 |
INTRODUCTION |
L-Fucose (6-deoxy-L-galactose) is an
important sugar in complex carbohydrates and is frequently found at the
non-reducing end of the oligosaccharide chains (1). Frequently,
L-fucose mediates the recognition reactions that are
typical of various glycoproteins and glycolipids (2, 3). Thus,
oligosaccharides with 
1,2-linked fucose are precursors for the blood
group A and B substances (4). In the Lewis type of blood group
antigens, Gal
1,3(Fuc1,4)GlcNAc-R and
Fuc1,2Gal1,3(Fuc1,4)GlcNAc-R, are the determinants for
Lewisa and Lewisb (5, 6). Another fucosylated
oligosaccharide, i.e. Gal1,4(Fuc1,3)GlcNAc-R, is
called the Lewisx antigen, and has been shown to be a
stage-specific embryonic antigen during development in the mouse (7).
This oligosaccharide may also be involved in cell-cell interactions
during embryogenesis (8, 9).
Fucosylated oligosaccharides with sialic acid on one terminus
have recently been demonstrated to be ligands for several members of
the selectin family of membrane receptors. In particular,
NeuAc2,3Gal1,4(Fuc1,3)GlcNAc-R, the sialyl Lewisx
antigen, is the ligand for the E and P selectins (10-13). In addition, an isomer of the sialyl Lewisx, called sialyl
Lewisa and having the structure
NeuAc2,3Gal1,3(Fuc1,4)GlcNAc-R, is also a ligand for the E
selectin (14, 15). L-Selectin also binds to sialyl
Lewisx antigen, but whether this, or some other structure,
is the natural ligand for this selectin is still not known (16).
Specific studies on structure-function of these ligands have suggested
that subtle differences in the structures of the sialyated, fucosylated
oligosaccharides affect the binding affinities of the selectins for
these molecules (17, 18).
The fucosyl donor for these fucosylated oligosaccharides is
GDP--L-fucose. The major pathway for formation of
GDP-fucose involves the oxidation-reduction and epimerization of
GDP--D-mannose to produce GDP--L-fucose
(19, 20). This pathway is present in most animal cells and tissues, as
well as in plants and microorganisms. An alternate pathway of formation
of GDP--L-fucose is present in certain mammalian
tissues, such as liver and kidney, and apparently functions as a
salvage pathway to reutilize L-fucose arising from the
turnover of glycoproteins and glycolipids (21). This pathway involves
the phosphorylation of L-fucose by a specific kinase to
form -L-fucose-1-P (22-24), and then condensation of
the L-fucose-1-P with GTP by a GDP-L-fucose
pyrophosphorylase to form GDP--L-fucose (25, 26).
In the present study, we have purified the GDP--L-fucose
pyrophosphorylase from porcine kidney, and identified the specific GFPP1 protein band using the
photoprobe
N3-GDP--L-[32P]fucose. Several
peptide sequences from this protein were used to clone the encoding
cDNA which gave high amounts of GFPP activity when expressed in a
myeloma cell line. In addition, various properties of the enzyme,
purified from kidney or obtained from the myeloma cells, have been
determined and are described in this manuscript.
| |
EXPERIMENTAL PROCEDURES |
Materials
L-[3H]Fucose-1-P was prepared from
L-[5,6-3H]fucose (40-60 Ci/mmol) using the
purified pig kidney L-fucokinase (25). The radiolabeled fucose, as well as GDP--L-[1-3H]fucose
(5-15 Ci/mmol), were purchased from NEN Life Science Products Inc.
Unlabeled sugars, sugar phosphates, and nucleoside diphosphate sugars
were obtained from Sigma. Various absorbents were obtained from the
following sources: DEAE-cellulose (DE-52) from Whatman Chemical
Separations, Inc. and Polybuffer Exchanger 94, Polybuffer 74, red-Sepharose, and phenyl-Sepharose were purchased from Sigma.
Polyethyleneimine-cellulose TLC plates, cellulose TLC plates, and
silica gel TLC plates were purchased from EM Science Inc. The following
materials were obtained from Bio-Rad: SDS, acrylamide, bisacrylamide,
hydroxylapatite, Coomassie Blue, and protein assay reagent. All other
chemicals were from reliable chemical sources, and were of the best
grade available.
GDP--L-fucose Pyrophosphorylase Assay
The pyrophosphorylase could be assayed in the forward
(i.e. formation of GDP-fucose from fucose-1-P and GTP), or
in the reverse (i.e. formation of fucose-1-P and GTP from
GDP-fucose and inorganic pyrophosphate) directions, as indicated below.
For measuring the activity in the forward direction, the incubation
mixtures contained the following components in a final volume of 50 µl: 100 mM Tris-HCl buffer, pH 7.6, 8 mM
MgCl2, 100 µM
L-[3H]fucose-1-P (40,000 cpm), 5 mM GTP, 0.5 unit of inorganic pyrophosphatase, and
different amounts of the GFPP at various stages of purification. After
an incubation at 37 oC for 5 or 10 min, the reaction was
terminated by heating the tubes in a boiling water bath for 40 s.
The reaction mixture was then applied to a column of DE-52 (about 1 ml
of resin in a Pasteur pipette), and the columns were washed with 50 mM (NH4)HCO3 to remove sugar
phosphates, and then with 200 mM
(NH4)HCO3 to elute the GDP-fucose. The
radioactivity in the various fractions was determined as a measure of
the amount of GDP-fucose formed.
The amount of product could also be determined by measuring the amount
of radioactivity that bound to DE-52 after treatment of the reaction
mixture with 2 units of alkaline phosphatase for 20 min at
37 oC. Alkaline phosphatase removes the phosphate group
from any remaining sugar phosphate but does not affect the nucleoside
diphosphate sugar that is produced in the reaction. After treatment
with phosphatase, the reaction mixtures were placed on DE-52 and the
columns were washed with 10 mM
(NH4)HCO3. The GDP-fucose was eluted from the columns as described above and the radioactivity in the eluate was determined.
In most of the experiments described in this study, pyrophosphorylase
activity was determined by measuring the formation of GDP-L-fucose (forward assay), since this assay was
considered to be more reliable. The enzyme activity,
especially with more purified enzyme fractions, could also
be determined by measuring the formation of fucose-1-P from GDP-fucose
(reverse reaction). For measuring activity in the reverse direction,
the incubation mixtures contained the following components in a final
volume of 50 µl: 100 mM Tris-HCl buffer, pH 7.4, 5 mM sodium pyrophosphate, 8 mM
MgCl2, 100 µM GDP-[3H]fucose
(10,000-15,000 cpm), and various amounts of the GFPP at different
stages of purification. Incubations were done at 37 oC for
5 min, and reactions were terminated by the addition of 0.5 ml of
ice-cold 5% trichloroacetic acid. The nucleotides were then absorbed
on to activated charcoal (150 mg/ml of Darco G-50 in water). The
suspension was vortexed vigorously, centrifuged, and the supernatant
liquid was removed and saved. The charcoal pellet was washed with 1 ml
of water and again centrifuged. The supernatant liquid from this wash
was pooled with the first supernatant liquid, and an aliquot
of the pooled fraction was counted for the determination of
radioactivity converted to [3H]fucose-1-P.
Preparation of Crude Extract
Pig kidneys were obtained from a local slaughterhouse and were
kept on ice until used. The kidneys were cut into small pieces and
homogenized in Buffer A (10 mM Tris-HCl buffer, pH 7.6, containing 1 mM -mercaptoethanol, 1 mM EDTA,
50 mM sucrose, and 1 mM phenylmethylsulfonyl fluoride) in a Waring blender for 3 to 4 min, at high speed. The homogenate was centrifuged at 12,000 × g for 20 min,
and the supernatant liquid was removed and filtered through several
layers of cheesecloth, and centrifuged at 100,000 × g
for 45 min. The supernatant liquid was removed and used as the crude extract.
Purification of the GDP--L-fucose
Pyrophosphorylase
The various steps used in the purification of the enzyme were as follows.
Step 1: Polyethylene Glycol Precipitation--
Solid
polyethylene glycol (8,000 molecular weight) was added to the crude
extract to reach a concentration of 30%. The solution was centrifuged
and the supernatant liquid was discarded. The precipitate was dissolved
in a minimal volume of Buffer A.
Step 2: Column Chromatography on DE-52--
The enzyme from step
1 was applied to a 5 × 18-cm column of DE-52 that had been
equilibrated with Buffer A. The column was then washed with Buffer A to
remove unbound protein, and the pyrophosphorylase was eluted with 1 liter of a linear gradient of 0 to 250 mM NaCl. Eight-ml
fractions were collected and the enzyme emerged between 75 and 150 mM NaCl. Active fractions were pooled and utilized in
further purification steps.
Step 3: Chromatography on Phenyl-Sepharose--
The active
fractions from the DE-52 column were pooled and brought to 60%
saturation by the addition of solid ammonium sulfate. The precipitate
was isolated by centrifugation and dissolved in Buffer A containing 1 M ammonium sulfate. This enzyme preparation was applied to
a column of phenyl-Sepharose that had been equilibrated with Buffer A,
containing 1 M ammonium sulfate. The column was eluted with
a downward linear gradient of ammonium sulfate, going from 1 M to 0 M salt concentration. The
pyrophosphorylase activity began to emerge from the column at about 0.3 M ammonium sulfate with the peak of activity eluting at 0.1 M salt. Active fractions were pooled and dialyzed against
Buffer B (10 mM sodium phosphate buffer, pH 6.8, containing
1 mM -mercaptoethanol and 50 mM sucrose).
Step 4: Chromatography on Hydroxylapatite--
The dialyzed
enzyme from the phenyl-Sepharose column was loaded onto a column of
hydroxylapatite (2 × 10 cm), that had been equilibrated with
Buffer B. The column was washed with Buffer B to remove unadsorbed
protein, and the enzyme was then eluted with a 10-200 mM
linear gradient of phosphate buffer. Fractions containing active enzyme
were pooled and concentrated to about 2 ml on the Amicon concentrator,
using a PM30 membrane.
Step 5: Gel Filtration on Sephacryl S-300--
The concentrated
enzyme from the hydroxylapatite column was applied to a column of
Sephacryl S-300 that had been equilibrated with 20 mM
Tris-HCl buffer, pH 7.6, containing 1 mM
-mercaptoethanol and 50 mM sucrose (Buffer C). The
enzyme emerged from the column in the area suggesting a molecular mass
of about 60 kDa. Active fractions were pooled, concentrated to about 5 ml on an Amicon filtration apparatus, and used in the next step.
Step 6: Chromatography on Reactive Red-Agarose--
The
concentrated fraction from the Sephacryl column was applied to a column
(2 × 10 cm) of Reactive Red-Agarose (Type 3000) that had been
equilibrated with Buffer C. The column was washed with the above
buffer, and the pyrophosphorylase was eluted with a linear gradient of
0 to 20 mM sodium pyrophosphate in Buffer C. Active
fractions were pooled, concentrated to about 5 ml, and dialyzed against
Buffer D (25 mM imidazole-HCl buffer, pH 7.4, containing 1 mM -mercaptoethanol, 1 mM EDTA, and 50 mM sucrose).
Step 7: Chromatofocusing--
The enzyme from the previous step
was applied to a 0.9 × 14-cm column of Polybuffer exchanger (PBE
94) that had been equilibrated with Buffer D. The enzyme was eluted
from the column with Polybuffer 74-HCl, pH 4.4, containing 1 mM EDTA, 1 mM -mercaptoethanol, and 50 mM sucrose. Fractions of 2 ml were collected, and
each fraction was analyzed for protein, for enzymatic activity, and for
pH. The enzyme emerged from the column at pH 6.5 to 5.5, with the peak
of activity emerging at pH 6.1 to 5.9. Active fractions were pooled,
dialyzed overnight against Buffer C, and concentrated.
A summary of the purification procedure is outlined in Table I, and the
discussion of this procedure is presented under "Results."
cDNA Libraries
Human prostate (CLONTECH, HL1140y), and
testis (Life Technologies, Inc., 10426-013) cDNA libraries, and
human prostate Marathon-Ready cDNA (CLONTECH,
7418-1) were purchased. The Epstein-Barr virus transformed B lymphocyte
line JY (27) was used to construct a cDNA library in
BluescriptII (Stratagene) according to standard protocols (28).
GDP-L-fucose Pyrophosphorylase cDNA Isolation
A PCR procedure was used to isolate GFPP clones from prostate,
testis, and B cell cDNA libraries. Purified plasmid DNA prepared from the total cDNA library or Marathon-Ready cDNA was
amplified with an amplifier set containing a GFPP primer and a vector
primer. The PCR primer set F12805+146: CAGAGCTCGGCTTACAGTCC
(nucleotides 1139-1159) with a vector-specific primer was used to
amplify the 3' end of the GFPP from all of the cDNA sources. The 5'
end of GFPP was isolated with the PCR primer set F12805
283:
AATGCAGTTTTCCCCAACTG (nucleotides 1314-1295) and a vector primer. PCR
products amplified with Taq polymerase were cloned into
pCRII and Pfu polymerase-amplified products were cloned into pCR-blunt
(Invitrogen). Both strands of at least two clones from each cDNA
source were sequenced. The primer FP-29,
TCGCAGCGATACTTCCGGAG, was used with the human Promoter Finder Walking
kit (CLONTECH, K1803-1) to isolate sequences
upstream of the GFPP coding region.
DNA Sequencing
Sequencing was performed on an ABI model 373 automated sequencer
in the Core Facilities at San Diego State University.
Northern Analysis
A probe encompassing nucleotides 170-1314 of the GFPP cDNA
was radiolabeled with [-32P]dCTP, using a random
priming kit (Boehringer Mannheim). A human multiple tissue Northern
blotII (CLONTECH 7759-1) containing poly(A) mRNA from spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes was hybridized and washed at
high stringency according to the manufacturer's protocol.
Generation of NSO Cell Line Stably Expressing GDP-fucose
Pyrophosphorylase
The murine myeloma cell line, NSO (Celltech), does not grow in
glutamine-free selection medium. NSO cells were maintained in
non-selective media: Iscove's Dulbecco's modified Eagle's medium supplemented with 10% heat inactivated dialyzed fetal bovine serum and
2 mM L-glutamine (Life Technologies, Inc.).
Selective media consisted of Iscove's modified Eagle's medium
supplemented with 10% heat inactivated fetal bovine serum and 1 × GS supplement (JRH Bioscience). Amplification media was prepared
using Iscove's modified Eagle's medium selective media, supplemented
with L-methionine sulfoximine (MSX, Sigma) at
concentrations of 20-40 µM.
The vector pEE12 was obtained from Celltech. This plasmid contains a
glutamine synthetase gene under control of SV40 early promoter.
Downstream of the SV40-GS transcription unit is the human
cytomegalovirus enhancer, promoter and 5'-untranslated region from the
major immediate early gene. The multicloning site is located directly
downstream of this sequence. The plasmid also contains ampicillin
resistance genes for maintenance in bacteria.
A 1.8-kilobase EcoRV fragment containing the entire open
reading frame of GFPP was inserted into the SmaI restriction
site of the plasmid pEE12 generating the plasmid pEE12-GFPP using
general molecular biology techniques (28). The orientation of the clone was judged to be correct by restriction mapping.
pEE12-GFPP was linearized with SalI, precipitated, and
resuspended in sterile TE at 1 µg/ml. NSO cells were grown to a
density of 8 × 105 cells/ml and 107 cells
were pelleted and washed once with cold sterile phosphate-buffered saline, and then pelleted again. The pellet was resuspended in 1 ml of
phosphate-buffered saline and stored on ice for up to 1 h prior to electroporation.
Linearized pEE12-GFPP DNA (40 µg) and 0.8 ml of the NSO cell
suspension were transferred to an electroporation cuvette and incubated
on ice for 5 min. A "gene pulser" electroporation (Bio-Rad) delivered 1500 volts, 3 microfarads to the DNA/cell suspension, and the
cuvette was incubated on ice for 5 min. The DNA/cell suspension was
diluted in non-selective media to prepare cell suspensions ranging in
density from 2.67 × 105 to 1.33 × 104 cells/ml. Cell suspensions were plated at 50 µl/well in a 96-well flat bottomed plate and incubated at
37 oC. After 24 h, 150 ml of selective media were
added and the plates were incubated until substantial cell death had
occurred and discrete colonies were apparent. Resistant colonies were
transferred to 24-well plates and assayed for GFPP activity. Positive
colonies were then gradually expanded.
Baculovirus Expression of GFPP
The GFPP coding region was amplified from a cDNA library
made from the B lymphocyte cell line JY. Pfu polymerase (Stratagene) was used with the primer sets TCAGATATCGGGGCTATGGCAGCTGCTAG and TTTGATATCTCTCTACATCAAACTGCTTTTTAAAC and the product cloned into pCR-blunt (Invitrogen). The GFPP clone was verified by sequencing both
strands. The insert was cut out with EcoR5 and transferred to the SmaI site of pVL1392 (Invitrogen). A clone containing
GFPP in the correct orientation was identified by restriction mapping. Recombinant baculovirus was generated with this clone
following the manufacturer's protocol, and tested for activity (Invitrogen).
Quantitative HPLC Assay of GFPP Activity
To quantitatively determine the expression of GFPP cDNA from
whole cell lysates, a reverse phase ion pairing HPLC method was developed that resolved GDP-fucose from GDP-mannose as well as GTP,
GDP, GMP, and guanosine. An Alltech Adsorbosphere HS C18 150 × 4.6-mm column (Alltech 28773) with a 7-µm particle size was utilized
for these assays. The elution buffers providing the best resolution
were 20 mM potassium phosphate (monobasic), 10 mM tetrapropylammonium phosphate, pH 5.0, with
H3PO4 (Buffer A) and methanol (Buffer B), using
a linear gradient of Buffer B from 1 to 20% over 20 min. NSO cells
expressing recombinant GFPP were lysed with 50 mM Tris
buffer, pH 7.5, containing 1% Triton X-100. Ten µl of this extract
were assayed in a 20-µl assay mixture consisting of 50 mM
Tris buffer, pH 7.5, 10 mM MgCl2, 10 mM [3H]GTP, 10 mM
L-fucose-1-P, and 10 milliunits of inorganic
pyrophosphatase with an incubation of 5 min at 37 oC.
Assays were quenched with methanol, and protein was removed by
centrifugation. The supernatant liquid was removed and dried under a
vacuum. The residue was dissolved in 20 µl for analysis by HPLC. The
formation of GDP-fucose was quantitated by measuring its absorbance at
260 nm and by scintillation counting of 250-µl aliquots across the
elution gradient. The assay was linear with time and protein
concentration. Negative controls included NSO cells harboring an
irrevelant construct (1,4-galactosyl transferase), or assay mixtures
in which fucose-1-P was omitted.
Characterization of the GFPP Reaction Products
The reaction products, formed in either the forward direction
(i.e. GDP--L-fucose) or the reverse direction
(i.e. GTP and L-fucose-1-P), were isolated by
chromatography on a 1 × 10-cm column of DEAE-cellulose
(HCO3
form), equilibrated with
H2O. After applying the sample, the column was washed with
H2O, and retained materials were eluted with 100 ml of a
linear gradient of 0 to 150 mM
(NH4)HCO3. Fractions were analyzed for
nucleotides by measuring the absorption at 260 nm, for radioactivity by
scintillation counting, and for 6-deoxyhexose by the cysteine-sulfuric
reaction (29). Peak fractions were pooled, concentrated on a rotary
evaporator, and (NH4)HCO3 was removed by
evaporation in the presence of triethylamine. The triethylamine was
then removed by evaporation in the presence of methanol.
The reaction products were identified by chromatography either directly
or following various treatments such as digestion with
phosphodiesterase or alkaline phosphatase, or by acid hydrolysis. Nucleotides were identified by TLC in the following systems:
polyethyleneimine plates developed in 0.2 and 0.4 M
solutions of LiCl; cellulose plates in ethanol, 1 M
ammonium acetate, pH 7.5 (7:3); or silica gel plates in ethanol, 1 M ammonium acetate, pH 5.0 (7:3). L-Fucose was
released from the nucleotide by mild acid hydrolysis (0.02 N HCl, 100 oC, 15 min) and identified by
chromatography on Whatman 3MM paper in 1-butanol/pyridine/water
(6:4:3). Sugars were detected with the silver nitrate reagent (30).
Polyacrylamide Gel Electrophoresis
Native PAGE was performed as described by Davis (31) with an 8%
gel and a discontinuous buffer system, under nondenaturing conditions.
Two samples were run in parallel, one lane was stained with Coomassie
Blue to detect protein bands; the other lane was cut into 0.5-cm
pieces and each piece was crushed in 200 µl of Buffer A
and incubated overnight in the cold to elute the enzyme. The
supernatant liquid was then assayed for enzymatic activity.
SDS-PAGE was done as described previously (32). Prior to
electrophoresis, protein samples were mixed with sample buffer (62 mM Tris-HCl, pH 6.8, 5% -mercaptoethanol, 2% SDS, 10%
glycerol, and 0.002% bromphenol blue) and heated in a boiling water
bath for 5 min.
Photoaffinity Labeling of the Enzyme
The purified enzyme was photolabeled with
8-azido-GDP-L-[-32P]fucose in the absence
or presence of unlabeled GDP-fucose. In these experiments, various
amounts of the azido-GDP-[32P]fucose were incubated with
the enzyme on ice for 2 min, and then the mixtures were exposed to UV
light for 90 s to activate the azido group. The protein was then
precipitated by the addition of 5% trichloroacetic acid and the
precipitate was suspended in SDS-loading buffer, and subjected to
SDS-PAGE. Radiolabeled proteins were detected by autoradiography for
2-5 days. In some of these incubations, various amounts of unlabeled
GDP-fucose were added to determine the specificity of the labeling
procedure (33).
The 8-azido-GDP-L-[32P]fucose was prepared
as follows: GTP (0.5 µmol containing 1 mCi of
[-32P]GTP) was incubated in 50 mM Tris-HCl
buffer, pH 8.0, containing 4 mM MgCl2, 2 µmol
of L-fucose-1-P, 2 units of inorganic pyrophosphatase, and
various amounts of the purified GFPP. Incubations were at 37 oC for 1 h after which time 1 ml of methanol was
added to terminate the reaction and precipitate the protein. The
nucleoside diphosphate sugars were isolated and purified by ion
exchange chromatography on DE-52, followed by thin layer chromatography.
The addition of the azido group to GDP-fucose was done in a two-step
chemical procedure as follows. To a solution of the
[-32P]GDP-fucose in Tris buffer, pH 8.0, water-saturated bromine was added dropwise with stirring to form
[-32P]8-bromo-GDP-fucose. The progress of the reaction
was followed by monitoring the shift in the UV spectrum from 252 to 262 nm. The reaction mixture was then diluted with 100 ml of 10 mM (NH4)HCO3 and placed on a column
of DE-52 equilibrated with 10 mM
(NH4)HCO3. The column was washed with 10 mM (NH4)HCO3 and the
8-bromo-GDP-fucose was eluted with a gradient of 10 to 400 mM (NH4)HCO3. Radiolabeled fractions with absorbance at 262 nm were pooled and concentrated to
dryness. The residue was dissolved in 1 ml of water and 4 ml of
triethylamine were added. The solution was then evaporated to dryness
to remove the triethylamine and (NH4)HCO3. The
product could be stored in methanol at 20 oC until used
in further reactions.
The above synthesized [-32P]8-bromo-GDP-fucose was
used to prepare the 8-azido derivative as follows. The bromo derivative in anhydrous methanol was placed in a dry flask and the solvent was
removed by evaporation. Additional anhydrous methanol was added and the
solvent evaporated again. This procedure was repeated several times.
Then, 5 ml of a solution of dimethyl formamide, isobutyric acid, and
lithium azide were added. This solution was prepared as follows: 5 ml
of methanol, saturated with lithium azide, was added to a dry flask and
the solvent was removed by evaporation. The residue was then dissolved
in 5 ml of a solution of dimethyl formamide and isobutyric acid (4:1),
and this mixture was added to the flask containing the
8-bromo-GDP-fucose. The flask was sealed with parafilm and placed in a
50 oC waterbath overnight. At the end of this time, the
solution was concentrated to dryness, taken up in water, and placed on
a column of DE-52 as described for the 8-bromo derivative. The
isolation of this product was based on its migration on the DE-52
column and on thin layer plates, as well as by identification of the products obtained upon digestion of this nucleotide with
phosphodiesterase and alkaline phosphatase. The purified
8-azido-GDP-L-[-32P]fucose had a maximun
of 278 nm and was stored at 20 oC in methanol until used.
| |
RESULTS |
Purification of GDP--L-fucose
Pyrophosphorylase--
GFPP was purified from pig kidney following the
methods described under "Experimental Procedures," and outlined in
Table I. The polyethylene glycol
precipitate was first placed on DEAE cellulose and the enzyme was
eluted with a linear gradient of NaCl as shown in Fig.
1. This gradient separated GFPP from the
L-fucokinase, and allowed us to isolate both enzymes from
the same tissue preparation. The active enzyme fractions from DEAE
cellulose were combined, precipitated with ammonium sulfate, and placed
on a phenyl-Sepharose column. GFPP was eluted with a downward gradient
of ammonium sulfate from 1 to 0 M, and the peak of activity
emerged at about 100 mM salt concentration. Additional
steps in the purification included chromatography on hydroxylapatite,
gel filtration, and then chromatography on red-Sepharose, and finally
chromatofocusing. It can be seen from the data presented in Table I
that this purification procedure resulted in an increase in specific
activity of about 560-fold, with an overall recovery of about 12%. At
the final stage of purification, staining of the enzyme preparation
with Coomassie Blue revealed a number of protein bands with a major
protein band at about 61 kDa. On Sephacryl S-300 columns, the active
enzyme emerged from the column in the area suggesting a molecular
weight of about 61,000. Thus, the GDP-L-fucose
pyrophosphorylase appears to be a monomer of about 61 kDa.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Purification of GFPP on DEAE-cellulose.
The enzyme preparation obtained by polyethylene glycol precipitation
was applied to a 5 × 18-cm column of DEAE cellulose. The column
was washed with buffer A, and bound proteins were eluted with a 0 to
250 mM linear gradient of NaCl as described
under "Experimental Procedures." The arrow in the figure
indicates the start of the gradient. Fractions were analyzed for
protein ( ), GDP-fucose pyrophosphorylase activity ( ), and
L-fucokinase activity ( ).
|
|
That the 61-kDa band is indeed GFPP was demonstrated by the fact that
it became radiolabeled when incubated with either the azido-GTP[32P] (data not shown) or
azido-GDP-[32P]L-fucose. As seen in Fig.
2, the native enzyme was incubated with
N3-GDP-[32P]L-fucose, in the
presence of Mg2+, for 2 min in an ice bath, and the
mixtures were then exposed to UV light. The proteins were then
precipitated by the addition of trichloroacetic acid, resuspended in
SDS, and separated by SDS-PAGE. Labeled proteins were detected by
autoradiography. Fig. 2, lane 2, shows that the 61-kDa band
became photolabeled, whereas no labeling was seen in the absence of
exposure to UV light (lane 1). Adding increasing amounts of
unlabeled GDP-L-fucose to the incubation mixtures
(lanes 3- 6) caused an increasing inhibition of
photoincorporation into the 61-kDa band, demonstrating that photolabeling of GFPP was specific for GDP-fucose. The photolabeling of
the 61-kDa band was also inhibited by the addition of unlabeled GTP
(lanes 7-10), and here also inhibition was
concentration-dependent as expected, since GTP is also a
substrate for this enzyme. However, addition of unlabeled UDP-glucose
or UTP did not inhibit the photolabeling (data not shown).
View larger version (113K):
[in this window]
[in a new window]
|
Fig. 2.
Photoaffinity Labeling of GFPP. The
purified enzyme was incubated with
8-N3-GDP-[32P]L-fucose in the
absence or presence of various unlabeled nucleotides to determine the
specificity of labeling, and the mixtures were exposed to UV light to
activate the photoprobe. The protein was precipitated by the addition
of trichloroacetic acid to a final concentration of 5% and the
resulting pellet was suspended in SDS buffer and subjected to SDS-PAGE.
Radioactive proteins were detected by exposure to film. Lanes are as
follows: 1, probe + enzyme, but no exposure to UV;
2, probe + enzyme + UV; 3-6, probe + enzyme + 20, 50, 75, or 100 µM unlabeled GDP-L-fucose + UV; 7-10, probe + enzyme + 20, 50, 75, or 100 µM unlabeled GTP + exposure to UV.
|
|
Stability of the GDP-L-fucose
Pyrophosphorylase--
The stability of GFPP was examined at various
stages of purification and under a variety of conditions. The enzyme
from DEAE cellulose lost most of its activity within five days when
kept in buffer at 0 to 5 oC. The addition of
L-fucose (50 mM) or D-glucose (50 mM) helped to stabilize the activity, but 50 mM
sucrose, or 2% polyethylene glycol were much more effective. Thus, in
the presence of 50 mM sucrose, the enzyme remained fairly
stable for 9 days on ice. Based on such experiments, it was found that
the enzyme could be stored for several months in the freezer
(i.e. 20 oC) in 50 mM sucrose,
with no loss in activity.
cDNA Cloning: Using the Porcine Peptide Sequences to Search
TBLASTN Data Base--
The 61-kDa band was eluted from the SDS gels at
the most purified stage, transferred to polyvinylidene difluoride
membranes, and subjected to proteolytic digestion and sequencing. Three
peptides obtained by trypsin digestion, and 4 peptides obtained by Endo Lys-C digestion, had the amino acid sequences presented in Table II. The amino acid sequence of the
porcine Endo Lys-C peak 123 peptide, SELGLQTIGFPIFPAIPEY, was used to
search the six-frame translation of the GenBank nonredundant EST data
base with the BLAST algorithm. A 14/18 identity to the ESTs HSC13H111,
HSC3EG051, and T75166 was found. The DNA sequence of the human
ESTT75166 was used to synthesize primers for screening cDNA
libraries as described under "Experimental Procedures." GFPP
cDNA clones were obtained from human prostate, testis, and an
Epstein-Barr virus transformed B lymphocyte cell line. The cDNA
sequences encompassed 3105 nucleotides and encoded a single open
reading frame containing the seven sequenced peptides from the GFPP
shown in Table II. None of these cDNAs contained the ATG
translation start site, so 345 base pairs of upstream DNA were isolated
with the Marathon Promoter Finder walking kit. This upstream sequence
provided the missing A of the ATG translation codon, the Kozak
sequence, the putative GFPP promoter region, and contained ESTs H81173
and N92082. The complete cDNA sequence (accession numbers AF017445) and the upstream region (acession number AF017446) have been deposited
in GenBank.
View this table:
[in this window]
[in a new window]
|
Table II
Peptide sequences from GFPP
The enzyme band from SDS gels was subjected to digestion with trypsin
or Endo Lys-C. Peptides were separated by HPLC and the peptides
indicated were subjected to amino acid sequencing.
|
|
GFPP Coding Sequence--
A 594-amino acid protein having a
molecular mass of 66,616 daltons is predicted by the GFPP DNA sequence.
The transcription start site of the GFPP gene has not been determined
and the genomic sequence encodes an in-frame upstream possible
translation initiation start site that would add an additional 13 amino
acids. We feel that the translation start site shown in Fig.
3 is correct since it best matches the
consensus Kozak sequence by having a G at the important positions 3
and +4 (34).
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 3.
Nucleotide and predicted amino acid sequences
for the coding region of GDP-L-fucose
pyrophosphorylase. The tryptic and Endo Lys-C peptides identified
by peptide sequencing are underlined. The complete
3.1-kilobase cDNA sequence including the 3'-untranslated region is
contained in GenBank.
|
|
Expression of GFPP Activity in NSO Cells and in Baculovirus
System--
GFPP activity was expressed in both NSO cells and the
baculovirus system containing the GFPP construct as indicated in Table III, but not in those systems with the
irrelevant construct. Thus, the control cells had barely detectable
GFPP activity whereas transfected NSO cells had a specific activity of
about 21 nmol/mg of protein and the baculovirus-infected cells a
specific activity of 38 nmol/mg of protein. These activities were
determined in the forward direction, although the same activity was
determined for the NSO cells in the reverse assay.
View this table:
[in this window]
[in a new window]
|
Table III
Demonstration of expression of GFPP activity in NSO cells and the
baculovirus system
In the forward assay, the reactions contained 400 µM
[3H]fucose-1-P (74,000 cpm) and 2 mM GTP with
an incubation time of 5 min. In the reverse direction, reactions
contained 100 µM GDP-[3H]fucose (27,000 cpm) and 5 mM inorganic pyrophosphate with an incubation
time of 5 min.
|
|
That the product formed by the NSO cells was indeed GDP-fucose was
demonstrated by HPLC. Fig. 4 shows two
HPLC tracings of the GFPP assays done with cellular extracts from NSO
cells harboring the GFPP plasmid pEE12-GFPP (Profile B), or a construct
encoding 1,4-galactosyltransferase cDNA in the pEE12 plasmid
(Profile A). As indicated in the figure, GDP-fucose emerges
approximately 1 min after GDP (about 12 min). This peak of GDP-fucose
is absent from extracts derived from the cell line harboring the
1,4-galactosyltransferase cDNA. When the GFPP was quantitated,
the clonal cell lines examined ranged in activity from 0.03 milliunit/2 × 105 cells to 0.38 milliunits/2 × 105 cells.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Formation of GDP-L-fucose in NSO
cells harboring GFPP cDNA. Extracts of NSO cells harboring an
irrevelant construct (pEE12:GT) for 1,4-galactosyltransferase were
incubated as described under "Experimental Procedures" with
[3H]GTP and fucose-1-P and the products were examined by
HPLC as seen in tracing A. No radioactivity was observed in
the GDP-fucose area of the elution. Extracts of NSO cells harboring the
GFPP cDNA (pEE12:GFPP) were also tested for their ability to form
GDP-L-fucose as shown in profile B. In this
case, a distinct peak was observed in the GDP-fucose area of the
column.
|
|
The actual elution times vary from run to run, depending on the time
allowed for the HPLC column to equilibrate in Buffer A. However, the
order of elution and relative retention times do not vary. This
analysis was repeated using a nucleotide analysis (Bio-Rad) HPLC column
(data not shown). In each case, only those cell lines harboring a GFPP
cDNA expression plasmid yielded a unique peak corresponding to the
GDP-fucose peak. Thus GFPP cDNA is expressed in active form in the
NSO cell line. This evidence along with the co-linearity of the
cDNA with peptides derived from purified GFPP strongly indicate
that the cDNA isolated in this study encodes GFPP activity.
Homology Searches--
BLAST and FASTA searches failed to identify
any matches to known sequences or motifs in the data bases. A BLAST
search of the Caenorhabditis elegans DNA data base with the
human GFPP sequence yielded one significant match to cosmid K03H1
(p = 2.1e-11, n = 8).
Northern Results and Tissue Distribution--
Hybridization of the
GFPP cDNA probe to a multiple poly(A) + RNA blot
(CLONTECH) revealed a single 3.5-kilobase
hybridizing band of equal intensity in spleen, thymus, prostate,
testis, ovary, small intestine, and colon. The GFPP hybridizing band in
the peripheral blood leukocyte lane was faint, however, GFPP could be
PCR amplified from the human B lymphoblastoid cell line JY. In
addition, a BLAST search of the GenBank identified GFPP sequence
matches to ESTs derived from human brain (F12805, R38619, T75166,
Z43126, Z39211), heart (N89141), B lymphocytes (AA490306, AA490400), and pancreas (AA386117).
Tissue Distribution of GFPP Activity--
Various porcine tissues
were examined for the presence of GFPP activity as shown in Table
IV. The highest specific activity of this
enzyme was found in kidney, while spleen showed the next highest
activity, and liver, lung, and pancreas were somewhat lower. In order
to be sure that these determinations were really measuring
pyrophosphorylase activity rather than degradative activity, the assays
were run in the forward as well as in the reverse direction. It is
clear that the GFPP is widely distributed in various tissues. GFPP
activity was also found in CHO cells, but not in Madin-Darby canine
kidney cells.
Properties of the GDP-L-fucose
Pyrophosphorylase--
The formation of GDP-L-fucose from
GTP and -L-fucose-1-P by the purified GFPP required the
presence of a divalent cation for activity, as shown in Fig.
5. Mg2+ gave the highest
activity and was optimum at about 6 to 8 mM, while
Mn2+ showed somewhat lower activity, but was optimum at 4 mM and inhibitory at higher concentrations.
Co2+ showed about the same activating activity as
Mn2+ at 6 mM, and was also inhibitory at higher
concentrations. Of the divalent cations tested for activity with the
GFPP, in either the forward or reverse direction, only
Mg2+, Mn2+, and Co2+ showed
significant activity, whereas Ca2+, Cu2+,
Zn2+, Ni2+, Hg2+, Mo2+,
and Fe2+ were without activity. Similar results were
obtained with the recombinant enzyme from NSO cells.
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of metal ions on the activity of
GDP-fucose pyrophosphorylase. Various amounts of each metal ion
were added to standard incubations containing fucose-1-P and GTP, as
shown in the figure. Activity was measured as described under
"Experimental Procedures." In this case the purified pig kidney
enzyme was used but similar results were observed with the enzyme from
NSO cells.
|
|
The pH optimum for the enzyme was measured using either Tris-HCl or
Tris maleate buffers in the assay mixtures, and assays were done in the
forward and reverse directions at various pH values. These experiments
demonstrated that the pH optimum for this enzyme was about pH 6.8 to
7.8 (data not shown).
The substrate specificity of the GFPP was examined in the forward
direction using various nucleoside triphosphates as shown in Table
V. With the partially purified enzyme
from pig kidney, the best activity was observed with either GTP or ITP
as the nucleotide donors, but significant activity was also observed
with ATP. The activity with ITP is not surprising but the activity with
ATP is unexpected. Attempts were made to isolate the product of the reaction without success. Since it was not clear that these other activities were entirely due to GFPP (since the kidney enzyme is not
homogeneous), specificity was also examined with the enzyme expressed in the NSO cells and in the baculovirus system. The table
shows that in both of these recombinant systems, GTP was clearly the
best nucleotide substrate, and the only other nucleotide showing
significant activity was ITP. Control NSO cells or baculovirus transfected with an irrelevant construct had very low activity with
fucose-1-P and any nucleoside triphosphate (see Table III).
The specificity of the enzyme for sugar-1-P was also examined with the
pig kidney GFPP as well as with the enzymes from NSO cells and from
baculovirus, as shown in Table VI.
However, in this experiment each of the sugar-1-Ps was not readily
available in radioactive form. Therefore, the experiment was done using radioactive L-fucose-1-P and GTP as substrates, and each of
the other sugar-1-Ps was added at 1 mM concentration to
determine whether any of them would inhibit the formation of
GDP-L-fucose. The idea of this experiment was that if any
of the other sugar-1-Ps could act as a substrate, then it should
inhibit the reaction with fucose-1-P. The results show that only
unlabeled L-fucose-1-P was effective at inhibiting the
reaction. The interpretation of this data is that GFPP from any of the
sources examined is specific for fucose-1-P as the sugar substrate.
However, previous studies have shown that the GFPP will synthesize
GDP-D-arabinopyranoside from GTP and
D-arabinose-1-P (35). Arabinose-1-P was not tested in the
experiment shown in Table VI since it was not available at 1 mM concentrations, but earlier studies (35) had indicated that it was about 5-10% as active as L-fucose-1-P.
The effect of substrate concentrations on the reaction rate was also
examined as indicated in Fig. 6,
A and B. In Fig. 6A, increasing
amounts of GTP were added to incubation mixtures containing 2 mM fucose-1-P, 6 mM MgCl2, 0.5 units of inorganic pyrophosphatase, and 2 units of purified enzyme. The
figure shows the plot of concentration of GTP versus
activity in terms of nanomoles of GDP-L-fucose formed, while the inset shows the same data, plotted according to
the method of Lineweaver and Burk. These results indicate that the Km for GTP is about 54 µM. Fig.
6B shows a similar experiment with L-fucose-1-P
as the other substrate. In this case, the incubations also contained 2 units of enzyme in the presence of 5 mM GTP, 6 mM MgCl2, and 0.5 units of inorganic
pyrophosphatase. Again the inset shows the 1/V
versus 1/S plot, and demonstrates that the
Km for fucose-1-P is about 60 µM. From
the same kinds of experiments and measuring the enzymatic activity in
the reverse directions, the Km for
GDP-L-fucose was estimated to be about 120 µM
and that for inorganic pyrophosphate was 135 µM (data not
shown).
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of substrate concentrations on
GDP-fucose pyrophosphorylase. A, various amounts of GTP
were added to standard incubations containing 2 mM
L-fucose-1-P and other necessary
components, and the formation of GDP-fucose was measured as described
under "Experimental Procedures." B, various amounts of
the other substrate, L-fucose-1-P were added to standard
incubation mixtures containing 5 mM GTP, and the formation
of GDP-fucose was determined. The data was plotted according to
Lineweaver and Burk, as seen in the insets.
|
|
Characterization of the Products of the Reaction with GFPP--
In
order to characterize the product of the reaction produced from GTP and
-L-[3H]fucose-1-phosphate, large scale
reaction mixtures were prepared using the purified enzyme and scaling
up the typical reaction mixture by a factor of 10. After incubation for
the appropriate amount of time, the reactions were terminated by
heating, and the protein precipitate was removed by centrifugation. The
reaction mixtures were applied to columns of DEAE cellulose
(HCO3), and the columns were washed
well with H2O. The labeled products were then separated
from any remaining substrate with a gradient of 0 to 150 mM
(NH4)HCO3. A peak of radioactivity,
representing 75% of the total radioactivity in the incubation emerged
in the area of the column expected for GDP-L-fucose and
clearly separated from fucose-1-P.
This radioactive material was subjected to paper chromatography on
Whatman 3MM paper in two different solvent systems. The radioactive
material migrated with the same RF as authentic GDP-fucose which was well separated from fucose-1-P. The radioactive compound was eluted from the paper and subjected to treatment with
alkaline phosphatase and phosphodiesterase. Alkaline phosphatase did
not affect the migration of the radioactive material on the paper
chromatograms, but treatment with phosphodiesterase caused the
radioactivity to shift mostly to the area of fucose-1-P. These results
indicate that the fucose is present in a pyrophosphate linkage to the
guanosine. Mild acid hydrolysis of the radioactive nucleotide (0.02 N HCl, 95 oC, 15 min) released most of the
radioactivity as a neutral compound that migrated like fucose upon
paper chromatography in 1-butanol, pyridine, 0.1 N HCl
(5:3:2) (data not shown). These data indicate that the product of this
reaction is GDP-[3H]fucose.
| |
DISCUSSION |
L-Fucose is a key sugar in glycoproteins and other
complex carbohydrates since it may be involved in many functional roles of these macromolecules, such as their role in cell:cell recognition or
targeting (36). For example, L-fucose is a component of the sialyl Lewisx antigen which is the recognition site for
selectins that play a key role in inflammation and the interaction of
leukocytes with endothelial cells (37).
The major pathway for the biosynthesis of L-fucose, which
is probably present in most eucaryotic and procaryotic cells, involves a pathway that converts GDP-D-mannose to
GDP-L-fucose. This fucose nucleotide is the fucosyl donor
for polysaccharides, glycoproteins, and glycolipids (38). However, in
various animal tissues, especially kidney, lung, and liver, another
pathway exists that can lead to the formation of
GDP-L-fucose. This pathway involves a fucokinase that
catalyzes the transfer of phosphate from ATP to free
L-fucose to give L-fucose-1-P, and a
GDP-L-fucose pyrophosphorylase that condenses the above
L-fucose-1-P with GTP to give GDP-L-fucose. This pathway appears to function as a salvage pathway to recapture L-fucose that arises in these tissues as a result of
turnover and degradation of complex carbohydrates.
Although the fucokinase and GDP-fucose pyrophosphorylase had been
partially purified from liver in the past (23, 24), neither enzyme was
pure enough to obtain amino acid sequence data, or to obtain probes for
molecular biological approaches to study these enzymes or their
possible regulation. We recently described the purification of the pig
kidney L-fucokinase to apparant homogeneity and the
sequencing of a number of peptides obtained from the homogeneous protein (25). In the present report, we have purified the pig kidney
GDP-fucose pyrophosphorylase to near homogeneity and identified the
specific protein band that represents this enzymatic activity using the
photoaffinity probe,
8-N3-GDP-[32P]L-fucose. The
61-kDa band that becomes photolabeled in a specific and
concentration-dependent manner was eluted from the SDS gels and subjected to amino acid sequencing.
Seven different peptide sequences were obtained and several of these
were used to prepare degenerate oligonucleotides for cloning the gene.
GFPP cDNA clones were obtained from human prostate, testis, and an
Epstein-Barr virus transformed B lymphocyte cell line. The GFPP DNA
sequence predicts a 594-amino acid sequence having a molecular mass of
66,616 daltons. When GFPP cDNA is expressed in the myeloma cell
line NSO, extracts of this culture catalyze the formation of GDP-fucose
from fucose-1-P and GTP. BLAST and FASTA searches failed to reveal any
matches to known sequences or motifs in the data bases. The GFPP
cDNA probe was used to identify the mRNA in various tissues.
Hybridization studies revealed a single 3.5-kilobase mRNA of equal
intensity in spleen, thymus, prostate, testis, ovaries,
small intestine, and colon.
Analysis of endogenous GFPP enzymatic activity from pig tissues
revealed the highest activity in kidney, while spleen was next, and
liver, lung, and pancreas were somewhat lower. However, it is not clear
whether tissues such as testis, ovaries, spleen, etc., actually
reutilize free L-fucose, or whether this enzyme and the
"salvage" pathway are mostly confined to tissues such as liver and
kidney. At any rate, the L-fucokinase and the
GDP-L-fucose pyrophosphorylase represent valuable enzymes
for biochemists studying fucosylation reactions, since they offer a
means to prepare radioactive GDP-fucose in large amounts and for a
reasonable cost. In addition, these enzymes may be under some sort of
regulation in these tissues, since the fucokinase was previously shown
to be inhibited by GDP-L-fucose. The availability of
various probes will allow us to examine the levels of mRNA and
protein in various tissues under normal and disease conditions.
,
Top
Abstract
Introduction
