INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

Glutathione conjugates play a central role in normal physiology and in responses to injury (1-6). Among the more important GSH derivatives are conjugates of eicosanoids, xenobiotics, and carcinogens. At least three types of eicosanoid-GSH conjugates have been identified, including derivatives of leukotriene A₄, prostaglandins, and hepoxilins. The LTA₄-GSH conjugate (LTC₄)¹ and its cleavage products, LTD₄ and LTE₄, are powerful mediators of bronchoconstriction, vasoconstriction, mucus formation, and edema. As a result, they are important mediators of asthma, coronary artery spasm, and nephropathies (7-15). Prostaglandins play diverse biological roles and are involved in the development of the inflammatory response, inhibition of platelet aggregation, and regulation of immune responses (6). Prostaglandins are inactivated and cleared by conjugation to GSH (3, 6). Hepoxilin A₃ forms a GSH conjugate, hepoxilin A₃-C, that is known to be a potent regulator of hippocampal neurons (4). In addition, several neurotransmitters, including serotonin and dopamine, form GSH conjugates, suggesting an additional role for this pathway in the central nervous system (16, 17). GSH conjugation along with glucuronide formation is the major pathway by which toxins, drugs, and carcinogens such as CH₃Hg, acetaminophen, and aflatoxin are detoxified and excreted (5, 18-21).

Until recently, it was thought that the sequential cleavage of GSH conjugates and their derivative cysteinyl-glycine conjugates were catalyzed by two enzymes. GGT was known to cleave a -glutamyl group from GSH conjugates, and a dipeptidase, often identified as membrane-bound dipeptidase, was believed to cleave the Cys-Gly bond of conjugates to yield Cys derivatives (2). We have recently developed mice deficient in GGT and have shown that tissues from these mice will not cleave GSH, but they retain the ability to metabolize LTC₄ to LTD₄, its Cys-Gly derivative (22, 23). We have partially purified this activity and termed it -glutamyl leukotrienase (GGL) to reflect this fact (23); however, the enzyme will also cleave S-decyl GSH, other alkyl GSH derivatives, and S-nitrosyl GSH (23, 24). A human cDNA coding for an enzyme termed GGT-rel shares at least some properties with GGL (25). While we were preparing this manuscript for publication, a report identifying the rat homologue of human GGT-rel appeared (26).

In other experiments, we have produced membrane-bound dipeptidase-deficient mice and found that tissues from these mice are capable of metabolizing LTD₄ to LTE₄, the Cys derivative (27). Thus, like the cleavage of GSH conjugates, more than one enzyme is capable of catalyzing the second step of this pathway.

A new picture is emerging in which a variety of enzymes participate in the biotransformation of GSH conjugates. At present, it is unknown how many enzymes are involved in each step and what role each plays in the regulation of these important biological molecules. To begin to examine this pathway in more detail, we have cloned a full-length mouse GGL cDNA and the corresponding gene and examined its expression in mouse tissues.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

Materials-- GGT-deficient mice were developed in our laboratory (22). All restriction enzymes were purchased from Boehringer Mannheim, and [-³²P]UTP and [-³²P]ATP were from NEN Life Science Products. Primers and Dullbecco's modified Eagle's medium were from Life Technologies, Inc. Fetal bovine serum, geneticin, LTC₄, LTD₄, LTE₄, and other chemicals were purchased from Sigma unless otherwise indicated.

RNA Isolation-- Total RNAs were isolated from various GGT-deficient mouse tissues following the acid guanidinium thiocyanate procedure described by Chomczynski and Sacchi (28). Poly(A)⁺ RNA was isolated using a Poly(A)Ttract mRNA isolation System III (Promega) or mRNA isolation kits from Ambion.

Isolation and Sequencing of Full-length GGL cDNA-- Spleen poly(A)⁺ RNA from GGT-deficient mice was reverse transcribed by human GGT-rel primers GGTR1-4, four partially overlapping 21-mers corresponding to bases 1537-1565 (5'GTTGATGGTGCTGGTGGCAGCCACGGCGC3') of human GGT-rel cDNA (25). The resulting cDNA was amplified by PCR using primers AP1 and GGTR5-8, four partially overlapping 21-mers corresponding to bases 1500-1552 (5'GTGGCAGCCACGGCGCTGCCATCCTCCCCCAGCACAGACACATGGGACGTGCC3') of human GGT-rel cDNA (25). AP1, a primer pairing with a 5' adaptor, was ligated to the 5' cDNA after reverse transcription. The cDNA was further amplified by PCR using primers GGTR9 (5'ACAGGGAAGGTGGAGGTCATC3') corresponding to bases 642-662 of human GGT-rel cDNA and GGTR10 (5'GTCTCTACAAGGTGGTGGTAC3') corresponding to bases 1295-1315 of human GGT-rel cDNA. A cDNA fragment of 680 bp (cDNA I) was obtained, cloned into pT7Blue(R)T-Vector (Novagen), and sequenced. The fragment shared 80% nucleotide sequence identity with the corresponding human GGT-rel sequence.

In Vitro Transfection of Murine NIH/3T3 Cells with Full-length GGL cDNA-- Murine NIH/3T3 cells were maintained in Dullbecco's modified Eagle's medium with 10% fetal bovine serum. Full-length GGL cDNA was released from pT7Blue(R)T-Vector and subcloned into a pCMV vector (CLONTECH). The construct was cotransfected into NIH/3T3 cells with pGK-neo using the calcium phosphate precipitation method, and the stable transfectants were selected in the presence of geneticin as described (29). LTC₄ to LTD₄ converting activity (GGL activity) and GSH cleavage were assayed by high performance liquid chromatography methods (23). The GGL enzyme activities for organs presented in this paper (Table I) are higher than those presented earlier (23) for which we used material frozen at 80 °C. All assays reported in this paper are carried out on homogenates of fresh organs. -Glutamyl-p-nitroanilide cleaving activity was assayed as described previously (22).

GGL Gene Structure Identification-- GGL genomic clones were isolated from a mouse  FixII genomic library (Stratagene) screened with GGL cDNA containing the full-length coding region as described previously (30, 31). The intron-exon organization of the gene was determined by the same procedures as used for the mouse GGT gene (30) and mouse GSH synthetase gene (31).

Primer Extension Analysis-- 26 µg of mouse spleen poly(A)⁺ RNA was used for primer extension analysis. The primer was GGL6 (5'CTGGACAGAAAGGATGACGGACAGCCTTACAGATAGGTGG3'). The reaction was carried out essentially as described previously (32).

Detection of GGL RNA Expression in Mouse Tissues-- Expression of GGL RNA in various mouse tissues was detected by Northern blot (31) and ribonuclease protection assay (Ambion). To obtain the probe for ribonuclease protection, a GGL cDNA fragment stretching from base 28 to base 173 (Fig. 1) was cloned into the pT7Blue(R)T plasmid. The plasmid was linearized with BamHI and transcribed by T7 RNA polymerase in the presence of [-³²P]UTP using an in vitro transcription kit (Stratagene). 100 µg of RNA from tissues of GGT-deficient mice (spleen, small intestine, kidney, liver, lung, and brain) and 2.0 × 10⁵ cpm of GGL probe were used for each assay following the manufacturer's instruction. Hybridization was carried out at 42 °C for 18 h followed by RNase digestion at 37 °C for 1 h with a 100-fold dilution of RNase R solution in the kit.

In Situ Hybridization-- A GGL cDNA fragment stretching from base 28 to base 254 (Fig. 1) was cloned into the pT7Blue(R)T plasmid in both orientations. To generate antisense and sense probes, the plasmids were then linearized by BamHI and transcribed by T7 RNA polymerase in the presence of digoxigenin-labeled UTP (Boehringer Mannheim). Sections of paraffin-embedded organs from wild-type and GGT-deficient mice were incubated on slides with 0.001% proteinase K for 20 min at 37 °C. After acetylation with 0.25% acetic anhydride for 5 min at room temperature (to block positive charges on tissue induced by protease digestion), the sections were dehydrated and prehybridized for 1 h at 45 °C in a hybridization buffer consisting of 50% deionized formamide, 2 × standard SSC solution, 20 mM Tris(hydroxymethyl)aminomethane, pH 8.0, 1 × Denhardt's solution, 1 mM ethylenediaminetetraacetic acid, 100 mM dithiothreitol, and 0.5 mg/ml yeast tRNA. The sections were then incubated with an antisense riboprobe (or a sense probe as a negative control) at 45 °C overnight followed by successive incubations in 2 × SSC for 1 h, 1 × SSC for 30 min at room temperature, 0.5 × SSC with RNase A at 65 °C for 30 min, and 0.5 × SSC for 1 h at room temperature. The tissues were incubated with a polyclonal sheep anti-digoxigenin antibody labeled with alkaline phosphatase. No differences were seen in patterns of in situ hybridization in GGT-deficient and wild-type mice. In all cases, hybridizations with the sense strand were negative.

Exposure of Mice to Oxygen-- GGT-deficient mice (22) and their wild-type littermates were exposed to 80% oxygen continuously for 120 h as described previously with minor modifications (33). They were sacrificed by metofane inhalation, then cervical dislocation. RNA was isolated from lungs of these mice for Northern blotting (31). Lung homogenates from oxygen-exposed and air-breathing control GGT-deficient mice were used to assay GGL activity (23).

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Isolation and Analysis of Mouse GGL cDNA-- As an initial step in examining the pathway(s) involved in the biotransformation of GSH conjugates, we cloned a full-length GGL cDNA by an RT-PCR strategy using poly(A)⁺ RNA from the spleen of GGT-deficient mice and primers for GGT-rel, a human gene product that shares some substrate specificity and properties with GGL (22, 23, 25). Although a search for genes related to human GGT-rel in the mouse by Northern blotting was negative (25), we were able to detect LTC₄ to LTD₄ conversion (GGL activity) in GGT-deficient mice (23). We reasoned that because GGL and GGT-rel shared some functions, it was likely that GGL would be at least in part homologous with GGT-rel. We isolated a 2.3-kb GGL cDNA containing an open reading frame of 1719 nucleotides, a 5' UTR of 314 nucleotides, and a 3' UTR of 284 nucleotides followed by the polyadenylation site, which is 18 nucleotides upstream of the poly(A) tail. The GGL cDNA and its deduced amino acid sequences are shown in Fig. 1. The cDNA shares an overall 68% nucleotide sequence identity with human GGT-rel cDNA (25) and an 89% identity with the recently identified rat homologue (26). The predicted amino acid sequence shows 77% identity with that of human GGT-rel (Fig. 2) and 88% identity with the rat sequence (26). The predicted heavy chain of mouse GGL contains 388 amino acids compared with 387 amino acids for human GGT-rel, whereas the predicted light chain contains 185 amino acids compared with 199 amino acids for human GGT-rel (Figs. 1 and 2 and Ref. 25). Closer inspection of the two cDNAs revealed that a stretch of 48 nucleotides in the region coding for the light chain of GGT-rel (corresponding to amino acids 446-461 of human GGT-rel in Fig. 2) was missing in GGL, which would account for the somewhat smaller predicted size of the GGL protein (573 amino acids) compared with the human GGT-rel protein (586 amino acids). The deletion of 48 nucleotides compared with human GGT-rel sequence also occurred in the rat GGT-rel cDNA sequence, which predicts 572 amino acids (26). From the putative structure of the rat protein, the histidine at position 371 of mouse GGL is deleted in rat GGT-rel (Fig. 2 and Ref. 26). GGL has six putative N-glycosylation sites, all located in the putative heavy chain (Fig. 1).

View larger version (64K): [in this window] [in a new window]   Fig. 1.   Nucleotide sequence of mouse GGL cDNA and its deduced amino acid sequence. The numbers of nucleotides and amino acids are indicated to the right of the sequences. The underlined sequences are primers with their names and orientations (horizontal arrows) above them. The triangle above the sequence at amino acid 389 indicates the putative N terminus of the light chain; the bold sequence indicates the putative polyadenylation signal. Asterisks show the possible N-linked glycosylation sites. The vertical arrows () mark the splice junctions.

View larger version (67K): [in this window] [in a new window]   Fig. 2.   Comparison of deduced amino acid sequences of human GGT-rel, mouse GGL, and GGT. HU-GGTR, human GGT-rel sequence (25); MU-GGL, mouse GGL sequence, and MU-GGT, mouse GGT sequence (30). The N termini of the light subunits for human GGT-rel at position 388, GGL (putative) at position 389, and GGT at position 380 are underlined.

Expression of GGL cDNA in Murine NIH/3T3 Cells-- To confirm that the cDNA we cloned from GGT-deficient mouse spleen codes for GGL activity, we transfected the cloned full-length cDNA under the regulation of the cytomegalovirus promoter into murine NIH/3T3 cells. Normally, these cells do not express either GGL or GGT. We isolated three clones with enzyme activity, thus demonstrating that this cDNA codes for GGL (Fig. 3). The specific activities of the three clones for conversion of LTC₄ to LTD₄ were 1.93, 3.48, and 4.10 µmol/g of protein/h, respectively. In addition to LTD₄, we detected LTE₄ in our reactions (Fig. 3). The appearance of this leukotriene results from the cleavage of LTD₄ to LTE₄ by dipeptidase(s) in NIH/3T3 cells (23, 34). We were unable to demonstrate cleavage of GSH or -glutamyl-p-nitroanilide (a substrate used to assay GGT) by transfected 3T3 cells (data not shown); this result confirms our earlier findings with partially purified enzyme preparations from GGT-deficient mice (23).

View larger version (11K): [in this window] [in a new window]   Fig. 3.   Conversion of LTC4 to LTD4 by GGL cDNA-transfected NIH/3T3 cells. Protein (50 µg) from GGL cDNA-transfected NIH/3T3 cell lysate (A), GGT-deficient mouse spleen homogenate (B), and control NIH/3T3 cell lysate (C) were incubated with 1 nmol of LTC4. The reactions were terminated at 3 h of incubation, and products were analyzed by reversed phase high performance liquid chromatography as described (23) (See "Experimental Procedures" for additional detail). 1, LTC4; 2, LTD4; 3, LTE4; mAu, milliabsorbance unit.

Genomic Structure of Mouse GGL-- A Southern blot of mouse DNA digested with EcoRI, HindIII, both EcoRI and HindIII, and BamHI and probed with a 0.37-kb GGL cDNA fragment yielded single bands (data not shown), indicating that GGL is a single copy gene. Subsequently, from 5 × 10⁵ phages of a mouse genomic  FixII library, we isolated seven individual clones that hybridized with the cDNA probe. These were mapped with restriction endonucleases and subcloned. Intron-exon boundaries were identified by sequencing the subclones that hybridized to the cDNA probe and comparing their genomic sequences with the GGL cDNA sequence. As a result, we found that GGL has 12 exons spanning approximately 26 kb (Fig. 4). The average length of exons is 190 bp, whereas that of introns is about 2.2 kb. All the intron-exon boundaries follow the GT/AG rule of splice site consensus (35). Interestingly, the intron-exon organization of GGL is almost identical to that of GGT with all the splice sites of GGL being consistent with those of GGT except for intron 9, which is spliced 6 bp (2 amino acids) upstream of the site corresponding to that of GGT (Fig. 4).

View larger version (12K): [in this window] [in a new window]   Fig. 4.   Structural comparison of the mouse GGL and GGT genes. Exons are denoted by solid boxes and drawn to scale. Partial restriction maps are also shown. B, BamHI; E1, EcoRI; E5, EcoRV; H, HindIII; P, PstI; St, StuI; X, XhoI. GGT data are from Ref. 30. As described in the text, the last exon (12th) of GGT is located 3 kb upstream of the first exon of GGL.

Analysis of GGL RNA-- To determine if GGL and GGT are similar in their 5' UTR, we examined the 5' UTR of mouse GGL cDNA by the RACE technique. We examined 46 clones containing the 5' UTR: 30 from kidney, 6 from liver, and 10 from spleen, and found only one 5' UTR that is part of first coding exon of GGL (Fig. 1). In contrast, the mouse GGT gene contains at least nine 5'-noncoding exons that generate seven types of RNA with different 5' UTRs (32, 36-38). These findings suggest that regulation of mouse GGL transcription is different from that of mouse GGT (39).

Sequence of the 5'-Flanking Region and Determination of Transcription Start Site-- The DNA sequence containing part of GGL 5' UTR and its 5' flanking region is presented in Fig. 5A. The transcription start site of GGL was determined by primer extension and ribonuclease protection analyses. For primer extension, mouse spleen poly(A)⁺ RNA was used with yeast tRNA as a negative control. The primer GGL6 for reverse transcription is located within the 5' UTR of the GGL gene (Fig. 5A, bases +111 to +150 corresponding to bases 180 to 219 in Fig. 1). A product, 150 nucleotides in length, was found (Fig. 5B), indicating the 5' UTR of GGL consists of 329 nucleotides (150 + 179). The result was confirmed by ribonuclease protection assay (Fig. 5C). The probe for ribonuclease protection assay was transcribed from a subclone containing GGL DNA sequence from bases 110 to +150 (Fig. 5A). The conditions for the reaction were the same as for the ribonuclease protection assay for detecting GGL RNA expression (see "Experimental Procedures") except that a 50-fold dilution of RNase R solution was used. The protected fragment (Fig. 5C) seems slightly longer than the expected 150 nucleotides. This apparent extra length is the result of comparing the mobility of RNA with DNA markers. The transcription start site is marked as +1 (Fig. 5A). The start site and its surrounding sequence (bold in Fig. 5A) match the PyPyA+1NT/APyPy consensus sequence for an initiator (40).

View larger version (45K): [in this window] [in a new window]   Fig. 5.   Sequence of the 5'-flanking region and determination of transcription start site. A, GGL DNA sequence containing part of 5'-untranslated exon and 499 bases of the 5'-flanking region. The transcription start site is marked as +1 and underlined. The initiator is in bold. The putative transcription factor binding sequences are underlined (AT rich, 14 to 26; SP1, 141 to 146, 149 to 154, and 157 to 163; CCAAT box, 189 to 193; AP2, 315 to 320). The oligonucleotide for primer extension (GGL6) is underlined; the arrow indicates the direction of extension. B, primer extension analysis (PE). MW, molecular weight marker (pBR322 DNA-MspI digest); T, tRNA as a negative control; Sp, spleen poly(A)+ RNA. The arrow indicates the primer extension product. C, ribonuclease protection assay (RPA). MW and T, the same as in panel B; P, probe; Sp, spleen total RNA. The arrow indicates the protected fragment.

GGL and GGT Are Members of the Same Gene Family-- Because of the similarity between GGL and GGT, we reasoned that one might be derived from the other by gene duplication and divergence, and they might be tightly linked. Therefore, we examined our mouse genomic GGT clones (30) and found that one of them (gtA) contained the 5' end of GGL about 3 kb 3' of GGT.

Detection of GGL RNA Expression in Mouse Tissues-- To determine the level of GGL expression in mouse tissues, we used Northern blot analysis and ribonuclease protection assays. Northern blot analysis failed to detect any GGL signal from spleen, small intestine, kidney, liver, and lung, suggesting that GGL is expressed at low levels or not at all in these organs (data not shown); These findings are in agreement with data on human and rat GGT-rel (25, 26). When more sensitive ribonuclease protection assays were performed, a protected fragment of the expected size was obtained from most organs (Fig. 6). Spleen expressed the highest level of GGL RNA, whereas small intestine, kidney, lung, and brain expressed lower levels. Additional ribonuclease protection experiments, semi-quantitative RT-PCR (results not shown), and enzyme assays all indicated that spleen expresses the highest level of GGL (Table I and Ref. 23).

View larger version (43K): [in this window] [in a new window]   Fig. 6.   Ribonuclease protection assay of GGL expression in mouse tissues. RNA (100 µg) from GGT-deficient mouse tissues and 2 × 105 cpm of GGL probe were used. Hybridization was carried out at 42 °C for 18 h. t, tRNA as a negative control; Sp, spleen; SI, small intestine; K, kidney; Li, liver; Lu, lung; Br, brain. MW, molecular weight marker (pBR322 DNA-MspI digest). I, undigested probe; II, protected fragment. (See "Experimental Procedures" for additional detail).

View this table: [in this window] [in a new window]   Table I Cellular distribution of -glutamyl leukotrienase (GGL) by in situ hybridization and enzymatic assay of GGL activity Intensity for GGL in situ hybridization is graded from 0 (no reaction product) to +++ (greatest intensity) and GGL activity is expressed as µmol/g protein/h (duplicate determination).

Localization of GGL Expression by in Situ Hybridization-- To study the distribution of GGL more specifically, we used in situ hybridization to examine GGL expression in tissues of GGT-deficient mice (Fig. 7, Table I). Enzyme activity data as another measurement of GGL expression are also presented in Table I. Almost all lymphocytes present in the spleen were positive by in situ hybridization (Fig. 7A). Thymus was positive in the medulla and paracortical region (Table I). Although we did not determine the phenotype of these lymphocytes, the locations of GGL-positive cells and their abundance in these organs suggest that both T and B cells express GGL. Interestingly, thymus expressed much lower GGL enzyme activity than spleen (Table I), although both tissues stained strongly by in situ hybridization. These findings suggest that GGL expression may be regulated post-transcriptionally in different tissues.

View larger version (121K): [in this window] [in a new window]   Fig. 7.   In situ hybridization analysis of GGL expression. A, section of spleen. Most lymphocytes in white and red pulp are positive. B, section of lung. A bronchiole (br) shows strong epithelial staining. All columnar epithelial cells are positive. Peripheral pulmonary parenchyma shows scattered positive cells in the interstitium. C, section of kidney shows weak staining of distal tubular (d) and strong staining of proximal tubular (p) cells. Some collecting ducts are positive, and glomeruli (g) are negative. D, section of small intestine. Epithelial cells of the crypts are positive (the intestinal lumen is labeled L). Other structures of the intestinal wall are negative. E, section of brain showing hippocampus. All neuronal elements are stained, but fibers and glial cells are negative. F, section of cerebellum. Purkinje cells (big arrows) are strongly positive, and granular neurons (small arrows) are weakly positive. Glial cells, white matter, and vessels are negative. All sections were also hybridized to digoxigenin-labeled sense probe; no reaction product was seen (all sections were photographed at 70× magnification and were not counterstained). Tissues were from GGT-deficient mice.

Expression of GGL in Mouse Lung after Oxygen Exposure-- Increased levels of rat GGT-rel RNA have been reported in lung after chronic exposure to isobutyl nitrite and in tumors induced by this agent (26). To examine the effects of other agents on the induction of GGL expression, we exposed wild-type and GGT-deficient mice to 80% oxygen for 120 h and performed Northern analysis of RNA from lungs of these mice and air breathing controls. We were unable to detect any GGL RNA in either O₂-exposed or control mice. Failure to find elevated levels of GGL RNA after oxygen exposure is not the result of generalized tissue damage since both wild-type and GGT-deficient mice are responsive to oxygen injury as judged by elevated levels of -glutamyl cysteine synthetase RNA in exposed mice.² We also examined GGL enzyme activity in GGT-deficient mice exposed to O₂ and their air-breathing controls. No apparent difference of GGL activity in lung was found between O₂-exposed GGT-deficient mice and their air-breathing controls (results not shown).

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

We have cloned a mouse cDNA (Fig. 1) that encodes GGL activity (Fig. 3). Its high sequence identity with human and rat GGT-rel (Fig. 2 and Ref. 26) suggests that GGT-rel is the human/rat homologue of GGL (23, 25, 26).

As judged by experiments with 3T3 cells carrying a full-length GGL cDNA, mouse GGL cleaves GSH conjugates (LTC₄) (Fig. 3) but not GSH itself (or -glutamyl-p-nitroanilide) (see also Refs. 23 and 24). We emphasize this point because the function of GGL seems to be the cleavage of these conjugated GSH molecules and not the cleavage of GSH itself (25, 26).

Our data also demonstrate that the mouse GGL gene and the mouse GGT gene are related by nucleotide sequence and are located within a few kilobases of one another (Fig. 4). Thus, GGL and GGT constitute a small gene family in which one gene probably evolved from the other by gene duplication. It may be that GGL is descended from GGT as a need arose for more selective cleavage of conjugated glutathiones in higher organisms. A search for other family members using Genbank and PCR strategies did not yield additional candidates. At present, we cannot rule out the possibility that other family members exist since their sequences may be too divergent to be identified by our methods.

Although we have not investigated the regulation of GGL expression in detail, we have used the RACE technique to look for a variety of 5' ends as evidence of different promoters or genes. The fact that all the GGL cDNAs we have identified to date in kidney (30 clones), liver (6 clones), and spleen (10 clones) have the same 5' UTR suggests that GGL is expressed from one or a limited number of promoters. In contrast, the selective expression of GGT in different tissues in the mouse is governed in part by at least seven independent promoters (39). Hence, the two genes have adopted different regulatory strategies in the mouse.

GGL is expressed in spleen at high levels relative to other mouse organs (Figs. 6 and 7, Table I). We do not know what role, if any, GGL plays in immune function, but it is worth noting that relative to other organs, GGT expression in mouse spleen is relatively low (23). In fact, about 90% of the cleavage of GSH conjugates (as measured by LTC₄ cleavage) is carried out by GGL in this organ (23).

Under normal circumstances, GGL is expressed at very low levels in most organs. The expression of GGL in bronchiolar epithelium and the interstitial cells of the lung is consistent with the role leukotrienes are believed to play in normal lung function and asthma; however, exposure to high levels of O₂ for 5 days did not result in detectable increases in steady-state levels of GGL RNA or in increases in GGL enzyme activity in lung. In contrast, other investigators have found elevated levels of rat GGT-rel RNA in lungs from rats exposed for 2 years to isobutyl nitrite (26). GGL is expressed in the proximal tubules of the kidney, which is the site of highest GGT expression (Table I and Refs. 23 and 39). GSH cleavage is an important function of GGT in kidney; as mentioned above, GGL does not cleave GSH. In addition, GGT is able to cleave all known substrates for GGL (23, 24). These observations suggest that GGL may have an as yet unrecognized function in kidney. In the brain, GGL expression is confined to neurons. Virtually all cerebral, cerebellar, and brain stem neurons express GGL as judged by in situ hybridization, whereas glial cells, vascular elements, and endothelial cells are GGL-negative (Fig. 7, Table I). At present, the meaning of this observation remains obscure.

In summary, GGL is a member of the GGT gene family and cleaves a subset of molecules cleaved by GGT. Highest levels of expression are found in spleen. The wide distribution of GGL in many organs suggests an important function for this enzyme.