|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 45, 29481-29488, November 6, 1998
From the Laboratory of Molecular Pathology, Department of
Pathology, University of Texas Southwestern Medical Center,
Dallas, Texas 75235-9072
In eukaryotes, nucleotide excision repair (NER)
is a complex reaction requiring multiple proteins. In the yeast
Saccharomyces cerevisiae, two of these proteins, Rad7 and
Rad16, are specifically involved in the removal of lesions from
transcriptionally silent regions of the genome in vivo.
Extracts prepared from rad7 or rad16 mutant
cells are deficient, but not totally defective, in both oligonucleotide
excision and repair synthesis of damaged plasmid DNA. We show that
these extracts are, however, fully proficient in the incision step of
the NER reaction in vitro. Furthermore, using a
cdc9 mutant to trap incision intermediates, we demonstrate that rad7 and rad16 mutants are proficient in
NER-dependent DNA incision in vivo. A purified
protein complex containing both Rad7 and Rad16 proteins complements the
oligonucleotide excision and repair synthesis defects in
rad7 and rad16 mutant extracts. We conclude
that the products of the RAD7 and RAD16 genes
are involved in a postincision event(s) during NER in yeast.
The yeast RAD7 and RAD16 genes belong to the
RAD3 epistasis group of DNA damage-responsive genes (1, 2).
This epistasis group includes genes required for nucleotide excision
repair (NER)1 of DNA, a
process by which multiple types of base damage are excised from the
genome as oligonucleotide fragments, and the resulting single strand
gaps are repaired by DNA synthesis (repair synthesis) and ligation (3).
In contrast to the extreme sensitivity to UV light (and other
DNA-damaging agents) conferred by complete inactivation of NER genes,
such as RAD1, RAD2, RAD3, RAD4, RAD10, and RAD14,
deletion of the RAD7 or RAD16 gene confers
partial UV radiation sensitivity (1, 2).
The precise role(s) of the RAD7 and RAD16 gene
products in NER is not clear. The proteins are required for NER of
transcriptionally repressed loci such as HML It has been reported that a reconstituted in vitro system
that supports damage-specific incision and oligonucleotide excision from purified plasmid DNA does not require the Rad7 and Rad16 proteins
(8). Subsequent studies (9) reported that these proteins actually
increase the efficiency of NER in vitro and offered the
suggestion that the specific role of these proteins is to facilitate
the recognition of damaged bases in nontranscribed regions of the
genome in vivo (10). Contrary to the observation that the
Rad7 and Rad16 proteins are not required for NER of plasmid DNA in a
reconstituted in vitro system, we previously reported that
they are indispensable for NER of plasmid DNA in yeast whole cell
extracts (WCEs), using an assay that measures repair synthesis of DNA
(6).
In view of the multiple and in some instances discordant roles proposed
for the RAD7 and RAD16 products during NER of
DNA, we have studied their requirement for specific events in this process in greater detail. We have investigated the possibility that
when purified plasmid DNA is incubated with yeast WCEs, the DNA is
assembled into nucleosomes. Such a result could explain the apparent
contradiction between the requirement for Rad7 and Rad16 proteins for
NER in WCEs and their dispensability in a reconstituted system using
purified proteins, and it would also be consistent with the suggestion
that the Rad7 and Rad16 proteins are required for the processing of
nucleosome structures during NER. Additionally, we have utilized both
in vitro and in vivo assays that allowed us to
independently monitor the steps of damage-specific incision, oligonucleotide excision, and repair synthesis in wild-type and rad7 and rad16 mutants.
We have found no evidence for nucleosome formation in yeast WCEs that
support robust NER of plasmid DNA. We show here that rad7
and rad16 mutants are fully proficient in damage-specific incision of DNA. In contrast, the postincision events of
oligonucleotide excision and, as previously reported, repair synthesis
(6) are severely deficient in rad7 and rad16
mutant extracts. Finally, we have purified a protein complex that
includes Rad7 and Rad16 proteins, without overexpression of these
proteins in yeast cells. This complex corrects both defective
oligonucleotide excision and repair synthesis in vitro. We
conclude that the RAD7 and RAD16 gene products
participate in postincision events during NER of transcriptionally
silent DNA. The utility of such participation may be obviated in
transcriptionally active DNA, perhaps as a direct consequence of
transcription itself.
Strains and Plasmids--
The RAD+ strain W303-B
(mata, ade2-1, trp1-1, leu2-3, 112, his3-11, 15, ura3-1) and the isogenic strains MGSC104
(rad7::LEU2), MGSC97
(rad7::URA3), and W303236
(rad16::URA3) were generously supplied
by Dr. Jaap Brouwer (University of Leiden, The Netherlands) (5). Other
strains used were SX46a (mata, ade2, his3-532, trp1-289, ura3-52) and its isogenic partners MGSC 139 (rad14::LEU2) and SX46a
(rad1::URA3), rad4-10
(mata, rad4-10, ade2, his3-832, trp1-289) and
KG119 (ssl2::TRP1, mata his7-2,
leu2-3, 112, ura3-52, trp1-289). Strain LP2915-8D
(cdc9-2, mata, his3-200, lys2-1, met15-3, trp1-289,
ura3-52) was used to examine DNA incision in vivo.
Strain LP2915-8D rad2::TRP was
generated by transforming LP2915-8D with SalI-digested
pWS521. This plasmid was derived from pWS519 containing the
RAD2 gene and flanking sequences. Plasmid pWS519 was cut
with HpaI-NdeI, thereby removing the entire
RAD2 coding sequence. A BglII-EcoRI
TRPI fragment was exchanged to generate pWS520. Strain
LP2915-8D rad7::HIS3 was constructed
by transformation of the parent strain with EcoRI-digested
pRAD7::HIS3, and strain LP2915-8D
rad16::HIS3 was constructed by transformation of
the parent strain with EcoRI-BamHI-digested
prad16::HIS3.
