|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 46, 30352-30359, November 13, 1998
From the Department of Cancer Cell Biology, Harvard School of
Public Health, Boston, Massachusetts 02115
We investigated the interaction dynamics of human
abasic endonuclease, the Ape1 protein (also called Ref1, Hap1, or
Apex), with its DNA substrate and incised product using electrophoretic assays and site-specific amino acid substitutions. Changing aspartate 283 to alanine (D283A) left 10% residual activity, contrary to a
previous report, but complementation of repair-deficient bacteria by
the D283A Ape1 protein was consistent with its activity in vitro. The D308A, D283/D308A double mutant, and histidine 309 to
asparagine proteins had 22, 1, and ~0.02% of wild-type Ape1 activity, respectively. Despite this range of enzymatic activities, all
the mutant proteins had near-wild-type binding affinity specific for
DNA containing a synthetic abasic site. Thus, substrate recognition and
cleavage are genetically separable steps. Both the wild-type and mutant
Ape1 proteins bound strongly to the enzyme incision product, an incised
abasic site, which suggested that Ape1 might exhibit product
inhibition. The use of human DNA polymerase Base excision repair (1, 2) is a multistep process that corrects a
diverse array of spontaneous and mutagen-induced DNA lesions. The
process can be initiated by DNA glycosylases, which excise damaged
bases to create apurinic/apyrimidinic
(AP)1 sites. Modified abasic
sites can arise directly from oxidative DNA-damaging agents, such as
ionizing radiation (3). The AP and modified abasic sites are substrates
for class II AP endonucleases, which cleave the 5' phosphodiester of
both regular (hydrolytic) AP sites (4) and oxidized abasic residues
(5). Excision of the lesion, DNA repair synthesis, and ligation
complete the process (1, 2).
Ape1 protein is quantitatively the main AP endonuclease of human cells
(6, 7). This DNA repair protein was independently named Hap1 (8) and
Apex (9), and as an in vitro activator of DNA binding
activity for some oxidized transcription factors, it was also named
Ref1 (10-12). Ape1 protein can be separated into two functionally
distinct regions, with the N-terminal domain possessing the Ref1 redox
activity (10, 12) and the C-terminal domain contains the AP
endonuclease activity within a 280-residue polypeptide sequence (10,
12, 13) homologous to exonuclease III of Escherichia coli
(27% identity), the ExoA protein of Streptococcus pneumoniae (39% identity), the Rrp1 protein of Drosophila
melanogaster (50% identity), and the Arp protein of
Arabidopsis thaliana (57% identity) (4, 14).
The proteins of the Ape1/exonuclease III family exhibit a range of
enzymatic activities on duplex DNA. Along with the class II AP
endonuclease activity, exonuclease III possesses duplex-specific 3'-5'
exonuclease activity, 3'-repair phosphodiesterase activity, 3'-phosphatase activity, and RNase H activity (15-18). Ape1 protein also has these multiple activities, but with 3'-repair diesterase, 3'-phosphatase, RNase H, and exonuclease activities 100-10,000-fold lower than its AP endonuclease activity (4, 19-21). The presence of
multiple catalytic functions for exonuclease III, a relatively small
(Mr ~30,000), monomeric protein suggested that
a single active site catalyzes all the enzymatic reactions (22). In
that model, distinct recognition elements in the protein were proposed to interact with duplex DNA 5' to the target site, and a "space" in
the DNA duplex caused by a missing base or frayed 3'-end.
The crystal structure of exonuclease III has been solved, and a
catalytic mechanism was proposed involving a single active site (23).
The recently proposed crystal structure of Ape1/Hap1 protein (24)
prompted an essentially identical proposal that involves a single
active site for this enzyme. Both models involve amino acid residues
that are conserved in the Ape1/exonuclease III family, and the
properties of some site-specific mutant Ape1 proteins are consistent
with the proposal (25, 26). In a reverse approach, Gu et al.
(27) used an in vivo complementation assay to isolate
mutants of the Drosophila Rrp1 protein with altered repair
capacity or specificity. Some of the alterations in these proteins were
mapped to conserved residues that do not correspond to functional
residues proposed for exonuclease III or Ape1. One of the Rrp1 mutant
proteins had diminished 3'-repair diesterase activity but normal AP
endonuclease activity. Thus, either these proteins have more than one
active site, or substrate specificity can be modulated independently of
the catalytic activity.
We have previously addressed the mechanism of substrate recognition by
Ape1 protein using electrophoretic mobility shift assay (EMSA) and
footprinting methods (28). Those studies showed that Ape1 binds
specifically around the abasic site in DNA and causes a pronounced
distortion at the abasic site in a preincision complex (19). However,
the EMSA conditions and those of others (26, 29) were not suitable for
biochemical characterization, because the protein-DNA complexes were
relatively unstable. Here we report improved conditions for EMSA and
use the assay to monitor Ape1 binding and dissociation from an abasic
substrate and the incised product. We have examined the interactions
for several site-specific mutant forms of Ape1. We show here that Ape1
has a high affinity to the incised product DNA and to DNA with a
one-nucleotide gap, and the several mutations that affect the catalytic
activity to different degrees do not significantly affect abasic site
recognition but do affect the dynamics of the protein-DNA interaction.
Strains and Plasmids
For plasmid construction, strain DH5 Site-directed Mutagenesis and Plasmid Construction
Construction of Mutant Ape1 Proteins--
"DeepVent" DNA
polymerase (New England Biolabs, Beverly, MA) was used in the
polymerase chain reaction (PCR) to generate site-specific mutations in
APE1 cDNA. In the final expression constructs, any DNA
products that resulted from PCRs were sequenced to verify that only the
desired mutation had been introduced.
Mutant D308A (Aspartate to Alanine Substitution at Residue
308)--
Using plasmid pCW26 (7) as the template DNA, the 5'-portion
of the APE1 gene was amplified with T3 (ATTAACCCTCACTAAAG) and D308A(-) primers (TAGGACAGTGAGCACTCGCGA). Likewise, the 3'-portion of the gene was amplified with T7 (AATACGACTCACTATAG) and D308A primer
(TCGCGAGTGCTCACTGTCCTA) in a separate reaction. The reaction products
were then isolated, mixed together, and PCR-amplified with the T7 and
T3 primers to generate a complete APE1 cDNA with the
desired site-specific mutation. The final PCR product was cut with
EcoRI and subcloned into Bluescript KS (Stratagene, La Jolla, CA) at the EcoRI site. Note that the sequence of
D308A primer had been designed to change two amino acid residues,
although the final plasmid had in fact only one mutation, D308A.
Mutants H309N (Histidine to Asparagine Substitution at Residue
309) and D283A (Aspartate to Alanine Substitution at Residue
283)--
Mutagenesis was exactly as for D308A, except that the H309N
(CGGCAGTGATAACTGTCCTAT) or D283A (GTTGGTTGGCGCCTTGCTTAC) primer and the
H309N(-) (ATAGGACAGTTATCACTGCCG) or D283A(-) (GTAAGCAAGGCGCCAACCAAC) primer were used to mutate the gene. The intermediate PCR products were
amplified with hAPE15NcoI (CAGCTGCCATGGGGTTCG) and
hAPE13HindIII (TCTCTGAAGCTTGTTTAAAG) primers to generate the
entire gene with the desired site-specific mutation. The final PCR
product was cut with NcoI and HindIII and
subcloned into NcoI/HindIII-digested pSE380
(Invitrogen, Carlsbad, CA).
Mutant D283A/D308A (Aspartate to Alanine Substitutions at
Residues 283 and 308)--
The technique described for generating the
D308A substitution was used to construct this double mutant, except
that the template DNA for the PCR was the single mutant D283A in
pSE380. The primers D308A and D308A(-) were used to create the second
site-specific mutation.
To construct expression plasmids for the mutant portion, the 238-base
pair PstI-HindIII fragment encompassing the
3'-portion of APE1 cDNA from pXC53 was replaced with the
corresponding PstI-HindIII fragment from the
mutagenized plasmids. For in vivo complementation tests, a
XbaI-HindIII fragment containing the entire
APE1 DNA from pXC53 or its derivatives was inserted
downstream of the arabinose-regulated promoter of pBAD22A (obtained
from The Cloning Vector Collection of the National Institute of
Genetics, Shizuoka, Japan).
In Vivo Complementation Test
Strain BW528 was transformed by pBAD22A or the derivatives
carrying the wild-type or mutant APE1 gene. The resulting
strains were tested for their ability to form single colonies by
streak-dilution on LB agar plates (33) containing 0.025% methyl
methanesulfonate (MMS) and 0.2% L-arabinose. The
colony-forming ability was checked after incubation for 24 h at
37 °C.
DNA Substrates
Poly[d(A-T)] containing
[ A 51-mer synthetic oligonucleotide (37) containing a tetrahydrofuran
residue (51F), a uracil (51U), or a cytosine at position 22 (51C) and
the related oligonucleotides (see Fig. 6A) were purchased from Operon Technologies Inc. (Alameda, CA). The concentration of high
pressure liquid chromatography-purified oligonucleotides was determined
by measuring absorbance at 260 nm (38). To generate a double-stranded
substrate, 100 pmol of oligonucleotide was 5'-end-labeled with
[ To prepare incised 51F, the double-stranded oligonucleotide (100 pmol)
was treated with 12.5 pmol of Ape1 in a 100-µl reaction (50 mM Tris-HCl (pH 8.4), 10 mM MgCl2,
and 0.2 mg/ml BSA) at 37 °C for 10 min. The reaction was stopped by
adding 5 µl of 0.5 M EDTA. After the reaction, 98% of
substrate had been converted to the incised form (data not shown). The
DNA was sequentially extracted with phenol-chloroform and chloroform
and then precipitated with ethanol.
A substrate with a single AP site was prepared according to Bennett
et al. (39), except that the Ape1 reaction buffer was used
(50 mM HEPES-KOH (pH 7.5), 50 mM KCl, 0.1 mg/ml
BSA, 10 mM MgCl2, and 0.05% Triton X-100).
After treatment with recombinant E. coli uracil-DNA
glycosylase (a generous gift of Dr. Dale Mosbaugh, Oregon State
University), the reaction mixture was used directly for incision assays.
Protein Purification
To purify the recombinant Ape1 proteins, expression was
accomplished by addition of isopropyl
For Pol Protein concentrations were determined by the Bio-Rad protein assay
(Bio-Rad), based on the method of Bradford (42), using BSA (Amersham
Pharmacia Biotech) as the standard.
DNA Binding Assays by EMSA
The following binding methods were adapted from the protocols of
Wilson et al. (28), Ng and Marians (43), and Hendrickson and
Schleif (44). Modification of the binding conditions of Wilson et
al. (28) involved exploring the pH range 7.5-8.8 with different
buffers and a range of KCl concentrations up to 50 mM NaCl
(data not shown); however, the most important factors in the improved
electrophoretic resolution were the reduction of the concentration of
EDTA and omission of glycerol from the buffer.
For binding measurements, reaction mixtures (10 µl) in 50 mM Tris-HCl (pH 8.4), 1 mM EDTA (pH 8.0), and
0.2 mg/ml BSA containing 51F DNA (1 nM) were mixed with
proteins as indicated in the figure legends. The mixtures were
incubated on ice for 10 min and loaded on a prerunning 8%
polyacrylamide gel (80:1 acrylamide:bisacrylamide). The electrophoresis
buffer contained 6 mM Tris-HCl (pH 7.8), 5 mM
sodium acetate, and 0.1 mM EDTA (43), and the gels were
subjected to a constant voltage of 8 V/cm applied for 2 h at
4 °C. Following gel electrophoresis, the gels were dried and
autoradiographed at -80 °C. The amount of DNA present in each band
was quantified using a Molecular Imager system (Bio-Rad).
To follow dissociation, binding reaction mixtures (100 µl) containing
1 nM 51F DNA and 7.8 nM Ape1 protein were
incubated on ice for 10 min. The subsequent steps were carried out at
0-4 °C using equipment prechilled to 4 °C. At time 0, 10-µl
samples were removed, mixed with 1 µl of a 1-µM
unlabeled 51F stock, and incubated for various times on ice before
being loaded on a prerunning gel to separate free DNA from the Ape1-DNA complexes.
Product Depletion Assay
To deplete the Ape1 reaction product from the reaction mixture,
we used human Pol Other Enzyme Assays
To monitor AP endonuclease activity during purification,
poly[d(A-T)] containing
[ To monitor the Pol Purification of Mutant Ape1 Proteins--
The site-specifically
mutated Ape1 proteins were purified following overexpression in
E. coli strain BL21 (DE3). After induction of the D283A and
D308A mutant proteins, the crude extracts (fraction I) containing these
proteins displayed significantly higher AP endonuclease activity than
extracts of the control strain (data not shown), which indicated that
both the D283A and D308A proteins retain substantial enzymatic
activity. This result seemed to contrast with the data of Barzilay
et al. (25), who reported a D283A mutant protein that had
~2000-fold reduced activity. Therefore, we purified the mutant
proteins very carefully, and both the AP endonuclease activity and the
amount of the induced Mr 37,000 protein were
monitored during all purification steps.
In contrast to the above, for the D283A/D308A double-mutant and H309N
proteins, no increase was detected in the total AP endonuclease activity in crude extracts of cells after protein induction, even though substantial amounts of the induced recombinant proteins were
detected by SDS-PAGE (data not shown). Thus, only the induced Mr 37,000 protein could be monitored during the
purification of the D283A/D308A and H309N proteins. In the final step
of the H309N purification, the leading edge of a bacterial AP
endonuclease peak introduced <5% contaminating activity (data not shown).
Analysis of these preparations by SDS-PAGE and staining with Coomassie
Brilliant Blue (Fig. 1) or silver (data
not shown) indicated that they contained only a single predominant
polypeptide (
The enzymatic activity of the mutant proteins was also addressed by
complementation of the nfo-
xth- E. coli strain BW528 (31). This
strain has <5% of the normal AP endonuclease activity and is highly
sensitive to MMS, but the wild-type APE1 gene can restore
MMS resistance to it (7). Consistent with the activities measured
in vitro, the D283A and D308A mutant APE1 genes
under inducing conditions restored MMS resistance in BW528, whereas the
genes containing the D283A/D308A double mutation, or the H309N single
mutation, did not.2
Binding of Ape1 to 51F DNA--
We previously (28) showed that an
EMSA allows the identification of specific complexes between wild-type
Ape1 and DNA containing an abasic site. However, these complexes are
evidently unstable, as indicated by the "smear" of DNA migrating in
gels between the protein-DNA complex and the free DNA (28). This
material likely represents protein-DNA complexes that dissociated
during electrophoresis. Thus, the assay probably underestimates the
amount of DNA bound by protein. The binding and electrophoresis
conditions were therefore modified (see under "Experimental
Procedures") to allow the free DNA and the DNA-Ape1 complexes to be
separated cleanly by electrophoresis (Fig.
2A, panel a). Nonspecific DNA
binding by the Ape1 proteins was estimated by using 51C DNA as the
substrate, which revealed only small amounts of protein-DNA complexes
with any of the proteins (Fig. 2B). Small amounts of these
nonspecific complexes were also observed for 51F DNA incubated with the
highest levels of Ape1 protein (see, for example, Fig. 2A, panel
d). Thus, the modified EMSA detects predominantly damage-specific
binding by Ape1.
The quantitative binding curves for 51F and the various Ape1 proteins
are shown in Fig. 2C. For all five proteins, the amount of
protein-DNA complex formed was proportional to the protein concentration up to 4 nM (Fig. 2C). This result
allowed us to estimate the relative binding affinities of wild-type and
mutant Ape1 proteins (Table II).
Surprisingly, all the mutant proteins showed high affinity for 51F in
this assay, with quantitative values very close to that for wild-type
Ape1 protein (Fig. 2C; Table II). The D308A and D283A/D308A
proteins showed slightly higher affinity for the abasic DNA than did
wild-type Ape1, and the H309N mutant had only ~2-fold reduced
affinity (Table II), even though its AP endonuclease activity was
markedly reduced (Table I). Thus, the defects in the D283A/D308A and
H309N proteins do not seem to influence substrate recognition, in
contrast to an inactive Ape1 mutant protein that was reported to lose
both activity and damage-specific DNA binding (26). This result shows that AP-specific binding and enzymatic activity can be separated by
certain amino acid substitutions.
Dissociation of Ape1 from 51F DNA--
Dissociation of an enzyme
from its DNA substrate prior to cleavage can be an important factor in
limiting its catalytic activity. We studied the dissociation of
preformed complexes of the Ape1 proteins and labeled 51F DNA by adding
a large excess of unlabeled 51F DNA (see under "Experimental
Procedures"). The vast majority of any dissociated Ape1 protein will
bind to this unlabeled DNA rather than rebind to the small portion of
labeled DNA. Samples were taken at various times after adding the
competitor DNA and analyzed by EMSA. Fig.
3A shows that at 0 °C,
Ape1-DNA complexes were converted to free DNA during incubation with
the unlabeled 51F substrate in a time-dependent manner. The
quantitative dissociation curves allowed us to determine the half-lives
of the protein-DNA complexes in the EMSA procedure (Fig.
3B). For wild-type Ape1 protein, this value was 50 s.
Previously, we developed a filter binding assay to measure the
half-life of Ape1 complexes with DNA containing an abasic site, and the
new value agrees quite well with the previous result (28).
Surprisingly, the half-lives of the F-DNA complexes with the D283A,
D308A, and D283A/D308A proteins were considerably longer than for
wild-type Ape1 (5, 9, and 7 min, respectively). In contrast, the
half-life of the complex with H309N protein was too short to measure in
this assay, because the majority of the protein had dissociated within
10 s (Fig. 3B; Table II).
Binding of Ape1 Proteins to Incised 51F DNA--
The catalytic
activity of Ape1 may be limited by interaction with its reaction
product, DNA containing an incised abasic site, but this question had
not been explicitly studied. We approached this issue by using incised
51F DNA as a binding substrate. EMSA using the incised 51F DNA showed
that both the wild-type and mutant Ape1 proteins had high affinity for
incised 51F DNA (Fig. 4A, panels
a-d). For the wild-type, D283A, D308A, and D283A/D308A proteins,
we estimate 50% binding of incised 51F DNA at 4 nM Ape1 protein (Table II). The dissociation of Ape1 proteins from complexes with 51F DNA was also measured by EMSA, again using unlabeled, nonincised 51F DNA as a competitor (Fig.
5) For the wild-type, D283A, and
D283A/D308A proteins, the half-lives were 35, 50, and 65 s,
respectively (Table II); for the D308A protein, the half-life was
130 s (Table II). Thus, under our conditions, wild-type Ape1 and
all but one of the mutant proteins bound the endonuclease cleavage
product with affinities very close to those for the nonincised abasic
DNA substrate.
Incised 51F DNA also bound Pol High-affinity Binding of Ape1 Protein to DNA Containing a
One-nucleotide Gap--
The high affinity of Ape1 for the incised F
site suggested that the enzyme might bind generally to nicked or gapped
structures in DNA. To test this idea, we generated duplex
oligonucleotides with a one-nucleotide gap at the same position as the
F residue in 51F, a nick at this position, or protruding 3'- or
5'-single-stranded regions; the structures are shown in Fig.
6A. In EMSA experiments, Ape1
bound the structure of the duplex oligonucleotides with a one-nucleotide gap with affinity similar to that for incised or intact
F sites (Fig. 6B). In contrast, Ape1 did not have high affinity for the structure with a nick or the 5'-single-stranded or
3'-single-stranded structures (Fig. 6B). We have not
explored the gap size-dependence of Ape1 binding affinity.
Effect of the Product on the Nicking Reaction in Solution--
The
high affinity of Ape1 protein for the incised product and for
one-nucleotide gapped DNA suggested that the enzyme might exhibit
product inhibition, although such an effect has not been reported. One
possibility is that Ape1 has high affinity for the incised
tetrahydrofuran (F) abasic site, but not for an incised hydrolytic AP
site. Because the latter moieties can undergo degradation during
electrophoresis (45), we performed steady-state kinetic studies using a
substrate with a glycosylase-generated AP site.
In Ape1 incision reactions, the kinetics exhibited a short linear range
restricted to <30% incision (Fig.
7A, open circles). We obtained
essentially the identical result when we used the 51F substrate (data
not shown). The nonlinearity observed as the incision reactions
proceeded could result from competitive inhibition by the incised
product. If the incision product is a competitive inhibitor, then the
depletion of the product by the deoxyribose-phosphatase and DNA
polymerase activities of Pol
To confirm that Pol Our studies have addressed the substrate and product binding
dynamics of Ape1, the predominant AP endonuclease of human cells. The
results show that the incised product of the AP endonuclease reaction
is a competitive inhibitor for Ape1 and that the next enzyme of the
base excision repair pathway, DNA polymerase We created four different mutant proteins by site-directed mutagenesis.
These altered enzymes had reduced AP endonuclease activity between 22 and ~0.02% that of wild-type Ape1. Unexpectedly, the D283A protein
was quite active (10% of wild-type), although Barzilay et
al. (25) reported that this mutation markedly reduced the activity
(~2000-fold) and concluded that aspartate 283 was critical for
catalysis. Repeated DNA sequencing and independent subcloning efforts
showed that only the D283A change was introduced by our procedure. The
activity of the D283A protein was not derived from contaminating
bacterial AP endonuclease: first, the AP endonuclease activity was
dependent on expression of the human protein; second, during
purification, the activity copurified with the induced Mr 37,000 protein; and third, the D283A mutant
cDNA restored resistance to MMS in an
xth- nfo- strain of
E. coli. We found that the D283A protein could aggregate under low-salt conditions (Buffer A containing 25 mM KCl),
which is one possible explanation for the dramatically divergent
results. Alternatively, the D283A derivative generated by Barzilay
et al. (25) may contain an unintended second mutation.
Regardless, aspartate 283 contributes to activity in Ape1 but is not essential.
We found that Ape1 protein has high affinity for incised abasic sites,
which was not detected in previous studies (28, 39). The previous EMSA
conditions may have been too stringent for this detection, because the
complex of Ape1 and the incised abasic site is less stable than the
complex of Ape1 and an intact abasic site (compare Fig. 2 with Fig. 4).
However, the binding determinants for incised abasic sites might
overlap with those for uncleaved abasic residues, because the
wild-type, D283A, D308A, and D283A/D308A proteins had identical
affinity. The much lower affinity of the H309N protein for incised
abasic sites compared with the other Ape1 derivatives could reflect an
important role of histidine-309 in product binding specifically, as
this protein has near-wild-type affinity for the substrate (an intact
abasic site).
Interestingly, the stability of the Ape1 DNA complexes varied among the
wild-type and the various mutant proteins. The slower dissociation of
the D283A, D308A, and D283A/D308A proteins from the intact abasic site
than from the incised lesion indicates that the preincision complex is
stabilized by the continuous DNA structure and perhaps by substrate
contacts within the active site. In a current model (23, 24), the
aspartate residue that was replaced in the D283A and D283A/D308A
proteins is postulated to act as general base. Without this aspartate
residue, the histidine residue might stabilize the preincision complex.
In fact, the unincised 51F DNA complex with the H309N protein had a
much lower stability, consistent with loss of an important contact. The
model of Gorman et al. (24) suggests that histidine 309 interacts with the 5'-phosphate bond of the abasic site through a water molecule. Structural studies of these mutant proteins, particularly in
complexes with DNA, would be useful.
What does Ape1 protein recognize specifically in DNA? We showed
previously that neither the deoxyribose of the AP site itself nor the
base opposite the AP site is necessary for incision (19). Indeed,
strong binding by Ape1 can occur when no residue is present at all, as
shown with the 51-Gap substrate (Fig. 6). A mere nick was insufficient
to allow Ape1 to bind stably, but Strauss et al. (29) showed
that Ape1 protein has high affinity for a 3'-incised abasic site
resulting from Although the EMSA approach is not suitable for determination of rate
constants, we were able to show in steady-state reactions that Pol We previously proposed a model that Ape1 protein loads Pol We thank Dr. Dale Mosbaugh (Oregon State
University) for supplying the uracil DNA glycosylase, Dr. Bernard Weiss
(University of Michigan Medical School) for supplying the dCTP
deaminase, and Dr. Stuart Linn (University of California, Berkeley, CA)
for providing the polymerase *
This work was supported by Grants GM40000, CA71993, and
ES03926 from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. E-mail:
bdemple{at}hsph.harvard.edu.
The abbreviations used are:
AP, apurinic/apyrimidinic; F, tetrahydrofuran; 51F, 51-mer double-strand
DNA containing a tetrahydrofuran residue at position 22; EMSA, electrophoretic-mobility-shift assay; Pol 2
Y. Masuda, R. A. O. Bennett, and B. Demple, unpublished data.
Dynamics of the Interaction of Human Apurinic Endonuclease (Ape1)
with Its Substrate and Product*
,
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
to increase Ape1
activity by eliminating the incision product supports this conclusion.
Notably, the complexes of the D283A, D308A, and D283A/D308A double
mutant proteins with both intact and incised abasic DNA were
significantly more stable than complexes containing wild-type Ape1,
which may contribute to the lower turnover numbers of the mutant
enzymes. Wild-type Ape1 protein bound tightly to DNA containing a
one-nucleotide gap but not to DNA with a nick, consistent with the
proposal that substrate recognition by Ape1 involves a space bracketed
by duplex DNA, rather than mere flexibility of the DNA.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(endA1 hsdR17
(rK
mK+) supE44 thi-1
recA1 gyrA (NalR) relA1
(lacZYA-argF)U169 deoR
(
80dlac(lacZ)M15)) was used (30). Strain
BW528 (xth nfo::kan) (31) was
obtained originally from Dr. Bernard Weiss (University of Michigan
Medical School). For overproduction of human Ape1 and human DNA
polymerase (Pol) proteins, strain BL21 (DE3) (ompT lon
hsdR (rB-mB-))
was used (32). The Ape1 expression plasmid, pXC53, was obtained from
DuPont Merck Pharmaceutical Co., and the expression plasmid for human
Pol was a generous gift of Dr. Stuart Linn (University of
California, Berkeley, CA)
-32P,uracil-3H]dUMP at a frequency of one
per 500 nucleotides was synthesized as described by Levin and Demple
(34), except that the [-32P]dUTP was prepared from
labeled dCTP (Andotek, Irvine, CA) by deamination with dCTP deaminase
(35) (kindly provided by Dr. Bernard Weiss, University of Michigan
Medical School). After the reaction, more than 95% of dCTP had been
converted to dUTP, as determined using thin layer chromatography on
polyethyleneimine cellulose (36).
-32P]ATP using T4 polynucleotide kinase (New England
Biolabs, Beverly, MA) and then annealed to the complementary
oligonucleotide (see Fig. 6A). After precipitation with
ethanol, the amount of DNA recovered was determined by monitoring the
recovered radioactivity.
-D-thiogalactopyranoside when the bacterial cultures had
reached an absorbance at 600 nm to 0.5, and the incubation was
continued for 90 min according to Marians (40). Cell lysates (fraction
I) were prepared as described by Hupp and Kaguni (41). The cell lysate
was fractionated at a 55% saturation of ammonium sulfate, and the
remaining soluble proteins were then precipitated at 80% saturation of
ammonium sulfate. The proteins were resuspended in Buffer A (50 mM HEPES-KOH (pH 7.5), 1 mM EDTA, 0.1 mM dithiothreitol, 10% (v/v) glycerol) containing 100 mM KCl and dialyzed against the same buffer (fraction II).
Fraction II was applied to a 20-ml phosphocellulose (Whatman P11)
column and then eluted with a linear gradient of 100-750 mM KCl in Buffer A. The peak fractions containing Ape1 were
pooled and dialyzed against Buffer A containing 100 mM KCl,
(fraction III). Fraction III was applied to a MonoS 5/5 column
(Amersham Pharmacia Biotech) and then eluted with a linear gradient of
100-250 mM KCl in Buffer A. The peak fractions containing
Ape1 were pooled and concentrated by dialysis against Buffer A
containing 200 mM KCl and 20% polyethylene glycol (average
molecular weight, 8000) (fraction IV). Fraction IV was applied to a
Superose-12 column (Amersham Pharmacia Biotech), which yielded a first,
symmetrical peak corresponding to Ape1 protein and the AP endonuclease
activity, and a second peak corresponding to residual lysozyme from the cell lysis procedure (41).
purification, expression of the protein and preparation of
lysate (fraction I) were performed basically the same as for Ape1
purification. After dialysis against Buffer B (50 mM
Tris-HCl (pH 8.0), 1 mM EDTA, 0.1 mM
dithiothreitol, and 10% (v/v) glycerol) containing 100 mM
KCl, fraction I was applied to a 60-ml phosphocellulose (Whatman P11)
column and then eluted with a linear gradient of 100-800
mM KCl in Buffer B. The peak fractions containing active
Pol were pooled and dialyzed against Buffer B containing 100 mM KCl, (fraction II). Fraction II was applied to a 1-ml
heparin column (Amersham Pharmacia Biotech) and eluted with a linear
gradient of 50-750 mM KCl in Buffer B. Fractions
containing active Pol were pooled. Analysis of these fractions by
SDS-PAGE indicated that they contained only a single protein detectable
by silver staining (data not shown).
and a 51-mer oligonucleotide (100 nM)
containing a natural AP site as the substrate. The concentration of
proteins used is indicated in the figure legends. After the incision
reactions, the AP site was treated with NaBH4 (140 mM) to reduce and stabilize it against spontaneous
-elimination (45). After inactivation of the enzymes by heating at
80 °C for 1 min, the DNA was analyzed on a 20% polyacrylamide gel
containing 8 M urea. The amount of DNA present in each band
was quantified using a Molecular Imager system (Bio-Rad).
-32P,uracil-3H]dUMP was used as a
substrate. Just before use, the polymer was treated with uracil-DNA
glycosylase (kindly provided by Dr. Dale Mosbaugh, Oregon State
University) at 37 °C for 1.5 h under standard assay conditions.
The AP endonuclease assays contained DNA with 1.8 pmol of AP sites in
25 µl, and the reactions were initiated by addition of an enzyme
sample (
2 µl), followed by incubation at 37 °C for 5 min. The
reactions were stopped by addition of 25 µl of stop solution (0.45 N NaOH, 25 mM EDTA) and heating for 45 min at
65 °C. The amount of incised AP sites was determined as the
acid-soluble, Norit-nonadsorbed radioactivity following treatment
at alkaline pH; -elimination of nonincised AP sites does not
liberate the 32P label in Norit-nonadsorbable form (34).
One unit of AP endonuclease was defined as the amount of activity that
cleaves 1 pmol of AP sites per min.
activity during purification, a
hairpin-structured oligonucleotide DNA (46) was used as a substrate. Assays contained 50 pmol of substrate DNA in buffer, 25 µl of 50 mM HEPES-KOH (pH 7.5), 50 mM KCl, 0.1 mg/ml
BSA, 10 mM MgCl2, 0.5 mM
dithiothreitol, and 100 µM each of
[-32P]dTTP, dGTP, dCTP, and dATP and were initiated by
the addition of an enzyme sample (2 µl) and incubation at 37 °C
for 5 min. The reactions were stopped by addition of 25 µl of 50 mM EDTA, and 5-µl samples were spotted on DE81 paper
(Whatman), which was washed three times with 0.5 M
Na2HPO4. The amount of incorporated dTMP
was determined as the radioactivity retained on the paper (38).
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
95%) with Mr ~37,000 as
expected for this protein of 35,500 Da (7). Interestingly, the two
proteins containing the D283A mutation migrated slightly faster in the
gel. Table I summarizes the enzymatic
activity of the purified proteins.
View larger version (82K):
[in a new window]
Fig. 1.
SDS-PAGE analysis of purified Ape1
proteins. Each lane contained 1.5 µg of protein. Electrophoresis
was performed using a 12% polyacrylamide gel, followed by Coomassie
Blue staining according to Sambrook et al. (38).
M, marker proteins, in descending order of
Mr: 97,400, 66,000, 45,000, 31,000, 21,500, and
14,500 (from top to bottom). Lane 1, wild-type Ape1 recombinant protein; lane 2, H309N protein;
lane 3, D283A protein; lane 4, D308A protein;
lane 5, D283A/D308A protein.
AP endonuclease activity of purified wild-type and mutant Ape1 proteins
View larger version (43K):
[in a new window]
Fig. 2.
Specific binding of wild-type and mutant
proteins to an abasic site. A and B,
autoradiographs of EMSA analysis with 51F DNA (A) or 51C DNA
(B). Reaction mixtures (10 µl) containing 1 nM
of labeled DNA and the indicated concentration of protein were
incubated and analyzed as described under "Experimental
Procedures." Filled and open arrowheads
indicate the positions of the DNA-Ape1 complexes and the free DNA,
respectively. Gels: a, wild-type Ape1; b, D283A
protein; c, D308A protein; d, D283A/D308A
protein; e, H309N protein. C, quantitation of
EMSA results. The band intensities were measured by a Molecular Imager
system, and the fraction of DNA bound was calculated as amount of
complex divided by total DNA and normalized to 100%. wt,
wild-type.
