| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 44, 28740-28745, October 30, 1998
§,¶
**
From the Departments of Biochemistry and
¶ Microbiology and the Cancer Center, University of
Rochester School of Medicine and Dentistry,
Rochester, New York 14642
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
The role of human FEN1 (flap
endonuclease-1), an RTH1 (RAD
two homolog-1) class nuclease, in
the replication of human immunodeficiency virus (HIV) type 1 has been
examined using model substrates. FEN1 is able to endonucleolytically
cleave a primer annealed to a template, but with a 5'-unannealed tail.
The HIV (+)-strand is synthesized as two discontinuous segments, with
the upstream segment displacing the downstream segment to form a
central (+)-strand overlap. Given a substrate with the exact HIV
nucleotide sequence, FEN1 was able to remove the overlap. After
extension of the upstream primer with DNA polymerase The multifunctional, virally encoded reverse transcriptase can
perform all the DNA synthesis steps required in the general model of
retroviral replication (1). In this model, (+)-strand synthesis is
initiated from a single RNA polypurine tract primer derived from a
location near the 3'-end of the viral genome
(3'-PPT).1 However, in many
retroviruses including human immunodeficiency virus (HIV), the
causative agent of AIDS, there is also a perfect copy of the polypurine
tract sequence present in a central position (cPPT) (2-4). The
polypurine tract is believed to resist reverse transcriptase-directed
RNase H action and to carry out a priming function because its sequence
imparts a structure more like a DNA-DNA helix than an RNA-DNA helix
(5). Having the same sequence as the 3'-PPT, the cPPT should be a
second site for (+)-strand initiation (6, 7). After a step called the
second strand transfer, the 3'-PPT-initiated segment is extended from
upstream of the cPPT segment. This upstream segment displaces the
downstream strand 88-98 nucleotides and then terminates, with reverse
transcriptase dissociation mediated via a cis-acting central
termination sequence (CTS) (8-11). Viral DNA with this overlap
structure is capable of integration, but it is not found following
transport to the nucleus, suggesting that it is rapidly repaired by
normal cellular mechanisms (12). Mutation of either the cPPT or the CTS
(8-10) profoundly impairs HIV replication and infectivity, even when the overlaid amino acid sequence is preserved. Thus, central initiation and termination, and presumably repair of the overlap, are critical steps in the HIV life cycle, yet reverse transcriptase lacks the DNA
cleavage activity necessary to perform this repair (1). As expected, we
failed to observe specific reverse transcriptase-directed cleavage of
the overlap substrate (data not shown).
The retroviral integrase, a component of the preintegration complex, is
another virus-encoded protein that might repair the overlap. It has
been shown to cleave single stranded flap structures (13, 14). The
enzymatic activity is mediated through a one-step transesterification
reaction and is referred to as a "DNA splicing" activity because of
its similarity to RNA splicing. Although integrase activity has been
observed with single-stranded flaps that mimic the terminal HIV-1 LTR
sequences, there are no reported data that this enzyme can cleave the
flaps generated during the central termination process.
Host enzymes have been shown to play a role in HIV infection; but often
these factors have not been specifically identified, and none have been
shown to participate in the replication process (15-17). For example,
cellular RNase H cannot substitute for reverse transcriptase-associated
RNase H (18). Identification of the cellular factors involved in
central (+)-strand processing might guide new therapeutic efforts.
FEN1 (flap endonuclease-1) is a
likely candidate to process the overlap region because of its substrate
specificity. As reviewed by Bambara et al. (19), FEN1
removes initiator RNA from Okazaki fragments during lagging strand DNA
synthesis in human cells. It may also participate in DNA repair because
it can traverse and remove adducts and abasic sites (20-22). FEN1 has
both exonucleolytic and endonucleolytic activities and can cleave both
RNA and DNA (23-28). To make an endonucleolytic cut, it must recognize
the 5'-end of an unannealed tail, apparently sliding along the single strand to the point of cleavage, near the position of annealing (20).
The enzyme also often requires an upstream primer immediately adjacent
to the site of cleavage (23). The HIV overlap region has all of these
structural characteristics. Since FEN1 is essential (29, 30), it will
be difficult to study the effect of mutations or knockouts on HIV
replication due to an overlying effect on cell viability. We therefore
chose to first study the role of FEN1 in HIV replication in
vitro, with the expectation that the resulting information would
indicate the potential value of further analysis in
vivo.
Although the HIV overlap has many of the structural characteristics
required by FEN1, its sequence suggests the presence of at least two
stem loops. It was unclear whether FEN1 could traverse these stem loops
because it is inhibited by primers that anneal to form double-stranded
regions on the tail flap (20). Additionally, the region clearly has an
atypical structure since it promotes dissociation of the reverse
transcriptase at the CTS after the limited displacement synthesis that
creates the overlap. The overlap region contains several oligo(dA)
tracts, which, along with the stem-loop structures, could create bends
in the DNA, resulting in a unique structure (11). This structure might
generally exclude protein-DNA interactions, including binding of FEN1.
In this study, the ability of FEN1 to process the HIV overlap was
examined using a substrate that models the replication intermediate
that would occur following central termination. We provide biochemical
evidence that the human DNA replication enzyme FEN1 removes the overlap created by synthesis from both the 3'-PPT and the cPPT.
Materials--
Unlabeled nucleotides were purchased from
Amersham Pharmacia Biotech, and radiolabeled nucleotides (3000 mCi/mmol) were from NEN Life Science Products. Oligonucleotides were
synthesized by Genosys Biotechnologies, Inc. (The Woodlands, TX). T4
polynucleotide kinase and Sequenase (Version 2.0) were obtained from
U. S. Biochemical Corp. T4 DNA ligase, calf intestinal phosphatase,
RNase inhibitor, and snake venom phosphodiesterase were from Boehringer
Mannheim. All other reagents were from Sigma.
Enzyme Purification--
Recombinant human FEN1 was purified as
described (21, 28). The final preparation was >95% pure as determined
by SDS-polyacrylamide gel electrophoresis and silver staining. The
final specific activity was 65,000 units/mg, with 1 unit defined as the
amount of nuclease required to exonucleolytically cleave 4000 fmol of a
linear oligonucleotide substrate with a DNA primer annealed to a longer
DNA template in 30 min at 37 °C.
HIV nucleocapsid protein (NC) was chemically synthesized by the
Louisiana State University Medical Core Center Laboratories. The
sequence of mature NC was that of the first 55 amino acids of the NC
precursor protein described previously (31). As a control, we have
compared this synthesized NC to biologically expressed NC obtained from
Enzyco (Denver, CO). The peptide was kept under reducing
conditions, and aliquots were stored in 10% 2-mercaptoethanol at
DNA polymerase Substrates--
The HIV overlap substrate was made from
the following oligomers: template 1, 3'-AGCGGTCCCAAAAGGGACAGTCCTGGCCCAAATAATGTCCCTGTCGTCTTTAGGA; upstream
primer 1, 5'-TCGCCAGGGTTTTCCCTGTCAGGAC; downstream primer 1a,
5'-ATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAACAAATTACAAAAA; and downstream primer 1b,
5'-TTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCC. Downstream primers 1a and 1b were 5'-phosphorylated using T4
polynucleotide kinase and ATP. Downstream primer 1b was radiolabeled by
addition of a single nucleotide at the 3' terminus using
[
The unannealed flap is 98 nucleotides long, representing the distance
from the cPPT to the major site of termination in the center of the
genome. Pause sites prior to the 98-nucleotide site, particularly one
at 88 nucleotides, are relatively easily overrun, suggesting that they
simply reduce enzyme efficiency as it approaches the final stop site
(8-11). In the event reverse transcriptase ever did dissociate after
forming a shorter tail, which would have even less secondary structure,
FEN1 could still act since it can navigate the entire
98-nucleotide tail. Following DNA initiation, the cPPT is expected to
be removed quickly by RNase H action (1), so we have not included it in
our substrate. However, since FEN1 can traverse RNA (28), its presence
should not affect cleavage.
Enzyme Assays--
Assays of cleavage by FEN1 were performed
under the same conditions as described for bulk ligation except with no
ATP, using 10 fmol of substrate in a volume of 25 µl/reaction.
Reactions were initiated by addition of 15 ng of FEN1/reaction and
stopped at the appropriate times with an equal volume of 98%
formamide, 10 mM EDTA (pH 8.0), and 0.01% (w/v) each
xylene cyanol and bromphenol blue and heating at 95 °C for 5 min.
Zero time controls were removed from the mixture before addition of
enzyme. Products were separated by 7 M urea, 5%
polyacrylamide (denaturing) gel electrophoresis and visualized by
autoradiography. Blocking, upstream, and other primers were annealed as
appropriate. Adjustments are as noted in the figure legends.
Quantification was done using a Molecular Dynamics PhosphorImager
and ImageQuant software. Snake venom phosphodiesterase ladders of
unrelated DNA and comigration with related and unrelated DNAs of known
size were used as size markers.
Reconstitution assays were performed using standard conditions with
addition of 10 mM ATP to act as cofactor for DNA ligase I. Zero, ligase, and polymerase controls were removed from the
mixture before addition of FEN1. Total incubation at 37 °C was for
90 min. Incubation was for 30 min after each addition, as appropriate,
of FEN1, polymerase FEN1 Can Cleave an HIV (+)-Strand DNA Overlap Substrate Despite the
Secondary Structure of the Overlap--
Since the structure of the HIV
central overlap is similar to the preferred substrates of FEN1, we
hypothesized that this cellular DNA replication enzyme might function
in viral overlap processing. However, we wondered whether FEN1 action
might be inhibited since the enzyme had not previously been observed to
traverse such a long tail containing stem loops and other secondary
structure. Surprisingly, incubation of the HIV substrate with FEN1
produced highly efficient cleavage at the expected location near the
junction of the single-stranded overlap with the template (Fig.
1A). Although cleavage rates
vary substantially depending on the particular substrate used, the
cleavage rate of the HIV substrate was similar to that of other non-HIV
sequence endonucleolytic substrates (data not shown). As with other
endonucleolytic substrates, the overlap was removed as an intact
segment. No intermediate products were observed between starting
material and final product at any time point, including points under a
minute (lanes 2-5). Lane M is shown here to
illustrate that the main cleavage product of FEN1 on this substrate
comigrates with a chemically synthesized 29-mer, representing the
3'-most 29 annealed nucleotides of the downstream primer. Annealing of
a complementary primer to the HIV tail inhibited cleavage, whereas
addition of a noncomplementary primer did not (data not shown).
Evidently, the natural foldback is not a sufficiently stable
double-stranded region to inhibit cleavage.
Since FEN1 had not previously been shown to cleave substrates with stem
loops, we wished to verify that significant secondary structure is
indeed present in the HIV overlap. To do so, we first analyzed the
effect of increasing salt concentrations on cleavage activity. As salt
is increased, annealed regions should hybridize more tightly, making it
more difficult for FEN1 to access the cleavage site. Fig. 1B
shows that increasing salt concentrations progressively inhibit
cleavage. Increased salt will, however, inhibit the enzyme directly by
disrupting catalysis. With the HIV substrate, the observed inhibition
is therefore likely due to a combination of effects on the enzyme
directly and on the stems.
To provide more direct evidence for flap secondary structure, we added
oligomer a to the HIV substrate in order to favor FEN1 cleavage at one
of the anticipated flap stem loops. The substrate depiction
shown to the right of the 64-nucleotide band in Fig. 1C
demonstrates how a stem-loop structure can form the downstream double-stranded region of a flap substrate. For cleavage, FEN1 often
requires an upstream primer, directly adjacent to the flap. We
hypothesized that if a stem loop were present, adding the appropriate oligonucleotide would promote upstream primer-dependent
cleavage. If no stem loop were present, the primer might act as a block for cleavage at the original flap annealing point, but it would be
unlikely to produce cleavage on the single strand. Fig. 1C shows that adding the appropriate primer does promote cleavage at the
expected location at the base of the proposed stem loop. Under the
conditions used in this experiment, the primer did not entirely prevent
cleavage at the original flap. It did, however, significantly inhibit
this cleavage compared with that seen in the same experiment with no
oligomer a added (compare lanes 2 and 3 with
lanes 5 and 6). While serving as an upstream
primer for one of the natural stems, oligomer a anneals over the other stem. This result is significant because it shows that FEN1 can be
inhibited by a double strand on the flap, but the natural HIV double
strand in the same location is not sufficient for extensive inhibition.
In this experiment, cleavage occurred at an unexpected site near the
5'-end of the tail. Presumably, an internal sequence of the primer,
probably one of the dT runs, can transiently anneal to a complementary
dA tract at this location on the overlap. Such annealing could create
another flap structure, as depicted. Evidently allowing upstream
primer-independent cleavage, this structure produced an additional
unanticipated product.
The observation that FEN1 can bypass stem loops has
implications for its role in Okazaki fragment processing and base
excision repair. We wanted to know whether it could cleave a substrate with a stem loop both different and more stable than that in the natural HIV substrate. Fig. 1D demonstrates that FEN1 can
cleave a substrate in which the HIV overlap downstream primer has been replaced by a downstream primer with a 10-nucleotide fully
complementary stem in the tail. This result supports the general
ability of FEN1 to cleave substrates with flap foldbacks, but clearly
much more work would be required to determine how the size, sequence, and flap location of such structures might affect cleavage. Our intention here is to focus on the suitability of the HIV substrate.
NC and RPA Have Little Effect on FEN1 Cleavage of the HIV
Overlap--
We decided to explore the influence of other factors that
might affect FEN1 cleavage of the HIV overlap. We hypothesized that human RPA and viral NC play a role. Both proteins have single-stranded binding and strand melting activities (35, 36). By binding the overlap,
they might interfere with movement of the nuclease to the cleavage
point. Alternatively, they might melt any existing secondary structure
or otherwise promote cleavage. Fig.
2A illustrates the influence
of NC. PhosphorImager quantitation suggested that NC is neutral
to slightly stimulatory up to 50% coating of substrate (lane
5), but very inhibitory by 100% coverage (lane 6).
Results of three to six experiments indicated that percent cleavage was 31.7 ± 4.5% with no NC (lane 2) and 34.7 ± 2.2% at 25% coating (lane 4). By 100% coating (lane
6), cleavage fell to 13.2 ± 2.6%. Not surprisingly, NC is
neutral or may even stimulate cleavage when present at low levels that
can melt secondary structure. The inhibition observed at high levels is
also not surprising. Protein-DNA aggregation at high concentrations has
been previously observed for Escherichia coli single-strand
binding protein (35) and could explain the inhibition of cleavage.
RPA behaved similarly, being neutral to slightly stimulatory
at low concentrations, but inhibitory at higher concentrations (Fig.
2B). Percent cleavage was 31.7 ± 4.5% with no RPA
(lane 2) and 43.4 ± 4.3% at 0.78% coverage
(lane 4) and declined from there. At high concentrations,
RPA destroyed the endonucleolytic substrate by completely unannealing
the downstream primer from the template, a phenomenon that we have
previously observed by native polyacrylamide gel electrophoresis using
oligomer substrates (data not shown). Unannealing should not be a
problem in vivo because the full-length provirus or
integrated viral DNA would be too long for RPA to dissociate. Moreover,
the normal cellular activities of FEN1 are carried out in the presence
of RPA, implying that these molecules are adapted to each other.
Overall, there is no evidence that either binding protein would have a
major effect on the cleavage reaction in vivo.
FEN1, DNA Polymerase, and DNA Ligase Can Complete Overlap
Repair, Forming Fully Double-stranded DNA--
To demonstrate that
FEN1 can participate in HIV metabolism, we reconstituted overlap repair
to make completely double-stranded DNA. After cleavage to remove a
tail, FEN1 typically leaves a nick or gap between remaining upstream
and downstream primers (20). During normal Okazaki fragment processing
or DNA repair, a polymerase would be expected to fill the gap, and a
ligase would seal the primers together (28). We surmised that
completion of HIV replication would occur the same way. In Fig.
3A, we used mammalian DNA
polymerase Overall, the results presented here provide evidence
that FEN1 plays an important role in HIV replication by removing the cPPT-initiated overlap and that a human DNA polymerase and ligase are
involved as well. Since the central processing steps of HIV replication
are critical in the viral life cycle (8-10) but often overlooked, we
feel that more focused exploration could produce new therapeutic
possibilities.
Generally, the structure of the HIV overlap flap is
consistent with the preferred FEN1 substrate. The sequence of the
tested substrate was identical to that of HIV-1, except that we changed the sequence of the upstream primer-template so that the template was
not complementary to the flap. In vivo, annealing of the
upstream primer and the overlapping downstream flap would be in
equilibrium. We have shown previously that FEN1 can cleave 5'-flaps
equilibrating in this manner because the upstream primer also promotes
displacement of the downstream flap (27, 28). In fact, the strand
displacement process may promote 5'-tail formation over a 3'-tail
because the polymerase binds the 3'-end of the upstream primer. The
presence or lack of upstream template complementarity should not
influence cleavage at the base of the tail (28).
Many host proteins have been shown previously to play a role
in HIV infection (15-17), but this is the first time a cellular enzyme
has been identified with a substrate specificity appropriate for direct participation in HIV replication. In Fig. 3B, we
present a model of the steps of HIV replication likely to involve human enzymes. The presence of two (+)-strand initiation sites is believed to
increase replication efficiency by allowing simultaneous synthesis of
two segments, each approximately half the total (+)-strand length (6,
7). It is unclear whether the overlap serves any other function, but
the strong replication advantage shown with the wild-type cPPT and CTS
suggests that it may (8-10). Since the overlap is removed as an intact
segment by FEN1 (Fig. 1A), it may survive to perform other
functions. For example, it may promote (+)-strand recombination by a
mechanism similar to that described previously (39, 40). Alternatively,
the released overlap would simply be degraded. We note that FEN1 is a
member of a family of enzymes, with other members that might be able to
remove the overlap. In particular, XPG, a nucleotide excision repair
nuclease, may substitute for FEN1, a possibility requiring further
study. FEN1-directed cleavage is more likely since XPG, although
capable of cleaving flaps, acts in concert with the nucleotide excision
repair complex of proteins. It cleaves on the 3'-side of a damaged
nucleotide where the single-stranded portion of a bubble structure
reanneals (41).
The possibility that retroviral integrase can cleave central
termination region flaps also remains to be investigated. Previous examination of the disintegration reaction catalyzed by the HIV-1 integrase has shown that single-stranded tail structures with the HIV
terminal LTR sequence at the annealing point can serve as
substrates for flap cleavage (13, 14). However, integration intermediates with single-stranded flaps are cleaved at a lower efficiency than the corresponding native double-stranded structure. Additionally, alteration of the conserved 3'-CA nucleotides at the base
of the flap lowered cleavage efficiency even further. At this point,
the high activity of FEN1 in the nucleus, its structure specificity, and its low sequence specificity make it a very strong candidate for this reaction.
For the gap-filling step, we propose a human DNA polymerase,
rather than reverse transcriptase itself, because overlap repair would
presumably occur after integration, certainly after nuclear entry, as part of normal chromosomal repair mechanisms. Additionally, reverse transcriptase dissociates at the CTS (8-11). We have chosen to
use polymerase Even though there clearly is secondary structure in the
overlap flap (Fig. 1, B-D), it does not interfere with
FEN1-directed cleavage (Fig. 1A). Although previous results
have shown that primers annealed to a flap are inhibitory (20), FEN1
may more readily traverse a double-stranded region if it is in the form of a foldback. Alternatively, the stability of the HIV foldbacks may
simply not have been sufficiently great to interfere with tracking,
binding, and cleavage by FEN1.
Deletion of the yeast homolog of FEN1 caused an increase in
expansion frequency of trinucleotide repeats, the hallmark of several
human genetic diseases, including myotonic dystrophy, Huntington's
disease, several ataxias, and fragile X syndrome (43). FEN1 mutation
may also correlate with increased risk for colorectal cancer (44-46).
This study suggests a mechanism by which FEN1 can play a role in
another human disease, AIDS. Knowledge of this mechanism may
eventually provide a new target for antiviral therapy. Such therapy
would be complicated because FEN1 is essential for normal cellular DNA
replication. Since the cPPT-initiated overlap is very specifically
defined, starting and ending at precise genomic locations, we envision
approaching the problem with antisense technology. Targeting
oligonucleotides to certain regions on or near the overlap might
prevent binding or cleaving of the HIV substrate, without significantly
inhibiting FEN1 action on normal cellular substrates.
, human DNA
ligase I was able to complete the continuous double strand as would
occur for an integrated provirus. FEN1 may represent a target for
new therapeutic interventions.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
70 °C. Recombinant human replication protein A (RPA) was purified
as described (32).
(33) and recombinant human DNA ligase I (34) were
purified as described. The ligase preparation had a final specific
activity of 5,000,000 units/mg, with 1 unit defined as the amount of
protein that ligates 20 fmol of linear nicked oligonucleotide substrate
in 5 min at 37 °C. The final specific activity of polymerase was
40,000 units/mg, with 1 unit defined as the amount of protein that
incorporates 1 pmol of [3H]dTTP in 15 min at
37 °C.
-32P]dTTP, template 1, and Sequenase (Version 2.0)
and isolated via 12% denaturing gel. Downstream primer 1a was ligated
to downstream primer 1b, producing downstream primer 1, which has the
(+)-strand sequence from nucleotides 4380 to 4507 of the HIV provirus
(2). Bulk ligation was done by T4 DNA ligase using linker template 2 (3'-AATGTTTTGTTTAATGTTTTTAAGTTTTAAAAGCCCAAATA) in 60 mM BisTris (pH 7.0), 5% glycerol, 0.1 mg/ml bovine serum
albumin, 5 mM 
-mercaptoethanol, 10 mM
MgCl2, 10 mM ATP, 20 pmol of each oligomer, and
10 units of enzyme in a final volume of 250 µl at 37 °C overnight.
Ligated downstream primer 1 was isolated via 5% denaturing gel. The
complete overlapping HIV substrate was constructed by annealing
upstream primer 1 and downstream primer 1 to template 1. Upstream
primer 1 fully anneals to template 1 and forms a nick with the first annealed nucleotide of downstream primer 1. The underlined sequence of
downstream primer 1 above represents the region annealed to template 1, whereas the remainder forms a 5'-unannealed tail. Boldface nucleotides
signify areas in the tail that could anneal to each other to form
stable secondary structure.
and dNTPs, and DNA ligase I.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (66K):
[in a new window]
Fig. 1.
FEN1 cleaves an HIV overlap substrate despite
secondary structure. A, time course for endonucleolytic
removal of an overlap having the exact HIV nucleotide sequence that is
displaced during HIV (+)-strand DNA synthesis. Incubation was for 0, 5, 15, 30, and 45 s and 1, 5, 15, 30, 45, and 60 min in lanes
1-11, respectively. The upper band represents starting
substrate, and the lower bands represent 3'-labeled
fragments remaining after cleavage. Lane M is a marker lane
containing a 29-mer representing the 3'-most 29 annealed nucleotides of
the downstream primer. B, inhibition of cleavage by
increasing salt concentrations. Incubation was for 60 min. Lanes
3-7 contained 20, 40, 60, and 80 mM NaCl,
respectively; lanes 2 and 8 had 100 mM NaCl; and lanes 1 and 2 had no
enzyme. C, upstream primer-dependent cleavage
occurs at the base of a stem loop present within the overlap. Oligomer
a is present only in lanes 4-9. Structures to the right
depict how addition of oligomer a can promote the observed internal
cleavages at the sites located by the arrows. Oligomer a is
3'-TGTTTTTAAGTTTTAAAA. Lanes 1 and 4 had no
enzyme and no incubation. The incubation time for lanes 2 and 5 was 1 min; for lanes 3 and 6, 5 min; and for lanes 7-9, 15, 30, and 60 min, respectively.
D, FEN1 can cleave a substrate with a 10-nucleotide stem in
the tail. Downstream primer 2 is
5'-GGGGGGTACAAATTAAAATTCAAAATTTTAATTGTGCAGGGGACGGGTTTATTACAGGGACAGCAGAA.
The underlined sequence anneals to template 1; boldface nucleotides
anneal to each other. The substrate was formed by annealing downstream
primer 2 and upstream primer 1 to template 1. Downstream primer2 was 5'-end-labeled using T4 polynucleotide kinase and
[32P]ATP, so the lower bands represent the 5'-labeled
removed tail. Separation was on 10% denaturing gel. Incubation was for
0, 1, 5, 15, 30, and 60 min in lanes 1-6,
respectively.
View larger version (37K):
[in a new window]
Fig. 2.
Influence of single-strand binding
proteins. Standard assays were performed in the presence of NC or
RPA, initiated by addition of 5 ng of FEN1/reaction, and incubated at
37 °C for 3 min. A, titration of HIV NC. Lane
1 had no enzyme; lane 2 had no NC; and lanes
3-6 contained 75, 150, 300, and 600 nM NC,
respectively. Assuming that one molecule of NC binds every seven
nucleotides (47), these concentrations coat 12.5, 25, 50, and 100% of
the DNA in the reaction, respectively. B, titration of human
RPA. Lane 1 had no enzyme; lane 2 had no RPA; and
lanes 3-8 had 0.55, 1.1, 2.2, 4.4, 8.75, and
17.5 nM RPA, respectively, coating 0.4, 0.8, 1.6, 3.12, 6.25, and 12.5% of the DNA, assuming that each molecule of RPA covers
30 nucleotides (32).
and human DNA ligase I to perform these functions
because both participate in DNA replication and cooperate with FEN1
(19, 37, 38). We note, however, that any one or more of at least three
human polymerases and three ligases (35) may be involved. With the HIV
substrate, FEN1 made no nicked product, but rather left mainly a
one-nucleotide gap and some two-nucleotide gaps. For this reason, in
lane 6, FEN1 was able to cleave the substrate, but despite
the presence of DNA ligase, no ligation product appeared. Lane
8 shows that when polymerase and dCTP were added to fill in the
one-nucleotide gap, ligation could occur. The next six nucleotides to
be added were three dGs followed by three dTs. When dC and dG were
incorporated, ligation efficiency was similar (compare lanes
8 and 9). However, FEN1 was able to cleave the tail
displaced by addition of the dGs, so a new, shorter product appeared as
well. When dT could also be incorporated, there was very little
ligation (lane 10). FEN1 cleavage efficiency is
sequence-dependent and can be either upstream
primer-dependent or -inhibited. A reasonable explanation
for the result in lane 10 is that the dTs extend the
upstream primer to a site at which cleavage is either inefficient or
upstream primer-inhibited. If FEN1 cannot cleave the tail at this site,
a ligatable substrate is not formed. In vivo, ligation could
occur immediately after addition of dC, with no additional strand
displacement or FEN1 cleavage, or later at another cleavable site.
View larger version (40K):
[in a new window]
Fig. 3.
Complete reconstitution of HIV overlap
removal and repair. A, conversion of the HIV overlap to
continuously double-stranded DNA. Lanes 5-10 contained 15 ng of FEN1. Lanes 2 and 6-10 had 6.67 ng of DNA
ligase I. Lanes 3, 4, and 7-10 had 20 ng of DNA polymerase . Lanes 4 and 8-10
contained 4 mM dCTP; lanes 9 and 10 had 4 mM dGTP; and lane 10 had 4 mM
dTTP. The middle band represents the ligation product of the
upstream primer to the cleaved downstream primer. B, model
for repair of the HIV (+)-strand overlap by human host cell enzymes,
completing HIV replication. First, FEN1 recognizes the cPPT-initiated
overlap as a typical flap substrate, slides through any secondary
structure, and removes the overlap. The intact released overlap may
serve a biological function or may be degraded. Next, DNA polymerase
fills in any gap, and DNA ligase seals the two (+)-strand segments
together, forming the complete double-stranded provirus.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
in this work because it is known to cooperate with
FEN1 (38) and probably with DNA ligase I (37). We recognize, however,
that other polymerases might substitute. Polymerase , in particular,
might be ideally suited to the role since it appears designed to fill
very short gaps (42). Although our results suggest that polymerase can perform the function, we have not ruled out the possibility that
any of the other human polymerases might participate in
vivo.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully thank Drs. H. Teraoka and M. Park for generous gifts of human DNA ligase I and human FEN1 expression vectors, respectively. We also thank M. DeMott and Dr. L. Henricksen for help with protein purification and for expert advice.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants GM24441 and GM49573 and by Cancer Center Core Grant CA11198.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Student in the Medical Scientist Training Program funded by National Institutes of Health Grant T32GM07356 and supported in part by an E. H. Hooker fellowship.
** To whom correspondence should be addressed. Tel.: 716-275-3269; Fax: 716-271-2683.
The abbreviations used are: 3'-PPT, 3'-polypurine tract; cPPT, central polypurine tract; HIV, human immunodeficiency virus; CTS, central termination sequence; NC, nucleocapsid protein; RPA, replication protein A; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl) propane-1,3-diol.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. Liu, J. Qiu, L. D. Finger, L. Zheng, and B. Shen The DNA-protein interaction modes of FEN-1 with gap substrates and their implication in preventing duplication mutations. Nucleic Acids Res., January 1, 2006; 34(6): 1772 - 1784. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Lyonnais, C. Hounsou, M.-P. Teulade-Fichou, J. Jeusset, E. L. Cam, and G. Mirambeau G-quartets assembly within a G-rich DNA flap. A possible event at the center of the HIV-1 genome Nucleic Acids Res., December 1, 2002; 30(23): 5276 - 5283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Hameau, J. Jeusset, S. Lafosse, D. Coulaud, E. Delain, T. Unge, T. Restle, E. Le Cam, and G. Mirambeau Human Immunodeficiency Virus Type 1 Central DNA Flap: Dynamic Terminal Product of Plus-Strand Displacement DNA Synthesis Catalyzed by Reverse Transcriptase Assisted by Nucleocapsid Protein J. Virol., April 1, 2001; 75(7): 3301 - 3313. [Abstract] [Full Text]
|
|
|
|
|
|
K. E. Yoder and F. D. Bushman Repair of Gaps in Retroviral DNA Integration Intermediates J. Virol., December 1, 2000; 74(23): 11191 - 11200. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