In Vitro NER--
Yeast WCEs capable of supporting NER were
prepared as described previously (11). NER was monitored by measuring
DNA repair synthesis in pUC18 containing
N-acetyl-2-aminofluorene (AAF) adducts. AAF-modified DNA was
prepared by treating pUC18 with AAF and purifying the DNA on a 5-20%
sucrose gradient as described (12). Plasmid DNA was recovered from
extracts by restricting with HindIII enzyme, which
linearizes the substrate and reveals a discrete band in a 1% agarose
gel. To detect damage-specific incision, plasmid DNA was recovered from
WCEs and electrophoresed through agarose without prior
HindIII restriction. Undamaged plasmid DNA was analyzed similarly in independent incubations. In the standard NER assay, which
measures repair synthesis, an undamaged DNA template is used as an
internal control. Background incorporation of radioactivity (typically
~5% of that in the damaged plasmid) is subtracted from that
incorporated in the damaged template. The DNA incision assay precludes
the use of a quantitative internal control because a single nick
changes the topology of the form I DNA. DNA was visualized in gels
under UV light following staining with ethidium bromide. Repair
synthesis was detected by autoradiography of dried agarose gels and
quantitated by phosphorimaging as described (6).
Excision Repair Assay--
An oligonucleotide of known sequence
(5'-TATGATTGGGGATAAGAT*TG-3') containing a single cyclobutane
pyrimidine dimer near the 3'-end was kindly prepared by Dr.
John-Stephen Taylor (Washington University, St. Louis, MO) (13, 14).
Plasmid substrates containing these oligonucleotides were constructed
as described (15, 16). Yeast WCEs were prepared and repair reactions
were performed as described (17). Following the reactions, radiolabeled
excision products were resolved on 10% polyacrylamide sequencing gels
and analyzed by autoradiography.
In Vivo Incision of DNA at the HML Construction of His-tagged RAD7 Strain--
A 6-His-tagged
RAD7 strain was constructed with the RAD7 gene
expressed from its own promoter on a centromeric plasmid. This strain
was derived from strain YPH/TFB1:6-His (22), in which the deleted
chromosomal TFB1 gene was replaced with the LEU2
marker. The strain carries a 6-His-tagged TFB1 gene driven
by its own promoter on a centromeric vector. The chromosomal
RAD7 gene was deleted using the one-step disruption
technique (23). Strain YPH/TFB1:6-His was transformed with
EcoRI-digested prad7::HIS. This plasmid was
constructed by digesting prad7::LEU2 (5) with KpnI
and HindIII, blunting the ends by filling in, and replacing the LEU2 gene with a 1.8-kb BamHI fragment
containing HIS3. Generation of the strain YPH/TFB1:6-His,
rad7 was confirmed by Southern analysis. Additionally, survival studies
revealed a level of UV radiation sensitivity consistent with that
expected for rad7 mutants. The centromeric plasmid pRS314,
containing an untagged copy of TFB1 and the TRP1
marker (provided by Dr. W. John Feaver), was used to clone a
6-His-tagged RAD7 gene. This construct was introduced into
strain YPH/TFB1:6-His, rad7. The 6-His-tagged RAD7 insert was generated by PCR. In addition to the RAD7 coding
sequence, the insert includes the promoter region for RAD7.
The 6-His tag was generated at the C terminus of the protein by
including codons for histidine in the downstream primer immediately
prior to the stop codon. Both primers included BamHI sites
at their 5'-ends to facilitate cloning of the PCR-generated product
into the BamHI site of the pRS314-TFB1
vector. The sequence of the primers was as follows: upstream primer,
5'ATATGGATCCTTTCTCCCCGACGATATAGGAATC 3'; downstream primer,
5'ATATGGATCCTTAGTGATGGTGATGGTGATGTATACTGTCACTCTGTCTCCCTAT3'. The
2.2-kb PCR product was cut with BamHI and cloned into the BamHI site of pRS314-TFB1-TRP1. Following cloning, the
insert was sequenced to confirm the RAD7 sequence and the
in-frame addition of the 6-His-tag. Transformation of strain
YPH/TFB1:6-His, rad7 with pRS314-TFB1, RAD7:6-His
resulted in complementation of UV radiation sensitivity. An untagged
RAD7 strain was constructed in the same fashion. During
final transformations, plasmid shuffling was employed to remove the
6-His-tagged TFB1:URA3 plasmid.
Production of RAD7 and RAD16 Antibodies--
The RAD7
gene was isolated from pAS1-CYH2RAD7 and cloned into the
NcoI/SalI site of pGEX-KG, creating an in-frame
RAD7-glutathione S-transferase fusion gene (6). A
0.6-kb internal fragment of RAD16 that encodes 192 amino
acids (from amino acids 475-667) was generated by PCR using the
following primers: upstream primer, 5'CATGCCATGGATCTTTACAGAAGT3';
downstream primer, 5'CCTGAAGCTTCACTGTTTGAA3'. The upstream primer
included an NcoI site, whereas the downstream primer
included a HindIII site to facilitate cloning of the PCR product in-frame into the pGEX-KG vector and allow expression of
glutathione S-transferase-RAD16 fusion protein. E. coli DH5 Purification of a Protein Complex Containing Rad7 and Rad16
Proteins--
A 10-liter culture of strain YPH/RAD7:6-His
was grown in YPD medium until the cell density reached 108
cells/ml. Cell paste (~100 g) was recovered following centrifugation. Cells were washed at 4 °C, and all manipulations from this point were at 4 °C. Cells were resuspended in 200 ml of extraction Buffer A (40 mM Hepes, pH 7.3, 350 mM NaCl, 0.1%
Tween 20, 10% glycerol, pepstatin A (2 µg/ml), leupeptin (2 µg/ml), 1 mM phenylmethylsulfonyl fluoride, 0.097 units
of trypsin inhibitor/ml of aprotinin). The cell suspension (300 ml) was
disrupted in a Biospec bead beater apparatus using Zirconium beads (0.5 mm). Cells were disrupted with 20 cycles of agitation and intermittent
cooling. After washing the beads, the extract (300 ml) was clarified by
centrifugation at 100,000 × g for 80 min and mixed
with 10 ml of Sepharose CL-6B (Amersham Pharmacia Biotech) equilibrated
with Buffer A. The mixture was rocked for 15 min and then centrifuged
twice at 1000 × g for 10 min to remove the resin.
