|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 44, 29156-29163, October 30, 1998
From the Derald H. Ruttenberg Cancer Center and the Brookdale
Center for Molecular and Developmental Biology, Mount Sinai School
of Medicine, New York, New York 10029
The tumor suppressor protein p53 has been
implicated in the response of cells to DNA damage. Studies to date have
demonstrated a role for p53 in the transcriptional activation of target
genes in the cellular response to DNA damage that results in either growth arrest or apoptosis. In contrast, here is demonstrated a role
for p53 in regulating the basal level of expression of the
cyclin-dependent kinase inhibitor p21 in the absence of
treatment with DNA-damaging agents. Wild-type p53-expressing MCF10F
cells had detectable levels of p21 mRNA and protein, whereas the
p53-negative Saos-2 cells did not. Saos-2 cells were infected with
recombinant retrovirus to establish a proliferating pool of cells with
a comparable constitutive level of expression of wild-type p53 protein
to that seen in untreated MCF10F cells. Restoration of wild-type but
not mutant p53 expression recovered a basal level of expression of p21
in these cells. Constitutive expression of luciferase reporter constructs containing the p21 promoter was inhibited by co-transfection with the human MDM2 protein or a dominant-negative p53 protein and was
dependent on the presence of p53 response elements in the reporter
constructs. Furthermore, p53 in nuclear extracts of untreated cells was
capable of binding to DNA in a sequence-specific manner. These results
implicate a role for p53 in regulating constitutive levels of
expression of p21 and demonstrate that the p53 protein is capable of
sequence-specific DNA binding and transcriptional activation in
untreated, proliferating cells.
The tumor suppressor protein p53 is a transcription factor that
binds to DNA in a sequence-specific manner, has been implicated in the
cellular response to DNA damage, and appears to play a role in a
variety of cellular responses including growth arrest, apoptosis,
differentiation, and senescence (1-4). Studies to date have documented
a role for p53 in transcriptional activation of target genes in
response to extracellular stimuli including DNA damage leading to a
cellular response involving either growth arrest or apoptosis.
DNA-damaging agents trigger an increase in p53 expression leading to
activation of particular target genes most notably that of the
cyclin-dependent kinase inhibitor, p21 (5). Consistent with
this, cells that lack p21 expression have an impaired
p53-dependent response to DNA damage (6, 7). This
transcriptional activation of p21 expression is mediated by the
interaction of p53 with two response elements located in the p21
promoter (8).
The DNA binding activity of p53 appears to be regulated by the terminal
30 amino acids of the protein. Phosphorylation by either casein kinase
II or protein kinase C, acetylation by p300, and binding by a
monoclonal antibody 421, or the bacterial dnaK protein all occur within
this region of p53 and will activate the ability of p53 to bind to DNA
in a sequence-specific manner in vitro (9-15). There have
been several reports that the ability of p53 in nuclear extracts to
bind to DNA requires the presence of antibody 421, leading to the
notion that p53 exists in a latent form prior to DNA damage (10, 12).
Consistent with this idea, microinjection of the antibody 421 into
cells activates p53-dependent expression from reporter
constructs (13, 16). Thus, it has been proposed that in untreated
cells, the p53 protein exists in a latent state that is unable to bind
to DNA and that the ability of p53 to activate target gene expression
is not merely dependent on the increase in protein level but also
requires post-translational modification of p53 to convert this latent
form into a form that is active for DNA binding (12, 17). This notion
is supported by studies demonstrating that p53 becomes phosphorylated
at particular sites after treatment of cells with DNA-damaging agents
(18, 19).
Prior to the cloning of the gene, it was noted that p21 was absent from
cyclin/cyclin-dependent kinase complexes in cells lacking
functional p53 (20). Other studies have noted that the level of p21
mRNA was much lower in fibroblasts and keratinocytes derived from
mice containing a homozygous deletion of p53 as compared with the
corresponding cells from mice expressing wild-type p53 (21-24). This
suggests that p53 may play a role in the level of p21 expression in
untreated, proliferating cells. The experiments presented here tested
this idea directly and demonstrate that constitutive expression of the
p21 protein in untreated cells is, indeed, dependent on p53 and thus
implicate a role for p53 not only in the increased expression of p21 in
response to DNA damage leading to either growth arrest or apoptosis but
also in the basal level of expression of p21 in normally proliferating cells.
Plasmids--
The plasmid p21P contains
2.5-kb1 of the human
p21 promoter inserted upstream of a firefly luciferase
reporter gene in the vector pGL2 (Promega). The plasmid p21D2.1 has 2.1 kb at the 5' end of the promoter sequence removed and lacks the two p53
response elements of the p21 promoter (25). The plasmid pRL-SV40
contains the SV40 enhancer and early promoter upstream of a Renilla
luciferase reporter gene (Promega). The plasmid pCMV-hdm2 encodes the
human MDM2 protein under control of the cytomegalovirus (CMV) promoter and the plasmid pCMV-p53Ala-143 encodes the tumor-derived mutant human
p53 protein containing a missense mutation of valine to alanine at
residue 143 (26).
Antibodies and Cells--
Saos-2 and WI38 cells were obtained
from the American Type Culture Collection and were maintained in
Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal
bovine serum (FBS). MCF7 cells were maintained in RPMI medium
containing 10% heat-inactivated FBS and 5 µg/ml insulin. MCF10F
cells were grown in 50% DMEM and 50% Ham's F12 medium containing 5%
horse serum, 20 ng/ml epidermal growth factor, 100 ng/ml cholera toxin,
10 µg/ml insulin, and 500 ng/ml hydrocortisone. PA12-p53BN and
PA12-p53EN are cell lines that produce recombinant retrovirus encoding
human wild-type p53 or the mutant p53His-273, respectively
(27). These cell lines were grown in 10% FBS in DMEM containing high
glucose and 400 µg/ml G418 sulfate. The hybridoma cell line producing
the mouse monoclonal antibody 1801 was grown in DMEM containing 10%
FBS. Hybridoma cell lines expressing the mouse monoclonal antibodies
421 and 419 were grown in 50% DMEM and 50% Fischer's medium
containing 10% FBS. Monoclonal antibody 1801 specifically reacts with
human p53 (28), 421 recognizes p53 from a variety of species, and 419 recognizes an epitope on the SV40 large T antigen (29). All cell lines
were grown at 37 °C in a humid incubator containing 5%
CO2. Antibody against p21WAF1, CIP1 was
obtained commercially (Ab-1/clone EA10, Calbiochem). For treatment with
ultraviolet light, the medium was removed, and the cells were exposed
to ultraviolet light using a UV Stratalinker (Stratagene).
