|
J Biol Chem, Vol. 273, Issue 43, 27960-27967, October 23, 1998
Mutational Analysis of Poliovirus 2Apro
DISTINCT INHIBITORY FUNCTIONS OF 2Apro ON
TRANSLATION AND TRANSCRIPTION*
Iván
Ventoso ,
Angel
Barco§, and
Luis
Carrasco
From the Centro de Biología Molecular (Consejo Superior de
Investigaciones Científicas), Universidad Autónoma de
Madrid, Canto Blanco, 28049 Madrid, Spain
 |
ABSTRACT |
Transient expression of poliovirus
2Apro in mammalian cells by means of the recombinant
vaccinia virus vT7 expression system leads to drastic inhibition of
both cellular and vaccinia virus gene expression (Aldabe, R., Feduchi,
E., Novoa, I., and Carrasco, L. (1995) FEBS Lett. 377, 1-5; Aldabe, R., Feduchi, E., Novoa, I., and Carrasco, L. (1995)
Biochem. Biophys. Res. Commun. 215, 928-936). To obtain
further insights into the molecular basis of this inhibition, a number
of 2Apro variants were generated and expressed in COS-1
cells. The effect of these variants on cellular translation, on
vaccinia virus-specific translation, and on transcription of the
reporter gene luciferase was analyzed. The ability of the different
2Apro variants to block cellular translation depends on
their capacities to cleave eIF-4G. The blockade exerted by
2Apro on transcription of the luciferase gene reinforces
the notion that this protease is a potent inhibitor of RNA polymerase
II-mediated transcription. Some of the 2Apro variants
tested failed to block luciferase transcription, despite the fact that
eIF-4G cleavage and inhibition of translation were observed. Two
reconstituted polioviruses mutated in 2Apro were defective
in inhibiting luciferase transcription, yet were still able to cleave
eIF-4G and block translation. These findings indicate that
2Apro interferes with cellular gene expression at both the
transcriptional and translational levels. Moreover, these two effects
probably reflect the inactivation of different host proteins by
poliovirus 2Apro.
 |
INTRODUCTION |
Infection of susceptible cells by poliovirus, a representative
member of the Picornaviridae family, induces drastic alterations in
cellular metabolism and morphology. Thus, RNA synthesis by the three
cellular RNA polymerases, as well as mRNA translation, are severely
impaired soon after poliovirus infection of cultured fibroblasts (1,
2). The availability of the poliovirus genome as cDNA permitted the
identification of gene products responsible for these phenomena. A
number of studies have focused on the action of two poliovirus
proteases, 2Apro and 3Cpro, on cellular
macromolecular synthesis. The finding that 2Apro bisected
initiation factor eIF-4G1
suggested that this protease is responsible for the inhibition of
cellular mRNA translation (3-5). Indeed, several recombinant picornavirus 2Apro directly cleave eIF-4G when this factor
forms part of the eIF-4F complex (6-8). Inactivation of eIF-4F leads
to a drastic inhibition of mRNA translation in cell-free systems
(6-9). However, under some experimental situations, ongoing cellular
translation continues for hours at substantial levels in cells
containing cleaved eIF-4G, whereas translation of newly made mRNAs
in this situation is drastically blocked (10-14). Therefore, it is
possible that, in addition to the bisection of eIF-4G, some other event
contributes to the complete shut-off of ongoing translation after
poliovirus infection (10, 12). Translation of poliovirus RNA escapes
this inhibition because picornavirus RNA utilizes the COOH-terminal
moiety of eIF-4G bound to eIF-4A, instead of an intact eIF-4F complex
(15-17).
Poliovirus 3Cpro has been linked to the inhibition of
cellular transcription by RNA polymerases II and III after proteolytic inactivation of several components of the cellular transcriptional machinery. Thus, purified 3Cpro cleaves and inactivates a
subunit of transcription factor IID, the TATA-binding protein (TBP),
and the cAMP-responsive element-binding protein (CREB) (18-20).
Likewise, cleavage of transcription factor IIC subunit by poliovirus
3Cpro leading to the shut-off of RNA polymerase III
transcription in vitro has been documented (21, 22).
However, the relevance of these cleavages for the inhibition of
cellular transcription by poliovirus infection remains to be
established. In addition to 3Cpro, transient expression of
poliovirus 2Apro in COS-1 cells also blocks transcription
of a reporter gene by RNA polymerase II (23, 24). Recently, in
vitro cleavage of TBP by recombinant poliovirus 2Apro
has been documented, although the functional significance of this event
remains obscure (25). Therefore, the possibility that 2Apro
interferes with cellular gene expression at both the transcriptional and translational levels is an attractive suggestion.
Poliovirus 2Apro is a small cysteine protease that exhibits
homology to trypsin-like proteases (26). 2Apro cleaves at
two different Tyr-Gly bonds present in the poliovirus polyprotein. The
first cleavage occurs in cis, while the polyprotein is still
being synthesized on polysomes, separating the precursor of structural
protein P1 from 2Apro itself (27). The second
2Apro-mediated cleavage is less efficient and occurs on the
3CDpro precursor to generate two alternative products, 3C'
and 3D', of still unknown function (28, 29). The catalytic triad of 2Apro is formed by His-20, Asp-38, and Cys-109. Some
mutations in this catalytic triad, particularly in Cys-109, render the
protease fully inactive, while other mutations outside this triad
generate a 2Apro still active in cis, but
incapable of bisecting eIF-4G (30-32). In addition to the functioning
of 2Apro in poliovirus polyprotein processing and
cytotoxicity, 2Apro has been implicated in other steps of
the poliovirus replicative cycle, such as enhancement of poliovirus
mRNA translation and participation in the RNA replication
apparatus, and as a determinant of the mouse neurovirulent phenotype
(29, 33-36). It is remarkable that a protein as small as
2Apro (only 149 amino acids) carries out multiple functions
during the virus life cycle, perhaps reflecting a common strategy
followed by viruses to condense their genetic information.
Recently, we reported that transient expression of poliovirus
2Apro in mammalian cells using recombinant vaccinia virus
(vT7), efficiently cleaves eIF-4G, leading to a drastic reduction of
both cellular and viral translation (37, 38). To obtain further insight into the molecular mechanism of this inhibition, a number of
2Apro variants were generated and expressed in COS-1 cells.