Unbound protein was added batchwise to 10 ml
Ni2+-nitriloacetic acid agarose (Qiagen, Chatsworth, CA)
for 3 h at 4 °C. The suspension was transferred to a glass
column (1.5 × 20 cm). The flow-through was collected, and the
column was washed with 50 ml of Buffer A supplemented with 1 mM Analysis of Nucleosome Formation during Incubation of Plasmid DNA
in NER-proficient Extracts--
In view of the notion that the
RAD7 and RAD16 gene products may be required for
the processing of chromatin during NER (4), we considered the
possibility that chromatin or some other higher ordered DNA structure
is generated during incubation of WCEs with purified plasmid DNA. We
harvested plasmid DNA following incubation with yeast WCEs known to
support robust NER and digested it with micrococcal nuclease. This
enzyme cleaves nucleosomal DNA in linker regions, yielding a
characteristic ladder of oligonucleosome fragments (25). In control
experiments, we demonstrated efficient nucleosome formation following
incubation of damaged plasmid DNA with Xenopus oocyte
extracts (data not shown). However, we failed to observe a nucleosomal
ladder in plasmid DNA incubated in yeast WCEs following mild
micrococcal nuclease digestion conditions (data not shown). Hence,
there is no evidence of nucleosome formation on the input plasmid DNA
in these yeast WCEs.
DNA Incision in RAD+ and rad Mutant Extracts--
In
an effort to identify a specific molecular defect in rad7
and rad16 mutants, we next examined individual steps in the
NER reaction in yeast WCEs. We analyzed damage-specific incision of plasmid DNA in RAD+ and in rad7,
rad16, rad14, rad4, and ssl2 mutant extracts by monitoring the conversion of AAF-damaged form I DNA to the relaxed state. Extracts of the latter three mutants are known to be totally defective in damage-specific incision of DNA in vitro (8). When covalently closed circular (form I) AAF-treated plasmid DNA (Fig.
3A, lane 1) was incubated with
250 µg of WCEs prepared from RAD+ strains, the DNA was
converted to the relaxed state (form II) within 2 min of incubation
(Fig. 3A, lanes 2-5), indicating incision of the DNA. When
these experiments were repeated using a 10-fold reduced concentration
of extract (25 µg of protein), subsaturating conditions were
achieved, and only partial conversion of form I to form II DNA was
observed at 2 min (Fig. 3B). As anticipated, when damaged
plasmid DNA was incubated with extracts from the incision-defective
rad14, rad4 or ssl2 mutants, the DNA remained in
the form I state (Fig. 4A, lanes
4-6). In contrast, incubation with 250 µg of protein (Fig.
5A) or subsaturating amounts
of protein (25 µg) (Fig. 5B) from a rad7 mutant
resulted in identical kinetics of conversion of form I to form II DNA
as observed with the RAD+ strain (Fig. 3, A and
B). This result was confirmed in a direct comparison of
wild-type, rad7, rad16, and various NER-defective mutants (Fig. 4A). The same results were obtained with
rad16 mutant extracts (data not shown). Thus,
rad7 and rad16 mutant extracts are as active as
wild-type extracts with respect to damage-specific incision of DNA.
Analysis of radiolabel incorporated by repair synthesis during
incubation with wild-type (RAD+) extracts revealed
increasing incorporation over a 2-h period in both form II DNA and in
various topoisomers (Fig. 3C). The difference in the
kinetics of repair synthesis and DNA incision reflects the fact that
just a single nick in the form I substrate DNA converts it to the form
II state, whereas the detection of radioactivity incorporated during
repair synthesis is significantly less sensitive. Only background
levels of repair synthesis were observed with extracts of
rad4, rad14, and ssl2 mutants (Fig. 4B, lanes 4-6). Consistent with the results of previous
studies (6), extracts of both rad7 and rad16
mutants supported markedly reduced (but clearly detectable) levels of
repair synthesis in form II DNA (Figs. 4B and
5C). We have previously shown that the level of repair
synthesis does not increase as a function of increasing the amount of
WCEs (10). Hence, this observation is not the result of suboptimal
incubation conditions. Furthermore, defective repair synthesis can be
fully corrected by mixing rad7 or rad16 mutant
extracts with extracts from other NER-defective mutants, such as
rad14 or rad2 (10). Thus, the extracts are not
nonspecifically inactivated for repair synthesis.
Conversion of form I to form II DNA was also observed when purified
form I plasmid DNA not treated with AAF was incubated with extracts of
RAD+ strains (data not shown). Our conclusion that the
conversion of AAF-treated DNA to form II reflects damage-specific
incision derives from the observation that such conversion was not
observed in extracts of rad4, rad14, or ssl2
NER-defective mutants (Fig. 4A). It is well documented that
"untreated" plasmid DNA contains background levels of base damage,
typically oxidative damage, generated during purification of the DNA
(26, 27). Because "native" DNA prepared under the most careful
conditions is subject to such perturbations (26, 27), investigators
wishing to avoid subtle topological changes in DNA and/or chromatin
substrates during incubations in vitro should consider using
extracts derived from cells that are defective in NER.
