J Biol Chem, Vol. 273, Issue 45, 29331-29340, November 6, 1998

Cloning of a Novel Member of the UDP-Galactose:-N-Acetylglucosamine 1,4-Galactosyltransferase Family, 4Gal-T4, Involved in Glycosphingolipid Biosynthesis^*

Tilo Schwientek, Raquel Almeida^§, Steven B. Levery^¶, Eric H. Holmes, Eric Bennett, and Henrik Clausen^**

From the  School of Dentistry, University of Copenhagen, Nørre Allé 20, 2200 Copenhagen N, Denmark, the ^§ Institute of Molecular Pathology and Immunology of University of Porto, Rua Dr. R. Frias s/n, 4200 Porto, Portugal, the ^¶ University of Georgia, Complex Carbohydrate Research Center, Athens, Georgia 30602, and the  Department of Cell Surface Biochemistry, Northwest Hospital, Seattle, Washington 98125

	ABSTRACT

Top Abstract Introduction Procedures Results Discussion References

A novel putative member of the human UDP-galactose:-N-acetylglucosamine 1,4-galactosyltransferase family, designated 4Gal-T4, was identified by BLAST analysis of expressed sequence tags. The sequence of 4Gal-T4 encoded a type II membrane protein with significant sequence similarity to other 1,4-galactosyltransferases. Expression of the full coding sequence and a secreted form of 4Gal-T4 in insect cells showed that the gene product had 1,4-galactosyltransferase activity. Analysis of the substrate specificity of the secreted form revealed that the enzyme catalyzed glycosylation of glycolipids with terminal -GlcNAc; however, in contrast to 4Gal-T1, -T2, and -T3, this enzyme did not transfer galactose to asialo-agalacto-fetuin, asialo-agalacto-transferrin, or ovalbumin. The catalytic activity of 4Gal-T4 with monosaccharide acceptor substrates, N-acetylglucosamine as well as glucose, was markedly activated in the presence of -lactalbumin. The genomic organization of the coding region of 4Gal-T4 was contained in six exons. All intron/exon boundaries were similarly positioned in 4Gal-T1, -T2, and -T3. 4Gal-T4 represents a new member of the 4-galactosyltransferase family. Its kinetic parameters suggest unique functions in the synthesis of neolactoseries glycosphingolipids.

	INTRODUCTION

Top Abstract Introduction Procedures Results Discussion References

A family of human UDP-galactose:-N-acetylglucosamine 1,4-galactosyltransferases (4Gal-Ts)¹ was recently identified (1-3). Four genes within this family encode 4-galactosyltransferases, which form the Gal1-4GlcNAc linkage (2, 4-6). The kinetic parameters and expression patterns of these enzymes differ and they are predicted to show some degree of overlap in biological function (2, 3, 6). Two 4-galactosyltransferases, 4Gal-T1 and -T2, can function as lactose synthases in the presence of -lactalbumin (2, 3, 7), whereas 4Gal-T3 and 4Gal-T5² are largely insensitive to -lactalbumin modulation (2, 6, 8). 4Gal-T1, -T2, and -T3 catalyze transfer of galactose to lactoseries glycosphingolipids, but 4Gal-T3 only efficiently catalyzes synthesis of the first N-acetyllactosamine unit in lactoseries glycolipids (2). In contrast, 4Gal-T5 was reported to be inactive with a glycolipid substrate (Lc₃Cer)² as well as with the glycoprotein acceptor, asialo-agalacto-transferrin (6). A rat lactosylceramide synthase was recently purified and cloned by Nomura et al. (9), and it appears to represent the ortholog of the human member of the gene 4-galactosyltransferase family designated 4Gal-T6 (10). Thus, the formation of Gal1-4Glc(NAc) linkages in different glycoconjugates and their varying oligosaccharide structures may be catalyzed by different 4-galactosyltransferases.

Analysis of ESTs suggested the existence of additional members of the human 4Gal-T gene family (1-3), and recently, Lo et al. (10) compared the full coding sequences of six homologous human genes and suggested a nomenclature based on sequence similarity: 4Gal-T1 (5, 11, 12), 4Gal-T2 (2), 4Gal-T3 (2), 4Gal-T4, 4Gal-T5 (6), and 4Gal-T6 (9). So far, all genes except one, localized at chromosome 3q13.3 and designated 4Gal-T4, have been expressed and shown to represent 4-galactosyltransferases. 4Gal-T4 is the subject of this report.

The greater 4Gal-T gene family may include members with both distinct and conserved donor and/or acceptor substrate specificities. For example, a snail gene, previously identified by hybridization to a 4Gal-T1 probe, has acceptor substrate specificity similar to 4Gal-T1, but different donor substrate specificity as it is a 4GlcNAc-transferase (13). This 4GlcNAc-transferase is not responsive to -lactalbumin modulation (14). In contrast, a snail 4GalNAc-transferase activity with acceptor substrate specificity similar to 4Gal-T1 exhibits sensitivity to -lactalbumin modulation of the acceptor specificity (15). The donor substrate specificity of 4Gal-T1 is modulated by -lactalbumin to include UDP-GalNAc, and the donor substrate specificity of the snail 4GalNAc-transferase activity is modulated to include UDP-Gal, albeit at much less efficiencies (15, 16). Given the similarities in donor substrate specificities and -lactalbumin modulation, it is likely that the snail 1,4GalNAc-transferase will be homologous to the mammalian 4Gal-T gene family (15, 17). The GalNAc1-4GlcNAc1-R structure exists in man, but is mainly associated with N-linked glycans found on glycoprotein hormones (18). A putative glycoprotein 4GalNAc-transferase with selective activity for N-glycans associated with a specific peptide sequence has been characterized (19); however, this enzyme may be unrelated to the 4Gal-T gene family.

In the present study, we used human EST sequence information to identify and clone a novel member of the 4Gal-T gene family, designated 4Gal-T4. 4Gal-T4 is an active UDP-Gal:GlcNAc 1,4Gal-transferase with specificity for glycolipid substrates; however, it does not catalyze glycosylation of several glycoprotein acceptors, which are good substrates for other 4Gal-transferases. 4Gal-T4 exhibits -lactalbumin modulation that is similar to a previously characterized snail 1,4GalNAc-transferase activity (15). The data demonstrate that members of the 4Gal-T gene family have distinct functions in galactosylation of different glycoconjugates, and suggest that 4Gal-T4 mainly plays a role in glycolipid biosynthesis.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results Discussion References

Identification of 4Gal-T4-- The BLASTn and tBLASTn were used with the coding sequence of human 4Gal-T3 to search the dbEST data base at The National Center for Biotechnology Information (NCBI) as described previously (2). Overlapping segments of EST sequences were compiled and compared with known members of the human 4Gal-T family. cDNA clones of ESTs with the longest inserts (Fig. 1) were obtained from Genome Systems Inc.

Cloning and Sequencing of the Full Coding Sequence of 4Gal-T4-- A large number of overlapping ESTs derived from a putative gene were identified and assembled by using Unigene (NCBI, transcript map A004F36). Five ESTs representing nearly the full coding sequence were selected (Fig. 1). Sequencing of EST clone 489768 revealed an open reading frame that encoded a sequence similar to 4Gal-T3, except that the 5' sequence was shorter and the clone lacked a translational initiation codon. The genomic organizations of 4Gal-T1, -T2, and -T3 genes were previously shown to be identical (2). Since the 5' sequence available from the 4Gal-T4 EST composite was incomplete but likely to extend into the first coding exon, the 5' position of the open reading frame was obtained by sequencing a genomic P1 clone. Confirmatory sequencing was performed on a cDNA clone obtained by PCR on total cDNA from the human MKN45 gastric cancer cell line with the sense primer TSHC 25 (5'- GTCCATCGGGGATGGGTTTTC -3') and the antisense primer TSHC 12 (5'- CCACTGTCAGGCACAAAGTCAAC -3'), for 30 cycles at 95 °C, 15 s; 55 °C, 20 s; 72 °C, 2 min 30 s. The entire sequence was confirmed by sequencing genomic P1 clones. The composite sequence contained an open reading frame of 1032 base pairs encoding a putative protein with a type II domain structure (Fig. 2).

Genomic Organization of 4Gal-T4-- A human foreskin genomic P1 library (DuPont Merck Pharmaceutical Co. Human Foreskin Fibroblast P1 Library) was screened using the primer pairs TSHC14 (5'-GAGGCCAGAGCAAGCTCATTTTC-3') and TSHC15 (5'-GGATGACGTAGATGCCATAATCC-3'). Two clones for 4Gal-T4 (DPMC-HFF#1-934 (G7) and DPMC-HFF#1-1025 (A6)) were obtained from Genome Systems Inc. DNA from P1 phage were prepared as recommended by Genome Systems Inc. The entire coding sequence of the 4Gal-T4 gene was sequenced in full using automated sequencing (ABI377, Perkin-Elmer) with dye terminator chemistry. Intron/exon boundaries were determined by comparison with the complete cDNA sequence, optimizing for the gt/ag rule (20). The chromosomal localization of 4Gal-T4 was determined using 3' EST mapping data (NCBI).

Expression of 4Gal-T4 in Insect Cells-- An expression construct designed to encode amino acid residues 42-344 of 4Gal-T4 was prepared by PCR using EST clone 489768, and the primer pair TSHC30 (5'- AGCGGATCCTAAAGCAAAGGAGTTCATGG -3') and TSHC36 (5'- AGCGAATTCCAGGGTCATGCACCAAACCAG-3'), which include BamHI and EcoRI restriction sites, respectively (Fig. 2). The PCR product was cloned directionally between the BamHI and EcoRI site of pAcGP67A (PharMingen), and the construct sequenced to verify insertion orientation and sequence fidelity. An expression construct designed to encode the full coding sequence was prepared by PCR on cDNA of clone 489768, using the primer pair TSHC29 (5'-CATGGGCTTCAACCTGACTTTCCACCTTTCCTAC -3') and TSHC36. The 12 bases missing from the 5'-end were added during PCR (Fig. 2), and the product was cloned into pBluescript KS+ (Stratagene). Product encoding the full-length 4Gal-T4 was cloned directionally between the BamHI and EcoRI site of pVL1393 (PharMingen). Plasmids pAcGP67-4Gal-T4-sol and pVL-4Gal-T4-full were co-transfected with Baculo-Gold^TM DNA (PharMingen) as described previously (21). Expression constructs pAcGP67-4Gal-T2-sol and pAcGP67-4Gal-T3-sol were prepared as described previously (2). Recombinant baculoviruses were obtained after two successive amplifications in Sf9 cells grown in serum-containing medium, and titers of virus were estimated by titration in 24-well plates with monitoring of enzyme activities. Controls included the pAcGP67-GalNAc-T3-sol (21). The kinetic properties were determined with secreted enzymes expressed in High Five^TM cells grown in serum-free medium (SF-900 II, Life Technologies, Inc.) as suspension cultures in upright roller bottles shaking 140 rpm in 27 °C water baths. Semipurification of enzymes was performed by consecutive chromatography on DEAE or Amberlite and S-Sepharose as described previously (22). Standard assays were performed in 50-µl reaction mixtures containing 25 mM Tris (pH 7.5), 4 mM MnCl₂, 0.1% Triton X-100, 90 µM UDP-[¹⁴C]Gal (2,700 cpm/nmol) (Amersham Pharmacia Biotech), and the indicated concentrations of acceptor substrates (Sigma and Dextra Laboratories Ltd.) (see Table I for structures). The soluble constructs were assayed with 10 µl of culture supernatant from infected cells. The full-length construct was assayed with 1% Triton X-100 homogenates of washed cells. Purified 4Gal-transferase from bovine milk (Sigma) and recombinant bovine 4Gal-T1 expressed in insect cells (Calbiochem) were used as controls. Reaction products were quantified by chromatography on Dowex-1. Assays with glycoprotein acceptors were performed with the standard reaction mixture modified to contain 100 mM Bis-Tris (pH 7) and 0.5 mg of the glycoprotein acceptor. The transfer of Gal was evaluated after acid precipitation by filtration through Whatman GF/C glass fiber filters. Assays for determination of K_m of acceptor substrates were performed with semipurified enzyme in the standard reaction mixture modified to include 180 µM UDP-[¹⁴C]Gal. Assays for donor substrate K_m were performed with 0.625 mM (for bovine 4Gal-T1) and 20 mM (for 4Gal-T4) -D-GlcNAc-1-benzyl.

Glycolipid Substrate Specificity of 4Gal-T4-- Analysis of acceptor specificity with glycolipid substrates were performed with semipurified secreted enzyme in 100-µl reaction mixtures of 25 mM Tris (pH 7.5), 2 mM MnCl₂, 0.1% Triton CF-54, 100 µM UDP-[¹⁴C]Gal (11,000 cpm/nmol), with 10 µg of glycolipids (Table III). Complete glycosylation of Lc₃Cer was performed in a reaction mixture consisting of 0.5 milliunits of 4Gal-T4 (specific activity determined with GlcNAc-benzyl), 150 µg of Lc₃, 25 mM Tris (pH 7.5), 2 mM MnCl₂, 0.1% Triton CF-54, and 250 nmol of UDP-Gal in a final volume of 50 µl. The Lc₃Cer substrate was prepared as described previously (2). The glycosylation of Lc₃Cer with 4Gal-T4 was monitored by high performance thin layer chromatography and run for 24 h until completed. The reaction product was purified on an octadecyl-silica cartridge (Bakerbond; J.T. Baker) and deuterium-exchange was performed as described previously (2). One-dimensional ¹H NMR spectroscopy was performed on a Bruker AMX-500 spectrometer (temperature, 308 K; spectral width, 5000 Hz acquired over ~16,000 data points; relaxation delay, 2 s; solvent suppression by presaturation pulse). NMR spectra were interpreted by reference to spectra of relevant glycosphingolipid standards acquired previously under identical conditions (23-25).

Northern Analysis-- The cDNA fragment of soluble 4Gal-T4 was used as a probe. The probe was random primer-labeled using [-³²P]dCTP and an oligonucleotide labeling kit (Amersham Pharmacia Biotech). A human multiple tissue Northern blot, MTN I (CLONTECH), was probed overnight at 42 °C as described previously (21), and washed twice for 10 min each at room temperature with 2 × SSC, 0.1% SDS; twice for 10 min each at 55 °C with 1 × SSC, 0.1% SDS; and once for 10 min with 0.1 × SSC, 0.1% SDS at 55 °C.

	RESULTS

Top Abstract Introduction Procedures Results Discussion References

Identification and Cloning of Human 4Gal-T4-- The strategy outlined in Fig. 1 produced a novel gene with significant sequence similarity to 4Gal-T3 and other members of the 4Gal-T gene family. A multiple sequence alignment of six human 4Gal-transferases is shown in Fig. 3. The 4Gal-T4 gene has highest sequence similarity to 4Gal-T3. Sequence similarities among the six human genes are found predominantly in the central regions; there were no significant similarities in the NH₂-terminal regions. Several sequence motifs in the putative catalytic domains are conserved among all the transferases (1). Importantly, four cysteine residues are conserved in all 4Gal-transferases; a fifth cysteine residue in the C-terminal end of 4Gal-T1 is substituted by a tyrosine in the other transferases (Fig. 3) (3). N-Linked glycosylation sites are not generally conserved in glycosyltransferase species homologues or within different members of glycosyltransferase gene families; however, a single N-linked site in the C-terminal regions of 4Gal-T2, -T3, -T4, -T5, and -T6 is conserved (Fig. 4). Similarly, a single site in the central region of the putative catalytic domains of four 3Gal-transferases was conserved (26).

View larger version (12K): [in this window] [in a new window]   Fig. 1.   Genomic organization and strategy for cloning of 4Gal-T4. Upper part, schematic representation of exon/intron structure with coding exons numbered with Roman numerals. The position of introns are indicated by number of last base in coding exons, and a polyadenylation consensus sequence at position 1796 is indicated by an arrow. Lower part, identification and cloning of 4Gal-T4. Several identified ESTs derived from 4Gal-T4 are indicated by their GenBank accession numbers. Labels indicate 5' positions of EST clones compared with the coding sequence.

The predicted coding region of 4Gal-T4 has a single initiation codon in agreement with Kozak's rule (27), which precedes a sequence encoding a potential hydrophobic transmembrane segment (Figs. 2-4). The predicted coding sequence indicates that 4Gal-T4 is a type II transmembrane glycoprotein with an N-terminal cytoplasmic domain of 14 residues, a transmembrane segment of 20 residues, and a stem region and catalytic domain of 310 residues with three potential N-linked glycosylation sites (28). One N-linked site is located in the putative cytoplasmic sequence and therefore may not be utilized. A hydropathy plot (29) of 4Gal-T4 indicated that the putative stem region was highly hydrophilic similar to 4Gal-T1, -T2, and -T3 (Fig. 4). In contrast, 4Gal-T5 and -T6 have unusually long hydrophobic regions at the putative signal anchor sequences, which are not clearly defined. A comparison of four members of a 3Gal-transferase family showed that one member with exclusive substrate specificity for glycolipids, the G_M1 synthase 3Gal-T4, differed from the other three members of the family by having a unique hydrophobic stem region (26). A hydrophobic stem region is not found in all glycosyltransferases acting on glycolipids (30). The 3'-untranslated region contains a polyadenylation signal at base pair 1796 (+761).

View larger version (51K): [in this window] [in a new window]   Fig. 2.   Nucleotide sequence and predicted amino acid sequence of human 4Gal-T4. The amino acid sequence is shown in single-letter code. The hydrophobic segment representing the putative transmembrane domain is underlined with a double line (Kyte & Doolittle, window of 8; Ref. 29). Three consensus motifs for N-glycosylation are indicated by asterisks. The location of the primers used for preparation of the expression constructs are indicated by single underlining. A potential polyadenylation signal is indicated in boldface underlined type.

View larger version (90K): [in this window] [in a new window]   Fig. 3.   Multiple sequence analysis (ClustalW) of human 4Gal-T1, -T2, -T3, -T4, -T5, and -T6. Introduced gaps are shown as hyphens, and aligned identical residues are boxed (black for all sequences, dark gray for five sequences, and light gray for four sequences). The putative transmembrane domains are underlined with a single line. The positions of conserved cysteines are indicated by asterisks. Tyrosine and tryptophan residues shown by Aoki et al. (56) to be functionally important for the activity of 4Gal-T1 are indicated by open arrows. One conserved N-glycosylation site is indicated by an open circle. Cysteine residue 338 of 4Gal-T1, which is replaced by tyrosine in all other 4Gal-transferases (3), is indicated by an open diamond.

View larger version (25K): [in this window] [in a new window]   Fig. 4.   Comparison of human 4Gal-transferases. A, Kyte and Doolittle (1) (window of 8) hydropathy plots. The position of conserved sequence motifs as shown in Fig. 3 are indicated with dotted lines. TM indicates the putative transmembrane regions. Arrows indicate the positions of the four conserved cysteine residues. B, schematic depiction of 4Gal-transferases aligned for the conserved cysteine residues. Potential N-glycosylation sites are indicated by trees.

Genomic Organization and Chromosomal Localization-- The coding region of 4Gal-T4 was found in six exons, similar to 4Gal-T1, -T2, and -T3 (Figs. 1 and 5) (2, 31, 32). Comparison of the intron/exon boundaries of four of the six human 4Gal-transferases cloned to date revealed that the five introns in the coding regions are placed identically. The central coding exons of all 4Gal-T genes are nearly identical in length. 4Gal-T4 does not appear to have intronic sequences in the 5'-untranslated region (150 bases sequenced), which is similar to 4Gal-T1. 4Gal-T2 and -T3 have an intron 53 and 34 bases, respectively, 5' of the initiating ATG (2) (note that the initiating ATG of 4Gal-T2 was changed in an erratum; Ref. 2). The chick homologue of 4Gal-T2 also has an intron in the 5'-untranslated region (3). The 3' ESTs of 4Gal-T4 were linked in transcript map A004F36 to chromosome 3q13.3 near the D3S1558 microsatellite marker at 136 centimorgans (NCBI). Thus, all 4Gal-transferases are localized to different loci with 4Gal-T1 on 9p13 (33), 4Gal-T2 on 1p32-p33, and 4Gal-T3 at 1q23 (2).

View larger version (19K): [in this window] [in a new window]   Fig. 5.   Intron junctions in the coding regions of the 4Gal-T4 gene. Exon sequences are shown in uppercase letters with the nucleotide positions from the initiation codon in subscript and the predicted amino acid sequence in single-letter code above the sequence. Flanking intron sequences are shown in lowercase letters, and introns are labeled according to Fig. 1. Sequences were aligned to best fit of the gt/ag consensus rule.

Expression of 4Gal-T4-- Expression of a soluble construct of 4Gal-T4 in insect cells resulted in marked increase in galactosyltransferase activity with a number of GlcNAc containing acceptor substrates, compared with uninfected cells or cells infected with a control construct (Table I). All identified substrates had GlcNAc at the nonreducing end. Of the simple saccharide derivatives tested, only the disaccharide GlcNAc1-6GlcNAc1-benzyl was better than monosaccharide derivatives. 4Gal-T4 did have significant activity with disaccharide derivatives representing N-linked and O-linked core structures (GlcNAc1-6Man1-Me, GlcNAc1-2Man, and GlcNAc1-3GalNAc1-pNP) and with the biantennary pentasaccharide. In contrast, no activity was found with three glycoproteins that served as substrates for bovine milk 4Gal-T and human 4Gal-T2 and -T3 (Table II). Interestingly, 4Gal-T2 showed the highest relative activity with glycoprotein substrates. Previously, it was found that this enzyme has a low apparent K_m for GlcNAc-benzyl and UDP-Gal (2). Analysis with glycolipid substrates showed that 4Gal-T4 had good activity with Lc₃Cer and 4-fold lower activity with nLc₅Cer (Table III). Lower activity with the longer lactoseries glycolipids was previously found to be more pronounced for 4Gal-T3, which had 10-fold lower activity with nLc₅Cer (2). 4Gal-T4 had higher apparent K_m for UDP-Gal (31 µM) than recombinant bovine 4Gal-T1 (20 µM) (Table IV). No significant differences in activity of the full coding construct was found with the simple saccharide derivatives (data not shown).

View this table: [in this window] [in a new window]   Table I Substrate specificities of 4Gal-T4

View this table: [in this window] [in a new window]   Table II Substrate specificity of 4-galactosyltransferases with glycoprotein acceptors

View this table: [in this window] [in a new window]   Table IV Kinetic properties of 4Gal-transferases

Although the activities of both human 4Gal-T1 and -T2 with GlcNAc concentrations above apparent K_m are inhibited by -lactalbumin (2, 7, 34), 4Gal-T4 showed a marked increase in N-acetyllactosamine synthase activity in the presence of -lactalbumin (Fig. 6A). Two-fold activation was achieved at 0.25 mg/ml and almost 8-fold at 20 mg/ml, which is substantial when compared with 50% reduction of activities of 4Gal-T1 and -T2 at 0.040 mg/ml and 0.2 mg/ml, respectively (2). Activation of 4Gal-T4 by -lactalbumin was observed at all concentrations of GlcNAc acceptor (Fig. 7A), and -lactalbumin had no significant effect on the activity with GlcNAc-benzyl at concentrations tested (Fig. 7B). Importantly, the apparent K_m of 4Gal-T4 for GlcNAc could not be determined because of the low activity with this substrate even at 200 mM. 4Gal-T (T1) from bovine milk shows a slight degree of activation at concentrations below the K_m for GlcNAc (Fig. 7A), which is in agreement with previous reports (7, 35-37). The activity of milk 4Gal-T with GlcNAc-benzyl was partly inhibited by -lactalbumin (Fig. 7B). Free glucose was not an acceptor for 4Gal-T4, but in the presence of increasing concentrations of -lactalbumin, a low level of lactose synthase activity was observed (Fig. 6B). Interestingly, a low level of catalysis of xylose glycosylation (Xyl-MU) was also induced (data not shown). This was also found for milk 4Gal-T activity (37), and may suggest that the N-acetyllactosamine synthases could be structurally related to the 4Gal-T involved in synthesis of the proteoglycan core structure Gal1-3Gal1-4Xyl1-O-Ser (38, 39). The concentration of -lactalbumin required for induction of lactose synthase activity was 1 mg/ml with maximum activity at 20 mg/ml (Fig. 6), which is considerably higher than previously observed for the bovine milk 4Gal-T activity and 4Gal-T2, which required 400 µg/ml and 100 µg/ml, respectively, to achieve maximum lactose synthase activity (2). As shown in Fig. 7, 4Gal-T4 was not inhibited at high concentrations of either GlcNAc-benzyl or free N-acetylglucosamine, which is in contrast to other 4Gal-transferases (2, 40). 4Gal-T4 showed strict donor substrate specificity for UDP-Gal and did not utilize UDP-GalNAc or UDP-GlcNAc with the acceptor substrates tested (data not shown). The soluble and full coding constructs exhibited the same modulation of activity by -lactalbumin (data not shown).

View larger version (17K): [in this window] [in a new window]   Fig. 6.   -Lactalbumin modulation of 4Gal-T4 activity. A, activity with GlcNAc in the presence of increasing amounts of -lactalbumin. 0.1 milliunit (measured with GlcNAc-benzyl) of 4Gal-T4 and bovine milk 4Gal-T were used with 50 mM GlcNAc as acceptor substrate. Purified bovine milk enzyme or media from High FiveTM cells expressing the secreted form of 4Gal-T4 were used as enzyme sources. B, activity with glucose in the presence of increasing amounts of -lactalbumin. , bovine milk Gal-transferase; , 4Gal-T4.

View larger version (19K): [in this window] [in a new window]   Fig. 7.   N-Acetyllactosamine synthase activation of 4Gal-T4 by -lactalbumin: lack of inhibition by high acceptor substrate concentrations. A, D-GlcNAc; B, -D-GlcNAc-1-benzyl. , bovine milk 4Gal-transferase without -lactalbumin; , bovine milk 4Gal-transferase with 2.5 mg/ml -lactalbumin; , 4Gal-T4 without -lactalbumin; , 4Gal-T4 with 2.5 mg/ml -lactalbumin.

Structural characterization of the product formed with nLc₃Cer by ¹H NMR showed that the 4Gal-T4 forms the Gal1-4GlcNAc linkage. One-dimensional ¹H NMR spectroscopy showed that the product was a single glycosphingolipid product with a spectrum virtually identical to that of nLc₄Cer acquired previously under identical conditions (25), and distinct from that of Lc₄Cer (23). In the downfield region of the spectrum (Fig. 8), four distinct -anomeric resonances (³J_{1, 2}  7-9 Hz), were observed at chemical shifts 4.169 ppm (³J_{1, 2} = 7.4 Hz), 4.212 ppm (³J_{1, 2} = 7.7 Hz), 4.263 ppm (³J_{1, 2} = 6.8 Hz), and 4.663 ppm (³J_{1, 2} = 8.3 Hz). Under these conditions, the resonance for H-1 of the terminal Gal13 of Lc₄Cer is found at 4.140 ppm (³J_{1, 2} = 7.3 Hz), whereas that of -GlcNAc III-1 is found at 4.780 ppm (³J_{1, 2} = 7.9 Hz) (23).

View larger version (23K): [in this window] [in a new window]   Fig. 8.   Downfield region of 500-MHz 1H NMR spectrum of glycosphingolipid produced by enzymatic glycosylation of Lc3Cer with 4Gal-T4. The product isolated by C-18 SepPak chromatography was deuterium-exchanged and dissolved in Me2SO-d6/2% D2O. 2048 free induction decays were accumulated at 308 K. Arabic numerals refer to ring protons of residues designated by Roman numerals or uppercase letters in the corresponding structure. R refers to protons of the sphingosine backbone.

Expression Pattern of 4Gal-T4-- Since a large number of ESTs from 4Gal-T4 has been identified, the cDNA library sources from which these are derived may provide information about the expression pattern. Based on this information, 4Gal-T4 is expressed in brain, central nervous system, colon, heart, lung, muscle, ovary, placenta, testis, and uterus.

Northern analysis with mRNA from eight human adult organs showed expression in most adult organs with highest levels observed in heart, placenta, kidney, and pancreas (Fig. 9). The transcript size of 4Gal-T4 was approximately 2.5 kilobase, which is similar to the transcript sizes of 2.2 kilobase for 4Gal-T2 and -T3. Two transcripts of 3.9 and 4.1 kilobase from 4Gal-T1 have been fully characterized, and shown to be differentially regulated (41, 42).

View larger version (57K): [in this window] [in a new window]   Fig. 9.   Northern blot analysis of human tissues. A multiple human Northern blot, MTNI, from CLONTECH was probed with 32P-labeled cDNA of 4Gal-T4 corresponding to the soluble expression construct (base pairs 125-1035).

	DISCUSSION

Top Abstract Introduction Procedures Results Discussion References

The human 4Gal-transferase gene family includes at least six members, which are involved in the synthesis of the N-acetyllactosamine disaccharide in oligosaccharides and glycoconjugates (2, 4-6, 9, 10). This large number of enzymes covering a single glycosidic linkage suggests either a high degree of redundancy in functions, or it may suggest that the enzymes have different functions. The high degree of divergence in primary sequence of the enzymes, studies of the acceptor substrate specificities of recombinant 4Gal-Ts (2, 6), and the findings that mice deficient in 4Gal-T1 exhibit a severe phenotype (43, 44), clearly point to different functional roles for each enzyme. Hence, the regulation of 1-4-galactosylation is more complex than previously recognized. Studies of the kinetic properties and the expression patterns of the individual enzymes may provide insight into their roles in synthesis of different types of glycoconjugates or in regulation of elongation and branching of poly-N-acetyllactosamine structures.

The sixth human member of the 4Gal-transferase family, 4Gal-T4, characterized in the study presented here, was found to exhibit unique kinetic properties. A dendrogram analysis (ClustalW) of the six human 4Gal-transferases indicates that the following pairs of enzymes, 4Gal-T1 and -T2, 4Gal-T3 and -T4, and 4Gal-T5 and -T6, are especially related (10). Since the first four identified human 4Gal-transferases, 4Gal-T1, -T2, -T3, and -T5, have similar donor and acceptor substrate specificities, it was expected that 4Gal-T4 also would have similar activity. 4Gal-T1, -T2, -T3, and -T4 all utilize GlcNAc-terminating glycolipid acceptors (Lc₃Cer, nLc₅Cer) (2) (Table III). 4Gal-T4 resembled its closer homologue 4Gal-T3 in showing strong preference for the shorter glycolipid substrate compared with nLc₅Cer (Table III) (2). This is in contrast to the bovine milk 4Gal-T, which efficiently utilized both glycolipid substrates (2). No natural glycoconjugate acceptor for 4Gal-T5 has been reported (6), but its close homologue, 4Gal-T6, transfers Gal to glucosylceramide (9).

An important finding was that the 4Gal-transferases showed different catalytic activities with glycoprotein acceptors. 4Gal-T1, -T2, and -T3 catalyzed transfer to asialo-agalacto-fetuin, asialo-agalacto-transferrin, and ovalbumin with varying efficiency, whereas 4Gal-T4 was inactive with these substrates (Table II). 4Gal-T5 was also reported to be inactive with asialo-agalacto-transferrin (6). The panel of glycoprotein substrates tested in the present study does not represent a complete set of possible N-linked glycan acceptor sequences, and the actual acceptor sequences for 4Gal-T1, -T2, and -T3 were not determined in the present study. Ovalbumin contains a single N-glycan with considerable heterogeneity, and mainly one potential acceptor sequence, GlcNAc1-2Man (45). Transferrin has two complex biantennary N-linked glycans with GlcNAc1-2Man1-3Man and GlcNAc1-2Man1-6Man acceptor sites (46). Fetuin contains three complex N-glycans of the biantennary form or of the 2,4-branched triantennary type (47, 48). Although no acceptor glycoprotein for 4Gal-T4 was identified, it is possible that this enzyme does catalyze transfer of galactose to glycoproteins since disaccharides and a pentasaccharide representing complex N-glycans served as a substrate (Table I). However, the activities with these structures were less than with monosaccharide derivatives, suggesting that indeed these oligosaccharides do not represent the glycoconjugate substrates. Fetuin also contains three O-glycans, of which some are of the complex type (49). Although 4Gal-T4 catalyzed glycosylation of the disaccharide structure GlcNAc1-3GalNAc1-pNP (the O-linked core 3 structure), the enzyme apparently did not work with the O-linked acceptors of asialo-agalacto-fetuin (Tables I and II). If 4Gal-T4 functions with glycoprotein acceptors, it may be with more complex structures. Preliminary studies with O-GlcNAc glycopeptides indicate that most enzymes can catalyze transfer to this type of protein glycosylation (50), but 4Gal-T4 showed the poorest activity.³ Collectively, it appears likely that the main function of 4Gal-T4 is in the biosynthesis of neolactoseries glycosphingolipids.

The catalytic efficiency of 4Gal-T4 with simple sugars and sugar derivatives was poor compared with 4Gal-T1, -T2, and -T3 (Tables I and II). At the concentrations tested, only 4Gal-T4 did not show substrate inhibition (Fig. 7). Interestingly, the activity of 4Gal-T4 with GlcNAc was activated by -lactalbumin to levels comparable to the activities with GlcNAc of other 4Gal-Ts in the absence of -lactalbumin (Fig. 6). A similar, although weaker, effect was previously found for the milk 4Gal-T (T1) activity with concentrations of GlcNAc acceptor below K_m (7, 35-37), and this was also observed in the present study (Fig. 7). At high GlcNAc acceptor concentrations, both 4Gal-T1 and -T2 are strongly inhibited by -lactalbumin, and this was suggested to reflect enhanced acceptor substrate accessibility (Fig. 7) (2, 35-37, 51). Correspondingly, interaction of -lactalbumin with 4Gal-T1 modulates the acceptor specificity from GlcNAc to Glc, thus forming the basis for lactose synthesis in mammary glands (7, 52). 4Gal-T2 is also efficiently induced to catalyze synthesis of lactose in the presence of -lactalbumin (2), a feature that is also found in the chick orthologs (3). In contrast, 4Gal-T3 and 4Gal-T5 are largely insensitive to -lactalbumin modulation, although weak inhibition of N-acetyllactosamine synthesis was observed (2, 6, 8). -Lactalbumin induced 4Gal-T4 to catalyze synthesis of lactose, but the catalytic efficiency was low (Fig. 6). In contrast to the effect of -lactalbumin on 4Gal-T1 activity toward monosaccharide acceptors, -lactalbumin acts as a competitive inhibitor of 4Gal-T1 activity with extended acceptor substrates (e.g. -D-GlcNAc-1-benzyl or N,N'-diacetylchitobiose; see Refs. 34-37 and 51), and this effect was also observed in the present study (Fig. 7B). Surprisingly, -lactalbumin did not show a similar inhibitory effect on the activity of 4Gal-T4 with -D-GlcNAc-1-benzyl at any concentration tested (Fig. 7B). The obtained data therefore suggest that -lactalbumin interacts differently with 4Gal-T1 and 4Gal-T4.

4Gal-T1 is strongly expressed in lactating mammary glands (41), and it has been reported that 4Gal-T5 is weakly expressed as well (8). However, Lo et al. (10) found that, of the six members of the family identified so far, only 4Gal-T1 is expressed in murine lactating glands. 4Gal-T2 is unlikely to be expressed in mammary glands since mice deficient in 4Gal-T1 do not produce lactose in milk (43, 44). Interestingly, the interaction of 4Gal-T4 with -lactalbumin may be weaker or different than 4Gal-T1, since affinity chromatography with -lactalbumin-Sepharose did not bind 4Gal-T4 under the same conditions under which 4Gal-T1 binds (53) (data not shown).

The distinct response of 4Gal-T4 to -lactalbumin resembles the response reported for a snail UDP-GalNAc:GlcNAc 1-4-N-acetylgalactosaminyltransferase activity (15). The 4GalNAc-transferase activity with GlcNAc-concentrations below K_m was activated nearly 3-fold in the presence of -lactalbumin, and the activity with Glc was increased 20-fold (12 mg/ml). For 4Gal-T1 and -T2 the relative lactose synthase activity inducible by -lactalbumin is over 2-fold higher as compared with N-acetyllactosamine synthase activity without (2, 7, 52). A comparable analysis of human 4Gal-T4 and snail 4GalNAc-transferase activity also shows approximately 2-fold higher rates; however, it should be noted that GlcNAc is a poor substrate for these enzymes without -lactalbumin (Table I) (15). If the induced lactose synthase activity is compared with N-acetyllactosamine synthase in the presence of the same concentration of -lactalbumin, the lactose synthase activity is lower than the N-acetyllactosamine synthase activity (15) (Fig. 6). The snail 4GalNAc-transferase activity also resembles bovine milk 4Gal-transferase by showing modulation by -lactalbumin of broader donor substrate specificity to include UDP-Gal. The equivalent was not found for 4Gal-T4, which only showed activity with UDP-Gal. It has been suggested that the 4GalNAc-transferase activity found in snails and other invertebrates could be homologous to the 4Gal-transferase family, which was the case for the snail 4GlcNAc-transferase (17). Similarities in properties of 4Gal-T4 and the snail 4GalNAc-transferase suggest that 4Gal-T4 could represent a human homologue of this enzyme, and the human 4Gal-T4 could potentially be a better probe than 4Gal-T1 for identification and cloning of the snail 4GalNAc-transferase (13).

The 4Gal-transferase gene family appears to be derived by gene duplication with subsequent divergence in sequences. The strongest evidence for this is the finding that four of the human 4Gal-Ts have identical genomic organizations that includes conservation of five intron positions within the translated region. Importantly, all five introns are also found in the chick homologues of 4Gal-T1 and -T2 (3), and in a homologous snail 4GlcNAc-transferase (54). Shaper et al. (3) suggested that these two genes represented distinct ancestral lineages, and that the 4Gal-T2 lineage had given rise to several additional genes including 4Gal-T3, -T4, and -T5 in man, based on sequence analysis and chromosomal synteny of the location of chick and human 4Gal-T1 and -T2 homologues. Related to this, only two putative members of the 4Gal-transferase gene family have been identified in Caenorhabditis elegans, ce1 (GenBank accession no. Z29095) and ce2 (GenBank accession no. X98132) (1, 55), and these exhibit most of the highly conserved motifs found in the chick and mammalian enzymes. The gene designated ce2 shows the highest sequence similarity to 4Gal-T5 and -T6, and the least to 4Gal-T1. ce2 contains all four cysteine residues conserved among 4Gal-T1, -T2, -T3, -T4, -T5, and -T6. The gene designated ce1 shows highest similarity to a more distant member of the human 4Gal-transferase gene family, which has not been fully characterized yet. ce1 does not contain the four conserved cysteine residues, and shows several differences in other conserved motifs among the 4Gal-transferases. The evolutionary trait of the 4Gal-transferase gene family thus remains to be clarified.

	ACKNOWLEDGEMENTS

We thank Drs. Michael A. Hollingsworth and Kiyoshi Furukawa for many helpful suggestions and critical reading of the manuscript.

	FOOTNOTES

^* This work was supported by the Danish Cancer Society; the Velux Foundation; the Danish Medical Research Council; Praxis XXI Grant 2/2.1/BIA/276/94; National Institutes of Health Grants 1 RO1 CA66234, RO1 CA41521, and RO1 CA70740; and National Institutes of Health Resource Center for Biomedical Complex Carbohydrates (under Grant 5 P41 RR05351).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF022367.

^** To whom correspondence should be addressed: School of Dentistry, Nørre Alle 20, DK-2200 Copenhagen N, Denmark. Tel.: 45-35326835, Fax: 45-35326505, E-mail: henrik.clausen{at}odont.ku.dk.

The abbreviations used are: 4Gal-T, UDP-galactose:-N-acetylglucosamine 1,4-galactosyltransferase; EST, expressed sequence tag; PCR, polymerase chain reaction.

² The designations of glycosphingolipids are abbreviated according to the recommendations of the IUPAC-IUB Commission on Nomenclature (57).

³ T. Schwientek, G. Arsequell, and H. Clausen, unpublished observation.

	REFERENCES

Top Abstract Introduction Procedures Results Discussion References

1. Van Die, I., Bakker, H., and Van den Eijnden, D. H. (1997) Glycobiology 7, v-ix
2. Almeida, R., Amado, M., David, L., Levery, S. B., Holmes, E. H., Merkx, G., van Kessel, A. G., Rygaard, E., Hassan, H., Bennett, E. P., and Clausen, H. (1997) J. Biol. Chem. 272, 31979-31992[Abstract/Free Full Text]
3. Shaper, N. L., Meurer, J. A., Joziasse, D. H., Chou, T. D., Smith, E. J., Schnaar, R. A., and Shaper, J. H. (1997) J. Biol. Chem. 272, 31389-31399[Abstract/Free Full Text]
4. Shaper, N. L., Shaper, J. H., Meuth, J. L., Fox, J. L., Chang, H., Kirsch, I. R., and Hollis, G. F. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1573-1577[Abstract/Free Full Text]
5. Narimatsu, H., Sinha, S., Brew, K., Okayama, H., and Qasba, P. K. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 4720-4724[Abstract/Free Full Text]
6. Sato, T., Furukawa, K., Bakker, H., Van den Eijnden, D. H., and Van Die, I. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 472-477[Abstract/Free Full Text]
7. Brew, K., Vanaman, T. C., and Hill, R. L. (1968) Proc. Natl. Acad. Sci. U. S. A. 59, 491-497[Free Full Text]
8. Sato, T., Aoki, N., Matsuda, T., and Furukawa, K. (1998) Biochem. Biophys. Res. Commun. 244, 637-641[CrossRef][Medline] [Order article via Infotrieve]
9. Nomura, T., Takizawa, M., Aoki, J., Arai, H., Inoue, K., Wakisaka, E., Yoshizuka, N., Imokawa, G., Dohmae, N., Takio, K., Hattori, M., and Matsuo, N. (1998) J. Biol. Chem. 273, 13570-13577[Abstract/Free Full Text]
10. Lo, N., Shaper, J. H., Pevsner, J., and Shaper, N. L. (1998) Glycobiology 8, 517-526[Abstract/Free Full Text]
11. Shaper, N. L., Hollis, G. F., Douglas, J. G., Kirsch, I. R., and Shaper, J. H. (1988) J. Biol. Chem. 263, 10420-10428[Abstract/Free Full Text]
12. Masri, K. A., Appert, H. E., and Fukuda, M. N. (1988) Biochem. Biophys. Res. Commun. 157, 657-663[CrossRef][Medline] [Order article via Infotrieve]
13. Bakker, H., Agterberg, M., Van Tetering, A., Koeleman, C. A., Van den Eijnden, D. H., and Van Die, I. (1994) J. Biol. Chem. 269, 30326-30333[Abstract/Free Full Text]
14. Bakker, H., Schoenmakers, P. S., Koeleman, C. A., Joziasse, D. H., Van Die, I., and Van den Eijnden, D. H. (1997) Glycobiology 7, 539-548[Abstract/Free Full Text]
15. Neeleman, A. P., and Van den Eijnden, D. H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10111-10116[Abstract/Free Full Text]
16. Do, K. Y., Do, S. I., and Cummings, R. D. (1995) J. Biol. Chem. 270, 18447-18451[Abstract/Free Full Text]
17. Van den Eijnden, D. H. (1997) Biochem. Soc. Trans. 25, 887-893