The proteolytic activities of these mutants on eIF-4G and their effects
on cellular and vaccinia virus translation, as well as their action on
transcription and translation of a reporter gene, were tested. Our
present results indicate that 2Apro blocks gene expression
at both transcriptional and translational levels.
 |
EXPERIMENTAL PROCEDURES |
Cells and Viruses--
COS and HeLa cells were grown in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 5%
newborn calf serum. Stably transfected HeLa cells (clone X1/5) carrying
the luciferase gene under the human cytomegalovirus promotor
EI(PhCMV) and the tetracycline-controlled operator was
generously provided by H. Bujard (Heidelberg, Germany) (39). These
cells were grown in DMEM supplemented with 10% newborn calf serum in
the presence of 0.02 µg/ml tetracycline until the induction. To this
end, tetracycline was removed and the luciferase activity was measured
6 h later. Recombinant vaccinia virus expressing the T7 RNA
polymerase (vT7) was amplified in HeLa cells growing in DMEM
supplemented with 2% newborn calf serum. Poliovirus type 1 (Mahoney
strain) was obtained and used as described previously (29). Poliovirus
mutants bearing substitutions in 2Apro, named as M3 (SS6F),
M6 (D135N), and M7 (V119M) were obtained as described previously
(40).
DNA Recombinant Technology--
All the plasmids were amplified
in Escherichia coli DH5 according to standard procedures
(41). Restriction enzymes, Klenow fragment, mung bean nuclease, and T4
DNA ligase were purchased from New England Biolabs. Avian
myeloblastosis virus reverse transcriptase and RNasin were from
Promega. pSVL-Luc plasmid was constructed by inserting a
BamHI fragment encompassing the entire coding region of the
firefly luciferase gene into plasmid pSVL (Amersham Pharmacia Biotech)
digested with the same enzyme. pKS-Luc plasmid was constructed by
inserting the BamHI fragment mentioned above into Bluescript KS vector (Stratagene). In this case, the luciferase gene is under the
control of T7 RNA polymerase promotor and is induced after infection
with vT7 virus.
Construction of Poliovirus 2Apro
Mutants--
Deletion mutants were obtained from pTM1-2A vector using
restriction enzymes that cleave within the 2Apro gene as
follows. For pTM12A 1-22, pTM1-2A vector was partially digested
with MscI and completely digested with SalI. The
fragment of 0.385 kb, which results from a single cleavage of
MscI at position 3447, was isolated from the agarose gel and
ligated with pTM1 vector previously digested with SmaI and
SalI. The resulting 2Apro lacks the 22 NH2-terminal amino acids. For pTM12A 66-79, pTM1-2A plasmid was fully digested with NdeI enzyme and partially
digested with XbaI. The DNA fragment of 5.8 kb was isolated
from the agarose gel, treated with Klenow fragment, and religated. The
resulting 2Apro gene contains an internal deletion of 30 codons. For pTM1-2A 101-146, pTM1-2A vector was partially
digested with MscI, and the fragment of 5.8 kb,
resulting from a single cleavage of MscI at position 3682, was isolated from the agarose gel. Then, the plasmid was digested with
NcoI, incubated with Klenow enzyme, and religated. The
resulting 2Apro contains a carboxyl-terminal deletion of 45 amino acids. For pTM1-2A 118-147, pTM1-2A plasmid was digested
with DraIII enzyme and the resulting 3' protruding ends were
removed by treatment with mung bean nuclease. This plasmid was digested
with PstI enzyme and the resulting 0.31-kbp DNA fragment was
isolated from the agarose gel. Additionally, pTM1-2A was digested with
NcoI and treated with mung bean nuclease to remove its 5'
protruding extreme and digested with PstI enzyme. The
resulting vector was isolated and ligated to the 0.31-kbp DNA fragment
mentioned above. The resulting 2Apro contains a
carboxyl-terminal deletion of 30 amino acids. Mutant 2A-1, which
contains a leucine inserted at position 103 of 2Apro, was
obtained by subcloning a 0.137-kbp NcoI-fragment obtained from plasmid pHF121pXA (generously given by N. Sonenberg, McGill University, Canada) into plasmid pTM12A previously digested with NcoI. Point mutations Y88S, Y88P, and Y88F in
2Apro have been described previously (29). Mutants N18K,
A22T, L39F, C55Y, G60R, S66F, G100N, G110S, V119M, G121E, A125V, G126D,
S134L, and D135N were obtained by random mutagenesis and genetic
selection in yeast as indicated (40).
Transient Expression of 2Apro Variants in COS-1
Cells--
COS-1 cells growing in 24-well dishes at 70% confluence
were infected with vT7 virus at 5 pfu/cell in DMEM without serum. Twenty minutes later, the cells were transfected with 0.5 µg of the
indicated plasmid using Lipofectin (Life Technologies, Inc.) as
described previously (37). Depending on cell confluence, the percentage
of transfected cells varied from 70% to 90%, as judged by eIF-4G
cleavage.
Analysis of Protein Synthesis by SDS-PAGE and by
Immunoblot--
At 16 h after transfection, the cells were
metabolically labeled with [35S]methionine (25 µCi/ml,
Amersham Pharmacia Biotech) for 1 h, recovered in lysis buffer,
and analyzed by SDS-PAGE (29). Immunoblot analyses were carried out as
described previously using the ECL Western blotting detection kit
(Amersham Pharmacia Biotech). Rabbit antisera against eIFG-4G or
anti-3Cpro proteins were used at 1:1000 dilutions.
Isolation of RNA and RT-PCR Analysis--
To analyze
transcription of the luciferase gene, 1.5 × 106 COS
cells were co-transfected with 1 µg of reporter plasmids (pSVL-Luc or
pKS-Luc) and 3 µg of effector plasmid (pTM12A or its
2Apro variants) using Lipofectin in medium without serum.
After 12 h, expression of 2Apro was induced by
infection with vT7 at 5 pfu/cell. The cells were also treated with 40 µg/ml AraC to prevent the replication of vaccinia virus DNA. Twenty
hours later (32 h after transfection), cell monolayers were washed with
phosphate-buffered saline and cytoplasmic extracts were collected in
buffer A (10 mM Tris-HCl (pH 7.8), 1 mM EDTA,
150 mM NaCl, and 0.65% Nonidet P-40). An aliquot of 20 µl was taken to measure luciferase activity of each sample (42), and
the remainder was used for isolation of cytoplasmic RNA as described
(43). The RNA pellets were dissolved in buffer P (20 mM
Tris-HCl (pH 7.6), 60 mM NaCl, 10 mM
MgCl2 and 2 mM 1,4-dithiothreitol) and treated
with 20 units of RQ1 RNase-free DNase (Promega) for 1 h at
37 °C. The RNA solutions were extracted three times with phenol and
once with chloroform:isoamyl alcohol (24:1). The RNA was precipitated
with two volumes of ethanol at 20 °C. Finally, RNA concentration
was quantified by absorbance at 260 nm and by agarose gel
electrophoresis.
To detect specific transcripts derived from the luciferase gene,
retrotranscription and subsequent PCR amplification were performed
(RT-PCR). To this end, 1 µg of total RNA from each sample were heated
at 90 °C in 50 mM Tris-HCl (pH 8.3), 50 mM
KCl, 10 mM MgCl2, 10 mM
1,4-dithiothreitol, and 0.5 mM spermidine in the presence
of 2 µM reverse primer (3'LUC:
CCGCAATATTTGGACTTTCCGCCC) and cooled slowly to 42 °C.
Ten units of avian myeloblastosis virus reverse transcriptase
(Promega), 0.5 mM dNTPs, and 4 units of RNasin (Promega)
were added, and the reactions were incubated at 42 °C for 1 h.
One half of the reaction volume was used for amplification of a 0.5-kb
fragment by PCR using the 3' LUC primer, and the internal primer
encompassing nucleotides 2811-2830 of luciferase gene (5' LUC primer:
GGCGTTAATCAGAGAGGCGA). Finally, the amplified fragments
were separated in a 0.8% agarose gel and visualized by staining with
ethidium bromide. The intensities of the DNA bands were quantified by
densitometry using a Molecular Dynamics 300A computing densitometer. In
some cases, it was not possible to visualize directly the amplified
products after agarose gel electrophoresis. In these cases, the nucleic
acids were transferred to a nitrocellulose membrane and probed with a
specific biotinylated riboprobe against luciferase gene as described
previously (29).
 |
RESULTS |
Construction and Expression of Poliovirus 2Apro
Variants in COS Cells--
Expression of 2Apro using the
vT7 system in COS-1 cells induces a marked inhibition of cellular
translation (37). To analyze this effect in more detail, the
2Apro variants depicted in Fig.
1 were generated and cloned in pTM1 plasmid as indicated under "Experimental Procedures." The
pTM1-based expression system provides a high level of expression at
only a few hours after transfection and infection of COS-1 cells with VT7. 2Apro mutants with deletions at the amino terminus
( 1-22), at the carboxyl terminus ( 101-146; 124-146), as
well as internally ( 66-97) were generated. In addition, 17 point
mutations in 2Apro were obtained, some of them by
site-directed mutagenesis (Y88S, Y88P, and Y88L) and the rest using a
recently described genetic system to select cytotoxic-deficient
2Apro mutants in yeast cells (40). Mutant 2A-1 contains a
leucine insertion at position 103 as described (44). Two questions were addressed with this collection of 2Apro variants. 1) Is
there a correlation between eIF-4G cleavage and the blockade of protein
synthesis? 2) To what extent are transcription and translation
differentially affected, particularly by the 2Apro variants
deficient in cleavage of eIF-4G?

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
A, schematic representation of the
poliovirus genome showing the point mutations in the 2Apro
sequence. The amino acids mutated are boxed: N18K, A22T,
L39F, C55Y, G60R, S66F, Y88S, Y88P, Y88F, G100N, G110S, V119M, G121E,
A125V, G126D, S134L, and D135N. 2Apro cleavage sites in the
polyprotein are denoted by a triangle ( ).
Asterisks show the amino acids forming the catalytic triad
of 2Apro (His-20, Asp-35, and Cys-109). B,
diagram of deletion mutants generated in 2Apro. Mutant 2A-1
(44) is also shown.
|
|
Action of 2Apro Variants on eIF-4G Cleavage and
Cellular Translation--
Infection of COS-1 cells with vaccinia virus
(vT7) inhibits the translation of cellular mRNA (45). However, if
cells are treated with AraC after infection, the replication of
vaccinia virus is blocked and cellular translation continues at
substantial levels (60-80% of control) for several hours.
Consequently, the use of AraC offers the possibility to test the action
of poliovirus 2Apro on cellular protein synthesis in cells
infected with vT7 and transfected with pTM1-2Apro.
Initially, pTM1 constructs bearing the different 2Apro
variants were transfected, infected with VT7, and treated with 40 µg/ml AraC. After 16 h of incubation, protein synthesis was estimated by [35S]methionine labeling of transfected
COS-1 cells. An aliquot of each sample was immunoreacted with
anti-eIF-4G antibodies. Expression of wt poliovirus 2Apro
reduced cellular protein synthesis by 80% as estimated by
densitometric quantitation of actin synthesis (Fig.
2). Analysis of eIF-4G cleavage in these
cells shows that most of this factor has been degraded, although
10-20% of eIF-4G remains intact, most probably corresponding to
untransfected cells. Notably, the level of expression was very variable
for the different 2Apro mutants. In general there is an
inverse correlation between 2Apro synthesis and the
capacity to block protein synthesis and to cleave eIF-4G. For most of
the variants, the major protein synthesized by transfected cells
corresponds to 2Apro.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of 2Apro expression on
cellular protein synthesis. COS-1 cells were first infected with
vT7 virus (5 pfu/cell) in the presence of AraC (40 µg/ml) and
transfected with pTM1 (vector) or with wt pTM1-2Apro or
its variants as indicated. Sixteen hours h later, the cells were
labeled for 1 h with [35S]methionine and analyzed by
SDS-PAGE and autoradiography (A). The position of actin and
2Apro protein bands are indicated. B, aliquots
of the same samples were analyzed by Western blotting using a
polyclonal rabbit serum against eIF-4G. Intact eIF-4G protein and its
cleavage products (CP) are indicated. C,
quantitation of cellular inhibition induced by the expression of
different 2Apro proteins. Actin bands shown in A
were quantitated by densitometry and expressed as percentage of control
cells (transfected with pTM1 vector, 100%). MOCK,
uninfected cells.
|
|
The 2Apro deletion mutants tested were devoid of eIF-4G
cleavage activity and did not significantly affect protein synthesis. The 1-22 and 66-97 variants were synthesized at very low
levels, and they were detectable only after prolonged gel exposures. At present we do not know the reason for this low expression, but one
possibility is that these proteins are very unstable and are rapidly
degraded. The 2Apro with point mutations cleaved eIF-4G to
varying degrees. Some variants such as A22T, L39F, S66F, Y88S, Y88P,
Y88F, G110S, V119M, G126D, and D135N hydrolyzed eIF-4G and blocked
protein synthesis at levels comparable to wt 2Apro.
However, other variants such as N18K, G60R, and G121E showed weak
proteolytic activity on eIF-4G and did not significantly reduce
cellular translation. Particularly striking is the G121E variant, which
synthesizes 2Apro at very high levels and yet cellular
translation is not affected. G121E together with N18K are the least
efficient variants as regards eIF-4G cleavage. Interestingly, mutant
2A-1, which was described as devoid of eIF-4G cleavage activity, showed
significant proteolytic activity on this factor when assayed by the vT7
transient expression system. This apparent discrepancy may reflect the
different systems used to detect eIF-4G cleavage.
Inhibition of Vaccinia Virus Translation by Several Poliovirus
2Apro Variants--
Poliovirus 2Apro is very
toxic for vaccinia virus, such that it was impossible to obtain
recombinant vaccinia viruses bearing the 2Apro gene (46,
47). Further work analyzing the action of this protease on vaccinia
virus gene expression indicated that 2Apro profoundly
interferes with vaccinia virus replication, such that no viral protein
synthesis is detected at late times of infection (48). Therefore, the
action of the different 2Apro variants described above was
tested on vaccinia virus late translation. An aliquot was taken to
assay the extent of eIF-4G cleavage in order to estimate the percentage
of transfected cells. The experiment was carried out as indicated in
Fig. 2, but AraC was omitted. The percentage of transfection achieved
was about 95% as judged by eIF-4G cleavage induced by wt
2Apro (Fig. 3B).
This result is consistent with the level of translation inhibition
obtained, which was above 90% (Fig. 3, A and C).
The higher inhibition of vaccinia virus protein synthesis obtained as
compared with the experiment shown in Fig. 2 may correspond in part to
a more efficient transfection. The point mutants that showed less
inhibitory potency on vaccinia virus translation (Fig. 3A),
such as G60R, N18K, C55Y, and G121E, left more eIF-4G uncleaved (Fig.
3B). However, with other 2Apro variants there is
not an evident correlation between eIF-4G cleavage and inhibition of
late viral protein synthesis. For instance, this is the case for the
N18K variant, which reduces viral translation by 75-80%, leaving part
of eIF-4G uncleaved. This inhibition of translation may be explained by
the fact that vaccinia virus late translation requires the synthesis of
early and intermediate proteins. Therefore, it may be that even partial
cleavage of eIF-4G interferes with viral protein synthesis at earlier
times of infection, amplifying the inhibition of late viral
translation. Alternatively, it is possible that poliovirus
2Apro blocks an as yet unidentified vaccinia virus function
unrelated to eIF-4G cleavage, which may lead to inhibition of late
translation. This possibility agrees well with the toxicity of
poliovirus 2Apro for vaccinia virus (46, 47).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of 2Apro expression on
vaccinia virus late translation. The experiment was carried out as
described in Fig. 2, except that AraC was omitted. A,
SDS-PAGE and autoradiography showing the synthesis of 2Apro
and some late vT7 proteins (80-kDa band). B, Western
blotting using anti-eIF-4G antiserum. Intact eIF-4G protein and its
cleavage products (CP) are indicated. C,
quantitation of the inhibition of vaccinia translation induced by the
expression of different 2Apro variants. The 80-kDa vaccinia
virus protein band marked in A was used for densitometric
quantitation. The data are expressed as percentage of control (cells
transfected with pTM1 vector; 100%). MOCK, uninfected
cells.
|
|
Blockade of Transcription and Translation of a Reporter Gene by
Poliovirus 2Apro and Its Variants--
The pioneering work
of Davies et al. (24) on the action of poliovirus
2Apro in different steps of gene expression showed that
2Apro inhibited the transcription of a reporter gene more
potently than its translation. However, it remains unclear whether this effect of 2Apro on transcription reflects a specific
inactivation of a component of the cellular transcriptional machinery
or if transcription is affected indirectly by the inhibition of protein
synthesis provoked by 2Apro. To distinguish between these
two possibilities, the action of poliovirus 2Apro and some
of the variants described above were assayed on transcription and
translation of luciferase as a reporter gene. Luciferase was expressed
either from pSVL-Luc (nuclear transcription) or from pKSLuc
(cytoplasmic transcription). Poliovirus wt 2Apro
drastically reduces transcription from the nuclear plasmid pSVL-Luc, but not from plasmid pKS-Luc, where transcription is driven by phage T7
RNA polymerase in the cytoplasm. Densitometric quantitation revealed a
reduction of luciferase transcription from pSVL-Luc of about
15-20-fold with respect to control cells transfected with pTM1 vector
without insert (Fig. 4A). By
contrast, luciferase synthesis is powerfully blocked in both instances
(Fig. 4, B and D). The effect of
2Apro on luciferase mRNA translation was estimated by
dividing the enzymatic activity of each sample by the luciferase
mRNA content. Thus, expression of poliovirus 2Apro
reduced translation of luciferase mRNA about 5-fold when plasmid pSV-Luc is tested, while the inhibition was about 100-fold with pKS-Luc. The conclusion from this experiment is that nuclear
transcription of a reporter gene is certainly blocked by
2Apro in good agreement with previous results (24), while
cytoplasmic transcription is not affected. Translation of the newly
generated mRNA is blocked by poliovirus 2Apro in both
instances.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of poliovirus wt 2Apro on
transcription and translation of luciferase. COS-1 cells were
transfected with 1 µg of pSVL-Luc plasmid (left
panel) or with 1 µg of pKS-Luc plasmid (right
panel) in the presence of 3 µg of pTM1 (labeled as
VECTOR) or 3 µg of pTM1-2Apro. Twelve hours
later, the cells were infected with vT7 (5 pfu/cell) in the presence of
AraC in order to induce the expression of 2Apro. Thirty-two
hours after transfection, the level of luciferase mRNA was
estimated by RT-PCR, using 1 µg of total RNA per sample as described
under "Experimental Procedures." The amplified bands corresponding
to a 0.5-kbp fragment of luciferase cDNA, as well PCR-amplified
fragment from pSVL-Luc DNA (PCR vector) used as marker, are shown
(A and C). Dilutions of RNA from cells
transfected with the vector are shown (1, 0.2, 0.1, and 0.05 µg).
Densitometric quantitation of bands are expressed in arbitrary units.
B and D, effect of 2Apro on
translation of luciferase gene. Luciferase activities were measured and
corrected by the amount of specific luciferase mRNA in each sample.
The data are expressed in arbitrary units.
|
|
The action of a number of poliovirus 2Apro variants on
transcription and translation of luciferase from pSVL-Luc was then
examined. These 2Apro variants showed different degrees of
eIF-4G cleavage. As shown in Fig.
5A, expression of wt
2Apro led to 12-15-fold reduction of luciferase
transcription, while the 2Apro mutants 1-22,
101-146, V119M, G121E, and D135N did not affect luciferase
transcription. Mutant S66F showed an effect similar to wt
2Apro, and the rest of the variants A22T, L39F, G60R, and
G100N showed an intermediate phenotype.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of some 2Apro variants on
transcription and translation of luciferase. COS-1 cells were
cotransfected with 1 µg of pSVL-Luc plasmid and with 3 µg of pTM1
plasmid (VECTOR) or with 3 µg of mutated
pTM1-2Apro plasmids in a manner similar to that described
in Fig. 4. A, quantitation of luciferase mRNA levels
analyzed by RT-PCR. B, effect of 2Apro proteins
on luciferase activity. The data were processed as in Fig. 4.
TRANSF, cells not transfected with pSVL-Luc;
RT, PCR amplification without previous
retrotranscription.
|
|
Analysis of luciferase activity indicated that variants V119M, D135N,
and, to a lesser extent, A22T, which did not affect transcription,
blocked translation of the luciferase mRNA to a degree similar to
wt 2Apro. This result agrees well with those described in
Figs. 2 and 3, where these 2Apro variants blocked both
cellular and vaccinia virus translation. On the other hand, mutant
G121E showed the least effect on both transcription and translation, in
accord with the effect shown by G121E on cellular protein synthesis
(Fig. 2). These findings indicate that the inhibition of transcription
and translation of a reporter gene by poliovirus 2Apro are
distinct phenomena that can be clearly separated in some of the
2Apro variants analyzed. Furthermore, these results support
the notion that the inhibition of transcription is not due to an
indirect effect mediated by the blockade of translation. The activities tested for the different 2Apro variants are summarized in
Table I.
Transcriptional Inhibition of an Integrated Luciferase Gene in
Poliovirus-infected HeLa Cells--
The experiments shown above
suggested that poliovirus 2Apro blocks class II
transcription in a specific manner. Our next step was to evaluate the
contribution of 2Apro activity to the inhibition of
cellular transcription observed after poliovirus infection. Previous
work has shown that inhibition of RNA polymerase II-mediated
transcription is due to 3Cpro activity in
poliovirus-infected cells. Indeed, recombinant 3Cpro
directly cleaves TATA-binding protein and CREB in cell-free systems (18-20). Much less is known about the action of poliovirus infection or 3Cpro alone on transcription in intact cells. Most of
these experiments have been done using nuclear extracts programmed with
plasmid DNA carrying the reporter gene to be transcribed. The
availability of a HeLa cell line that expresses luciferase in a
tetracycline-dependent manner opens the possibility of
assaying the action of poliovirus and individual poliovirus proteases
on transcription driven by RNA polymerase II (39). Luciferase activity
in HeLa cells clone X1/5 is induced about 1500-fold 6 h after
tetracycline withdrawal (Fig.
6B). Infection of these cells
with poliovirus 1 h after luciferase induction provoked a drastic
reduction in both luciferase activity and transcription of the
luciferase gene (Fig. 6, A and B). The presence
of guanidine, a known inhibitor of poliovirus RNA synthesis, does not
prevent this inhibition. Three different poliovirus variants bearing
point mutations in 2Apro, i.e. S66F (M3), D135N
(M6), and V119M (M7), were assayed for their effect on luciferase gene
expression. These poliovirus variants, which have been characterized in
detail recently (40), are viable but show defects in the
transactivation of translation by 2Apro. The three
poliovirus mutants tested cleaved eIF-4G and shut down host translation
(Fig. 6, C and D). Consequently, the three mutants drastically prevented luciferase synthesis, but mutants M7 and
M6 showed defects in blocking luciferase transcription. Notably, the M7
mutant synthesized luciferase mRNA transcripts at levels comparable
to the uninfected control, despite the fact that this mutant virus
synthesized substantial amounts of 3Cpro (Fig. 6,
A and D). The finding that the poliovirus M7
mutant blocks luciferase activity while having no effect on
transcription agrees well with the results described above, where this
2Apro mutant failed to block transcription from pSVL-Luc
(Fig. 5), but cellular and luciferase synthesis were profoundly
affected (Figs. 2 and 5).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of wt and 2Apro-mutated
polioviruses on transcription and translation of the integrated
luciferase gene. HeLa cells (clone X1/5) were induced to
synthesize luciferase by tetracycline withdrawal. One hour later, the
cells were infected with wild-type poliovirus (+WT) or with
the different mutants in 2Apro gene at 25 pfu/cell: S66F
(M3), D135N (M6), or V119M (M7). Five
hours after infection, the cells were metabolically labeled with
[35S]methionine for 30 min. Then, cell extracts were
obtained and divided into four aliquots. One aliquot was used to
measure luciferase activity, another to extract total RNA, the third
for analysis of protein synthesis by SDS-PAGE, and the last for Western
blotting against anti-eIF-4G and anti-3Cpro antisera.
A, Southern blotting of RT-PCR amplified luciferase
mRNAs using a biotinylated riboprobe against luciferase gene.
Dilutions of RNA from mock-infected cells are shown (1, 0.2, and 0.1 µg, respectively). IND, cells not induced;
+WT +GUA, cells infected with wt poliovirus and
treated with 0.5 mM guanidine; RT, PCR without
previous retrotranscription. PCR vector as marker. B, effect
of poliovirus infection on luciferase mRNA translation. Luciferase
activities from different samples were measured and corrected for the
luciferase mRNA content. C, SDS-PAGE and autoradiography
of cells infected with the different poliovirus mutants and
metabolically labeled with [35S]methionine. The positions
of some poliovirus proteins are shown. D, Western blotting
using anti-eIF-4G serum (upper panel) or
anti-3Cpro serum (lower panel). The
position of intact eIF-4G, its cleavage products (CP), as
well as poliovirus 3Cpro are indicated.
|
|
 |
DISCUSSION |
The inhibition of host gene expression after poliovirus infection
has been linked to the action of virus-encoded proteinases 2Apro and 3Cpro (4, 19, 24, 26). However,
little is known about the effect of individual expression of these
proteinases on transcription and translation in mammalian cells.
Therefore, the exact mechanism by which poliovirus disarms the cellular
gene expression is still a matter of intense research.
The differential effect of 2Apro expression on cellular
transcription and translation has now been analyzed using a genetic
approach. A number of 2Apro mutants have been obtained and
expressed in COS cells by means of pTM1/vT7 expression system. The
ability of 2Apro variants to block cellular translation
depends on their capacity to hydrolyze eIF-4G. Point mutants such as
G60R, N18K, and G121E showed weak proteolytic activity compared with wt
2Apro and failed to block cellular translation (Table I).
These data suggest that 2Apro expression, employing the vT7
system, impairs cellular translation through the inactivation of
eIF-4G. However, these results do not rule out that another event apart
from eIF-4G cleavage participates in the early shut-off of translation
observed in poliovirus infected cells (10, 12).
Vaccinia virus specific translation appears to be more sensitive to the
action of 2Apro than does cellular translation. Thus, only
the deletion mutant 66-97 was unable to interfere with vaccinia
translation. The point mutants G60R, N18K, and G121E, which failed to
shut down cellular translation, affected vaccinia late translation at
substantial levels. This effect could be explained in part by the fact
that vaccinia virus late translation relies upon the action of early and intermediate proteins. In addition, transcription of these genes in
a cascade fashion is necessary to obtain late protein synthesis. A
small effect of these 2Apro variants on early vaccinia
translation may result in an amplified effect on translation of
vaccinia late polypeptides. It should be kept in mind that the presence
of the poliovirus 2Apro gene alone is toxic for vaccinia
replication, even when this sequence is placed in the inverse
orientation where no expression of 2Apro occurs (46,
47).
Notably, we have observed that poliovirus 2Apro is a potent
transcriptional inhibitor of class II genes when expressed in COS cells. The presence of 2Apro leads to a 15-20-fold
inhibition of transcription from a reporter gene (pSVL-Luc) bearing the
late promoter of SV40. These results agree well with whose obtained by
Davies et al. (24) and support the notion that
2Apro impairs gene expression by blocking both cellular
transcription and translation. Furthermore, the fact that
2Apro expression did not affect cytoplasmic transcription
driven by T7 RNA polymerase suggests that 2Apro inactivates
the nuclear transcriptional machinery. Interestingly, some
2Apro mutants such as D135N and V119M failed to repress
luciferase transcription, despite retaining the capacity to block
cellular and luciferase translation. This finding argues against the
transcriptional inhibition as an indirect effect of translational
blockade induced by 2Apro. Clearly, the inhibitory
functions of 2Apro on cellular transcription and
translation can be separated using mutants described in this work
(Table I).
The above conclusion was reinforced by the analysis of reconstituted
polioviruses bearing mutated 2Apro: V119M (M7) and D135N
(M6). These mutants shut down cellular translation but were defective
in blocking transcription of the integrated luciferase gene, despite
the synthesis of substantial amounts of 3Cpro. This result
was surprising because previous studies have linked the activity of
3Cpro to the shut-off of cellular transcription after
poliovirus infection (18, 19). Indeed, some transcription factors such
as TBP, CREB, and transcription factor IIC have been described as
targets of poliovirus 3Cpro, although the relevance of
these inactivations to the transcriptional inhibition induced by
poliovirus remain to be established. The results obtained with
poliovirus mutant M7 (2AV119M) point to the action of poliovirus
2Apro as a major determinant of class II-specific
transcriptional inhibition after poliovirus infection. In this study
the effect of poliovirus infection on transcription of a specific host
gene has been tested for the first time in intact cells. However, the
possibility that both 2Apro and 3Cpro
proteinases may cooperate to complete the global transcriptional inhibition observed after poliovirus infection, remains open.
How does 2Apro impair cellular transcription?
Immunostaining of cells expressing poliovirus 2Apro shows
that this enzyme is preferentially located in the cytoplasm (37).
However, it cannot be ruled out that a small amount of 2Apro might migrate to the nucleus to cleave some cellular
factors as has been shown for poliovirus 3Cpro (18, 49). At
present, the best known cellular substrate for poliovirus
2Apro is the translational initiation factor eIF-4G.
However, after poliovirus infection, several proteins become degraded;
the majority of them remain to be identified (50). It could be that
some of these cellular polypeptides, perhaps implicated in cellular transcription, are directly or indirectly inactivated by
2Apro. In this respect, Yalamanchili et al. (25)
have reported recently that recombinant poliovirus 2Apro
cleaves TBP in vitro, although this cleavage does not appear to lead to inhibition of transcription by RNA polymerase II in vitro. Additional experiments will be required to test whether cleavage of TBP by poliovirus 2Apro has repercussions on
class II transcription in vivo.
Finally, inducible expression of poliovirus 2Apro in yeast
also arrests cellular transcription (32). It is possible that
poliovirus 2Apro inactivates similar factor(s) in both
mammalian and yeast cells. This attractive hypothesis would allow us to
capitalize on the genetic advantages of yeast to find novel cellular
substrates of poliovirus 2Apro. Experiments in this
direction are in progress in our laboratory.
 |
ACKNOWLEDGEMENTS |
We thank R. Aldabe, H. Bujard, and N. Sonenberg for providing with plasmid pTM1-2Apro, HeLa cell
clone X1/5, and plasmid pHF121pXA, respectively. We acknowledge the
critical reading of the manuscript by John Lewis, and the expert
technical assistance of M. A. Sanz.
 |
FOOTNOTES |
*
This work was supported in part by DGICYT Grant PB94-0148
and an institutional grant (to the Centro de Biología
Molecular) from the Fundación Ramón Areces.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Recipient of a Comunidad Autónoma de Madrid fellowship. To
whom correspondence and reprint requests should be addressed. Tel:
34-1-91-3978450; Fax: 34-1-91-3974799; E-mail:
iventoso{at}trasto.cbm.uam.es.
§
Recipient of a Consejo Superior de Investigaciones
Científicas postdoctoral fellowship.
The abbreviations used are:
eIF-4G, eukaryotic
initiation factor 4G; PAGE, polyacrylamide gel electrophoresis; pfu, plaque-forming unit(s); wt, wild-type; TBP, TATA-binding protein; CREB, cAMP-responsive element-binding protein; DMEM, Dulbecco's modified
Eagle's medium; kb, kilobase(s); kbp, kilobase pair(s); RT, reverse
transcriptase; PCR, polymerase chain reaction.
 |
REFERENCES |
-
Crawford, N.,
Fire, A.,
Samuels, M.,
Sharp, P. A.,
and Baltimore, D.
(1981)
Cell
27,
555-561[CrossRef][Medline]
[Order article via Infotrieve]
-
Leibowitz, R.,
and Penman, S.
(1971)
J. Virol.
8,
661-668[Abstract/Free Full Text]
-
Etchison, D.,
Milburn, S. C.,
Edery, I.,
Sonenberg, N.,
and Hershey, J. W.
(1982)
J. Biol. Chem.
257,
14806-14810[Abstract/Free Full Text]
-
Krausslich, H. G.,
Nicklin, M. J.,
Toyoda, H.,
Etchison, D.,
and Wimmer, E.
(1987)
J. Virol.
61,
2711-2718[Abstract/Free Full Text]
-
Wyckoff, E. E.,
Hershey, J. W. B.,
and Ehrenfeld, E.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
9529-9533[Abstract/Free Full Text]
-
Liebig, H.-D.,
Ziegler, E.,
Yan, R.,
Hartmuth, K.,
Klump, H.,
Kowalski, H.,
Blaas, D.,
Sommergruber, W.,
Frasel, L.,
Lamphear, B.,
Rhoads, R.,
Kuechler, E.,
and Skern, T.
(1993)
Biochemistry
32,
7581-7588[CrossRef][Medline]
[Order article via Infotrieve]
-
Lamphear, B. J.,
Yan, R.,
Yang, F.,
Waters, D.,
Liebig, H.-D.,
Klump, H.,
Kuechler, E.,
Skern, T.,
and Rhoads, R. E.
(1993)
J. Biol. Chem.
268,
19200-19203[Abstract/Free Full Text]
-
Haghighat, A.,
Svitkin, Y.,
Novoa, I.,
Kuechler, E.,
Skern, T.,
and Sonenberg, N.
(1996)
J. Virol.
70,
8444-8450[Abstract]
-
Novoa, I.,
Martínez-Abarca, F.,
Fortes, P.,
Ortín, J.,
and Carrasco, L.
(1997)
Biochemistry
36,
7802-7809[CrossRef][Medline]
[Order article via Infotrieve]
-
Bonneau, A. M.,
and Sonenberg, N.
(1987)
J. Virol.
61,
986-991[Abstract/Free Full Text]
-
Novoa, I.,
Cotten, M.,
and Carrasco, L.
(1996)
J. Virol.
70,
3319-3324[Abstract]
-
Perez, L.,
and Carrasco, L.
(1992)
Virology
189,
178-186[CrossRef][Medline]
[Order article via Infotrieve]
-
Irurzun, A.,
Sanchez-Palomino, S.,
Novoa, I.,
and Carrasco, L.
(1995)
J. Virol.
69,
7453-7460[Abstract]
-
Keiper, B. D.,
and Rhoads, R. E.
(1997)
Nucleic Acids Res.
25,
395-402[Abstract/Free Full Text]
-
Lamphear, B. J.,
Kirchweger, R.,
Skern, T.,
and Rhoads, R. E.
(1995)
J. Biol. Chem.
270,
21975-21983[Abstract/Free Full Text]
-
Ohlmann, T.,
Rau, M.,
Pain, V. M.,
and Morley, S. J.
(1996)
EMBO J.
15,
1371-1382[Medline]
[Order article via Infotrieve]
-
Pestova, T. V.,
Shatsky, I. N.,
and Hellen, C. U. T.
(1996)
Mol. Cell. Biol.
16,
6870-6878[Abstract]
-
Clark, M. E.,
Lieberman, P. M.,
Berk, A. J.,
and Dasgupta, A.
(1993)
Mol. Cell. Biol.
13,
1232-1237[Abstract/Free Full Text]
-
Yalamanchili, P.,
Harris, K.,
Wimmer, E.,
and Dasgupta, A.
(1996)
J. Virol.
70,
2922-2929[Abstract]
-
Yalamanchili, P.,
Datta, U.,
and Dasgupta, A.
(1997)
J. Virol.
71,
1220-1226[Abstract]
-
Clark, M.,
Hämemerle, T.,
Wimmer, E.,
and Dasgupta, A.
(1991)
EMBO J.
10,
2941-2947[Medline]
[Order article via Infotrieve]
-
Shen, Y. H.,
Igo, M.,
Yalamanchili, P.,
Berk, A. J.,
and Dasgupta, A.
(1996)
Mol. Cell. Biol.
16,
4163-4171[Abstract]
-
Sun, X. H.,
and Baltimore, D.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
2143-2146[Abstract/Free Full Text]
-
Davies, M. V.,
Pelletier, J.,
Meerovitch, K.,
Sonenberg, N.,
and Kaufman, R. J.
(1991)
J. Biol. Chem.
266,
14714-14720[Abstract/Free Full Text]
-
Yalamanchili, P.,
Banerjee, R.,
and Dasgupta, A.
(1997)
J. Virol.
71,
6881-6886[Abstract]
-
Dougherty, W. G.,
and Semler, B. L.
(1993)
Microbiol. Rev.
57,
781-822[Abstract/Free Full Text]
-
Toyoda, H.,
Nicklin, M. J.,
Murray, M. G.,
Anderson, C. W.,
Dunn, J. J.,
Studier, F. W.,
and Wimmer, E.
(1986)
Cell
45,
761-770[CrossRef][Medline]
[Order article via Infotrieve]
-
Lee, C. K.,
and Wimmer, E.
(1988)
Virology
166,
405-414[CrossRef][Medline]
[Order article via Infotrieve]
-
Ventoso, I.,
and Carrasco, L.
(1995)
J. Virol.
69,
6280-6288[Abstract]
-
Hellen, C. U. T.,
Fäcke, M.,
Kräusslich, H.,
Lee, C.,
and Wimmer, E.
(1991)
J. Virol.
65,
4226-4231[Abstract/Free Full Text]
-
Yu, S. F.,
and Lloyd, R. E.
(1991)
Virology
182,
615-625[CrossRef][Medline]
[Order article via Infotrieve]
-
Barco, A.,
and Carrasco, L.
(1995)
FEBS Lett.
371,
4-8[CrossRef][Medline]
[Order article via Infotrieve]
-
Hambidge, S. J.,
and Sarnow, P.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10272-10276[Abstract/Free Full Text]
-
Macadam, A. J.,
Ferguson, G.,
Fleming, T.,
Stone, D. M.,
Almond, J. W.,
and Minor, P. D.
(1994)
EMBO J.
13,
924-927[Medline]
[Order article via Infotrieve]
-
Lu, H.-H.,
Yang, C.-F.,
Murdin, A. D.,
Klein, M. H.,
Harber, J. J.,
Kew, O. M.,
and Wimmer, E.
(1994)
J. Virol.
68,
7507-7515[Abstract/Free Full Text]
-
Molla, A.,
Paul, A. V.,
Schmid, M.,
Jang, S. K.,
and Wimmer, E.
(1993)
Virology
196,
739-747[CrossRef][Medline]
[Order article via Infotrieve]
-
Aldabe, R.,
Feduchi, E.,
Novoa, I.,
and Carrasco, L.
(1995)
FEBS Lett.
377,
1-5[CrossRef][Medline]
[Order article via Infotrieve]
-
Aldabe, R.,
Feduchi, E.,
Novoa, I.,
and Carrasco, L.
(1995)
Biochem. Biophys. Res. Commun.
215,
928-936[CrossRef][Medline]
[Order article via Infotrieve]
-
Gossen, M.,
and Bujard, H.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
5547-5551[Abstract/Free Full Text]
-
Barco, A.,
Ventoso, I.,
and Carrasco, L.
(1997)
J. Biol. Chem.
272,
12683-12691[Abstract/Free Full Text]
-
Sambrook, J.,
Fritsch, E. R.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Wet, J. R. de,
Wood, K. V.,
DeLuca, M.,
Helinski, D. R.,
and Subramani, S.
(1987)
Mol. Cell. Biol.
7,
725-737[Abstract/Free Full Text]
-
Favaloro, J.,
Treisman, R.,
and Kamen, R.
(1980)
Methods Enzymol.
65,
718-749[Medline]
[Order article via Infotrieve]
-
Bernstein, H. D.,
Sonenberg, N.,
and Baltimore, D.
(1985)
Mol. Cell. Biol.
5,
2913-2923[Abstract/Free Full Text]
-
Schnierle, B. S.,
and Moss, B.
(1992)
Virology
188,
931-933[CrossRef][Medline]
[Order article via Infotrieve] -
-
Turner, P. C.,
Young, D. C.,
Flanegan, J. B.,
and Moyer, R. W.
(1989)
Virology
173,
509-521[CrossRef][Medline]
[Order article via Infotrieve]
-
Jewell, J. E.,
Ball, L. A.,
and Rueckert, R.
(1990)
J. Virol.
64,
1388-1393[Abstract/Free Full Text]
-
Feduchi, E.,
Aldabe, R.,
Novoa, I.,
and Carrasco, L.
(1995)
Eur. J. Biochem.
234,
849-854[Medline]
[Order article via Infotrieve]
-
Fernández-Tomas, C.
(1982)
Virology
116,
629[CrossRef][Medline]
[Order article via Infotrieve]
-
Urzáinqui, A.,
and Carrasco, L.
(1989)
J. Virol.
63,
4729-4735[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. M. Morrison and V. R. Racaniello
Proteinase 2Apro Is Essential for Enterovirus Replication in Type I Interferon-Treated Cells
J. Virol.,
May 1, 2009;
83(9):
4412 - 4422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Castello, E. Alvarez, and L. Carrasco
Differential Cleavage of eIF4GI and eIF4GII in Mammalian Cells: EFFECTS ON TRANSLATION
J. Biol. Chem.,
November 3, 2006;
281(44):
33206 - 33216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Zhou and W. Song
Leaky Scanning and Reinitiation Regulate BACE1 Gene Expression.
Mol. Cell. Biol.,
May 1, 2006;
26(9):
3353 - 3364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Alvarez, L. Menendez-Arias, and L. Carrasco
The Eukaryotic Translation Initiation Factor 4GI Is Cleaved by Different Retroviral Proteases
J. Virol.,
December 1, 2003;
77(23):
12392 - 12400.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ventoso, R. Blanco, C. Perales, and L. Carrasco
HIV-1 protease cleaves eukaryotic initiation factor 4G and inhibits cap-dependent translation
PNAS,
October 16, 2001;
(2001)
231343498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, H.-H. Lu, S. Mueller, and E. Wimmer
The C-terminal residues of poliovirus proteinase 2Apro are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage
J. Gen. Virol.,
February 1, 2001;
82(2):
397 - 408.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Barco, E. Feduchi, and L. Carrasco
A Stable HeLa Cell Line That Inducibly Expresses Poliovirus 2Apro: Effects on Cellular and Viral Gene Expression
J. Virol.,
March 1, 2000;
74(5):
2383 - 2392.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
I. Novoa and L. Carrasco
Cleavage of Eukaryotic Translation Initiation Factor 4G by Exogenously Added Hybrid Proteins Containing Poliovirus 2Apro in HeLa Cells: Effects on Gene Expression
Mol. Cell. Biol.,
April 1, 1999;
19(4):
2445 - 2454.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ventoso, R. Blanco, C. Perales, and L. Carrasco
HIV-1 protease cleaves eukaryotic initiation factor 4G and inhibits cap-dependent translation
PNAS,
November 6, 2001;
98(23):
12966 - 12971.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|