In summary, the results of the experiments described above indicate
that rad7 and rad16 mutants are indeed defective
in NER in yeast WCEs. However, this defect is not at the level of DNA incision, but in some postincision event(s).
rad7 and rad16 Mutants Are Proficient in Incision In Vivo--
A
number of in vivo studies have demonstrated that NER
measured by the specific loss of pyrimidine dimers from the
heterochromatic HML
In order to facilitate the persistence of nicks associated with
defective NER at a step following DNA incision, we utilized strains
conditionally defective in the CDC9 gene, which encodes DNA
ligase I (29). Fig. 6 shows the effect of
the cdc9 ts mutation on NER at the MAT rad7 and rad16 Mutant Strains Are Defective in Oligonucleotide
Excision in Vitro--
Because rad7 and rad16
mutant extracts are proficient in DNA incision but defective in repair
synthesis (6), we examined their ability to support the excision of
oligonucleotide fragments generated by the bimodal incision reaction
during NER. For these studies, we utilized a plasmid carrying a single
pyrimidine dimer at a defined site on one of the DNA strands. The
plasmid was radiolabeled close to the site of the dimer (see under
"Materials and Methods"). Incubation of the plasmid with extracts
of RAD+ cells resulted in the release of radiolabeled
oligonucleotide fragments of the expected size (~30 nucleotides)
(Fig. 7, lane 5). No excision
was detected in extracts of rad1 and rad14 mutant strains (Fig. 7, lanes 1 and 2), consistent with
the fact that these extracts do not support any damage-specific
incision of DNA. Significantly reduced but clearly detectable
oligonucleotide excision was observed in rad7 and
rad16 mutant extracts (Fig. 7, lanes 3 and
4). Because these extracts are proficient for incision of
damaged DNA, we conclude that as is the case in vivo (see
above), incisions generated in vitro in rad7 and
rad16 extracts are rapidly religated.
Complementation of Defective Repair Synthesis and Oligonucleotide
Excision in rad7 and rad16 Mutant Extracts--
Previous studies have
demonstrated that the Rad7 and Rad16 proteins are stably associated
in vivo and in vitro (6, 9). In order to avoid
possible artifacts in the subunit composition of a complex that
includes Rad7 and Rad16 proteins following overexpression of these
proteins in yeast, we purified such a complex from a strain expressing
endogenous Rad16 protein and His6-tagged Rad7 protein
expressed from its normal promoter on a single copy plasmid. Rad7 and
Rad16 proteins co-eluted through multiple distinct chromatographic steps (Fig. 2). We obtained ~30,000-fold enrichment of a
Rad7/Rad16-containing complex with ~20% yield. Peak fractions from
the final purification step (glycerol gradient sedimentation) (Fig. 2)
coincided with a peak of activity that complemented defective repair
synthesis in extracts of a rad7, rad16 double mutant (Figs.
2E and 8A). Addition of increasing amounts of
this fraction resulted in increasing complementation of defective
repair synthesis in rad7 and rad16 extracts (Fig.
8B, lanes 6-8 and
9-11, respectively) but had no effect on defective repair
synthesis in rad2 mutant extracts (Fig. 8B, lanes
12-14). It should be noted that once again rad7 (Fig. 8B, lane 3) and rad16 (data not shown) mutant
extracts showed residual capacity for repair synthesis compared with
rad2 mutant extracts (Fig. 8B, lane 2) and that
mixing rad7 and rad2 mutant extracts restored
repair synthesis (Fig. 8B, lane 4). Complementation of
defective oligonucleotide excision by the purified
Rad7/Rad16-containing complex was also observed (data not shown).
Studies on NER in yeast have led to the definition of distinct
subpathways of this process (30). Global genome repair is a process
that operates on transcriptionally silent DNA, including the
nontranscribed strands of transcriptionally active genes. Transcription-coupled repair is a process that operates exclusively on
the transcribed strands of transcriptionally active genes (30). Although the two processes utilize the same general NER machinery, specific additional gene products have been implicated for each subpathway. The Rad7 and Rad16 proteins are implicated in the global
subpathway because rad7 and rad16 mutants are
defective in the removal of pyrimidine dimers from nontranscribed
regions of the genome in vivo, whereas transcription-coupled
repair operates normally in such strains (5). Similarly, the RAD26 gene
product is implicated in transcription-coupled NER, because
rad26 mutants are defective in this process but not in
global genome repair (30).
The observation that rad7 and rad16 mutants are
defective in NER of the transcriptionally repressed HML We previously reported a requirement for the Rad7 and Rad16 proteins
for normal levels of repair synthesis of naked plasmid DNA in WCEs
under conditions that are independent of RNA polymerase II
transcription (6). In contrast, it has been reported that in a
reconstituted system using purified NER proteins (also independent of
transcription), both DNA incision and oligonucleotide excision transpire in the absence of Rad7 and Rad16 proteins (8), and that these
proteins actually increase the efficiency of the recognition of base
damage during NER (9). We were therefore led to examine NER in
rad7 and rad16 mutant strains more closely. We
investigated two possible explanations for defective repair synthesis
in WCEs. First, we considered the possibility that following the
addition of naked plasmid DNA to yeast WCEs, the DNA is assembled into chromatin, the processing of which specifically requires the Rad7 and
Rad16 proteins during NER. Hence, defective repair synthesis in WCEs
would reflect a defect in NER of chromatin that is obviated in a system
reconstituted with purified proteins and naked DNA. However, the
present studies provide no evidence for nucleosome assembly on plasmid
DNA during incubation with yeast WCEs. This is not surprising, because
it is well established that efficient nucleosome assembly is achieved
with extracts from Xenopus oocytes or Drosophila
embryos, which are highly enriched for histones (32), but not in yeast
or human extracts. Indeed, this property of human extracts has been
exploited to demonstrate a requirement for a distinct protein complex
termed chromatin assembly factor 1 for efficient nucleosome assembly
following repair synthesis in vitro (33). A similar protein
complex encoded by the chromatin assembly complex genes has been
identified in yeast (34).
A second possibility was that the Rad7 and Rad16 proteins may be
involved in a specific stage of NER that precedes repair synthesis of
DNA. We dissected the NER reaction using independent assays to examine
individual events in this process. Extracts from rad7 or
rad16 mutants are fully proficient in the incision of
damaged DNA compared with wild-type strains. As already indicated, previous studies have shown that DNA incision (and oligonucleotide excision) can take place in a reconstituted in vitro system
without added Rad7 and Rad16 protein (8). However, these studies did not exclude the possibility that such proteins may have been present as
contaminants. Hence, the present studies provide a direct demonstration that rad7 and rad16 mutant extracts are
proficient for DNA incision in vitro. This result was
corroborated in vivo using a ts cdc9 mutant
strain to trap incision intermediates during NER. Our studies additionally showed that rad7 and rad16 mutants
are proficient for NER-dependent incision in regions such
as HML We confirmed an earlier observation (6) that rad7 and
rad16 WCEs are defective in the repair synthesis step of the
NER reaction. Additionally, we have provided a direct demonstration of
a defect in oligonucleotide excision of base damage in these extracts.