Northern Analysis--
Total RNA was extracted from 5 × 106 cells using RNAzol (Tel-test), and Northern blot
analysis was performed following conventional procedures, using a
2.1-kb full-length human p21 cDNA or human glyceraldehyde-3-phosphate dehydrogenase cDNA (Ambion) as
probes.
Immunoblotting--
Cells were lysed in a buffer containing
0.5% sodium deoxycholate, 2% Nonidet P-40, 0.2% sodium dodecyl
sulfate (SDS), 50 mM NaCl, 25 mM Tris-HCl, pH
7.5, and the protease inhibitors, phenylmethylsulfonyl fluoride (1 mM), aprotinin (50 µg/ml), and leupeptin (50 µg/ml) for
10 min on ice. Lysates were spun at 15,000 rpm for 10 min, and the
supernatant was saved. Protein levels were determined by the
bicinchoninic acid protein assay (Pierce). Appropriate amounts of total
cellular protein were loaded on 10% SDS-polyacrylamide gels and
electrophoresed at 150 V constant voltage for 3 h. Samples were
transferred to nitrocellulose paper and probed with the appropriate antibody. Second antibody was a horseradish peroxidase-conjugated goat
anti-mouse IgG, and the signal was detected by the enhanced chemiluminescence method (Amersham Pharmacia Biotech).
Establishment of Retrovirally Infected Cells Expressing Ectopic
p53--
The retrovirus-producing cell lines PA12-BN and PA12-EN were
grown to 75% confluence and fed with fresh DMEM containing 10% FBS.
After incubation at 37 °C for 16 h, the supernatant was
harvested and filtered through a 0.2-µm filter. Old medium was
removed from a subconfluent 60-mm dish of Saos-2 cells and replaced
with 1 ml of filtered supernatant containing 8 µg/ml Polybrene.
Dishes were rocked for 2 h at 37 °C in a humid incubator
containing 5% CO2 and then 3 ml of DMEM containing 10%
FBS was added to the dish, and it was further incubated for 48 h.
The cells were then trypsinized and replated in a 100-mm dish using
DMEM containing 10% FBS and 400 µg/ml G418 sulfate. Cells were fed
every 3 days with this same medium. After 2 weeks, the resulting
drug-resistant colonies were pooled and passaged.
Incorporation of Bromodeoxyuridine--
For detecting
replicative DNA synthesis, cells were incubated with 10 µM bromodeoxyuridine for 30 min prior to fixation. The proportion of cells actively synthesizing DNA was quantitated by
anti-bromodeoxyuridine immunoanalysis, and the total DNA content was
analyzed by staining with propidium iodide as described previously (30). Cells were fixed with 70% ethanol for at least 2 h,
resuspended in the following solutions in order: 0.25%
paraformaldehyde in phosphate-buffered saline (PBS), 0.5 mg/ml
ribonuclease A in PBS, 0.5% Triton X-100 in 0.1 N HCl, and
finally distilled water. Samples were then heated at 97 °C for 10 min, immediately placed on ice for additional 10 min, and washed with
0.5% Tween 20 in PBS. The incorporation of bromodeoxyuridine was
detected by monoclonal anti-bromodeoxyuridine antibody conjugated to
fluorescein isothiocyanate (Becton Dickinson). Flow cytometric analysis
was performed using a FACScan flow cytometer (Becton Dickinson).
Transfection of Reporter Constructs--
MCF7, MCF10F, or Saos-2
cells were transfected using the
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
salts liposomal transfection reagent (DOTAP, Boehringer Mannheim). One
confluent 100-mm dish of cells was split into three 6-well dishes and
incubated for 24 h. Cells were fed with complete medium containing
serum and incubated for an additional 3 h.
N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium salts/DNA mixtures containing 2 µg of the relevant reporter plasmid plus 50 ng of the p53 expression plasmid or an equal amount of an empty
vector plasmid were prepared according to the manufacturer's instructions and incubated at room temperature for 15 min. Serum-free medium was then added to the mixtures and used to replace the media in
the wells. The dishes were incubated at 37 °C for 3 h, after
which the transfection mix was removed and replaced with complete
medium containing serum. After 48 h, the 6-well plates were placed
on ice and washed once with PBS. The cells were then lysed by scraping
into 120 µl of Reporter Buffer (Promega Luciferase Assay System), and
samples were spun for 1 min at 14,000 rpm at 4 °C. Total protein
concentration was determined using a commercially available assay
(Bio-Rad). 40 µl of each sample was warmed to room temperature and
mixed with luciferase assay substrate that was reconstituted with
Luciferase Assay Buffer (Promega). Light emission was determined in a
TD-20e luminometer (Turner).
Preparation of Nuclear and Cytosolic Extracts--
Nuclear and
cytosolic extracts were performed as described by Graeber et
al. (31). Cells were homogenized in 10 mM Tris-HCl, pH
7.4, containing 10 mM NaCl, 6 mM
MgCl2, 1 mM dithiothreitol, 0.4 mM
phenylmethylsulfonyl fluoride, and 100 µM
Na3VO4 and spun at 10,000 rpm for 30 s.
The supernatant was saved as the cytosolic extract. The pellet was
repacked by spinning at 14,000 rpm for 1 min and then nuclei were
suspended in a nuclear extraction buffer (20 mM Hepes, pH
7.5, containing 20% glycerol, 500 mM NaCl, 1.5 mM MgCl2,, 0.2 mM EDTA, 0.1%
Triton X-100, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 50 µM leupeptin, and 50 µg/ml aprotinin), incubated at 4 °C for 1 h, and spun at
14,000 rpm for 10 min. This supernatant was saved as the nuclear
extract. Lactate dehydrogenase activity was assayed according to
Ramirez et al. (32), and histone levels were determined by
immunoblotting using an anti-histone antibody that reacts with an
epitope that is present on all five histone proteins (H11-4, Boehringer
Mannheim). Such assays showed less than 10% cross-contamination
between cytosolic and nuclear extracts.
Electrophoretic Mobility Shift Assays--
The specific
probe that was used for binding, TCGAGCCGGGCATGTCCGGGCATGTCCGGGCATGTC,
contains the high affinity binding sequence identified by Halazonetis
et al. (11) named by them BC or BB.9. In the competition
experiments, the nonspecific oligonucleotide (referred to as Sens-1),
TCGAAGAAGACGTGCAGGGACCC, was used. Complementary single-stranded
oligonucleotides were annealed by incubation at 95 °C for 4 min,
65 °C for 10 min, and then gradually brought to room temperature.
Ends were filled using the Klenow fragment of DNA polymerase to produce
a labeled double-stranded oligonucleotide. Appropriate amounts of
extracts (1-7 µl) were mixed with 1 ng of labeled double-stranded
oligonucleotide in a total reaction mixture of 30 µl containing 6 µl of 5× electrophoretic mobility shift assay buffer (100 mM Hepes, pH 7.9, 0.5 mM EDTA, 50% glycerol, 10 mM MgCl2), 1.5 µl of 40 mM
spermidine, 1.5 µl of 10 mM dithiothreitol, 1 µl of 500 µg/ml double-stranded poly(dI/dC), and 5-13 µl of water with a
final salt concentration of 85 mM. The amount of total
protein per reaction was normalized, and the reactions were carried out
at room temperature for 30 min. For antibody supershift analysis, 2 µl of the appropriate undiluted hybridoma supernatant was added.
His-tagged human p53 was produced by infection of insect cells with a
recombinant baculovirus and purified by nickel-agarose chromatography
and used as a positive control (52). Samples were electrophoretically
separated on a native 4% polyacrylamide gel at 4 °C at 200 V for
2 h. After drying, gels were exposed to Kodak XAR film at
MCF10F Cells Express Detectable Levels of p21 mRNA and Protein,
Whereas p53-Negative Saos-2 Cells Do Not--
Previous studies have
noted that either fibroblasts or keratinocytes from mice that were
homozygously deleted for p53 expressed lower basal levels of p21
mRNA as compared with fibroblasts or keratinocytes from mice
expressing both alleles of the wild-type p53 gene (21-24). To
characterize further a role for p53 in the basal level of expression of
p21, the p53-negative cell line Saos-2 was compared with the wild-type
p53-expressing cell line MCF10F. Total RNA was extracted from each cell
line, and Northern analysis was performed. The p53-negative Saos-2 cell
line expressed low levels of p21 mRNA as compared with the
wild-type p53-expressing MCF10F cells (Fig.
1A). Total cellular extracts
of each cell line were subjected to SDS-polyacrylamide gel
electrophoresis and subsequent immunoblotting with an anti-p21-specific
antibody (Fig. 1B). MCF10F cells expressed a detectable
level of p21, whereas the level of p21 expression in Saos-2 cells was
undetectable. To confirm that Saos-2 cells retained the ability to
synthesize p21, both MCF10F and Saos-2 cells were treated with 10 mM N,N'-hexamethylene-bisacetamide (HMBA). HMBA is a non-retinoid, differentiating agent that has previously been shown to induce p21 expression in a p53-independent manner (24). Treatment of Saos-2 cells with HMBA induced expression of
p21 demonstrating that Saos-2 cells retained the ability to synthesize
p21. Thus, both the level of protein and messenger RNA for p21 were
much higher in the p53-expressing MCF10F cells than in the p53-negative
Saos-2 cells.
Retroviral Infection of Saos-2 Cells Restores Expression of p53 and
p21--
Previous studies have shown that restoration of wild-type p53
expression through transfection of a suitable expression plasmid did
not allow for establishment of stable cell lines expressing wild-type
p53 (33-37). This was presumably due to the fact that plasmid
transfection results in a high level of expression of p53 which is
incompatible with cell proliferation. Chen et al. (27)
utilized recombinant retroviral infection to restore a level of
wild-type p53 expression in Saos-2 cells that was comparable to that
seen in normal cells and that was compatible with continued proliferation of these cells. To that end, Saos-2 cells were infected with recombinant retroviruses expressing either wild-type human p53 or
the mutant human p53His-273, and pools of G418
sulfate-resistant cells were established. Immunoblotting of whole cell
extracts from these drug-resistant pools demonstrated that both
wild-type (Fig. 2A, lane 4)
and mutant (Fig. 2A, lane 3) p53 expression could
be detected in comparison to the parent cells which are p53-negative
(Fig. 2A, lane 2). Furthermore, the pool of Saos-2 cells
expressing wild-type p53 expressed a level that is comparable to the
endogenous p53 level in MCF10F cells (Fig. 2A, lane 5).
Consistent with previous observations, this level of expression of
wild-type p53 that was obtained using recombinant retroviral infection
was sufficiently low to allow the cells to continue to grow (Table
I). These drug-resistant pools were
labeled with bromodeoxyuridine and subjected to flow cytometric
analysis to demonstrate that they were actively incorporating DNA.
Indeed, the pools expressing wild-type p53 had a similar percentage of
bromodeoxyuridine-positive cells as the parent cell line, the pool
expressing mutant p53, or the wild-type p53 expressing cell lines WI38,
MCF10F, or MCF7 (Table I). These pools were then examined for the level
of p21 expression. Immunoblotting of whole cell extracts demonstrated
that Saos-2 cells expressing wild-type but not mutant p53 expressed a
level of p21 that was comparable to that of WI38 or MCF7 cells and, in
fact, was greater than that seen with MCF10F cells (Fig.
2B). Thus, restoration of expression of wild-type p53 in a
p53-negative cell line also restored a basal level of expression of
p21.
Constitutive Expression of Luciferase Reporter Constructs
Containing the p21 Promoter Is p53-dependent--
The
observation that reintroduction of p53 expression in Saos-2 cells
restored a basal level of p21 expression (Fig. 2) suggests that in the
absence of DNA damage, p53 regulates expression of p21. To test
directly this notion and to confirm that such regulation is at the
level of transcription, wild-type p53-expressing MCF7 cells were
transfected with a luciferase reporter construct containing 2.4 kb of
the human p21 promoter. To determine whether the basal level of
expression that is observed was p53-dependent, an
expression plasmid for the human MDM2 protein was co-transfected with
the reporter. Mdm2 binds to p53 and inhibits its transcriptional
activity, apparently by targeting the p53 protein for degradation (19, 38-41). Transfection of MCF7 cells with a luciferase reporter
construct under control of the p21 promoter, p21P, confirmed a basal
level of activation of the p21 promoter (Figs.
3 and
4A). Co-transfection of an
expression plasmid encoding human MDM2 protein caused repression of
that basal level of expression (Fig. 3 and 4A). Deletion of the p53-binding sites from this reporter (p21P 2.1) resulted in a
complete loss of basal luciferase activity (Fig. 3). In contrast, co-transfection of the plasmid encoding Mdm2 into the p53-negative Saos-2 cells had no effect on the low level of luciferase activity seen
in these cells from the same reporter construct (Figs. 3 and
4C). Treatment of MCF7 cells with ultraviolet light induced expression of the full-length p21 promoter construct but not the construct that lacks the p53-binding sites (Fig. 3). Furthermore, treatment of Saos-2 cells with ultraviolet light had no effect on the
expression of luciferase from the full-length p21 promoter reporter
construct (Fig. 3). These latter results are consistent with the fact
that MCF7 cells express a functional wild-type p53 protein
(42-44).2
The ability of the Mdm2 protein to repress basal expression from a
luciferase reporter containing the full-length p21 promoter was
confirmed in the wild-type p53-expressing cell line MCF10F (Fig.
4B). Similar to MCF7 cells (Fig. 4A) and in
contrast to the p53-negative Saos-2 cells (Fig. 4C),
co-transfection of the expression plasmid for Mdm2 protein inhibited
the constitutive level of expression that is seen with the reporter
p21P. The apparently low level of basal expression seen in Saos-2 cells
further strengthens the notion that the basal level of expression is
p53-dependent. To confirm that this is indeed the case and
not a reflection of different transfection efficiencies by the various
cell lines, MCF7, MCF10F, and Saos-2 cells were co-transfected with
p21P and an additional reporter that contains Renilla luciferase under the control of the SV40 enhancer and early promoter. This latter reporter construct was used to normalize for transfection efficiency. The results of this analysis demonstrated that, indeed, both MCF7 and
MCF10F have a much higher basal level of expression of p21P than the
p53-negative Saos-2 cells (Fig. 4D).
To provide further evidence that the basal expression that is seen upon
transfection of MCF7 cells with p21P is p53-dependent, MCF7
and Saos-2 cells were co-transfected with p21P and increasing amounts
of an expression plasmid encoding a dominant-negative mutant
p53Ala-143 (45). Increasing amounts of the
p53Ala-143 expression plasmid repressed the basal level of
expression of p21P in MCF7 cells but not in Saos-2 cells (Fig.
5). Thus, co-transfection of either a
dominant-negative p53 or the human MDM2 protein, both of which are
capable of inhibiting the endogenous wild-type p53, caused repression
of the basal level of expression from the reporter construct containing
the p21 promoter. In contrast, co-transfection of the dominant-negative
p53 or the human MDM2 protein into the p53-negative Saos-2 cells had no
effect on the low level of luciferase activity seen in these cells from
the same reporter construct.
p53 in Nuclear Extracts of Untreated Cells Is Capable of Binding to
DNA in a Sequence-specific Manner--
The data presented thus far
implicate a role for endogenous p53 in transcriptional activation of
the p21 promoter in untreated proliferating cells. If this is the case,
then this endogenous p53 should be capable of binding to DNA. To
examine this, electrophoretic mobility shift assays utilized nuclear
extracts from three different wild-type p53-expressing cell lines,
WI38, MCF10F, and MCF7 to demonstrate that, indeed, the endogenous p53
was capable of binding to DNA prior to DNA damage. All three cell lines
were either untreated or treated with 50 J/m2 of
ultraviolet light and then were fractionated into nuclear and cytosolic
extracts. Immunoblotting for p53 demonstrated that prior to DNA damage,
WI38 and MCF10F cells express a p53 that was primarily localized to the
nucleus (Fig. 6, lanes 1 and
2, and 5 and 6), whereas the p53 in
untreated MCF7 cells was present primarily in the cytoplasm with a low
level detectable in the nuclear fraction (Fig. 6, lanes 9 and 10). After treatment with ultraviolet light, the p53
levels increased substantially in all three cell lines (Fig. 6,
lanes 3-4, 7 and 8, and 11-12).
Extracts were assayed for a cytoplasmic marker, lactose
dehydrogenase,3 as described under
"Experimental Procedures" and were immunoblotted for a nuclear
marker, histone H1 (Fig. 6, lower panel). It is estimated
that there was less than 10% cross-contamination between the
cytoplasmic and nuclear extracts using these markers.
Nuclear and cytoplasmic extracts from untreated and UV-treated MCF
cells were normalized for level of p53 protein and used in an
electrophoretic mobility shift assay using a consensus p53-binding site
as radiolabeled probe (Fig. 7). Both the
nuclear and cytoplasmic extracts from UV-treated cells demonstrate a
shifted complex with a similar mobility as that of purified p53 (Fig.
7, lanes 11 and 14). The p53-specific antibody
1801 efficiently supershifted this complex, whereas the nonspecific
antibody 419 did not (Fig. 7, lanes 12-13 and
15-16). The extracts from untreated cells contained a
shifted complex with a similar mobility as purified p53 (Fig. 7,
lanes 5 and 8). Incubation with the p53-specific
antibody 1801 produced a slower migrating complex but did not
substantially affect the original protein-DNA complex (Fig. 7,
lanes 6 and 9). The nonspecific antibody 419 had no such
effect (Fig. 7, lanes 7 and 10). This result
suggests that there is p53 in these extracts which is capable of
binding to DNA, but there is also an additional DNA-binding protein
that is distinct from p53 which produces a shifted complex of similar
mobility as purified p53. To test this, nuclear extracts of untreated
MCF7 cells were immunoprecipitated with an anti-p53 antibody to clear
all detectable p53 protein from the extract as determined by
immunoblotting.4 This extract was compared in an
electrophoretic mobility shift assay with a comparable extract that had
been immunoprecipitated with the nonspecific antibody 419 as a control
as well as a nuclear extract for UV-treated cells that had similarly
been immunoprecipitated with 419 (Fig.
8A). Incubation of the
p53-specific antibodies 1801 or 421 with untreated nuclear extracts
resulted in the detection of slow migrating DNA-protein complexes that
were not present in the absence of antibody (Fig. 8A,
lanes 2 and 3). These slower migrating complexes
were not seen in an extract that had been cleared of p53 by
immunoprecipitation but were present in extract that had been
immunoprecipitated with a nonspecific antibody (Fig. 8A, lanes
5 and 6 and 8 and 9). Clearing of
p53 from the extract had no effect on the protein-DNA complex that
migrated to a similar mobility as the p53-DNA complex, confirming that
there is a DNA-binding protein in the extract which is distinct from
p53. Extracts from UV-treated cells were used to identify the p53-DNA
complex that was confirmed by its ability to be efficiently
supershifted by both 1801 and 421 (Fig. 8A, lanes
11 and 12). To determine that the binding that was seen
was sequence-specific, competition experiments were performed (Fig.
8B). Nuclear extract from untreated MCF7 cells was used in
an electrophoretic mobility shift assay in the presence of increasing
amounts of either specific probe, BB.9, or a nonspecific probe, Sens-1.
Since it was difficult to detect the p53-DNA complex in the absence of
antibody, the competition was also performed in the presence of the
p53-specific antibody 1801. Increasing amounts of unlabeled BB.9 (Fig.
8B, lanes 9-11) competed well for the binding to
1801-supershifted complexes, whereas increasing amounts of Sens-1 (Fig.
8B, lanes 12-14) did not. The faster migrating complex that
did not appear to contain p53 was similarly competed suggested that the
binding of this protein is also sequence-specific (Fig.
8B).
The untreated MCF7 cells used in these experiments expressed an
endogenous p53 that is localized primarily in the cytoplasm (Fig. 6).
The DNA binding results were subsequently confirmed in WI38 and MCF10F
cells in which the p53 is primarily nuclear prior to DNA damage (Fig.
6). Nuclear and cytoplasmic extracts from untreated and UV-treated WI38
and MCF10F cells were normalized for level of p53 protein and used in
similar electrophoretic mobility shift assays (Fig.
9). Both the nuclear and cytoplasmic
extracts from UV-treated cells from both cell lines demonstrated a
shifted complex with a similar mobility as that of purified p53 (Fig. 9, A and B, lanes 11 and 14). The
p53-specific antibody 1801 efficiently supershifted this complex,
whereas the nonspecific antibody 419 did not (Fig. 9, A and
B, lanes 12 and 13, and 15 and 16). As seen with extracts from MCF7 cells, the extracts
from untreated WI38 or MCF10F cells contained a shifted complex with a
similar mobility as purified p53 (Fig. 9A, lane 5, and
9B, lanes 5 and 8). Incubation with the
p53-specific antibody 1801 produced a slower migrating complex but did
not substantially affect the original protein-DNA complex (Fig. 9,
A and B, lanes 6 and 9). The
nonspecific antibody 419 had no such effect (Fig. 9, A and B, lanes 7 and 10). These results are
consistent with those seen with extracts of MCF7 cells demonstrating
that there is p53 in these extracts that is capable of binding to DNA
but there is also an additional DNA-binding protein that is distinct
from p53 that produces a shifted protein-DNA complex of a similar
mobility as p53. The presence of a slower migrating shifted complex
that was induced by the p53-specific antibody 1801 but not the
nonspecific antibody 419 in untreated extracts from all three cell
lines is consistent with the notion that the endogenous p53 in these
cells is capable of binding to DNA in untreated, proliferating
cells.
Previous studies have suggested that p53 exists in a latent or
inactive form in untreated cells and that upon DNA damage not only does
the p53 level increase but the p53 itself is modified in some way to
activate it for DNA binding and transcriptional activation.
Reintroduction of p53 into the p53-negative cell line Saos-2 restored a
constitutive level of expression of the cyclin-dependent kinase inhibitor p21 (Fig. 2). A similar result has been reported upon
similar retroviral infection of a p53-negative peripheral neuroepithelioma cell line (46). These results suggest that the
endogenous p53 in untreated, proliferating cells may be capable of
transcriptionally regulating p21 expression. Indeed, experiments involving transfection of wild-type p53-expressing MCF7 cells with a
luciferase reporter construct containing the p21 promoter have
confirmed that this is the case (Figs. 3-5). A reporter containing the
full-length p21 promoter but not a promoter construct in which the p53
response elements have been deleted demonstrated a basal level of
expression in MCF7 or MCF10F cells but not in p53-negative Saos-2 cells
(Fig. 4). This basal level of expression was inhibited by coexpression
of either a dominant-negative p53 or the human MDM2 protein (Figs.
3-5). These results imply that the endogenous p53 in MCF7 or MCF10F
cells is capable of binding to DNA. This was directly tested through
the use of electrophoretic mobility shift assays (Figs. 7-9). Although
untreated extracts from either MCF7, MCF10F, or WI38 cells contain a
DNA-binding protein other than p53 which is capable of shifting a
specific radiolabeled probe representing a p53 consensus binding site,
experiments in the presence of a p53-specific monoclonal antibody 1801 clearly demonstrated that p53 in these extracts could bind to DNA in a sequence-specific manner (Figs. 7-9). Taken together, these results demonstrate that endogenous p53 in untreated, proliferating cells is
capable of binding DNA and activating transcription. Thus, p53 is
implicated as playing a role in constitutive expression of a particular
target gene, that of the cyclin-dependent kinase inhibitor
p21, in proliferating cells in the absence of treatment with
DNA-damaging agents.
Attempts to demonstrate the ability of p53 from nuclear extracts to
bind DNA have often relied on the use of monoclonal antibody 421. The
epitope for 421 is located in the carboxyl end of p53, a region that
has been suggested to have a negative effect on the sequence-specific
DNA binding of p53 (10-15). Studies in vitro have
demonstrated that 421 can stimulate the binding of wild-type p53 and in
some cases can activate select tumor-derived mutant p53 proteins that
are incapable of binding to DNA in the absence of antibody (10-12, 14,
47). In the electrophoretic mobility shift analyses performed here,
care was taken to avoid the use of monoclonal antibody 421 for these
reasons. The presence of a BB.9-binding protein that is not p53 in the
untreated extracts made it necessary to supershift gel shift complexes
containing p53 in order to detect the complex of p53 with the probe
(Figs. 7-9). Use was made of the antibody 1801 that has an epitope on
p53 near the amino-terminal end of the protein (28). Studies have demonstrated that in contrast to 421, 1801 does not restore DNA binding
activity to mutant p53 proteins (48). It does, however, exert an
enhancing effect on the ability of p53 to bind to DNA, but this is due
to the ability of 1801 to stabilize p53 against thermal denaturation
that occurs during the incubations that are performed to detect
specific DNA binding (48, 49). Hence, it is unlikely that 1801 is
conferring on the p53 in untreated cell extracts an ability to bind to
DNA that this p53 would not otherwise have. Thus, the supershifted
complexes produced by incubation with 1801 do indeed reflect the
ability of endogenous p53 in the cell to interact in a specific manner
with DNA.
Studies utilizing mice that have been homozygously deleted for p53 have
shown that the majority of tissues express p21 in a p53-independent
manner. Only in the spleen was there substantial differences in p21
expression between p53-null and p53-expressing animals (24). These
results indicate that in addition to the p53-dependent
mechanism demonstrated here, there must also be p53-independent
mechanisms for the regulation of basal levels of p21 expression.
Nevertheless, treatment of cells with DNA-damaging agents clearly
inhibits cellular proliferation and involves an increase in p21
expression that is p53-dependent (1-3). It is reasonable to expect that cells growing in vitro experience a low level
of oxidative DNA damage, and there may be damage resulting from errors during DNA synthesis. This low level of DNA damage may be responsible for activation of a subset of the p53 protein in the cell leading to
transcriptional activation of particular target genes at a low level.
Indeed it is likely that cells in vivo are subjected to
similar low levels of DNA damage. Thus, the results presented here do
not necessarily contradict the notion that upon DNA damage, p53 may, in
fact, be modified in some way to increase its ability to bind DNA and
transcriptionally activate target genes. Post-translational modification of p53 upon DNA damage of cells has been documented, and
some studies suggest that this modification may be necessary to achieve
the full induction of p53 target gene expression that is seen after
treatment with DNA-damaging agents (18, 19).
The human gene for thrombospondin-1 has previously been identified as a
target for transcriptional activation by p53 (50). Studies leading to
this observation demonstrated that fibroblasts from early passage cells
obtained from Li-Fraumeni patients constitutively expressed
thrombospondin-1, but later passage cells that had lost expression of
p53 no longer secreted thrombospondin-1. Transfection studies
demonstrated that the thrombospondin-1 promoter was a target for
transcriptional activation by p53, although a specific binding site for
p53 in this promoter has yet to be identified (50). As thrombospondin-1
has anti-angiogenic activity, the observation that its constitutive
expression is p53-dependent is consistent with the role of
p53 as a tumor suppressor. The experiments reported here with the p21
promoter confirm the ability of p53 to transcriptionally regulate
constitutive expression of particular target genes in proliferating
cells, thereby suggesting a mechanism that is consistent with the
report of p53-dependent expression of
thrombospondin-1 in proliferating human fibroblasts (50).
Chen et al. (27) demonstrated that expression of wild-type
but not mutant p53 in Saos-2 cells by retroviral infection will inhibit
the ability of these cells to grow in soft agar and grow as tumors in
nude mice. Similar results were obtained by retroviral infection of a
p53 null peripheral neuroepithelioma cell line (51). As with the
studies reported here (Fig. 2 and Table I), the level of p53 that was
expressed in the cells in both these studies was sufficiently low to
allow the cells to continue to proliferate albeit at a slower rate than
the parent cell lines (27, 51). The implication of these observations
is that this low level of p53 is capable of suppressing the oncogenic
phenotype in these cells suggesting that the ability of p53 to
transcriptionally regulate constitutive expression of select target
genes may, therefore, play a role in its ability to function as a tumor
suppressor. The increased tumorigenicity that results from the loss of
basal expression of these p53-dependent targets would then
contribute to the selective pressure for the loss of wild-type p53
function in human tumors.
We thank Michael Datto and Xiao-Fan Wang
(Duke University) for the p21 promoter reporter constructs;
Xiangwei Wu (Mount Sinai School of Medicine) for pCMV-hdm2 and the p21
cDNA probe; Rafael Mira-y-Lopez (Mount Sinai School of Medicine)
for MCF7 and MCF10F cells; Bert Vogelstein (Johns Hopkins University)
for pCMV-p53Ala-143; and Wen-Hwa Lee (University of Texas)
for the packaging cell lines expressing the recombinant retroviruses.
The following members of the Manfredi laboratory are thanked for their
help and support: Lois Resnick-Silverman, Selvon St. Clair, and Edward
Thornborrow.
*
This work was supported by Public Health Service Grant
CA-69161 from the National Cancer Institute and Grants
DAMD-17-97-1-7336 and DAMD-17-97-1-7337 from the Breast Cancer Program
of the U. S. Army Medical Research and Materiel Command.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
kb, kilobase
pair(s); CMV, cytomegalovirus; DMEM, Dulbecco's modified Eagle's
medium; FBS, fetal bovine serum; PBS, phosphate-buffered saline; HMBA, N,N'-hexamethyl- ene-bisacetamide.
2
H.-Y. Tang, K. Zhao, J. Langer, S. Waxman, and
J. J. Manfredi, submitted for publication.
3
H.-Y. Tang and J. J. Manfredi, unpublished
observations.
Constitutive Expression of the Cyclin-dependent
Kinase Inhibitor p21 Is Transcriptionally Regulated by the Tumor
Suppressor Protein p53*
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
70 °C with an intensifying screen.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (44K):
[in a new window]
Fig. 1.
MCF10F cells express detectable levels of p21
mRNA and protein, whereas p53-negative Saos-2 cells do not.
A, RNA was extracted from wild-type p53-expressing MCF10F
and p53-negative Saos-2 cells, and Northern analysis was performed as
described under "Experimental Procedures." Blots were probed with
either a cDNA for human p21 or glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as indicated. B, MCF10F or
Saos-2 cells were left untreated or treated with 10 mM HMBA
for 16 h. Whole cell extracts were prepared and subjected to
electrophoresis and subsequent immunoblotting using an anti-p21
antibody as described under "Experimental Procedures."
View larger version (39K):
[in a new window]
Fig. 2.
Retroviral infection of Saos-2 cells restores
expression of p53 and p21. A, Saos-2 cells were
infected with a recombinant retrovirus expressing either wild-type p53
or the mutant p53His-273. Selection was performed in G418
sulfate, and drug-resistant pools of cells were obtained. Equivalent
amounts of total cellular extract of parent Saos-2 cells (lane
2), the His273-expressing Saos-2 cells (lane
3), the wild-type (wt) p53-expressing Saos-2 cells
(lane 4), or MCF10F cells (lane 5) were
electrophoresed on a 10% SDS-polyacrylamide gel, transferred to
nitrocellulose, and immunoblotted with an anti-p53 antibody. Purified
human p53 is shown in lane 1. B, equivalent
amounts of total cellular extract of Saos-2 cells expressing either
wild-type p53 (lane 1) or the His273 mutant p53
(lane 2) were electrophoresed on a 10% SDS-polyacrylamide
gel, transferred to nitrocellulose, and immunoblotted with either an
anti-p53 or anti-p21 antibody.
Incorporation of bromodeoxyuridine into the DNA of various cell lines
View larger version (25K):
[in a new window]
Fig. 3.
Deletion of the p53 response elements results
in loss of basal expression of a luciferase reporter containing the p21
promoter. MCF7 cells or Saos-2 cells were transfected as described
under "Experimental Procedures" with 2 µg of p21P or p21P 2.1 and
either 50 ng of pCMV or pCMV-hdm2 as indicated. 18 h prior to
lysis, a set of wells containing only pCMV were treated with 50 J/m2 of ultraviolet light, indicated by +UV.
48 h after transfection, cells were washed, lysed, and assayed for
luciferase activity and total protein levels as described under
"Experimental Procedures." The indicated values are from a
representative experiment that had been performed in duplicate.
View larger version (40K):
[in a new window]
Fig. 4.
Ectopic expression of the human MDM2 protein
represses basal expression of a luciferase reporter containing the p21
promoter. MCF7 cells (A), MCF10F cells (B),
or Saos-2 cells (C) were transfected as described under
"Experimental Procedures" with 2 µg of p21P and either 50 ng of
pCMV or pCMV-hdm2 as indicated. 48 h later cells were washed,
lysed, and assayed for luciferase activity and total protein levels as
described under "Experimental Procedures." 18 h prior to
lysis, a set of wells containing only pCMV were treated with 50 J/m2 of ultraviolet light, indicated by +UV. The
bars represent the average of three independent experiments
that had been performed in duplicate. D, MCF7 cells, MCF10F
cells, or Saos-2 cells were transfected as described under
"Experimental Procedures" with 2 µg of p21P and 50 ng of
pRL-SV40. 48 h later cells were washed, lysed, and assayed for
luciferase activity and total protein levels as described under
"Experimental Procedures." The bars represent the
average of two independent experiments that had been performed in
duplicate.
View larger version (43K):
[in a new window]
Fig. 5.
Ectopic expression of the mutant human
p53Ala-143 protein represses basal expression of a
luciferase reporter containing the p21 promoter in a
dose-dependent manner. MCF7 cells (A) or
Saos-2 cells (B) were transfected as described under
"Experimental Procedures" with 2 µg of p21P alone or in the
presence of 50, 100, 200, or 500 ng of pCMV-p53Ala-143 as
indicated. 48 h later cells were washed, lysed, and assayed for
luciferase activity and total protein levels as described under
"Experimental Procedures." The indicated values are from a
representative experiment that had been performed in duplicate.
View larger version (24K):
[in a new window]
Fig. 6.
Biochemical fractionation demonstrates that
nuclear p53 levels increase upon UV treatment in WI38, MCF10F, and MCF7
cells. WI38, MCF10F, or MCF7 cells were untreated or treated with
50 J/m2 of ultraviolet light (+UV) and then
incubated at 37 °C for 20 h prior to fractionation into
cytosolic (C) or nuclear extracts (N) as
described under "Experimental Procedures." Samples were
electrophoresed on a 10% SDS-polyacrylamide gel, transferred to
nitrocellulose, and immunoblotted with the anti-p53 monoclonal antibody
1801 or a polyclonal antibody directed against histone H1 as indicated.
The protein level for the cytosolic samples ranged from 60 to 120 µg.
For each cell line, the cytosolic and nuclear samples were normalized
so that the loaded samples were obtained from an equivalent number of
cells.
View larger version (95K):
[in a new window]
Fig. 7.
p53 in nuclear extracts of untreated MCF7
cells binds to DNA in an electrophoretic mobility shift assay.
Nuclear and cytosolic extracts were prepared from MCF7 cells that were
untreated (lanes 5-10) or 24 h after treatment with 50 J/m2 of ultraviolet light (lanes 11-16).
Electrophoretic mobility shift assay was performed as described under
"Experimental Procedures." 1 ng of radiolabeled probe (BB.9) was
incubated in the absence of protein (lane 1), or in the
presence of 0.5 µg of human purified human p53 (lanes
2-4) or the appropriate amount of nuclear (lanes 5-7
and 11-13) or cytosolic (lanes 8-10 and
14-16) extracts as indicated. The level of p53 loaded in
cellular extracts was normalized by adjusting the total protein.
Incubations were performed either with no addition (lanes 1, 2, 5, 8, 10, and 14) or in the presence of either 1801 (anti-p53 antibody, lanes 3, 6, 9, 12, and 15) or
419 (anti-SV40 large T antigen, lanes 4, 7, 10, 13, and
16). The arrow indicates the position of the
p53-DNA complex, and the bracket indicates the position of
the supershifted p53-DNA-antibody complex.
View larger version (73K):
[in a new window]
Fig. 8.
p53 in nuclear extracts of untreated MCF7
cells binds to DNA in a sequence-specific manner. A,
nuclear extracts of MCF7 cells that were untreated (lanes
1-9) or treated with 50 J/m2 ultraviolet light (UV,
lanes 10-12) were used directly (lanes 1-3) or
immunoprecipitated with either an anti-p53 antibody 421 (lanes
4-6) or an anti-SV40 large T antigen antibody 419 (lanes
7-12). The resulting supernatants were used in an electrophoretic
mobility shift assay using 1 ng of radiolabeled probe (BB.9).
Incubations were performed either in the absence (lanes 1, 4, 7, and 10) or presence of 1801 (anti-p53 antibody,
lanes 2, 5, 8, and 11) or presence of 421 (anti-p534 antibody, lanes 3, 6, 9, and 12). The
arrow to the left indicates the position of the
p53-DNA complex, and the bracket to the right
indicates the position of the supershifted p53-DNA-antibody complex.
B, 1 ng of radiolabeled probe (BB.9) was incubated with an
appropriate amount of nuclear extract alone (lanes 1 and
8), or in the presence of increasing amounts of unlabeled
BB.9 oligonucleotide (lanes 2-4 and 9-11) or
increasing amounts of a nonspecific oligonucleotide, Sens-1
(lanes 5-7 and 12-14). Incubations were
performed either in the absence (lanes 1-7) or presence of
1801 (anti-p53 antibody, lanes 8-14). The
bracket to the right indicates the position of
the supershifted p53-DNA-antibody complex.
View larger version (79K):
[in a new window]
Fig. 9.
p53 in nuclear extracts of untreated WI38 or
MCF10F cells binds to DNA in an electrophoretic mobility shift
assay. Nuclear and cytosolic extracts were prepared from WI38
(A) or MCF10F (B) cells that were untreated
(lanes 5-10) or 24 h after treatment with 50 J/m2 of ultraviolet light (lanes 11-16).
Electrophoretic mobility shift assay was performed as described under
"Experimental Procedures." 1 ng of radiolabeled probe (BB.9) was
incubated in the absence of protein (lane 1), or in the
presence of 0.5 µg of human purified human p53 (lanes
2-4) or the appropriate amount of nuclear (lanes 5-7
and 11-13) or cytosolic (lanes 8-10 and
14-16) extracts as indicated. The level of p53 loaded in
cellular extracts was normalized by adjusting the total protein.
Incubations were performed either with no addition (lanes 1, 2, 5, 8, 10, and 14), or in the presence of either 1801 (anti-p53 antibody, lanes 3, 6, 9, 12, and 15) or
419 (anti-SV40 large T antigen, lanes 4, 7, 10, 13, and
16). The arrow to the left indicates
the position of the p53-DNA complex, and the bracket to the
right indicates the position of the supershifted
p53-DNA-antibody complex.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Derald H. Ruttenberg
Cancer Center, Box 1130, Mount Sinai School of Medicine, New York, NY
10029. Tel.: 212-824-8110; Fax: 212-849-2446; E-mail: jmanfredi{at}smtplink.mssm.edu.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. S. M. Shih, S. H. K. Wong, N. W. Schoene, and K. Y. Lei Suppression of Gadd45 Alleviates the G2/M Blockage and the Enhanced Phosphorylation of p53 and p38 in Zinc Supplemented Normal Human Bronchial Epithelial Cells Experimental Biology and Medicine, March 1, 2008; 233(3): 317 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. N. Ivanov, H. Zhou, and T. K. Hei Sequential Treatment by Ionizing Radiation and Sodium Arsenite Dramatically Accelerates TRAIL-Mediated Apoptosis of Human Melanoma Cells Cancer Res., June 1, 2007; 67(11): 5397 - 5407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. I. Kim, J.-K. Chung, J. H. Kang, Y. J. Lee, J. H. Shin, H. J. Oh, J. M. Jeong, D. S. Lee, and M. C. Lee Visualization of Endogenous p53-Mediated Transcription In vivo Using Sodium Iodide Symporter Clin. Cancer Res., January 1, 2005; 11(1): 123 - 128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-C. Kuo, H.-F. Liu, and J.-I Chao Survivin and p53 Modulate Quercetin-induced Cell Growth Inhibition and Apoptosis in Human Lung Carcinoma Cells J. Biol. Chem., December 31, 2004; 279(53): 55875 - 55885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Legube, L. K. Linares, S. Tyteca, C. Caron, M. Scheffner, M. Chevillard-Briet, and D. Trouche Role of the Histone Acetyl Transferase Tip60 in the p53 Pathway J. Biol. Chem., October 22, 2004; 279(43): 44825 - 44833. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Scott, J. D. Earle, and P. H. Gumerlock Functional p53 Increases Prostate Cancer Cell Survival After Exposure to Fractionated Doses of Ionizing Radiation Cancer Res., November 1, 2003; 63(21): 7190 - 7196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cicchillitti, P. Fasanaro, P. Biglioli, M. C. Capogrossi, and F. Martelli Oxidative Stress Induces Protein Phosphatase 2A-dependent Dephosphorylation of the Pocket Proteins pRb, p107, and p130 J. Biol. Chem., May 23, 2003; 278(21): 19509 - 19517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Jing, L. Xia, and S. Waxman Targeted removal of PML-RARalpha protein is required prior to inhibition of histone deacetylase for overcoming all-trans retinoic acid differentiation resistance in acute promyelocytic leukemia Blood, July 18, 2002; 100(3): 1008 - 1013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Li, J. N. Rao, X. Guo, L. Liu, R. Santora, B. L. Bass, and J.-Y. Wang Polyamine depletion stabilizes p53 resulting in inhibition of normal intestinal epithelial cell proliferation Am J Physiol Cell Physiol, September 1, 2001; 281(3): C941 - C953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Doubrovin, V. Ponomarev, T. Beresten, J. Balatoni, W. Bornmann, R. Finn, J. Humm, S. Larson, M. Sadelain, R. Blasberg, et al. Imaging transcriptional regulation of p53-dependent genes with positron emission tomography in vivo PNAS, July 31, 2001; 98(16): 9300 - 9305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nakamura, J. A. Roth, and T. Mukhopadhyay Multiple Lysine Mutations in the C-Terminal Domain of p53 Interfere with MDM2-Dependent Protein Degradation and Ubiquitination Mol. Cell. Biol., December 15, 2000; 20(24): 9391 - 9398. [Abstract] [Full Text]
|
|
|
|
|
|
A. Sigal and V. Rotter Oncogenic Mutations of the p53 Tumor Suppressor: The Demons of the Guardian of the Genome Cancer Res., December 1, 2000; 60(24): 6788 - 6793. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. C. McKay, F. Chen, C. R. Perumalswami, F. Zhang, and M. Ljungman The Tumor Suppressor p53 Can Both Stimulate and Inhibit Ultraviolet Light-induced Apoptosis Mol. Biol. Cell, August 1, 2000; 11(8): 2543 - 2551. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. C. McKay, M. Ljungman, and A. J. Rainbow1 Potential roles for p53 in nucleotide excision repair Carcinogenesis, August 1, 1999; 20(8): 1389 - 1396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Blaydes, M. G. Luciani, S. Pospisilova, H. M.-L. Ball, B. Vojtesek, and T. R. Hupp Stoichiometric Phosphorylation of Human p53 at Ser315 Stimulates p53-dependent Transcription J. Biol. Chem., February 9, 2001; 276(7): 4699 - 4708. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Janssens, C. Van Hoof, I. De Baere, W. Merlevede, and J. Goris The Phosphotyrosyl Phosphatase Activator Gene Is a Novel p53 Target Gene J. Biol. Chem., June 30, 2000; 275(27): 20488 - 20495. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |