| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 44, 28860-28867, October 30, 1998
From the Department of Neurochemistry and Neuropharmacology,
Biomedical Research Center, Osaka University Medical School, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan
Under conventional culture conditions, smooth
muscle cells display their phenotypic modulation from a differentiated
to a dedifferentiated state. Here, we established a primary culture system of smooth muscle cells maintaining a differentiated phenotype, as characterized by expression of smooth muscle-specific marker genes
such as h-caldesmon and calponin, cell
morphology, and ligand-induced contractility. Laminin retarded the
progression of dedifferentiation of smooth muscle cells. Insulin-like
growth factors (IGF-I and IGF-II) and insulin markedly prolonged the
differentiated phenotype, with IGF-I being the more potent. In
contrast, serum, epidermal growth factor, transforming growth factors,
and platelet-derived growth factors potently induced dedifferentiation
compared with angiotensin II, arginine-vasopressin, and basic
fibroblast growth factor. Using the present culture system, we
investigated signaling pathways regulating a phenotype of smooth muscle
cells. In cultured cells, IGF-I specifically activated
phosphatidylinositol 3-kinase (PI3-kinase) and its downstream target,
protein kinase B, but not mitogen-activated protein kinases. Specific
inhibitors of PI3-kinase (wortmannin and LY294002) induced
dedifferentiation of smooth muscle cells even when they were cultured
on laminin under IGF-I-stimulated conditions. The sole effect of
laminin to retard the dedifferentiation was completely blocked by
anti-IGF-I antibody, and laminin promoted the endogenous expression of
IGF-I in cultured cells. The reduced promoter activity of the caldesmon gene induced by platelet-derived growth factor BB was overcome by the
forced expression of the constitutive active form of PI3-kinase p110 The smooth muscle cells
(SMCs)1 play roles in the
control of blood pressure, enteric peristalsis, and bronchial, uterus,
and bladder contraction. Although the precursor cells of SMC seem to
undergo phenotypic modulation into matured cells, the origin of
precursor cells has not been well characterized. During embryogenesis, three different lineages (cardiac neural crest, nodosa placode, and
lateral mesoderm) have been, in part, proven as precursors of SMC. In
the case of vasculogenesis (1, 2), angioblasts originated from mesoderm
differentiate into endothelial cells, which then coalesce to form a
single layer of endothelial tubes. It has been proposed that these
primitive vessels are involved in the recruitment of neighboring
mesenchymal cells and the subsequent differentiation of SMCs. However,
the precise mechanism regarding recruitment of SMC precursors has
remained unknown. Phenotypic modulation of SMCs is also associated with
pathological conditions, such as atherosclerosis, hypertension, and
leiomyogenic tumorigenicity. In the progression of these diseases, SMCs
change their phenotype from a differentiated to a dedifferentiated
state (3). Recent studies have focused on the molecular mechanism of
SMC phenotype-dependent expression and/or isoform
conversion of In order to elucidate the molecular mechanism of such phenotypic
modulation, it is necessary to use cultured SMCs. However, the SMCs in
conventional culture display their phenotype from a differentiated to a
dedifferentiated state (16). In addition, passaged SMCs do not show a
differentiated phenotype even if they are cultured under quiescent
conditions. Serum growth factors and extracellular matrices (ECMs) have
been reported to be involved in such phenotypic modulation. Using
morphological criteria, Hedin et al. (17) demonstrated that
in primary cultured vascular SMCs, laminin induced a delay in the
progression of dedifferentiation, whereas fibronectin stimulated it.
There are some reports regarding the establishment of cell lines that
display partial characteristics of differentiated SMCs as monitored by
morphological and biochemical indicators. Despite these efforts,
primary culture systems or cell lines of SMC maintaining a
differentiated phenotype have not been presented. Here, we achieved the
first establishment of a primary culture system of SMCs to maintain a
differentiated phenotype for a long culture using SMC-specific
molecular markers, cell morphology, and ligand-induced contractility as
indicators. We confirmed that laminin retarded the progression of SMC
dedifferentiation and found that insulin-like growth factor-I (IGF-I)
had a highly potent activity to maintain a differentiated phenotype.
Using these culture conditions, we investigated the IGF-I-generated signaling pathway in SMCs and demonstrated the critical role of phosphatidylinositol 3-kinase (PI3-kinase) in maintaining a
differentiated phenotype. This culture system seems to be useful for
future analyses of SMC-specific signal transduction and transcription
and for identification of factors affecting the SMC phenotype.
Antibodies--
Anti-PI3-kinase p85 subunit antiserum and
monoclonal anti-IGF-I antibody, which can neutralize the activity of
IGF-I, were purchased from Upstate Biotechnology. Polyclonal antibodies
against mitogen-activated protein kinases (MAPKs), such as
extracellular signal-regulated kinase (ERK), c-Jun N-terminal protein
kinase (JNK), p38MAPK, Akt/protein kinase B (PKB), and PI3-kinase
p110 Plasmids--
Construction of caldesmon promoter plasmid,
GP3CAT, is described elsewhere (12). Expression plasmid of a
constitutive active form of PI3-kinase p110 Cell Culture--
Gizzard SMCs in primary culture were prepared
from 15-day old chick embryos. Whole gizzards were dissected under
sterile conditions, and tunica muscularis was carefully separated from
serosa and tunica mucosa. The gizzard muscles were minced well with
scissors and were incubated at 30 °C in 1 mg/ml collagenase (type V,
Sigma) solution containing 137 mM NaCl, 5 mM
KCl, 4 mM NaHCO3, 2 mM
MgCl2, 5.5 mM D-glucose, 10 mM PIPES, pH 6.5, and 0.2% bovine serum albumin (BSA) for
60 min with gentle shaking (19). Dispersed single cells were separated
from undigested tissues by filtration and were collected by
centrifugation at 800 rpm for 5 min at 4 °C. The cells thus obtained
were washed twice with basal culture medium (Dulbecco's modified
Eagle's medium (DMEM) supplemented with 0.2% BSA) and were cultured
in the medium on 6-well culture plates (1 × 106
cells/3.6-cm2 well) coated with ECM components (laminin,
fibronectin, and collagen type I or collagen type IV) at 37 °C with
5% CO2 atmosphere. The coating of the wells with ECM
components was performed as follows: the wells were soaked with
solutions containing laminin or fibronectin (20 µg/ml in
phosphate-buffered saline (PBS), Iwaki Glass, Chiba, Japan) or collagen
type I or type VI (20 µg/ml in 0.1 mM HCl, Iwaki Glass)
at room temperature for 3 h. After washing with PBS, the wells
were soaked with DMEM containing 0.2% BSA to block nonspecific binding. The cultured cells were stimulated with indicated amounts of
growth factors, cytokines, and/or kinase inhibitors on the first day of
culture, and the medium was changed at an interval of 2 days. The
medium containing wortmannin was replaced every 6 h throughout the
culture period (20).