We have consistently observed that the defects in both oligonucleotide
excision and repair synthesis in rad7 and rad16 mutants are not as complete as those observed in incision-defective mutants, such as rad1 or rad14. This is not the
result of subsaturating reaction conditions, because previous studies
have shown that deficient repair synthesis is independent of the
protein concentration of WCEs (6). We estimate that the level of
residual excision and resynthesis in rad7 and
rad16 mutants to be ~10-20% that of wild-type levels.
This may explain the oligonucleotide excision observed in the
reconstituted NER assay in the absence of added Rad7 and Rad16 proteins
(8). Both defective repair synthesis and oligonucleotide excision can
be complemented in vitro by a purified Rad7/Rad16-containing
protein complex.
A Rad7/Rad16 complex was previously isolated from cells in which both
proteins were simultaneously overexpressed from strong promoters on
multicopy plasmids (9). In order to avoid stoichiometric artifacts that
might arise from such overexpression, including the possible exclusion
of other relevant subunits, we purified such a complex without
overexpression of Rad7 or Rad16. Preliminary analysis shows that the
complex has a molecular mass of ~250 kDa (considerably larger than
that expected for a complex with a 1:1 stoichiometry of Rad7 and Rad16
protein) and that it includes at least one polypeptide other than Rad7
or Rad16.2 A more detailed
characterization of this complex will be presented elsewhere.
In contrast to a previous suggestion (10) that the yeast Rad7 and Rad16
proteins participate in the recognition of base damage in
transcriptionally silent DNA and stimulate DNA incision at such sites,
we conclude that rad7 and rad16 mutants are
proficient in the recognition and incision of sites of base damage in
nontranscribed regions of DNA. However, such mutants cannot efficiently
execute the subsequent steps of oligonucleotide excision and repair
synthesis. Our results suggest that although the Rad7 and Rad16
proteins participate in postincision events during NER, they are not
indispensable for this process. This may explain the fact that
rad7 and rad16 mutants are only partially
sensitive to DNA-damaging agents, such as UV radiation.
The specific role(s) of Rad7 and Rad16 in oligonucleotide excision (and
possibly coupled repair synthesis) during NER of transcriptionally repressed regions of the genome and the nontranscribed strand of
transcriptionally active genes, as well as the observation that such a
role(s) is obviated during NER of the template strand of
transcriptionally active genes, remains to be explained. All known
members of the SWI/SNF superfamily of proteins are
DNA-dependent ATPases for which the DNA dependence can
vary. For example, the yeast and human SNF2 proteins (the ATPase
subunits of the SWI/SNF complex) are stimulated by synthetic DNA with
four-way junctions (31). This structure is believed to mimic crossover
points where DNA enters and exits nucleosomes (31). On the other hand,
imitation switch (ISWI) protein, the ATPase subunit of the nucleosome
remodeling factor (NURF) complex (35), has a specific requirement for
DNA in chromatin. Conceivably, the ATPase activity of Rad16 protein has
a requirement for a particular DNA conformation generated by damage
specific incision of the coding strand of transcriptionally active
genes. Once this ATPase is activated, the Rad7/Rad16-containing complex
may facilitate the remodeling of a protein-DNA structure (possibly
including the NER machinery) that is uniquely associated with NER of
transcriptionally repressed regions and the nontranscribed strand of
transcriptionally active genes. This remodeling presumably facilitates
oligonucleotide excision and repair synthesis. The dispensability of
Rad7 and Rad16 for efficient oligonucleotide excision and repair
synthesis of the template strand of transcriptionally active genes may
be a consequence of a distinct DNA conformation that derives from
transcription itself. Although our studies do not support the notion
that purified plasmid DNA is organized into nucleosomes in yeast whole
cell extracts, we cannot formally eliminate the possibility that a
requirement for Rad7 and Rad16 proteins for oligonucleotide excision
and repair synthesis during NER of plasmid DNA in such extracts
reflects the presence of other protein-DNA complexes.
It is interesting to note that whereas the majority of the polypeptides
involved in NER in yeast are highly conserved in humans, and the
essential biochemistry of global genome repair in vitro appears to be identical in yeast and human extracts, human homologs of
the yeast RAD7 and RAD16 genes have not been
identified. It remains to be determined whether this reflects subtle
differences in the biochemistry of NER and or RNA polymerase II
transcription in lower and higher eukaryotes, or whether the human
homologs have simply eluded identification to date.
We thank Dr. John-Stephen Taylor for
providing us with oligonucleotides of defined sequence bearing
pyrimidine dimers at a defined site. We also thank our laboratory
colleagues for numerous discussions and for critical review of the manuscript.
*
This study was supported by Research Grant CA12428 from the
United States Public Health Service.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
NER, nucleotide
excision repair; WCE, whole cell extract; AAF, N-acetyl-2-aminofluorene; kb, kilobase(s); PCR, polymerase
chain reaction.
2
S. H. Reed and E. C. Friedberg,
unpublished observations.
The Yeast RAD7 and RAD16 Genes Are
Required for Postincision Events during Nucleotide Excision Repair
IN VITRO AND IN VIVO STUDIES WITH
rad7 AND rad16 MUTANTS AND PURIFICATION OF A
Rad7/Rad16-CONTAINING PROTEIN COMPLEX*
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
and
HMRa in vivo (4),
and for the nontranscribed (coding) strand of transcriptionally active genes. However, unlike the other RAD genes mentioned above,
the RAD7 and RAD16 genes are not required for NER
of the transcribed (template) strand of such genes (5). The Rad7 and
Rad16 proteins have been shown to stably interact both in
vivo and in vitro (6, 9). Rad16 is a member of the
SWI2/SNF2 superfamily of proteins, several of which have been shown to
be ATPases involved in chromatin remodeling (7). This observation,
coupled with the requirement for the RAD7 and
RAD16 genes for NER of transcriptionally repressed regions
of the genome, has led to the notion that the Rad7 and Rad16 proteins
may be subunits of a complex dedicated to the perturbation of chromatin
structure in order to facilitate NER of transcriptionally silent
regions of the genome and the nontranscribed strand of transcriptionally active genes (5).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
and MAT Loci--
Yeast
strains were grown in YPD medium (yeast/peptone/dextrose) overnight at
23 °C (permissive temperature for the cdc9 mutation). All
strains were cdc9 ts and were either wild-type for NER
(RAD+) or were rad2, rad7, or
rad16 mutants. Cells were grown to mid-log phase, harvested
by centrifugation, and resuspended to a density of 2 × 107 cells/ml. Aliquots were incubated for 30 min at either
23 or 37 °C (nonpermissive temperature for cdc9). Cell
suspensions were placed in a Pyrex dish (14 × 1 cm) to a depth of
~0.3 cm to ensure uniform radiation. Dishes were shaken while cell
suspensions were irradiated at 254 nm (70 J/m2) at a dose
rate of 1 J/m2/s, using a germicidal lamp. Following
irradiation, cells were pooled and kept at 23 or 37 °C for 20 min
before harvesting. Unirradiated control samples were harvested for each
strain. Cells were lysed with zymolyase 1000T as described (18), and
DNA was isolated as described (19). Purified DNA was resuspended in 10 mM Tris-HCl (pH 7.5), 1 mM EDTA and stored at
4 °C. All procedures were carried out under safety lights to prevent
enzymatic photoreactivation of pyrimidine dimers. Analysis of DNA
incision at the MAT and HML loci was
performed by Southern blot analysis as described (20).
MAT and HML fragments were generated by
digesting genomic DNA with HaeII enzyme, which yields a
3.6-kb MAT fragment and a 4.0-kb HML
fragment. The probe was an internal fragment of the Y
region of MAT, which is strictly -specific
(see below) (21). DNA (5 µg) was restricted with HaeII and
incubated at 37 °C for 2 h. The DNA was recovered after
phenol-chloroform extraction and resuspended in 10 µl of denaturing
loading buffer (12.5% Ficoll, 5 mM EDTA, 0.125%
bromphenol blue, 0.25 M NaOH). Aliquots from each
HaeII restriction digest (with appropriate controls) were quantified by spectroscopy to ensure equal loading onto 1% alkaline agarose gels. Electrophoresis was performed overnight at 1.5 V/cm under
denaturing conditions. DNA was vacuum-blotted to Genescreen plus (NEN)
transfer membranes. The membranes were prehybridized for 1 h and
then hybridized with a specific radiolabeled probe prepared by random
primer labeling. MAT and HML bands were
visualized by autoradiography.
cells were transfected with each of the constructs,
and induction of the fusion genes was achieved by addition of 100 µM isopropyl 
-D-thiogalactopyranoside.
Both fusion proteins were insoluble in E. coli. We therefore
purified fusion proteins from inclusion bodies by affinity
chromatography on glutathione agarose as described (24). After
immobilizing fusion proteins on glutathione-agarose beads, we cleaved
at the glycine linker regions between the Rad and the glutathione
S-transferase moieties with thrombin (24) to isolate each
Rad protein. Purified full-length Rad7 and truncated Rad16 proteins
were used as antigens to generate polyclonal antisera in rabbits
(Babco). Rad7 antibodies were purified from rabbit sera using antigens
cross-linked to cyanogen bromide-activated sepharose-4B (Amersham
Pharmacia Biotech).
-mercaptoethanol (final concentration) and 10 mM imidazole. No Rad7 protein was detected by
immunoblotting in either the flow-through fractions or after washing.
His-tagged Rad7 protein was eluted from the column with Buffer A plus 1 mM -mercaptoethanol and 25, 50, or 100 mM
imidazole. The peak of both Rad7 and Rad16 proteins eluted in 25-50
mM imidazole (see Fig. 2). The strain containing the untagged RAD7 gene was subjected to the same procedure in
parallel. No binding of Rad7 (Fig. 1) or
Rad16 (data not shown) was observed in the nontagged strain. Fractions
1-6 from Ni2+-nitriloacetic acid were pooled (21 ml),
dialyzed against Buffer A with 100 mM NaCl, 1 mM dithiothreitol for 2 h, and applied to a column of
phosphocellulose (P11, Whatman, 1.5 × 8 cm; 14-ml matrix). The
column was washed and eluted with a 60-ml salt gradient (0.1-1.0
M NaCl) in Buffer A. Rad7 and Rad16 proteins co-eluted in
fractions 7-10 at 480 mM NaCl (Fig.
2). Pooled P11 fractions (8 ml) were
dialyzed against Buffer A with 0.1 M NaCl, 1 mM
dithiothreitol and fractionated on DEAE-Sephacel (Amersham Pharmacia
Biotech) (1.5 × 8 cm; 14-ml matrix). Fractions were collected
following elution with a 60-ml salt gradient from 0.1-1.0
M NaCl. Immunoblotting revealed co-fractionation of Rad7
and Rad16 proteins (Fig. 2). Peak fractions were pooled and dialyzed
and further fractionated by fast protein liquid chromatography on a
Mono-Q HR5/5 column using a 10-ml salt gradient (0.1-1.0 M
NaCl). Once again, Rad7 and Rad16 proteins co-eluted (Fig. 2). Mono-Q
fractions were pooled (1.5 ml) and concentrated in a Centricon-10
microconcentrator (Amicon) to a volume of 200 µl. This was layered on
a glycerol gradient (10-30% glycerol). The gradient was centrifuged
at 39,000 rpm for 16 h in a SW41 rotor. Fractions were collected,
and Rad7 and Rad16 proteins were shown to co-elute (Fig. 2).
View larger version (37K):
[in a new window]
Fig. 1.
Western blot analysis showing specific
binding of His-tagged Rad7 protein to the
Ni2+-nitriloacetic acid matrix. Yeast WCEs
were prepared from strains expressing the Rad7 protein with or without
a C-terminal His6 tag. Tagged Rad7 protein was eluted with
25 mM and 50 mM imidazole in Buffer A
(lanes 1 and 3, respectively). Untagged Rad7
protein was detected in the flow-through (FT) fractions
(lane 6) but not in the column wash (lane 5) or
50 or 25 mM imidazole fractions (lanes 2 and
4, respectively).
View larger version (57K):
[in a new window]
Fig. 2.
Western blot analysis showing co-purification
of Rad7 and Rad16 proteins. A, His-tagged Rad7 protein
eluted with increasing concentrations of imidazole buffer following
binding to the Ni2+-nitriloacetic acid (Ni-NTA)
matrix. The far left lane shows the absence of Rad7 protein
in extracts from an isogenic rad7 strain. No Rad7 protein
was detected in the flow-through (FT) fractions containing
His-tagged Rad7 protein (second lane from left).
However, some bound His-tagged Rad7 protein eluted in the wash
(WASH) (third lane from left).
B-E, Rad7 and Rad16 proteins co-eluted following further
purification on phosphocellulose P-11 (B), DEAE-Sephacel
(C), Mono-Q (D), and glycerol gradient
sedimentation (E).
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (40K):
[in a new window]
Fig. 3.
A, incision of DNA visualized by
ethidium bromide staining in RAD+ WCEs. Lane 1 shows the presence of negatively supercoiled (form I) DNA prior to
incubation with WCEs. Lanes 2-5 show conversion to various
topoisomers and to form II DNA following incubation with 250 µg of
RAD+ extract for 2, 20, 60, and 120 min, respectively.
B, incubation with 25 µg of RAD+ extract for
2, 20, and 40 min, respectively shows partial nicking of form I DNA at
2 min. C autoradiogram of A demonstrating repair
synthesis of DNA.
View larger version (91K):
[in a new window]
Fig. 4.
A, ethidium bromide-stained gel showing
the effect of incubating substrate DNA with wild-type and various
rad mutant extracts. Both wild-type and rad7 or
rad16 mutant extracts incise the DNA (lanes
1-3), whereas the incision-defective mutants rad4,
rad14, and ssl2 (lanes 4-6) do not.
B, autoradiogram of A. Repair synthesis was
observed in the wild-type extract (lane 1) but was defective
in the rad4, rad14, and ssl2 mutant extracts
(lanes 4-6). Extracts of rad7 and
rad16 mutants show residual repair synthesis (lanes
2 and 3).
View larger version (42K):
[in a new window]
Fig. 5.
A, DNA visualized by ethidium bromide
staining. Lane 1, form I DNA prior to incubation with WCEs.
Lanes 2-5, incubation with 250 µg of rad7
mutant extract for 2, 20, 60, and 120 min, respectively, converts form
I to form II DNA. B, incubation of rad7 mutant
extract with 25 µg of rad7 extract for 2, 20, and 40 min
shows partial conversion of form I to form II DNA at 2 min.
C, autoradiogram of A demonstrating residual
incorporation of radiolabel into the substrate DNA associated with
defective repair synthesis in rad7 mutant extracts.
locus is defective in rad7
and rad16 mutant strains (4). The results of the experiments
with WCEs described above invited the possibility that the failure to
observe a loss of UV-induced lesions from the HML locus
is similarly not the result of defective DNA incision. In wild-type
living cells, once NER is initiated at any single lesion, the entire
process is completed very rapidly. This precludes the facile detection
of DNA incisions in the overall population of substrate DNA molecules.
Hence, following UV irradiation of RAD+ cells, no
significant change in the average molecular weight of genomic DNA is
detected as a function of the time of incubation (28). Similar results
were obtained when NER was examined at the level of individual genes by
Southern hybridization with gene-specific probes (20). In such
experiments, the presence of pyrimidine dimers in a defined DNA
sequence can be detected by extracting the DNA and digesting it with
dimer-specific enzymes, such as T4 endonuclease V (20). The persistence
of dimers due to defective NER results in degradation of the DNA by the
endonuclease and loss of a hybridization signal during subsequent
Southern analysis (20). As NER approaches completion, substrate sites
for the endonuclease probe (dimers) are lost, and the hybridization
signal returns (20). However, in repair-proficient cells in which the DNA is not treated with a dimer-specific endonuclease, a hybridization signal of constant intensity is observed during the repair process (20). DNA incisions do not accumulate because the repair process at any
given site is rapidly completed.
and
HML loci in a RAD+ strain and in various
rad mutants. When a UV-irradiated RAD+,
cdc9 strain was incubated at the nonpermissive temperature (Fig. 6A), we observed a loss of both MAT and
HML signals following Southern hybridization, as expected
if incisions persisted at these loci due to a failure of DNA ligation.
No loss of signal was detected in unirradiated cells (Fig.
6A). Similarly, no loss of signal was observed at either
locus in an irradiated or unirradiated rad2, cdc9 strain,
consistent with defective incision in such a mutant. In contrast,
proficient incision was detected at both the MAT and
HML loci in rad7, cdc9 and rad16,
cdc9 strains. To demonstrate that DNA ligation is indeed defective
at the restrictive temperature, experiments were repeated at the
permissive temperature for the cdc9 mutation. No incisions
were detected in the MAT and HML loci in
any of the strains examined (Fig. 6B). These observations
indicate that incisions are generated at UV radiation-induced photoproducts at the MAT and HML loci both
in RAD+ and rad7/rad16 mutant
strains. These incisions are apparently rapidly religated under
conditions permissive for DNA ligase I activity.
View larger version (54K):
[in a new window]
Fig. 6.
A, autoradiogram demonstrating
gene-specific incision at 37 °C (nonpermissive temperature for
cdc9) following exposure of cells to UV radiation at the
MAT and HML loci. Incisions are reflected
by loss of the hybridization signal at the MAT and
HML loci in the RAD+, cdc9 and
rad7 (or rad16), cdc9 mutants. No
incisions were detected at either locus in a rad2, cdc9
mutant. Samples were loaded in pairs; one sample represents DNA from
unirradiated cells (
), and the other represents DNA from cells
irradiated with UV light (+). B, autoradiogram showing the
absence of gene-specific incision at the permissive temperature for
cdc9 (23 °C).
View larger version (37K):
[in a new window]
Fig. 7.
Oligonucleotide excision in yeast WCEs.
Reactions were with 100 ng of radiolabeled DNA and 100 µg of yeast
WCEs in a 25-µl reaction volume. Incubations were for 2 h at
25 °C. The sequencing gel shows oligonucleotide fragments (~30
nucleotides (nts) in length) excised in the presence of
wild-type (RAD+) extract (lane 5). No excision
products were observed in the rad1 and rad14
extracts (lanes 1 and 2), and markedly reduced
levels of excision were observed in extracts of rad16 and
rad7 mutants (lanes 3 and 4).
View larger version (40K):
[in a new window]
Fig. 8.
A, in vitro complementation of repair
synthesis in WCEs from a rad7, rad16 double mutant. Peak
activity was observed in fraction 18. Reactions were performed using
5-µl aliquots from each fraction (50 ng of protein in fraction 18).
B, in vitro NER was performed using standard conditions with
the various yeast WCEs indicated. Normal repair synthesis was observed
in wild-type extracts (lane 1), and defective repair
synthesis was observed in rad2 mutant extracts (lane
2). Residual repair synthesis was observed in rad7
(lane 3) extracts. Lane 4, complementation of
repair synthesis by mixing rad2 and rad7
extracts. Complementation of repair synthesis was observed by addition
of increasing amounts of purified Rad7/Rad16-containing complex (5, 50, and 75 ng or protein) in rad7 (lanes 6-8) and
rad16 (lanes 9-11) extracts but not in
rad2 (lanes 12-14) extracts.
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
locus but not the homologous transcriptionally active MAT
locus led to the suggestion that the Rad7 and Rad16 proteins
participate in global genome repair by contributing to disruption of
heterochromatic regions in order to allow access of the repair
machinery to sites of base damage (4). This model has been indirectly
reinforced by the observation that Rad16 protein is a member of the
SWI2/SNF2 superfamily of DNA-dependent ATPases (7), a
number of which are known subunits of chromatin remodeling complexes
(31).
, which were previously thought to be refractory to
the NER machinery.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Dept. of Pathology,
University of Texas Southwestern Medical Center, 5323 Harry Hines
Blvd., Dallas, Texas 75235-9072. Tel.: 214-648-4020; Fax: 214-648-4067; E-mail, friedberg.errol{at}pathology.swmed.edu.
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Yu, J. B. Smirnova, E. C. Friedberg, B. Stillman, M. Akiyama, T. Owen-Hughes, R. Waters, and S. H. Reed ABF1-binding Sites Promote Efficient Global Genome Nucleotide Excision Repair J. Biol. Chem., January 9, 2009; 284(2): 966 - 973. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Gonzalez-Barrera, F. Prado, R. Verhage, J. Brouwer, and A. Aguilera Defective nucleotide excision repair in yeast hpr1 and tho2 mutants Nucleic Acids Res., May 15, 2002; 30(10): 2193 - 2201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Friedberg Nucleotide Excision Repair and Cancer Predisposition : A Journey from Man to Yeast to Mice Am. J. Pathol., September 1, 2000; 157(3): 693 - 701. [Full Text] [PDF]
|
|
|
|
|
|
W. J. Feaver, W. Huang, O. Gileadi, L. Myers, C. M. Gustafsson, R. D. Kornberg, and E. C. Friedberg Subunit Interactions in Yeast Transcription/Repair Factor TFIIH. REQUIREMENT FOR Tfb3 SUBUNIT IN NUCLEOTIDE EXCISION REPAIR J. Biol. Chem., February 25, 2000; 275(8): 5941 - 5946. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Araújo, F. Tirode, F. Coin, H. Pospiech, J. E. Syväoja, M. Stucki, U. Hübscher, J.-M. Egly, and R. D. Wood Nucleotide excision repair of DNA with recombinant human proteins: definition of the minimal set of factors, active forms of TFIIH, and modulation by CAK Genes & Dev., February 1, 2000; 14(3): 349 - 359. [Abstract] [Full Text]
|
|
|
|
 |
|
 T.J. BEGLEY, S.A. JELINSKY, and L.D. SAMSON Complex Transcriptional Responses to Macromolecular Damaging Agents: Regulatory Responses Specific for SN2 Alkylation and the MAG1 Gene Cold Spring Harb Symp Quant Biol, January 1, 2000; 65(0): 383 - 394. [Abstract] [PDF]
|
|
|
|
|
|
S. H. Reed, M. Akiyama, B. Stillman, and E. C. Friedberg Yeast autonomously replicating sequence binding factor is involved in nucleotide excision repair Genes & Dev., December 1, 1999; 13(23): 3052 - 3058. [Abstract] [Full Text]
|
|
|
|
|
|
S. N. Guzder, P. Sung, L. Prakash, and S. Prakash Synergistic Interaction between Yeast Nucleotide Excision Repair Factors NEF2 and NEF4 in the Binding of Ultraviolet-damaged DNA J. Biol. Chem., August 20, 1999; 274(34): 24257 - 24262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Rodriguez, J. Talamantez, W. Huang, S. H. Reed, Z. Wang, L. Chen, W. J. Feaver, E. C. Friedberg, and A. E. Tomkinson Affinity Purification and Partial Characterization of a Yeast Multiprotein Complex for Nucleotide Excision Repair Using Histidine-tagged Rad14 Protein J. Biol. Chem., December 18, 1998; 273(51): 34180 - 34189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wakasugi, M. Shimizu, H. Morioka, S. Linn, O. Nikaido, and T. Matsunaga Damaged DNA-binding Protein DDB Stimulates the Excision of Cyclobutane Pyrimidine Dimers in Vitro in Concert with XPA and Replication Protein A J. Biol. Chem., April 27, 2001; 276(18): 15434 - 15440. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |