxicity of poliovirus 2Apro for vaccinia virus (46, 47).


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of 2Apro expression on vaccinia virus late translation. The experiment was carried out as described in Fig. 2, except that AraC was omitted. A, SDS-PAGE and autoradiography showing the synthesis of 2Apro and some late vT7 proteins (80-kDa band). B, Western blotting using anti-eIF-4G antiserum. Intact eIF-4G protein and its cleavage products (CP) are indicated. C, quantitation of the inhibition of vaccinia translation induced by the expression of different 2Apro variants. The 80-kDa vaccinia virus protein band marked in A was used for densitometric quantitation. The data are expressed as percentage of control (cells transfected with pTM1 vector; 100%). MOCK, uninfected cells.

Blockade of Transcription and Translation of a Reporter Gene by Poliovirus 2Apro and Its Variants-- The pioneering work of Davies et al. (24) on the action of poliovirus 2Apro in different steps of gene expression showed that 2Apro inhibited the transcription of a reporter gene more potently than its translation. However, it remains unclear whether this effect of 2Apro on transcription reflects a specific inactivation of a component of the cellular transcriptional machinery or if transcription is affected indirectly by the inhibition of protein synthesis provoked by 2Apro. To distinguish between these two possibilities, the action of poliovirus 2Apro and some of the variants described above were assayed on transcription and translation of luciferase as a reporter gene. Luciferase was expressed either from pSVL-Luc (nuclear transcription) or from pKSLuc (cytoplasmic transcription). Poliovirus wt 2Apro drastically reduces transcription from the nuclear plasmid pSVL-Luc, but not from plasmid pKS-Luc, where transcription is driven by phage T7 RNA polymerase in the cytoplasm. Densitometric quantitation revealed a reduction of luciferase transcription from pSVL-Luc of about 15-20-fold with respect to control cells transfected with pTM1 vector without insert (Fig. 4A). By contrast, luciferase synthesis is powerfully blocked in both instances (Fig. 4, B and D). The effect of 2Apro on luciferase mRNA translation was estimated by dividing the enzymatic activity of each sample by the luciferase mRNA content. Thus, expression of poliovirus 2Apro reduced translation of luciferase mRNA about 5-fold when plasmid pSV-Luc is tested, while the inhibition was about 100-fold with pKS-Luc. The conclusion from this experiment is that nuclear transcription of a reporter gene is certainly blocked by 2Apro in good agreement with previous results (24), while cytoplasmic transcription is not affected. Translation of the newly generated mRNA is blocked by poliovirus 2Apro in both instances.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of poliovirus wt 2Apro on transcription and translation of luciferase. COS-1 cells were transfected with 1 µg of pSVL-Luc plasmid (left panel) or with 1 µg of pKS-Luc plasmid (right panel) in the presence of 3 µg of pTM1 (labeled as VECTOR) or 3 µg of pTM1-2Apro. Twelve hours later, the cells were infected with vT7 (5 pfu/cell) in the presence of AraC in order to induce the expression of 2Apro. Thirty-two hours after transfection, the level of luciferase mRNA was estimated by RT-PCR, using 1 µg of total RNA per sample as described under "Experimental Procedures." The amplified bands corresponding to a 0.5-kbp fragment of luciferase cDNA, as well PCR-amplified fragment from pSVL-Luc DNA (PCR vector) used as marker, are shown (A and C). Dilutions of RNA from cells transfected with the vector are shown (1, 0.2, 0.1, and 0.05 µg). Densitometric quantitation of bands are expressed in arbitrary units. B and D, effect of 2Apro on translation of luciferase gene. Luciferase activities were measured and corrected by the amount of specific luciferase mRNA in each sample. The data are expressed in arbitrary units.

The action of a number of poliovirus 2Apro variants on transcription and translation of luciferase from pSVL-Luc was then examined. These 2Apro variants showed different degrees of eIF-4G cleavage. As shown in Fig. 5A, expression of wt 2Apro led to 12-15-fold reduction of luciferase transcription, while the 2Apro mutants Delta 1-22, Delta 101-146, V119M, G121E, and D135N did not affect luciferase transcription. Mutant S66F showed an effect similar to wt 2Apro, and the rest of the variants A22T, L39F, G60R, and G100N showed an intermediate phenotype.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of some 2Apro variants on transcription and translation of luciferase. COS-1 cells were cotransfected with 1 µg of pSVL-Luc plasmid and with 3 µg of pTM1 plasmid (VECTOR) or with 3 µg of mutated pTM1-2Apro plasmids in a manner similar to that described in Fig. 4. A, quantitation of luciferase mRNA levels analyzed by RT-PCR. B, effect of 2Apro proteins on luciferase activity. The data were processed as in Fig. 4. -TRANSF, cells not transfected with pSVL-Luc; -RT, PCR amplification without previous retrotranscription.

Analysis of luciferase activity indicated that variants V119M, D135N, and, to a lesser extent, A22T, which did not affect transcription, blocked translation of the luciferase mRNA to a degree similar to wt 2Apro. This result agrees well with those described in Figs. 2 and 3, where these 2Apro variants blocked both cellular and vaccinia virus translation. On the other hand, mutant G121E showed the least effect on both transcription and translation, in accord with the effect shown by G121E on cellular protein synthesis (Fig. 2). These findings indicate that the inhibition of transcription and translation of a reporter gene by poliovirus 2Apro are distinct phenomena that can be clearly separated in some of the 2Apro variants analyzed. Furthermore, these results support the notion that the inhibition of transcription is not due to an indirect effect mediated by the blockade of translation. The activities tested for the different 2Apro variants are summarized in Table I.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Summary of the effects obtained with the different 2Apro variants

Transcriptional Inhibition of an Integrated Luciferase Gene in Poliovirus-infected HeLa Cells-- The experiments shown above suggested that poliovirus 2Apro blocks class II transcription in a specific manner. Our next step was to evaluate the contribution of 2Apro activity to the inhibition of cellular transcription observed after poliovirus infection. Previous work has shown that inhibition of RNA polymerase II-mediated transcription is due to 3Cpro activity in poliovirus-infected cells. Indeed, recombinant 3Cpro directly cleaves TATA-binding protein and CREB in cell-free systems (18-20). Much less is known about the action of poliovirus infection or 3Cpro alone on transcription in intact cells. Most of these experiments have been done using nuclear extracts programmed with plasmid DNA carrying the reporter gene to be transcribed. The availability of a HeLa cell line that expresses luciferase in a tetracycline-dependent manner opens the possibility of assaying the action of poliovirus and individual poliovirus proteases on transcription driven by RNA polymerase II (39). Luciferase activity in HeLa cells clone X1/5 is induced about 1500-fold 6 h after tetracycline withdrawal (Fig. 6B). Infection of these cells with poliovirus 1 h after luciferase induction provoked a drastic reduction in both luciferase activity and transcription of the luciferase gene (Fig. 6, A and B). The presence of guanidine, a known inhibitor of poliovirus RNA synthesis, does not prevent this inhibition. Three different poliovirus variants bearing point mutations in 2Apro, i.e. S66F (M3), D135N (M6), and V119M (M7), were assayed for their effect on luciferase gene expression. These poliovirus variants, which have been characterized in detail recently (40), are viable but show defects in the transactivation of translation by 2Apro. The three poliovirus mutants tested cleaved eIF-4G and shut down host translation (Fig. 6, C and D). Consequently, the three mutants drastically prevented luciferase synthesis, but mutants M7 and M6 showed defects in blocking luciferase transcription. Notably, the M7 mutant synthesized luciferase mRNA transcripts at levels comparable to the uninfected control, despite the fact that this mutant virus synthesized substantial amounts of 3Cpro (Fig. 6, A and D). The finding that the poliovirus M7 mutant blocks luciferase activity while having no effect on transcription agrees well with the results described above, where this 2Apro mutant failed to block transcription from pSVL-Luc (Fig. 5), but cellular and luciferase synthesis were profoundly affected (Figs. 2 and 5).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of wt and 2Apro-mutated polioviruses on transcription and translation of the integrated luciferase gene. HeLa cells (clone X1/5) were induced to synthesize luciferase by tetracycline withdrawal. One hour later, the cells were infected with wild-type poliovirus (+WT) or with the different mutants in 2Apro gene at 25 pfu/cell: S66F (M3), D135N (M6), or V119M (M7). Five hours after infection, the cells were metabolically labeled with [35S]methionine for 30 min. Then, cell extracts were obtained and divided into four aliquots. One aliquot was used to measure luciferase activity, another to extract total RNA, the third for analysis of protein synthesis by SDS-PAGE, and the last for Western blotting against anti-eIF-4G and anti-3Cpro antisera. A, Southern blotting of RT-PCR amplified luciferase mRNAs using a biotinylated riboprobe against luciferase gene. Dilutions of RNA from mock-infected cells are shown (1, 0.2, and 0.1 µg, respectively). -IND, cells not induced; +WT +GUA, cells infected with wt poliovirus and treated with 0.5 mM guanidine; -RT, PCR without previous retrotranscription. PCR vector as marker. B, effect of poliovirus infection on luciferase mRNA translation. Luciferase activities from different samples were measured and corrected for the luciferase mRNA content. C, SDS-PAGE and autoradiography of cells infected with the different poliovirus mutants and metabolically labeled with [35S]methionine. The positions of some poliovirus proteins are shown. D, Western blotting using anti-eIF-4G serum (upper panel) or anti-3Cpro serum (lower panel). The position of intact eIF-4G, its cleavage products (CP), as well as poliovirus 3Cpro are indicated.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The inhibition of host gene expression after poliovirus infection has been linked to the action of virus-encoded proteinases 2Apro and 3Cpro (4, 19, 24, 26). However, little is known about the effect of individual expression of these proteinases on transcription and translation in mammalian cells. Therefore, the exact mechanism by which poliovirus disarms the cellular gene expression is still a matter of intense research.

The differential effect of 2Apro expression on cellular transcription and translation has now been analyzed using a genetic approach. A number of 2Apro mutants have been obtained and expressed in COS cells by means of pTM1/vT7 expression system. The ability of 2Apro variants to block cellular translation depends on their capacity to hydrolyze eIF-4G. Point mutants such as G60R, N18K, and G121E showed weak proteolytic activity compared with wt 2Apro and failed to block cellular translation (Table I). These data suggest that 2Apro expression, employing the vT7 system, impairs cellular translation through the inactivation of eIF-4G. However, these results do not rule out that another event apart from eIF-4G cleavage participates in the early shut-off of translation observed in poliovirus infected cells (10, 12).

Vaccinia virus specific translation appears to be more sensitive to the action of 2Apro than does cellular translation. Thus, only the deletion mutant Delta 66-97 was unable to interfere with vaccinia translation. The point mutants G60R, N18K, and G121E, which failed to shut down cellular translation, affected vaccinia late translation at substantial levels. This effect could be explained in part by the fact that vaccinia virus late translation relies upon the action of early and intermediate proteins. In addition, transcription of these genes in a cascade fashion is necessary to obtain late protein synthesis. A small effect of these 2Apro variants on early vaccinia translation may result in an amplified effect on translation of vaccinia late polypeptides. It should be kept in mind that the presence of the poliovirus 2Apro gene alone is toxic for vaccinia replication, even when this sequence is placed in the inverse orientation where no expression of 2Apro occurs (46, 47).

Notably, we have observed that poliovirus 2Apro is a potent transcriptional inhibitor of class II genes when expressed in COS cells. The presence of 2Apro leads to a 15-20-fold inhibition of transcription from a reporter gene (pSVL-Luc) bearing the late promoter of SV40. These results agree well with whose obtained by Davies et al. (24) and support the notion that 2Apro impairs gene expression by blocking both cellular transcription and translation. Furthermore, the fact that 2Apro expression did not affect cytoplasmic transcription driven by T7 RNA polymerase suggests that 2Apro inactivates the nuclear transcriptional machinery. Interestingly, some 2Apro mutants such as D135N and V119M failed to repress luciferase transcription, despite retaining the capacity to block cellular and luciferase translation. This finding argues against the transcriptional inhibition as an indirect effect of translational blockade induced by 2Apro. Clearly, the inhibitory functions of 2Apro on cellular transcription and translation can be separated using mutants described in this work (Table I).

The above conclusion was reinforced by the analysis of reconstituted polioviruses bearing mutated 2Apro: V119M (M7) and D135N (M6). These mutants shut down cellular translation but were defective in blocking transcription of the integrated luciferase gene, despite the synthesis of substantial amounts of 3Cpro. This result was surprising because previous studies have linked the activity of 3Cpro to the shut-off of cellular transcription after poliovirus infection (18, 19). Indeed, some transcription factors such as TBP, CREB, and transcription factor IIC have been described as targets of poliovirus 3Cpro, although the relevance of these inactivations to the transcriptional inhibition induced by poliovirus remain to be established. The results obtained with poliovirus mutant M7 (2AV119M) point to the action of poliovirus 2Apro as a major determinant of class II-specific transcriptional inhibition after poliovirus infection. In this study the effect of poliovirus infection on transcription of a specific host gene has been tested for the first time in intact cells. However, the possibility that both 2Apro and 3Cpro proteinases may cooperate to complete the global transcriptional inhibition observed after poliovirus infection, remains open.

How does 2Apro impair cellular transcription? Immunostaining of cells expressing poliovirus 2Apro shows that this enzyme is preferentially located in the cytoplasm (37). However, it cannot be ruled out that a small amount of 2Apro might migrate to the nucleus to cleave some cellular factors as has been shown for poliovirus 3Cpro (18, 49). At present, the best known cellular substrate for poliovirus 2Apro is the translational initiation factor eIF-4G. However, after poliovirus infection, several proteins become degraded; the majority of them remain to be identified (50). It could be that some of these cellular polypeptides, perhaps implicated in cellular transcription, are directly or indirectly inactivated by 2Apro. In this respect, Yalamanchili et al. (25) have reported recently that recombinant poliovirus 2Apro cleaves TBP in vitro, although this cleavage does not appear to lead to inhibition of transcription by RNA polymerase II in vitro. Additional experiments will be required to test whether cleavage of TBP by poliovirus 2Apro has repercussions on class II transcription in vivo.

Finally, inducible expression of poliovirus 2Apro in yeast also arrests cellular transcription (32). It is possible that poliovirus 2Apro inactivates similar factor(s) in both mammalian and yeast cells. This attractive hypothesis would allow us to capitalize on the genetic advantages of yeast to find novel cellular substrates of poliovirus 2Apro. Experiments in this direction are in progress in our laboratory.

    ACKNOWLEDGEMENTS

We thank R. Aldabe, H. Bujard, and N. Sonenberg for providing with plasmid pTM1-2Apro, HeLa cell clone X1/5, and plasmid pHF121pXA, respectively. We acknowledge the critical reading of the manuscript by John Lewis, and the expert technical assistance of M. A. Sanz.

    FOOTNOTES

* This work was supported in part by DGICYT Grant PB94-0148 and an institutional grant (to the Centro de Biología Molecular) from the Fundación Ramón Areces.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Recipient of a Comunidad Autónoma de Madrid fellowship. To whom correspondence and reprint requests should be addressed. Tel: 34-1-91-3978450; Fax: 34-1-91-3974799; E-mail: iventoso{at}trasto.cbm.uam.es.

§ Recipient of a Consejo Superior de Investigaciones Científicas postdoctoral fellowship.

The abbreviations used are: eIF-4G, eukaryotic initiation factor 4G; PAGE, polyacrylamide gel electrophoresis; pfu, plaque-forming unit(s); wt, wild-type; TBP, TATA-binding protein; CREB, cAMP-responsive element-binding protein; DMEM, Dulbecco's modified Eagle's medium; kb, kilobase(s); kbp, kilobase pair(s); RT, reverse transcriptase; PCR, polymerase chain reaction.
    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Crawford, N., Fire, A., Samuels, M., Sharp, P. A., and Baltimore, D. (1981) Cell 27, 555-561[CrossRef][Medline] [Order article via Infotrieve]
  2. Leibowitz, R., and Penman, S. (1971) J. Virol. 8, 661-668[Abstract/Free Full Text]
  3. Etchison, D., Milburn, S. C., Edery, I., Sonenberg, N., and Hershey, J. W. (1982) J. Biol. Chem. 257, 14806-14810[Abstract/Free Full Text]
  4. Krausslich, H. G., Nicklin, M. J., Toyoda, H., Etchison, D., and Wimmer, E. (1987) J. Virol. 61, 2711-2718[Abstract/Free Full Text]
  5. Wyckoff, E. E., Hershey, J. W. B., and Ehrenfeld, E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9529-9533[Abstract/Free Full Text]
  6. Liebig, H.-D., Ziegler, E., Yan, R., Hartmuth, K., Klump, H., Kowalski, H., Blaas, D., Sommergruber, W., Frasel, L., Lamphear, B., Rhoads, R., Kuechler, E., and Skern, T. (1993) Biochemistry 32, 7581-7588[CrossRef][Medline] [Order article via Infotrieve]
  7. Lamphear, B. J., Yan, R., Yang, F., Waters, D., Liebig, H.-D., Klump, H., Kuechler, E., Skern, T., and Rhoads, R. E. (1993) J. Biol. Chem. 268, 19200-19203[Abstract/Free Full Text]
  8. Haghighat, A., Svitkin, Y., Novoa, I., Kuechler, E., Skern, T., and Sonenberg, N. (1996) J. Virol. 70, 8444-8450[Abstract]
  9. Novoa, I., Martínez-Abarca, F., Fortes, P., Ortín, J., and Carrasco, L. (1997) Biochemistry 36, 7802-7809[CrossRef][Medline] [Order article via Infotrieve]
  10. Bonneau, A. M., and Sonenberg, N. (1987) J. Virol. 61, 986-991[Abstract/Free Full Text]
  11. Novoa, I., Cotten, M., and Carrasco, L. (1996) J. Virol. 70, 3319-3324[Abstract]
  12. Perez, L., and Carrasco, L. (1992) Virology 189, 178-186[CrossRef][Medline] [Order article via Infotrieve]
  13. Irurzun, A., Sanchez-Palomino, S., Novoa, I., and Carrasco, L. (1995) J. Virol. 69, 7453-7460[Abstract]
  14. Keiper, B. D., and Rhoads, R. E. (1997) Nucleic Acids Res. 25, 395-402[Abstract/Free Full Text]
  15. Lamphear, B. J., Kirchweger, R., Skern, T., and Rhoads, R. E. (1995) J. Biol. Chem. 270, 21975-21983[Abstract/Free Full Text]
  16. Ohlmann, T., Rau, M., Pain, V. M., and Morley, S. J. (1996) EMBO J. 15, 1371-1382[Medline] [Order article via Infotrieve]
  17. Pestova, T. V., Shatsky, I. N., and Hellen, C. U. T. (1996) Mol. Cell. Biol. 16, 6870-6878[Abstract]
  18. Clark, M. E., Lieberman, P. M., Berk, A. J., and Dasgupta, A. (1993) Mol. Cell. Biol. 13, 1232-1237[Abstract/Free Full Text]
  19. Yalamanchili, P., Harris, K., Wimmer, E., and Dasgupta, A. (1996) J. Virol. 70, 2922-2929[Abstract]
  20. Yalamanchili, P., Datta, U., and Dasgupta, A. (1997) J. Virol. 71, 1220-1226[Abstract]
  21. Clark, M., Hämemerle, T., Wimmer, E., and Dasgupta, A. (1991) EMBO J. 10, 2941-2947[Medline] [Order article via Infotrieve]
  22. Shen, Y. H., Igo, M., Yalamanchili, P., Berk, A. J., and Dasgupta, A. (1996) Mol. Cell. Biol. 16, 4163-4171[Abstract]
  23. Sun, X. H., and Baltimore, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 2143-2146[Abstract/Free Full Text]
  24. Davies, M. V., Pelletier, J., Meerovitch, K., Sonenberg, N., and Kaufman, R. J. (1991) J. Biol. Chem. 266, 14714-14720[Abstract/Free Full Text]
  25. Yalamanchili, P., Banerjee, R., and Dasgupta, A. (1997) J. Virol. 71, 6881-6886[Abstract]
  26. Dougherty, W. G., and Semler, B. L. (1993) Microbiol. Rev. 57, 781-822[Abstract/Free Full Text]
  27. Toyoda, H., Nicklin, M. J., Murray, M. G., Anderson, C. W., Dunn, J. J., Studier, F. W., and Wimmer, E. (1986) Cell 45, 761-770[CrossRef][Medline] [Order article via Infotrieve]
  28. Lee, C. K., and Wimmer, E. (1988) Virology 166, 405-414[CrossRef][Medline] [Order article via Infotrieve]
  29. Ventoso, I., and Carrasco, L. (1995) J. Virol. 69, 6280-6288[Abstract]
  30. Hellen, C. U. T., Fäcke, M., Kräusslich, H., Lee, C., and Wimmer, E. (1991) J. Virol. 65, 4226-4231[Abstract/Free Full Text]
  31. Yu, S. F., and Lloyd, R. E. (1991) Virology 182, 615-625[CrossRef][Medline] [Order article via Infotrieve]
  32. Barco, A., and Carrasco, L. (1995) FEBS Lett. 371, 4-8[CrossRef][Medline] [Order article via Infotrieve]
  33. Hambidge, S. J., and Sarnow, P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10272-10276[Abstract/Free Full Text]
  34. Macadam, A. J., Ferguson, G., Fleming, T., Stone, D. M., Almond, J. W., and Minor, P. D. (1994) EMBO J. 13, 924-927[Medline] [Order article via Infotrieve]
  35. Lu, H.-H., Yang, C.-F., Murdin, A. D., Klein, M. H., Harber, J. J., Kew, O. M., and Wimmer, E. (1994) J. Virol. 68, 7507-7515[Abstract/Free Full Text]
  36. Molla, A., Paul, A. V., Schmid, M., Jang, S. K., and Wimmer, E. (1993) Virology 196, 739-747[CrossRef][Medline] [Order article via Infotrieve]
  37. Aldabe, R., Feduchi, E., Novoa, I., and Carrasco, L. (1995) FEBS Lett. 377, 1-5[CrossRef][Medline] [Order article via Infotrieve]
  38. Aldabe, R., Feduchi, E., Novoa, I., and Carrasco, L. (1995) Biochem. Biophys. Res. Commun. 215, 928-936[CrossRef][Medline] [Order article via Infotrieve]
  39. Gossen, M., and Bujard, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5547-5551[Abstract/Free Full Text]
  40. Barco, A., Ventoso, I., and Carrasco, L. (1997) J. Biol. Chem. 272, 12683-12691[Abstract/Free Full Text]
  41. Sambrook, J., Fritsch, E. R., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  42. Wet, J. R. de, Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7, 725-737[Abstract/Free Full Text]
  43. Favaloro, J., Treisman, R., and Kamen, R. (1980) Methods Enzymol. 65, 718-749[Medline] [Order article via Infotrieve]
  44. Bernstein, H. D., Sonenberg, N., and Baltimore, D. (1985) Mol. Cell. Biol. 5, 2913-2923[Abstract/Free Full Text]
  45. Schnierle, B. S., and Moss, B. (1992) Virology 188, 931-933[CrossRef][Medline] [Order article via Infotrieve] -
  46. Turner, P. C., Young, D. C., Flanegan, J. B., and Moyer, R. W. (1989) Virology 173, 509-521[CrossRef][Medline] [Order article via Infotrieve]
  47. Jewell, J. E., Ball, L. A., and Rueckert, R. (1990) J. Virol. 64, 1388-1393[Abstract/Free Full Text]
  48. Feduchi, E., Aldabe, R., Novoa, I., and Carrasco, L. (1995) Eur. J. Biochem. 234, 849-854[Medline] [Order article via Infotrieve]
  49. Fernández-Tomas, C. (1982) Virology 116, 629[CrossRef][Medline] [Order article via Infotrieve]
  50. Urzáinqui, A., and Carrasco, L. (1989) J. Virol. 63, 4729-4735[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
J. M. Morrison and V. R. Racaniello
Proteinase 2Apro Is Essential for Enterovirus Replication in Type I Interferon-Treated Cells
J. Virol., May 1, 2009; 83(9): 4412 - 4422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Castello, E. Alvarez, and L. Carrasco
Differential Cleavage of eIF4GI and eIF4GII in Mammalian Cells: EFFECTS ON TRANSLATION
J. Biol. Chem., November 3, 2006; 281(44): 33206 - 33216.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Zhou and W. Song
Leaky Scanning and Reinitiation Regulate BACE1 Gene Expression.
Mol. Cell. Biol., May 1, 2006; 26(9): 3353 - 3364.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Alvarez, L. Menendez-Arias, and L. Carrasco
The Eukaryotic Translation Initiation Factor 4GI Is Cleaved by Different Retroviral Proteases
J. Virol., December 1, 2003; 77(23): 12392 - 12400.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Ventoso, R. Blanco, C. Perales, and L. Carrasco
HIV-1 protease cleaves eukaryotic initiation factor 4G and inhibits cap-dependent translation
PNAS, October 16, 2001; (2001) 231343498.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
X. Li, H.-H. Lu, S. Mueller, and E. Wimmer
The C-terminal residues of poliovirus proteinase 2Apro are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage
J. Gen. Virol., February 1, 2001; 82(2): 397 - 408.
[Abstract] [Full Text]


Home page
J. Virol.Home page
A. Barco, E. Feduchi, and L. Carrasco
A Stable HeLa Cell Line That Inducibly Expresses Poliovirus 2Apro: Effects on Cellular and Viral Gene Expression
J. Virol., March 1, 2000; 74(5): 2383 - 2392.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
I. Novoa and L. Carrasco
Cleavage of Eukaryotic Translation Initiation Factor 4G by Exogenously Added Hybrid Proteins Containing Poliovirus 2Apro in HeLa Cells: Effects on Gene Expression
Mol. Cell. Biol., April 1, 1999; 19(4): 2445 - 2454.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Ventoso, R. Blanco, C. Perales, and L. Carrasco
HIV-1 protease cleaves eukaryotic initiation factor 4G and inhibits cap-dependent translation
PNAS, November 6, 2001; 98(23): 12966 - 12971.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ventoso, I.
Right arrow Articles by Carrasco, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ventoso, I.
Right arrow Articles by Carrasco, L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement