|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 45, 29373-29380, November 6, 1998
From the Department of Physiology and Pediatrics, Johns Hopkins
University School of Medicine, Baltimore, Maryland 21205
The cystic fibrosis transmembrane conductance
regulator (CFTR) consists of two transmembrane domains (TMDs), TMD1 and
TMD2, two cytoplasmic nucleotide binding domains (NBDs), NBD1 and NBD2, and a regulatory domain. To elucidate the complex function of the CFTR,
deletion constructs encompassing the second half of the CFTR distal to
the first transmembrane domain were expressed in Xenopus
oocytes and IB3 cells (a cystic fibrosis cell line). Constructs
containing the regulatory domain, the second transmembrane domain, and
the second nucleotide binding domain formed constitutively active
channels, which were further stimulated upon the addition of cAMP. On
the other hand, a construct encompassing the second transmembrane
domain and the second nucleotide binding domain was stimulated to a
small but noticeable extent upon the addition of cAMP. The selectivity
of the second-half construct was the same for iodide and chloride, in
contrast to the selectivity of wild-type CFTR, which is
Cl Quinton suggested in 1983 (24) that Cl Although TMD1 (7, 8) has been studied extensively, the role of the
second half of the CFTR in ion conduction is still unresolved. To
evaluate the functional contributions of this region of the protein, we
generated deletion constructs encompassing the second half of the CFTR
(Fig. 1). The cRNA for these mutants was
then injected into Xenopus oocytes. Seventy-two h after
injection, two-electrode voltage clamp experiments were performed to
look for channel activity. The first construct contains the regulatory domain, the second transmembrane domain, and the second nucleotide binding domain of CFTR (RT2N2CFTR). A second construct containing the
second transmembrane domain and the second nucleotide binding domain
(T2N2CFTR) was also tested for cAMP-stimulated chloride channel
activity. Both constructs included the first 159 bases of wtCFTR so as
to include the Kozak methionine for translation initiation. Our results
suggest that the second half of the CFTR does play a role in
Cl Site-directed Mutagenesis--
The double-stranded mutagenesis
method (Stratagene) was used to generate all of the necessary
mutations. Both constructs (RT2N2CFTR and T2N2CFTR) were constructed
using a wtCFTR plasmid (PBluescript CFTR) as the template. A
StuI site (AGGCCT) was created at position 160 using the
oligonucleotide CGCCTCTGGAAAAGGCCTGCGTTGTCTCCAAAC, and another
StuI site was created at positions 2125 (for RT2N2CFTR) and
2523 (for T2N2CFTR) using oligonucleotides
CCTAACTGAGGCCTTACACCGTTTCTCATTAGAAGG and
CGAAAAGTGTCACTGGCGCCTCAGGCAAACTTG, respectively. The selection primer
used for this method of mutagenesis was one that eliminated the
KpnI site on the vector backbone
(CGACCTCGAGGGGGGGCCCAGATCTCAGCTTTTGTTCCC). The three
oligonucleotides were phosphorylated and added to a mixture of wtCFTR
plasmid and mutagenesis buffer, followed by denaturation by boiling at
100 °C for 5 min. The mixture was cooled on ice for 5 min and then
at room temperature for 30 min to facilitate the annealing of the
primers to the single-stranded template. The oligonucleotides were
extended using DNA polymerase and deoxynucleotide triphosphates,
followed by ligation with DNA ligase. Any wild-type plasmid that
remained was eliminated by digestion with KpnI for 2 h.
A mutS strain was then transformed with the digestion mix and spread out on LB-agar plates overnight. Plasmid DNA was extracted from the colonies and redigested with KpnI to eliminate the
wild-type plasmids. The remaining undigested plasmids were then
retransformed into XL1 supercompetent cells. Plasmids were then
extracted from individual colonies and screened for the mutation of
interest. Plasmids carrying mutations at both sites (160 and 2125/2523) were ligated after removal of the intervening regions (160-2125 for
RT2N2CFTR and 160-2523 for T2N2CFTR) using the Rapid DNA Ligation kit
(Life Technologies, Inc.). The sequences were confirmed by sequencing.
The newly generated constructs thus had the first 159 bases of wtCFTR
so as to include the Kozak methionine to facilitate translation
initiation and the second half of the CFTR (2125-4700 for RT2N2CFTR;
2523-4700 for T2N2CFTR).
Shuttling of DNA Fragments into PRSVCFTR for Transfection into
Mammalian Cells--
The cDNA fragments encoding the two
second-half constructs were excised from their PBQ vector backbones
using the restriction enzymes NotI and SalI.
These were then subcloned into a PRSVCFTR vector that had been cut with
the same two enzymes to excise wtCFTR, followed by ligation using the
Rapid DNA Ligation kit (Life Technologies, Inc.).
Preparation of Messenger RNA--
The PBqCFTR vector was
linearized with XhoI (New England Biolabs). One µg of the
linearized DNA was in vitro-transcribed with T7 RNA
polymerase using the manufacturer's protocol (Ambion Megascript Kit;
Ambion, Austin, TX).
Transient Transfection of IB3 Cells using Lipofectin--
The
methodologies involved have been described in detail by Schwiebert
et al. (5).
Xenopus Oocytes Preparation--
The methodologies involved have
been described in detail by Morales et al. (4).
Xenopus Oocyte Expression and Recording--
For the expression
studies, oocytes were isolated and incubated for 24 h in modified
Barth's solution for 24 h before microinjection. Fifty ng of RNA
were microinjected into the cytoplasm of the oocytes and incubated at
18 °C for 72 h. Two-electrode voltage clamp experiments were
performed on an oocyte immersed in a 1-ml recording chamber filled with
frog Ringer solution. The frog Ringer solution used consisted of 115 mM NaCl, 2 mM KCL, 1 mM
CaCl2, 1 mM MgCl2, and 5 mM HEPES, pH 7.4. DIDS (500 µM) was used in
the frog Ringer solution at all times. To study iodide currents, sodium
chloride in the Ringer solution was substituted by an equimolar
quantity of sodium iodide. For membrane current measurements, the
oocytes were impaled with two electrodes filled with 3 M
KCl with resistances of 0.5-2 megaohms. The resting membrane
potentials were allowed to stabilize for 15 min and were typically in
the range of 38-48 mV. The membrane potentials were clamped to 36Cl Whole Cell Patch-Clamp Recording--
Cells were seeded at 50%
confluence and transfected with wild-type, mutant, or truncated CFTR
cDNA. The night before recording and approximately 48 h after
transfection, transfected cells were trypsinized from 6-well plates,
seeded, and concentrated onto Vitrogen (human collagen; Celtrix, Inc.,
Palo Alto, CA)-coated glass coverslips (Bellco Glass, Vineland, NJ) for
patch-clamp recording. Symmetrical 145 mM Tris-Cl solutions
were used to study Cl Single-Channel Recording--
Single-channel patch-clamp
recording was carried out in the excised inside-out patch-clamp
configuration by using conventional procedures. Catalytic subunits of
protein kinase A (75 nM; Promega) and Mg-ATP (1 mM; Sigma) were added to cytoplasmic face of excised patches to activate the channel. All single-channel patch-clamp studies
were performed at 25 °C. Integrity of the cell-attached patch was
confirmed by visualizing the membrane patch ripping away from the cell,
because the patch was excised from the inside-out configuration.
Currents were amplified with an Axopatch 200B patch-clamp amplifier and
recorded on videotape for later analysis. Data were low-pass filtered
at 200 Hz and digitized at 1 kHz. Data were analyzed by pCLAMP6.03
software. A simplex maximum likelihood estimate routine was used to fit
the logarithmically binned data (6 bins/decade). The bath solution
contained 140 mM
N-methyl-D-glutamine chloride, 2 mM
MgCl2, 1 mM EGTA, 5 mM HEPES, and
0.5 mM CaCl2 (pH 7.35 with
N-methyl-D-glutamine); the pipette solution
contained 140 mM
N-methyl-D-glutamine chloride, 2 mM
CaCl2, and 5 mM HEPES (pH 7.35 with
N-methyl-D-glutamine).
Chloride Channel Studies in Xenopus Oocytes--
To evaluate the
functions of the second transmembrane domain of CFTR, cRNA for wtCFTR
and the two second-half mutants was expressed in Xenopus
oocytes. Water-injected oocytes exhibited little or no current activity
in the absence (I = 90.06 ± 6.88 nA,
n = 9 at 60 mV; Fig. 2)
or presence of cAMP agonists (I = 92.24 ± 7.44 nA, n = 9 at 60 mV). wtCFTR-injected oocytes expressed linear currents upon cAMP stimulation that were DIDS insensitive and
exhibited linear I/V characteristics and a reversal
potential consistent with a chloride current. The current magnitude was reduced (wtCFTR, ICl
On the contrary, oocytes injected with RT2N2CFTR (I = 470.52 ± 84.51 nA at 60 mV) exhibited a large baseline
constitutive current compared with those injected with wtCFTR
(I = 115.06 ± 9.16 nA, n = 8 at
60 mV; Fig. 4). The current was further
increased upon the addition of cAMP agonists (RT2N2CFTR,
I = 676.03 ± 87 nA at 60 mV, n = 9; wtCFTR, I = 534.67 ± 39.7 nA at 60 mV,
n = 8). The current magnitude was unchanged upon
switching the Ringer solution from one in which the predominant anion
was chloride to one in which the predominant anion was iodide. This was
in contrast to wtCFTR-injected oocytes, in which a decrease in current magnitude was observed upon switching to an iodide-containing Ringer's
solution.
Oocytes injected with cRNA for T2N2CFTR exhibited a small baseline
current similar to that exhibited by wtCFTR-injected oocytes (Table
I, I = 86.47 ± 6.62 nA, n = 8 at 60 mV; Fig.
5). However, the addition of cAMP
agonists increased the current magnitude by only 10-20% compared with
wtCFTR (I = 175.38 ± 17.46 nA, n = 8 at 60 mV). There was, however, no change in current magnitude upon
switching to an iodide-containing Ringer's solution.
Chloride Channel Studies in IB3-1 Cells--
To assess the
Cl
Whole cell current patch-clamp recordings were carried out to assess
the Cl The importance of TMD2 for the normal functioning of the CFTR is
evident in the large number (19 thus far) of missense mutations associated with CF located in the fourth intracellular loop (ICL4) between segments M10 and M11 of CFTR (10-14). One residue in
particular, R1066, is associated with four separate CF-causing
mutations. Cotten et al. (15) constructed several of these
mutants and expressed them in heterologous cells to study their effects
on protein processing and function. These mutants expressed chloride currents upon cAMP stimulation, which had close to wild-type
characteristics. The single-channel conductances and anion selectivity
of these mutants resembled that of wild-type CFTR, suggesting that ICL4 does not contribute directly to the conduction pore. However, the
mutants did have varied influences on the open state probability and
burst duration. The authors speculate that ICL4 mutations might disrupt
or modify some aspect of gating of the Cl Fluorescence assays on peptides corresponding to the individual
transmembrane segments revealed that membrane-spanning regions in the
second half were able to conduct chloride and could thus line the pore
in the wild-type protein. McCarty et al. (17) and McDonough
et al. (18) studied the diphenylamine-2-carboxylic acid
binding properties of residues within the putative chloride permeation
pathway of CFTR. Residues in CFTR that exhibit altered diphenylamine-2-carboxylic acid binding properties when mutated may
line the pore. They showed that residues in both M6 and M12 may line
the channel pore, suggesting that regions of the second half of the
CFTR may line the channel pore.
Anderson et al. (1) mutated several amino acids in the TMDs
and evaluated their effects on CFTR channel function. They hypothesized
that if the charged amino acids that lined the channel were mutated,
they would disrupt the wild-type electrical forces in the pore, thereby
influencing ion selectivity. Lys95 in M1 and
Lys335 in M6 were mutated to Asp and Glu, respectively.
HeLa cells were transfected with wtCFTR or with the mutants. Analysis
of whole cell cAMP-stimulated chloride currents showed that these
lysine mutations altered wild-type ion selectivity from
Br The results from our studies suggest that regions of the second half of
CFTR may line the channel pore and have important contributions to its
chloride channel function, whereas the selectivity filter of CFTR is
provided by charged residues on the sixth transmembrane segment (M6) of
wtCFTR. We have shown that expression of the second half of CFTR distal
to the first nucleotide binding domain generated functional chloride
channels albeit with properties distinct from that of wild-type CFTR.
RT2N2CFTR produces Cl The results summarized above suggest that the second half of CFTR has
important functions in the overall tertiary structure of the channel.
The regions of the second half distal to the second nucleotide binding
domain may also play important roles in the regulatory interactions of
CFTR with the outwardly rectifying chloride channel, the epithelial
sodium channel, and other potassium channels. Finally, the discovery of
proteins that facilitate interactions between membrane proteins via
interactions at the amino and carboxyl termini could add importance to
the second half of CFTR. There is growing evidence that proteins with
PDZ domains do interact with other ion channels (19, 20). Expression of
proteins containing these domains causes a clustering of ion channels
and receptors at the plasma membrane. For instance, coexpression of
PSD-95 (a PDZ domain-containing protein) results in clustering of
voltage gated K+ channels and
N-methyl-D-aspartate receptors at the plasma
membrane (19). The PSD-95 protein recognizes a specific sequence
present at both the carboxyl termini of the Shaker voltage gated
K+ channel and the NR2 subunit of the
N-methyl-D-aspartate receptor. Similar domains
have also been identified recently for CFTR (21). Furthermore, several
such proteins have been discovered that interact with the
carboxyl-terminal of CFTR, rendering this region of the protein to be
of greater importance than previously thought
(21-23).2
*
This work was supported by the Cystic Fibrosis Foundation
Research Development Program and National Institutes of Health Grants HL 51811, HL 47122, and DK 48977 (to W. B. G.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
CF, cystic fibrosis; CFTR, CF transmembrane conductance regulator; TMD, transmembrane
domain; NBD, nucleotide binding domain; R, regulatory; wt, wild-type; DIDS, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid.
2
J. Cheng, personal communication.
The Second Half of the Cystic Fibrosis Transmembrane Conductance
Regulator Forms a Functional Chloride Channel*
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
> I. However, both constructs displayed
single-channel conductances that were significantly smaller than those
displayed by the first half of the CFTR. We conclude that regions of
the second transmembrane domain may contribute to the overall channel
of the pore, although the first half of the CFTR may confer its selectivity.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
transport is
defective in CF,1 and 6 years
later, cloning of the CF gene and subsequent studies showed that CFTR
is indeed a chloride channel (1, 2) with a linear current
versus voltage (I/V) relationship and a 9-11-pS single-channel conductance. The selectivity of the channel is Br > Cl > I > F. Subsequent to the cloning of the CF gene, many
investigators have used site-directed mutagenesis to create CFTR
cDNAs containing both naturally occurring and artificial mutations.
Studies on the consequences of these mutations have shaped our thinking
about the structure and function of the protein. For example, a mutant CFTR (TNRCFTR) composed of the first transmembrane domain, the first
nucleotide binding domain, and the R domain can form a functional chloride channel with characteristics approaching that of wtCFTR (3,
4). An additional construct composed of only the first six
transmembrane-spanning segments of TMD1 also forms an ion channel with
selectivity and single-channel conductance identical to that of
wild-type CFTR (5). We have previously shown (6) that the ion
selectivity and single-channel conductance of 
259 CFTR, which
contains membrane-spanning segments M5, M6, and the second half of the
CFTR, are identical to those of wild-type CFTR. These studies suggest
that the major structural components that allow the CFTR to select
among different anions reside within TMD1, more specifically, distal to
transmembrane segment M4.
conduction.
View larger version (14K):
[in a new window]
Fig. 1.
Generation of cDNA constructs.
Schematic illustrations of the truncations made to the CFTR cDNA.
The representation is based on the putative model for wtCFTR (22). Each
vertical bar represents an individual transmembrane segment,
whereas straight lines are the intra- or extracytosolic
loops. Larger rectangles represent the nucleotide binding
domains (NBD1 and NBD2), and the oval represents the R
domain. M1 is the first functional Kozak methionine used for
translation initiation. The first 160 bases of wtCFTR were added to the
second-half deletion constructs to include the first Kozak methionine
to facilitate translation initiation.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
40 mV
using a two-electrode voltage clamp amplifier (AXOCLAMP-2A; Axon
Instruments). The voltage protocol used consisted of voltage steps
ranging from 80 to +60 mV in increments of 20 mV delivered from a
Pentium 133 MHz computer. Data were analyzed using PClamp 6.03 software
(Axon Instruments). Experiments were performed at room temperature. The
cAMP stimulation mixture consisting of 10 µM forskolin
and 1 mM 3-isobutyl-1-methylxanthine was added after
recording the baseline current. Ten to 15 min after the addition of the
mixture, currents were recorded again to measure channel activity.
Efflux Assay--
Cells were
seeded at 30-50% confluence and transfected as described previously
(5). Cells were washed three times with Ca2+Mg2+-free phosphate-buffered saline (Life
Technologies, Inc.) to remove serum. Thirty µl of
36Cl solution (DuPont New England Nuclear; 1 mCi/ml) were diluted in 9 ml of Ringer's solution, and 1.5 ml of this
loading solution were added to each well of a 6-well plate. The plate
was incubated for 2-3 h in a 37 °C room. The Ringer's solution for
these experiments was a standard HCO3-free,
HEPES- and phosphate-buffered, 140 mM NaCl Ringer solution supplemented with 5 mM glucose and titrated to pH 7.45 with
1N NaOH. All efflux runs were performed in a 37 °C room.
Each well served as its own control. At time 0, Ringer's solution
without cAMP agonists was added and removed immediately. A fresh
aliquot of Ringer's solution was added immediately after that, and the efflux run was started. This process was repeated every 15 s until the 1 min time point, at which time 750 µl of Ringer's solution with
forskolin (2.5 mM), 8-bromo-cAMP (250 mM), and
CPT-cAMP (250 mM) were added and removed every 15 s
for the remaining 2 min of the efflux run. At the end of the run, 750 µl of 0.5 N NaOH was added in two aliquots to lyse and
recover all of the cell lysate to determine how much labeled chloride
had remained in the cells, and this was used to standardize the data.
Each sample was diluted in a scintillation mixture, counted in a
scintillation counter, and normalized on a Microsoft Excel spreadsheet
as the rate of labeled chloride lost from the cells per minute.
currents exclusively. Whole cell
recording has been described in detail previously (9).
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
= 534.67 ± 39.7 nA at 60 mV (n = 8) and
II = 410.1 ± 39.7 nA at 60 mV (n = 8); Fig. 3) upon
switching to an iodide Ringer solution, consistent with the selectivity
profile demonstrated for wtCFTR (Cl > I;
Ref. 1).
View larger version (19K):
[in a new window]
Fig. 2.
Current characteristics of water-injected
oocytes. Representative two-electrode voltage clamp current
recordings of water-injected oocytes. Basal, cAMP-stimulated and
I/V current characteristics are depicted. The voltage
protocol used consisted of a stepwise depolarization, in steps of 20 mV, from 80 to +60 mV with a holding potential of 40 mV. The cAMP
stimulation mixture consisting of 10 µM forskolin and 1 mM 3-isobutyl-1-methylxanthine was added 15 min after
recording the baseline current. Average whole cell currents at +60 mV
are as follows: basal, I = 90.06 ± 6.88 nA,
n = 9; cAMP-stimulated current, I = 92.24 ± 7.44 nA, n = 9.
View larger version (22K):
[in a new window]
Fig. 3.
Current characteristics of wtCFTR-injected
oocytes. Representative two-electrode voltage clamp current
recordings of wild-type CFTR-injected oocytes. Basal, cAMP-stimulated,
and I/V current characteristics are depicted. The voltage
protocol used consisted of a stepwise depolarization, in steps of 20 mV, from 80 to +60 mV with a holding potential of 40 mV. The
outward rectification of the curves is due to the higher extracellular
concentration of chloride (121 mM) compared with that of
the inside of the oocyte (40 mM). Average whole cell
currents at +60 mV are as follows: basal, I = 115.06 ± 9.16 nA, n = 8; cAMP-stimulated current,
ICl = 534.67 ± 39.7 A,
n = 8; II = 410.1 ± 39.7 nA at 60 mV, n = 8.
View larger version (26K):
[in a new window]
Fig. 4.
Current characteristics of RT2N2CFTR-injected
oocytes. Representative two-electrode voltage clamp current
recordings of RT2N2CFTR-injected oocytes. Basal, cAMP-stimulated, and
I/V current characteristics are depicted. The voltage
protocol used consisted of a stepwise depolarization, in steps of 20 mV, from 80 to +60 mV with a holding potential of 40 mV. Average
whole cell currents at +60 mV are as follows: basal, I = 470.52 ± 84.51 nA, n = 9; cAMP-stimulated
current, I = 676.03 ± 87 nA, n = 9. The current magnitude was unchanged upon switching to a Ringer
solution in which the predominant anion was iodide.
Cl currents in cRNA-injected oocytes
View larger version (23K):
[in a new window]
Fig. 5.
Current characteristics of T2N2CFTR-injected
oocytes. Representative two-electrode voltage clamp current
recordings of T2N2CFTR-injected oocytes. Basal, cAMP-stimulated, and
I/V current characteristics are depicted. The voltage
protocol used consisted of a stepwise depolarization, in steps of 20 mV, from 80 to +60 mV with a holding potential of 40 mV. Average
whole cell currents at +60 mV are as follows: basal, I = 86.47 ± 6.62 nA, n = 8; cAMP-stimulated
current, I = 175.38 ± 17.46 nA, n = 8.
channel functions of CFTR, paired
36Cl efflux assays without and with a cAMP
agonist mixture (2.5 µM forskolin and 250 µM 8-chlorophenylthio-cAMP or CPT-cAMP) were performed in
IB3-1 cells. IB3-1 cells are a CF bronchial epithelial cell line used
extensively to study CFTR function. The experiments were performed as
an initial screen to assess whether an individual CFTR mutant could
restore cAMP-stimulated efflux of labeled chloride. Parental IB3-1
cells and mock-transfected IB3-1 cells failed to respond to cAMP
agonists (Table II), which is typical of
CF cells. Wild-type-, 259-M265-, RT2N2CFTR-, and T2N2CFTR-
transfected cells, however, all responded to cAMP agonists as predicted
from oocyte recordings (Table II). Surprisingly, cells transfected with
T2N2CFTR also demonstrated an increase in efflux upon cAMP stimulation
that was similar to that exhibited by cells transfected with wtCFTR.
This could be attributed to a larger number of channels being formed on
the plasma membrane.
Cl efflux analysis in IB3-1 cells
efflux of labeled chloride from IB3-1 CF cells
is shown. The before agonists value is the rate of
36Cl efflux immediately before stimulation with cAMP
agonists (2.5 µM forskolin and 250 µM
CPT-cAMP). The after agonists value is the peak stimulated rate after
the addition of cAMP agonists.
channel function of wild-type CFTR and the
second-half mutants in IB3-1 cells, a CF cell line. Mock-transfected
cells failed to exhibit cAMP-stimulated chloride currents (Fig.
6A). However, cells
transfected with wtCFTR exhibited cAMP-stimulated currents that were
DIDS insensitive (Fig. 6B). Cells transfected with RT2N2CFTR exhibited a larger baseline compared with those transfected with wtCFTR. When stimulated, RT2N2CFTR-transfected cells generated currents
comparable to those of wtCFTR-transfected cells (Fig. 6C).
On the other hand, cells transfected with T2N2CFTR exhibited a small
baseline current comparable to that of wtCFTR-transfected cells and
were stimulated to a smaller extent upon the addition of cAMP agonists
(Fig. 6D). Single-channel analysis of the mutant constructs
in excised inside-out patches also revealed chloride channels with
significantly smaller conductances than that of wtCFTR (Table
III; Fig.
7), whereas wtCFTR had a conductance of 10.2 pS, compared with a conductance of 4 pS for RT2N2CFTR and 3.8 pS
for T2N2CFTR. Interestingly enough, both constructs were nonselective
for the halides chloride or iodide, in contrast with wild-type CFTR,
which was more selective for chloride than iodide.
View larger version (19K):
[in a new window]
Fig. 6.
Whole cell currents of wild-type and deletion
mutants of CFTR expressed in cultured bronchial CF epithelial cells
(IB3-1). A, Mock, representative whole cell
patch-clamp recordings of the cAMP-stimulated and DIDS-insensitive
component of cAMP-stimulated Cl currents in wild-type
CFTR-transfected IB3-1 cells. A very small basal current was observed
that was not increased upon cAMP stimulation. B,
wtCFTR, representative whole cell patch-clamp recordings of
the cAMP-stimulated and DIDS-insensitive component of cAMP-stimulated
Cl currents in wild-type CFTR-transfected IB3-1 cells
(n = 5). cDNA constructs were transfected
transiently into IB3-1 CF cells and studied in physiological assays
72 h after transfection in comparison with wild-type CFTR,
mock-transfected cells, and parental IB3-1 cells. DIDS (500 µM) inhibited the outwardly rectifying current, whereas
the remaining, underlying linear current (CFTR current) was unaffected
(100 to +100 mV in 20-mV increments from a holding voltage of 0 mV).
C, RT2N2CFTR, typical whole cell patch-clamp
recordings of cAMP-stimulated DIDS inhibition of cAMP-stimulated
Cl currents from a RT2N2CFTR-transfected cell
(n = 5). D, T2N2CFTR,
representative whole cell patch-clamp recordings of a
cAMP-T2N2CFTR-transfected cell (n = 5); DIDS (500 µM) failed to inhibit the current observed, indicating
that the linear current was due exclusively to the CFTR channel
activity.
Single-channel characteristics of the second-half of CFTR in IB3-1
CF cells
View larger version (15K):
[in a new window]
Fig. 7.
Single-channel current characteristics of
wild-type CFTR and deletions in IB3-1 cells. Representative
single-channel traces from an excised, inside-out membrane patch from
IB3-1 cells transfected with either mock, wtCFTR, RT2N2CFTR, or
T2N2CFTR. Downward deflections indicate channel openings. The holding
potential Vm was 75 mV. Catalytic subunits of protein
kinase A (75 nM; Promega) and Mg-ATP (1 mM;
Sigma) were added to the cytoplasmic face of excised patches to
activate the channel.
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
channel pore
but not the conduction of anions through the pore. Siebert et
al. (16) conducted similar experiments on the third intracellular
loop of CFTR and concluded that this region may be involved in
maintaining the stability of the channel in the open state.
> Cl > I > F to I > Br > Cl > F. In contrast, the mutation of
Arg347 in M6 and Arg1030 in M10 did not induce
major differences in halide selectivity compared with wtCFTR. From
these data, they concluded that the residues in TMD1 play an important
role in the selectivity filter of the CFTR.
currents that are stimulated by
cAMP. On the other hand, T2N2CFTR generated a smaller increase in
current upon cAMP stimulation. This could be due to the fact that
T2N2CFTR has no consensus phosphorylation sites, whereas RT2N2CFTR
retains most of the phosphorylation sites that lie in the R domain. In
the case of the wild-type protein, phosphorylation of the R domain
followed by ATP binding and hydrolysis causes the opening of the
channel. In the case of RT2N2CFTR, the R domain is unable to keep the
channel closed in the basal or unstimulated state. This could suggest
that in the absence of the first transmembrane domain and the first
nucleotide binding domain, the R domain is unable to form a regulated
channel. Furthermore, the first two domains may be necessary for the R
domain to keep the channel closed in the unstimulated state. The
observation that T2N2CFTR channels were not stimulated significantly
upon the addition of cAMP agonists is not surprising because this
construct lacks any consensus PKA phosphorylation sites. Furthermore,
NBD1 has been shown to be responsible for the opening of the channel, whereas NBD2 has been shown to be associated with channel closing. The
presence of NBD2 in this construct could also result in the longer
closure of these channels and, subsequently, a smaller stimulation of
the channels. The smaller conductance exhibited by these second-half
constructs could suggest that the overall conductance of CFTR is
provided by TMD1 and TMD2. TNRCFTR, which contains the first
transmembrane domain, the first nucleotide domain, and the R domain,
displays a conductance (8 pS) almost equal to that of wtCFTR, whereas
the second-half constructs discussed above show much smaller
conductances (RT2N2CFTR, 4 pS; T2N2CFTR, 3.8 pS). This could suggest
that the major contribution to the size of the pore comes from the
first half of the protein, whereas regions of the second half could
contribute a smaller part.
FOOTNOTES
To whom correspondence should be addressed: Dept. of Physiology
and Pediatrics, Johns Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205. Tel.: 410-955-7166; Fax: 410-955-0461;
E-mail: wguggino{at}bs.jhmi.edu.
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C. M. Lewarchik, K. W. Peters, J. Qi, and R. A. Frizzell Regulation of CFTR Trafficking by Its R Domain J. Biol. Chem., October 17, 2008; 283(42): 28401 - 28412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-R. Zhang, G. Cui, X. Liu, B. Song, D. C. Dawson, and N. A. McCarty Determination of the Functional Unit of the Cystic Fibrosis Transmembrane Conductance Regulator Chloride Channel: ONE POLYPEPTIDE FORMS ONE PORE J. Biol. Chem., January 7, 2005; 280(1): 458 - 468. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. De la Vieja, O. Dohan, O. Levy, and N. Carrasco Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology Physiol Rev, July 1, 2000; 80(3): 1083 - 1105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yue, S. Devidas, and W. B. Guggino The Two Halves of CFTR Form a Dual-pore Ion Channel J. Biol. Chem., March 31, 2000; 275(14): 10030 - 10034. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. McCarty Permeation through the CFTR chloride channel J. Exp. Biol., January 7, 2000; 203(13): 1947 - 1962. [Abstract] [PDF]
|
|
|
|
|
|
D. N. SHEPPARD and M. J. WELSH Structure and Function of the CFTR Chloride Channel Physiol Rev, January 1, 1999; 79(1): 23 - 45. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Van Oene, G. L. Lukacs, and J. M. Rommens Cystic Fibrosis Mutations Lead to Carboxyl-terminal Fragments That Highlight an Early Biogenesis Step of the Cystic Fibrosis Transmembrane Conductance Regulator J. Biol. Chem., June 23, 2000; 275(26): 19577 - 19584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Cahill, M. W. Nason Jr., C. Ambrose, T.-Y. Yao, P. Thomas, and M. E. Egan Identification of the Cystic Fibrosis Transmembrane Conductance Regulator Domains That Are Important for Interactions with ROMK2 J. Biol. Chem., May 26, 2000; 275(22): 16697 - 16701. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||