Ligand-induced contractility of cultured SMCs was analyzed as follows.
SMCs were cultured under IGF-I- or PDGF-BB-stimulated conditions for 3 days, and the cultures were washed with PBS and then stimulated with
basal culture medium containing 1 mM carbachol for 1 min.
Contraction was observed with a microscope, and the same fields of
vision before and after carbachol treatment (1 min) were
photographed.
Northern Blotting--
Total RNAs were extracted from
precultured or cultured SMCs under indicated conditions using an ISOGEN
RNA extraction kit (Nippon Gene, Japan). Two micrograms of total RNAs
were separated on 1.0% agarose-formaldehyde denaturing gels and then
transferred to nylon membranes. A caldesmon cDNA
(GenBankTM accession number M28417) fragment (expanding
from 286 to 810) and a calponin cDNA (GenBank accession number
M63559) fragment (expanding from 1 to 867) were used as probes to
monitor the expression of respective mRNA. This caldesmon cDNA
fragment, composed of parts of exon 2 and exon 3a is a common probe for
h- and l-caldesmon (21, 22). In previous studies,
we demonstrated using specific probes for h- or
l-caldesmon that the full lengths of h- and
l-caldesmon mRNAs are 4.8 and 4.1 kilobases,
respectively (9, 14). Probes were 32P-labeled on the
antisense strands and used for hybridization under the following
conditions: at 42 °C for 16 h in 50% formamide, 6× SSC, 10×
Denhardt's solution (1× Denhardt's solution is 0.02% polyvinylpyrrolidone/0.02% BSA), 0.5% SDS, and 0.5 mg/ml denatured herring sperm DNA. The blots were washed in 0.1× SSC containing 0.1%
SDS at 52 °C and visualized by autoradiography. The ratio of
h-caldesmon mRNA versus total h-
and l-caldesmon mRNAs and the content of calponin
mRNA were quantified by Scanning Imager (Molecular Dynamics). To
quantify the applied RNAs, ribosomal RNAs were stained with 0.02%
methylene blue.
Immunoblotting--
After washing with PBS, the indicated
cultured SMCs were lysed with 2% SDS sample buffer. The protein
samples were separated by SDS-polyacrylamide gel electrophoresis and
transferred to nitrocellulose membranes. Detection of target proteins
on the membrane was performed by ECL Western blotting detection kit
(Amersham Pharmacia Biotech) using the respective polyclonal antibodies
against caldesmon (23) and calponin (24). The anti-calponin antibody
was donated by Dr. K. Hiwada.
Reverse Transcription-Polymerase Chain Reaction (PCR)
Analysis--
Endogenous IGF-I mRNA in SMCs was analyzed by
reverse transcription-PCR based on the contents of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Total RNAs
were extracted from precultured and cultured SMCs under the indicated
conditions, and oligo(dT)15 primed single-strand cDNAs
were synthesized from 3 µg of total RNAs using RAV-2 reverse
transcriptase (Takara). Heat-treated single-strand cDNA mixtures
were subjected to PCR using specific sets of primers (see the legend to
Fig. 6) and ExTaq DNA polymerase (Takara) under the
following conditions: 96 °C for 3 min once and 28 cycles of 94 °C
for 1 min, 62 °C for 1.5 min, and 72 °C for 1.5 min for IGF-I
mRNA, and 96 °C for 3 min once and 18 cycles of 94 °C for 1 min, 56 °C for 2 min, and 72 °C for 2 min for GAPDH mRNA. We
confirmed that PCR cycle numbers were pertinent because PCR products
were saturated under 30 cycles for IGF-I mRNA and 20 cycles for
GAPDH mRNA (data not shown). PCR products were separated on 1.2%
agarose gels, and then transferred to nylon membranes. The membranes
were hybridized with oligoprobes (see the legend to Fig. 6) to detect
IGF-I and GAPDH cDNAs under the following conditions: at 45 °C
for 16 h in 6× SSC, 10× Denhardt's solution, 0.5% SDS, and 0.5 mg/ml denatured herring sperm DNA. The blots were washed in 6× SSC
containing 0.1% SDS at 50 °C. Quantification of amplified IGF-I and
GAPDH cDNA were carried out as described for Northern blotting, and
the ratios of IGF-I cDNA content were normalized to GAPDH cDNA
contents.
PI3 Kinase Assay--
Phospholipid mixtures containing
phosphatidylinositol (PI) and phosphatidylserine (PS) were dried under
a stream of nitrogen and sonicated (2 mg/ml) in 10 mM HEPES
(pH 7.4) in a bath sonicator at 0 °C for 15 min. Ten microliters of
the vesicles (PI/PS) was used as a substrate for PI3-kinase.
Preparation of cell lysates and immunoprecipitation for PI3 kinase were
conducted at 4 °C. The cultured cells were washed three times with
ice-cold PBS, and the cells were lysed in 550 µl of lysis buffer (20 mM Tris-HCl, pH 7.5, 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2,
1% Nonidet P-40, 50 mM NaF, 1 mM
Na3VO4, 50 µg/ml phenylmethylsulfonyl
fluoride, 1 µg/ml leupeptin, and 1 µg/ml pepstatin). After 30 min
of gentle shaking, the lysates were centrifuged in a microcentrifuge at 13,000 rpm for 5 min. The amounts of PI3-kinase p85 subunit in the cell
lysates were estimated by Western blotting using antiserum against
PI3-kinase p85 subunit (Upstate Biotechnology). The lysates containing
equal amounts of PI3-kinase p85 subunit were precleaned with control
rabbit IgG coupled protein A-Sepharose for 30 min. PI3-kinase was
immunoprecipitated with antiserum against PI3-kinase p85 subunit
(Upstate Biotechnology) and protein A-Sepharose. The immunoprecipitates
were washed twice with the lysis buffer; twice with 100 mM
Tris-HCl, pH 7.5, 0.5 M LiCl, 1 mM DTT, and 0.2 mM Na3VO4; and three times with 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM DTT, and 0.2 mM
Na3VO4. All washes were performed at 4 °C. The reaction mixtures (50 µl) containing the immunoprecipitates in 20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 0.5 mM EGTA, 10 µM ATP, 5 µCi [ Other Protein Kinase Assays--
Basic methods were similar to
that for PI3-kinase assay. Cell lysis buffer comprised 50 mM Tris-HCl (pH 7.5), 120 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 50 mM NaF, 1 mM Na3VO4, 10 mM Promoter Analysis--
Caldesmon promoter was analyzed using
chloramphenicol acetyltransferase (CAT) construct, GP3CAT (12),
according to the method described elsewhere (12, 14). The SMCs prepared
as described above were seeded on laminin-coated 6-well plates and were
cultured in DMEM supplemented with 0.2% BSA or in the medium
containing 20 ng/ml PDGF-BB for 3 days. Transfection was carried out on
3-day culture using Trans ITTM-LT1, polyamine transfection
reagents (Pan Vera Corporation). Complex mixtures composed of 10 µg
of trans-ITTM-LT1 reagent and 2 µg of GP3CAT, 1 µg of
control plasmid carrying the luciferase gene under Rous sarcoma virus
promoter (Rous sarcoma virus-luciferase), and 2 µg of control
expression plasmid (pCMV5) or expression plasmid carrying a
constitutive active form of PI3-kinase p110 Effects of ECMs on a Phenotype of Cultured SMCs--
Under
conventional culture conditions, SMCs prepared by either enzyme
dispersion or explant methods rapidly display phenotypic modulation
from a differentiated to a dedifferentiated state (16). It has been
suggested that ECMs play, at least in part, a role in the determination
of SMC phenotype. Using SMC-specific molecular markers (caldesmon,
calponin, IGF-I Is a Highly Potent Factor to Maintain a Differentiated
Phenotype of SMCs--
Although laminin retarded the dedifferentiation
of SMCs, it was not able to maintain a differentiated phenotype for
more than 5 days of culture (Fig. 1), suggesting the requirement of
additional factors. We further examined the effects of several growth
factors and cytokines on SMCs cultured on laminin (Fig.
2). Dedifferentiation of SMCs was induced
by serum and several growth factors/cytokines such as platelet-derived
growth factors (PDGFs), basic fibroblast growth factor, angiotensin II,
arginine-vasopressin, epidermal growth factor (EGF), and transforming
growth factors (TGF
To determine which is the most potent factor for maintaining a
differentiated state of SMCs, we compared dose dependence among IGFs
and insulin (Fig. 3). The concentrations
of IGF-I, IGF-II, and insulin required for half-maximum levels of
h-caldesmon expression (the ratio of h-caldesmon
mRNA to total h- and l-caldesmon mRNAs is
50%) were 6.5 × 10
In addition to these SMC-specific molecular markers, SMCs cultured on
laminin under IGF-I-stimulated conditions appeared as a spindle-like
shape and formed a typical meshwork. They also displayed a
carbachol-induced contractility (Fig. 4,
A and C). In contrast, SMCs cultured under
PDGF-BB-stimulated conditions showed a fibroblast-like shape and were
unable to contract (Fig. 4, B and D). Based on
three criteria, such as biochemical markers, cell morphology, and
ligand-induced contractility, we concluded that our culture system as
presented here made it possible to maintain a differentiated phenotype
of SMCs for a long culture.
Biological Significance of Laminin on SMCs--
We then
investigated the effect of laminin on cultured SMCs (Fig.
5). Anti-IGF-I monoclonal antibody, which
can neutralize the activity of IGF-I, abolished the effect of laminin
to retard the dedifferentiation of SMCs under nonstimulated conditions
(Fig. 5, lanes 1-3) and the effect of IGF-I to maintain a
differentiated phenotype of SMCs cultured on laminin (lanes
4-6). h-Caldesmon was converted to
l-caldesmon in addition to the significant down-regulation of its expression. At the same time, the expression of calponin was
also drastically decreased (Fig. 5, lanes 1 and
4). These results suggest that the effect of laminin on SMCs
is mediated through the action of IGF-I, which minimally affects the
phenotype. To confirm this, we carried out reverse transcription-PCR
analysis to compare the IGF-I expression in SMCs cultured on laminin,
fibronectin, and collagens type I and type IV (Fig.
6). At early culture days (1-day to 3-day
culture), IGF-I mRNA contents in SMCs cultured on laminin were
3-5-fold higher than those in SMCs cultured on other ECM components.
The effect of laminin on enhanced IGF-I mRNA synthesis was observed
to last for 9 days of culture (data not shown). As shown in Fig. 3,
IGF-I concentration required for half-maximum levels of the expression
of h-caldesmon and calponin mRNAs was 6.5 × 10 PI3-Kinase Generated by IGF-I Is a Major Signaling Pathway
Maintaining Differentiated SMCs--
As demonstrated here, IGF-I plays
a vital role in maintaining a differentiated phenotype of SMCs. To
characterize the signaling pathways generated from IGF-I, we analyzed
several kinases involved in signal transduction: PI3-kinase, Akt/PKB,
and MAPKs. IGF-I potently activated PI3-kinase and also its downstream
target, Akt/PKB. PI3-kinase was maximally activated at 10 min after
IGF-I stimulation, and its activity gradually decreased thereafter
(Fig. 7A, lanes 1-6), whereas
activation of Akt/PKB lasted for more than 3 h (Fig. 7B,
lanes 1-4). In SMCs stimulated with IGF-I, activation of ERK and
stress-activated MAPKs, JNK, and p38MAPK was not observed (Fig. 7,
C-E). Activation of PI3-kinase and Akt/PKB was
significantly suppressed by specific PI3-kinase inhibitors, LY294002
and wortmannin (Fig. 7A, lanes 7-10, and 7B, lanes
5-8), suggesting that activation of Akt/PKB depends on PI3-kinase
activity. Based on these findings, we further examined the effect of
the PI3-kinase inhibitors on a phenotype of SMCs cultured on laminin under IGF-I-stimulated conditions. Both PI3-kinase inhibitors induced
isoform conversion of caldesmon and down-regulation of caldesmon and
calponin in a dose-dependent manner (Fig.
8, lanes 1-7), indicating
that SMC phenotype was mediated by these inhibitors. These drugs also
inhibited the sole effect of laminin to retard the dedifferentiation of
SMCs (data not shown). The specific inhibitors for the ERK signaling
pathway, PD98059, and for p38MAPK, SB203580, did not affect on a
phenotype of differentiated SMCs maintained by IGF-I as determined by
caldesmon and calponin mRNAs (Fig. 8, lanes 8 and
9). p70 ribosomal S6 kinase (p70S6K) is one of the downstream targets of PI3 kinase and Akt/PKB (25). Rapamycin, a
specific inhibitor of p70S6K, had also no effect on differentiated SMCs
(Fig. 8, lane 10). These results suggest that PI3-kinase is
a major downstream target of IGF-I signaling in SMCs and plays an
important role in maintaining a differentiated state of SMCs. As shown
in Fig. 2, EGF, TGF Under conventional culture conditions, SMCs convert their
phenotype from a differentiated to a dedifferentiated state (16). During dedifferentiation, the SMC irreversibly changes its morphology from a long spindle-like to a proliferative fibroblast-like shape and
loses the expression of SMC-specific marker genes and its ligand-induced contractility. To our knowledge, there have been no
reports regarding the establishment of primary culture systems or
clonal cell lines of SMC that can control its own phenotype. As
monitored by SMC-specific molecular markers, cell morphology, and
function, we achieved the first establishment of a primary culture
system of SMCs maintaining a differentiated phenotype by a combination
of IGF-I and laminin. Using this culture system, we demonstrated that
PI3-kinase activation by IGF-I is a key signaling event involved in
maintenance of a differentiated phenotype of SMCs.
As shown in Fig. 2, IGF-I, IGF-II, and insulin prolonged the
differentiated phenotype of SMCs. Among them, IGF-1 was the most potent
factor (Fig. 3). Because the order of concentrations of IGFs and
insulin required for maintenance of half-maximum expression levels of
caldesmon and calponin genes was IGF-I < IGF-II Using a variety of cell lines, it has been well studied that binding of
IGF-I to its receptor activates the intrinsic tyrosine kinase activity
of the IGF-I receptor, resulting in autophosphorylation of its own
receptor and phosphorylation of target molecules such as insulin
receptor substrate-1 and Shc proteins (32, 33). Multiple
phosphotyrosine sites in insulin receptor substrate-1 serve as binding
sites of various signaling molecules, including PI3-kinase (34).
Stimulation of PI3-kinase leads to the activation of downstream
signaling molecules, including Akt/PKB and p70S6K (25). PI3-kinase also
directly interacts with the PDGF receptor. The Shc proteins have
specific tyrosine phosphorylation sites to associate with Grb2 and the
GTP-binding protein Ras (35, 36). However, these are no reports
regarding the IGF-I generated signaling in SMCs. In this study, we
found in our culture system that IGF-I enhanced PI3-kinase and Akt/PKB
activities and that these activations were completely blocked by
wortmannin and LY294002 (Fig. 7, A and B).
Consistent with this, the PI3-kinase inhibitors induced the
dedifferentiation of SMCs cultured on laminin under IGF-I stimulated
conditions (Fig. 8). Forced activation of PI3-kinase further resulted
in an increase in the promoter activity of caldesmon gene in
dedifferentiated SMCs induced by PDGF-BB (Fig. 9). In contrast, IGF-I
did not activate the signaling pathways through MAPKs (Fig. 7,
C-E). These results suggest that a signaling pathway of
PI3-kinase plays a crucial role in maintaining a differentiated phenotype of SMC. At present, we have not yet characterized the downstream signaling molecules of PI3-kinase, except for Akt/PKB. Because the activity of Akt/PKB was potentiated by IGF-I stimulation in
a PI3-kinase-dependent manner and activation of this kinase lasted for more than 3 h (Fig. 7B), this kinase would
be one of the downstream targets of PI3-kinase. It is now necessary to
reveal whether Akt/PKB is functionally involved in phenotypic
modulation of SMC and to identify the further downstream targets.
Rapamycin did not affect a differentiated phenotype of SMCs cultured on laminin under IGF-I stimulated conditions (Fig. 8), indicating that
p70S6K would not be involved in this signaling. As demonstrated here,
the signaling pathway from IGF-I to PI3-kinase plays a key role in
maintaining a differentiated phenotype of SMCs. IGF-I-stimulation was,
however, not able to convert a dedifferentiated state of SMCs to a
differentiated state even when IGF-I receptor was fully expressed (data
not shown). Therefore, the signaling pathway inducing differentiation
of SMCs would be different from that maintaining a differentiated
phenotype.
Regarding the effect of laminin on SMCs, laminin enhanced endogenous
expression and secretion of IGF-I. This finding is based on the
inhibitory effect of neutralizing anti-IGF-I antibody, endogenous
expression of IGF-I mRNAs (Figs. 5 and 6), and semi-estimation of
IGF-I in cultured medium for maintaining the expression of SMC-specific
marker genes. The effect of laminin mediated through endogenous
expression and secretion of IGF-I on differentiated SMCs was abolished
by the specific PI3-kinase inhibitors wortmannin and LY294002 (data not
shown). These observations suggest that a low level of endogenously
produced IGF-I might contribute to delay the dedifferentiation. It has
been previously reported that laminin delayed the progression of
dedifferentiation of primary cultured vascular SMCs, whereas
fibronectin stimulates it (17). Such an effect of laminin on cultured
vascular SMCs might be due to the enhanced production and secretion of
IGF-I by laminin.
In this paper, we established for the first time a culture system of
visceral SMCs maintaining a differentiated state for a long culture.
This culture system may be applicable for vascular SMCs. Furthermore,
the SMC culture system presented here is useful for analyzing
SMC-specific molecular events, such as signal transduction and gene
regulation, including transcription and splicing. In this paper, we
showed a partial characterization of caldesmon gene expression in
association with signaling pathways (Fig. 9). Using the present culture
system, we are currently conducting detailed analyses of the gene
regulation of SMC-specific markers and screening of novel factors
involved in phenotypic modulation of SMCs. Information obtained by this
culture system should be effective in clarifying the molecular
mechanism of SMC phenotypic determination, including vascular and
visceral SMCs.
We thank Drs. H. Kurosu and T. Katada
(Department of Physiological Chemistry, Graduate School of
Pharmaceutical Sciences, University of Tokyo) for providing a
constitutive active form of PI3-kinase p110 *
This work was supported by grants-in-aid for COE Research
(to K. S.) and in part by grants-in-aid for Scientific Research from
the Ministry of Education, Science, Sports and Culture of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 81-6-879-3680;
Fax: 81-6-879-3689; E-mail: sobue{at}nbiochem.med.osaka-u.ac.jp.
The abbreviations used are:
SMC, smooth muscle
cell; ECM, extracellular matrix; IGF, insulin-like growth factor; PI3-kinase, phosphatidylinositol 3-kinase; MAPK, mitogen-activated
protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun
N-terminal protein kinase; PKB, protein kinase B; BSA, bovine serum
albumin; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase
chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PI, phosphatidylinositol; PS, phosphatidylserine; CAT, chloramphenicol
acetyltransferase; PDGF, platelet-derived growth factor; EGF, epidermal
growth factor, TGF, transforming growth factor; p70S6K, p70 ribosomal
S6 kinase; CMV, cytomegalovirus; pCMV, plasmid-carrying
cytomegalovirus promoter; PIPES, 1,4-piperazinediethanesulfonic
acid; PBS, phosphate-buffered saline; DTT, dithiothreitol.
Differentiated Phenotype of Smooth Muscle Cells Depends on
Signaling Pathways through Insulin-like Growth Factors and
Phosphatidylinositol 3-Kinase*
,,
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
catalytic subunit. These findings suggest that an IGF-I signaling
pathway through PI3-kinase plays a critical role in maintaining a
differentiated phenotype of smooth muscle cells.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-SM actin (4, 5), smooth muscle myosin heavy chain (6,
7), - and 
-tropomyosins (8, 9), calponin (10, 11), SM22 (10,
11), h-caldesmon (9, 12), and 1 integrin (13, 14). These
proteins, which are specifically expressed in SMCs, are collectively
termed as SMC-specific molecular markers. The expressions of -SM
actin, caldesmon, calponin, SM22, -tropomyosin, smooth muscle
myosin heavy chain, and 1 integrin are increased in differentiated
SMCs but are decreased in dedifferentiated SMCs. These changes are regulated at transcription levels. Isoform changes of caldesmon, -tropomyosin, and smooth muscle myosin heavy chain are controlled by
alternative splicing in an SMC phenotype-dependent manner. Changes to these molecular markers are, therefore, favorable for quantification to SMC phenotypes (15).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
subunit were obtained from Santa Cruz Biotechnology.
subunit was kindly
provided by Drs. H. Kurosu and T. Katada (Department of Physiological
Chemistry, Graduate School of Pharmaceutical Sciences, University of
Tokyo). This cDNA was constructed by Hu et al. as
described previously (18) and was inserted downstream of the
cytomegalovirus promoter of pCMV5.
-32P]ATP, and 20 µg
of PI/PS were incubated at 30 °C for 10 min. The reactions were
terminated, and the lipids were extracted by the addition of
CHCl3/MeOH (1: 2) and mixing. The mixture was vortexed and
centrifuged. The extracted reaction products were separated by
thin-layer chromatography by a developing solution composed of
CHCl3/MeOH/4 M NH4OH (9:7:2). The
production of phosphatidylinositol-3-phosphate was observed by
autoradiography.
-glycerophosphate, 50 µg/ml phenylmethylsulfonyl
fluoride, 1 µg/ml leupeptin, and 1 µg/ml pepstatin for ERK and
Akt/PKB; 20 mM Tris-HCl, pH 7.5, 10% glycerol, 1 mM DTT, 120 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 50 mM NaF, 1 mM Na3VO4, 10 mM
-glycerophosphate, 50 µg/ml phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml pepstatin for JNK; and 20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM EDTA, 1% Triton X-100, 50 mM NaF, 2 mM Na3VO4, 10 mM
-glycerophosphate, 50 µg/ml phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml pepstatin for p38MAPK. The cell
lysates were immunoprecipitated with specific antibodies against the
respective protein kinases, and the immunoprecipitates were washed well
with their lysis buffer and then with kinase assay buffer and incubated
with respective specific substrates and 5 µCi [
32P]ATP for 30 min at 30 °C. The reaction products were
analyzed by 15% SDS-PAGE. Kinase reaction mixtures were as follows: 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 µM protein kinase A inhibitor, 1 mM DTT, and
25 µg of histone H2B for Akt/PKB; 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 µM protein kinase
A inhibitor, 1 mM DTT, and 25 µg of myelin basic protein
for ERK; 50 mM Tris-HCl, pH 7.5, 10 mM
MgCl2, 1 µM protein kinase A inhibitor, 1 mM DTT, 1 mM Na3VO4,
and 1 µg of glutathione S-transferase-Jun (1-79) for JNK;
and 20 mM HEPES, pH 7.4, 20 mM
MgCl2, 20 mM -glycerophosphate, 1 µM protein kinase A inhibitor, 2 mM DTT, and
1 µg of glutathione S-transferase-ATF2 (1-96) for
p38MAPK.
subunit were added to
the cells in Opti-MEM (Life Technologies, Inc.). Following a further
4-h incubation, the medium was replaced with DMEM supplemented with
0.2% BSA plus 2 ng/ml IGF-I or 20 ng/ml PDGF-BB, and the transfected
cells were harvested 48 h later. Standardization of transfection
efficiency was performed using luciferase activity as described
previously (12, 14). Cell extracts containing equal amounts of
luciferase activity were used for CAT assay. The transfection
experiments were repeated at least three times on duplicate cultures
with two or three different plasmid preparations. The CAT activity was
quantified by Scanning Imager (Molecular Dynamics).
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
- and -tropomyosins, and 1 integrin), we examined
the culture conditions of SMCs using ECM components such as laminin,
fibronectin, and collagens type I and type IV, which are present in the
SMC layer. The expression of such SMC-specific molecular markers at
mRNA levels represented a phenotype of SMCs; h-caldesmon
and -tropomyosin were converted to l-caldesmon and F1 and
F2 tropomyosins, respectively. Calponin, -tropomyosin, and
-integrin were also down-regulated during dedifferentiation (data
not shown). Among them, we selected caldesmon and calponin as molecular
markers for SMC phenotype (Fig. 1). In
SMCs cultured on laminin, isoform conversion of caldesmon and
down-regulation of total caldesmon (h- plus
l-caldesmons) and calponin were significantly observed at 5 days of culture, and these changes proceeded thereafter. By contrast,
such changes in the expression of marker genes occurred on the first
day of SMCs cultured on the other three ECM components. These results
indicated that laminin, but not other ECM components, retarded the
dedifferentiation of SMCs.
View larger version (45K):
[in a new window]
Fig. 1.
Effects of ECM components on the expression
of caldesmon and calponin mRNAs in cultured SMCs.
A, expression of caldesmon isoform mRNAs (top
panel) (h-caldesmon mRNA (h-CaD), 4.8 kilobases) and l-caldesmon mRNA (l-CaD), 4.1 kilobases)) and calponin mRNA (middle panel) (1.8 kilobases) in SMCs cultured on ECM components. Caldesmon and calponin
mRNAs were analyzed by Northern blotting. The bottom
panel shows the 28S rRNAs stained by methylene blue. ECM
components and culture days were indicated at the top: LN,
laminin; FN, fibronectin; Col-I, collagen type I;
Col-IV, collagen type IV. B, the relative ratios
of h-caldesmon mRNA to total h- and
l-caldesmon mRNAs. C, the relative ratios of
calponin mRNA. The ratios of calponin mRNA to 28S rRNAs were
calculated, and they were normalized to the ratio of 1-day culture of
SMCs on laminin as 100%. In B and C, symbols are
as follows: open circles, laminin; closed
circles, fibronectin; closed squares, collagen type I;
and open squares, collagen type IV.
s). These factors induced the conversion of
h-caldesmon to l-caldesmon and the decrease of
the calponin expression. Among them, serum, EGF, TGFs, and PDGFs
potently induced dedifferentiation compared with angiotensin II,
arginine-vasopressin, and basic fibroblast growth factor; the former
factors completely induced the conversion of h-caldesmon to
l-caldesmon and the down-regulation of the calponin expression to a negligible level at 5 days of culture (Fig. 2A, lanes 2-4 and 8-13). EGF, TGFs, and PDGFs
significantly decreased the expression of caldesmon (Fig. 2A,
lanes 9-13), whereas the down-regulation of caldesmon by serum
(Fig. 2A, lane 8) was modest. On the other hand, IGF-I,
IGF-II, and insulin prolonged the differentiated phenotype of SMCs for
more than 9 days of culture, as determined by the expression of
h-caldesmon and calponin mRNAs (Fig. 2A, lanes
5-7, 14, and 15-17) and the proteins (Fig. 2B,
lanes 1-4). The same results were obtained using - and
-tropomyosins and 1 integrin as other SMC-specific molecular
markers (data not shown).
View larger version (27K):
[in a new window]
Fig. 2.
Effects of growth factors or cytokines on the
expression of caldesmon and calponin mRNAs in cultured SMC.
A, the expression of caldesmon isoform and calponin
mRNAs was analyzed by Northern blotting as shown in Fig. 1. Total
RNAs were isolated from precultured SMCs (lane 14) and 5-day
(lanes 1-13) and 9-day (lanes 15-17) cultured
SMCs on laminin under indicated growth factor-, cytokine-, or
nonstimulated conditions, and they were analyzed by Northern blotting
or probed with caldesmon and calponin cDNA fragments, respectively.
B, the expressions of caldesmon and calponin proteins were
analyzed by immunoblotting in precultured SMCs (lane 1) and
9-day cultured SMCs under indicated growth factor stimulated conditions
(lanes 2-4). Anti-caldesmon antibodies reacted with both
h- and l-caldesmons. The concentrations of growth
factors and cytokines were as follows: angiotensin II
(AngII), 1 µM; arginine-vasopressin
(AVP), 1 µM; basic fibroblast growth factor
(bFGF), 1.0 nM; insulin, 8.7 nM;
IGF-I, 2.6 nM; IGF-II, 2.7 nM; serum, 10%
(v/v); EGF, 1.6 nM; TGF 1, 4.0 pM; TGF2,
4.0 pM; PDGF-AA, 0.75 nM; and PDGF-BB, 0.77 nM.
13, 2.7 × 1012, and 2.2 × 1011 M,
respectively (Fig. 3A). In regard to calponin, the
concentrations of IGF-I, IGF-II, and insulin required for half-maximum
levels were 1.3 × 1012, 2.7 × 1012, and 1.7 × 1010 M,
respectively (Fig. 3B). These results suggest that IGF-I is 2-4 times and 34-130 times more potent than IGF-II and insulin, respectively. We also confirmed by immunoblotting that IGF-I receptor protein was expressed in SMCs and that its expression was not affected
by stimulation of IGF-I, serum, or PDGF-BB (data not shown).
View larger version (16K):
[in a new window]
Fig. 3.
Dose dependence of IGF-I, IGF-II, and insulin
on the expression of caldesmon and calponin mRNAs in cultured
SMCs. Total RNAs from 9-day cultured SMCs on laminin were
subjected to Northern blotting to analyze the expression of caldesmon
and calponin mRNAs. The SMCs cultured on laminin were stimulated by
indicated concentrations of IGF-I (open circles), IGF-II
(closed squares), and insulin (open squares). The
relative ratios of h-caldesmon mRNA to total
h- and l-caldesmon mRNAs (A) and
the relative ratios of calponin mRNA to 28S rRNAs (B)
are graphically shown. Calponin mRNA contents are normalized to the
ratio of 1-day culture of SMCs stimulated with 2.6 nM IGF-I
as 100%.
View larger version (121K):
[in a new window]
Fig. 4.
Comparison of ligand-induced contractility of
SMCs stimulated with IGF-I (A and C) or PDGF-BB
(B and D). The SMCs cultured on laminin
were stimulated with 0.26 nM IGF-I (A and
C) or 0.77 nM PDGF-BB (B and
D) for 3 days, and then contraction was induced by an
addition of carbachol (1 mM) for 1 min. Photographs are
shown as before (A and B) and after (C
and D) carbachol treatment.
13 to 1.3 × 1012 M.
Exogenous IGF-I (1.3 × 1011 M) made it
possible to maintain half-maximum levels of the marker gene expression
in SMCs cultured on other ECM components (data not shown). Considering
these findings, we speculate that the amounts of IGF-I secreted from
SMCs cultured on laminin would be 1.2 × 1011
M. Under a large excess of IGF-I (2.6 × 109 M), SMCs were able to maintain a
differentiated state even when they were cultured on other ECM
components (data not shown). Thus, IGF-I is absolutely essential for
the maintenance of a differentiated state.
View larger version (52K):
[in a new window]
Fig. 5.
Induction of dedifferentiation of SMCs by
anti-IGF-I neutralizing antibody. Total RNAs from 5-day
(lanes 1-3) and 9-day (lanes 4-7) cultured SMCs
were analyzed by Northern blotting. The SMCs were cultured under
nonstimulated (lanes 1-3 and 7) or IGF-I (0.26 nM)-stimulated (lanes 4-6) conditions.
Anti-IGF-I antibody (5 µg/ml) (lanes 1 and 4)
or equal amounts of control mouse IgG (lanes 2 and
5) were added to the culture medium.
View larger version (39K):
[in a new window]
Fig. 6.
Expression of endogenous IGF-I mRNA in
SMCs cultured on laminin, fibronectin, collagen type I, and collagen
type VI. Total RNAs were extracted from precultured SMCs and 1-day
and 3-day cultures of SMCs on ECM components under nonstimulated
conditions. Then, single-strand cDNAs were synthesized as described
under "Materials and Methods." Primer sets used for PCR were as
follows: IGF-I mRNA, AATCAGAGCAGATAGAGCCTGC (sense primer,
nucleotide numbers 97-118) and CAGCAAAGTACTCTGCAGATGG (antisense
primer, corresponding to nucleotides 741-765) (GenBank accession
numbers M32791 and M29720); GAPDH, CTGGCAAAGTCCAAGTGGTG (sense primer,
nucleotide numbers 124-143) and CATAAGACCCTCCACAATGC (antisense
primer, corresponding to nucleotides 556-575) (GenBank accession
number K01458). PCR products separated by 1.2% agarose gel
electrophoresis were transferred to nylon membranes, followed by probed
with oligonucleotides to detect cDNA fragments of IGF-I and GAPDH:
IGF-I, TTGGAGCACAGTACATCTCCAG (antisense primer, corresponding to
nucleotide numbers 619-640); GAPDH, GGCCAAGGGTGCCAGGC (antisense
primer, corresponding to nucleotides 517-523). ECM components and
culture days were indicated at the top: LN, laminin;
FN, fibronectin; Col-I, collagen type I; and
Col-IV, collagen type IV.
s, and PDGFs decreased the expression of
caldesmon concomitant with the down-regulation of calponin. We then
carried out a promoter analysis using a CAT construct inserted in the
caldesmon promoter region into the upstream of CAT gene, GP3CAT (12),
to confirm the functional involvement of PI3-kinase in transcriptional
regulation of the caldesmon gene. We previously reported that GP3CAT
produced high promoter activity in differentiated SMCs (12). Consistent
with the data in Fig. 8, the promoter activity of GP3CAT was
dramatically decreased by LY294002 (Fig.
9, columns 1 and
2). In 3-day culture of SMCs stimulated with PDGF-BB, the
expression of caldesmon was potently down-regulated (Fig. 2, lane
13). The promoter activity was also reduced to 50% of that in
SMCs stimulated with IGF-I (Fig. 9, column 3). This
reduction could be overcome by the forced expression of the
constitutive active form of PI3-kinase p110 catalytic subunit (18)
(Fig. 9, column 4). These findings indicate that PI3-kinase
is involved in maintaining a differentiated phenotype of SMCs and that
activation of caldesmon promoter also depends on the PI3-kinase
signaling pathway.
View larger version (35K):
[in a new window]
Fig. 7.
Characterization of downstream targets of
IGF-I signaling in SMCs. A, PI3-kinase assay. The SMCs
on laminin were cultured in DMEM supplemented with 0.2% BSA for
24 h, and then the cells were stimulated with 0.26 nM
IGF-I for indicated times (lanes 1-6), or with vehicle
alone (lane 7), 0.26 nM IGF-I plus 30 µM LY294002 (lane 8), 0.26 nM
IGF-I plus 30 nM wortmannin (lane 9), or 0.26 nM IGF-I (lane 10) for 10 min. The cells were
lysed and subjected to PI3-kinase assays as described under
"Materials and Methods." To confirm the amounts of PI3-kinase p85
regulatory subunit in the cell lysates used for kinase assay, we
performed immunoblotting probed with antiserum against PI3-kinase p85
subunit. The top and bottom panels are the
results of kinase assay and immunoblotting (IB),
respectively. B, Akt/PKB assay; C, ERK assay;
D, JNK assay; and E, p38MAPK assay. In these
protein kinase assays, the cells were stimulated with 0.26 nM IGF-I for indicated times (lanes 1-4 in
B-E). In the Akt/PKB assay (B), the cells were
stimulated with vehicle alone (lane 5), 0.26 nM
IGF-I (lane 6), 0.26 nM plus 30 µM
LY294002 (lane 7), or 0.26 nM plus 30 nM wortmannin (lane 8) for 10 min. As a positive
control for ERK, JNK, and p38MAPK assays, the cells were stimulated
with 0.77 nM PDGF-BB for indicated times (lanes
5-7 in C) or with 38 µM anisomysin for
30 min (lane 5 in D and E).
Stimulation with vehicle alone did not activate JNK and p38MAPK (data
not shown).
View larger version (50K):
[in a new window]
Fig. 8.
Effects of PI3-kinase or other protein kinase
inhibitors on the expression of caldesmon and calponin mRNAs.
Total RNAs from 9-day culture of SMCs on laminin were analyzed by
Northern blotting. The SMCs were stimulated with 0.26 nM
IGF-I in the presence of indicated amounts of PI3-kinase inhibitors,
LY294002 (LY) (lanes 2-4), wortmannin
(WT) (lanes 5-7), or other protein kinase
inhibitors: 30 µM PD98059 (PD) for ERK kinase
inhibitor (lane 8), 20 µM SB203580
(SB) for p38MAPK inhibitor (lane 9), 55 nM rapamycin (Ra) for p70S6K inhibitor
(lane 10), or no treatment (vehicle alone) (N)
(lanes 1 and 11).
View larger version (11K):
[in a new window]
Fig. 9.
Positive regulation of PI3-kinase on
caldesmon promoter activity in SMCs. A, caldesmon
promoter construct, GP3CAT, was transfected in 3-day culture of SMCs
under the following conditions: DMEM supplemented with 0.2% BSA
(columns 1 and 2) and this medium containing 0.77 nM PDGF-BB (columns 3 and 4). After
transfection, SMCs were stimulated with 0.26 nM IGF-I
(column 1), 0.26 nM IGF-I plus 20 µM LY249002 (column 2), or 0.77 nM
PDGF-BB (columns 3 and 4). GP3CAT was
co-transfected with Rsv-Luciferase and a control plasmid (pCMV5)
(columns 1-3) or pCMV5p110 Act carrying a constitutive
active form of PI3-kinase p110 subunit (column 4).
Promoter activity was assayed at 48 h after transfection as
described under "Materials and Methods." Relative promoter
activities were normalized to the activity in SMCs cultured under
IGF-I-stimulated conditions as 100%. Each value represents the average
and S.D. of at least three independent experiments. Promoterless
control CAT plasmid, pUC0CAT, did not show a detectable CAT
activity under respective conditions (data not shown). B,
PI3-kinase activities in SMCs transfected with pCMV5p110Act
(lane 1) and control plasmid pCMV5 (lane
2).
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
insulin, the effects of these growth factors would be mediated through IGF-I
receptor. It has been reported that in cultured vascular SMCs, IGF-I
stimulates SMC proliferation and migration (26-29). Balloon
denaturation of the rat aorta results in a 7-fold increase in IGF-I
expression, and this increase is closely associated with cell growth
(30). Antisense transcripts of IGF-I receptor cDNA inhibit vascular
SMC growth (31). This accumulated evidence suggests that IGF-I is a
factor inducing cell growth and/or migration in vascular SMCs. On the
other hand, in our culture system of visceral SMCs, IGF-I was the most
potent factor maintaining a differentiated phenotype, but it is not
involved in dedifferentiation characterized by cell growth and
migration. This discrepancy would be due to a difference in the origin
of the SMCs or experimental conditions. In fact, vascular SMCs reported
by previous investigators have been passaged under serum-stimulated
conditions. The response to IGF-I in these cells would be changed by
serum-induced phenotypic modulation. Additionally, our culture
conditions are in part applicable for vascular SMCs. Therefore, a
difference in experimental conditions is a likely cause of the
discrepancy.
ACKNOWLEDGEMENTS
subunit cDNA.
FOOTNOTES
These authors contributed equally to this work.
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. Sharma, T. Tran, G. L. Stelmack, K. McNeill, R. Gosens, M. M. Mutawe, H. Unruh, W. T. Gerthoffer, and A. J. Halayko Expression of the dystrophin-glycoprotein complex is a marker for human airway smooth muscle phenotype maturation Am J Physiol Lung Cell Mol Physiol, January 1, 2008; 294(1): L57 - L68. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Martin, B. L. Merenick, M. Ding, K. M. Fetalvero, E. M. Rzucidlo, C. D. Kozul, D. J. Brown, H. Y. Chiu, M. Shyu, B. L. Drapeau, et al. Rapamycin Promotes Vascular Smooth Muscle Cell Differentiation through Insulin Receptor Substrate-1/Phosphatidylinositol 3-Kinase/Akt2 Feedback Signaling J. Biol. Chem., December 7, 2007; 282(49): 36112 - 36120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Albinsson and P. Hellstrand Integration of signal pathways for stretch-dependent growth and differentiation in vascular smooth muscle Am J Physiol Cell Physiol, August 1, 2007; 293(2): C772 - C782. [Abstract] [Full Text] [PDF]
|
|