Binding affinity of wild-type and mutant Ape1 proteins for damaged DNA
and stability of the protein-DNA complexes
View larger version (33K):
[in a new window]
Fig. 3.
Kinetics of dissociation of Ape1 proteins
from an AP site. A, autoradiographs of EMSA analysis.
The reaction mixtures contained 1 nM of labeled 51F DNA and
7.8 nM of the indicated Ape1 protein and were incubated for
10 min to allow complex formation. The dissociation reactions were
started by adding a 100-fold molar excess of unlabeled 51F DNA. After
incubation for the indicated times, the remaining protein-DNA complex
was resolved as described under "Experimental Procedures."
Time 0 represents no added competitor DNA. The
filled and open arrowheads indicate the positions
of the DNA-Ape1 complexes and the free DNA, respectively. Gels:
a, wild-type Ape1; b, H309N protein;
c, D308A protein; d, D283A protein; e,
D283A/D308A protein. B, quantitation of EMSA results. The
analysis was performed as described in the legend to Fig. 2.
wt, wild-type.
View larger version (43K):
[in a new window]
Fig. 4.
Specific binding of wild-type and mutant
Ape1, or of Pol , to incised abasic sites. A,
analysis by EMSA; autoradiographs are shown. Reaction mixtures (10 µl) contained 1 nM of labeled, preincised 51F DNA and
protein as indicated. After incubation to allow complex formation, EMSA
and analysis were conducted as described under "Experimental
Procedures." The filled and open arrowheads
indicate the positions of the DNA-Ape1 complexes and the free DNA,
respectively. The asterisk represents the position of a
small fraction of single-stranded incised 51F. Gels: a,
wild-type Ape1; b, D283A protein; c, D308A
protein; d, D283A/D308A protein; e, H309N
protein; f, Pol. B, quantitation of binding to
incised DNA. Analysis was conducted as described in the legend to Fig.
2; the band indicated by the asterisk was omitted from the
analysis. wt, wild-type.
View larger version (48K):
[in a new window]
Fig. 5.
Kinetics of dissociation of Ape1 proteins
from an incised abasic site. A, dissociation followed
by EMSA; autoradiographs are shown. Reaction mixtures contained 1 nM of labeled, preincised 51F and 7.8 nM of
protein and were incubated for 10 min to allow complex formation. The
dissociation reactions were started by adding a 100-fold molar excess
of unlabeled 51F DNA. After incubation for the indicated times, the
remaining protein-DNA complex was resolved as described under
"Experimental Procedures" and loaded onto a polyacrylamide gel.
Time 0 represents no added competitor DNA. The
filled and open arrowheads indicate the positions
of the DNA-Ape1 complexes and the free DNA, respectively. The
asterisk represents the position of a small fraction of
single-stranded incised 51F. Gels: a, wild-type Ape1;
b, D283A protein; c, D308A protein; d,
D283A/D308A protein. B, quantitation of the dissociation
reaction. The analysis was carried out as described in the legend to
Fig. 2, except that the band indicated by the asterisk (see
Fig. 4 legend) was omitted from the calculations. wt,
wild-type.
tightly (Fig. 4, panel f),
even though this material is not a substrate for deoxyribose-phosphate excision by the -elimination activity of the polymerase (45). The
affinity of Pol for incised 51F DNA was such that a higher protein
concentration (estimated ~12 nM; see Fig. 4B)
was required for 50% binding by Pol than by Ape1 (compare with
Table II).
View larger version (20K):
[in a new window]
Fig. 6.
Specific binding of wild-type Ape1 to
one-nucleotide gapped DNA. A, structures of the DNA
substrates used for EMSA. The positions labeled with
-32P are indicated as P*. The 5'-ends of
oligonucleotides at the site of a gap or nick were phosphorylated with
a molar excess of unlabeled ATP using T4 polynucleotide kinase.
B, autoradiographs of EMSA analysis. Reaction mixtures (10 µl) contained 1 nM of labeled DNA substrate and the
indicated concentration of wild-type Ape1 protein, and were incubated
as described in the legend to Fig. 2. The filled and
open arrowheads indicate the positions of DNA-Ape1 complexes
and free DNA, respectively. The DNA substrates used are indicated to
the left of each gel panel; the concentration of Ape1 protein is shown
along the top. 51-Gap, duplex oligonucleotides with a
one-nucleotide gap at the same position as the F residue in 51F;
51-Nick, a nick at this position; 3'-ss and
5'-ss, protruding 3'- and 5'-single-stranded regions,
respectively.
(45) might enhance the reaction by
Ape1. Indeed, in the presence of Pol and dCTP, Ape1 incision
kinetics showed an expanded linear range (Fig. 7A, closed circles), although Pol cannot incise abasic sites (Fig.
7A, closed triangle) (45). The same effect of Pol was
seen for the D283A and D308A proteins (Fig. 7, B and
C). This result is consistent with the results from EMSA
using 51F, which show that the Ape1 proteins have affinity for incised
51F DNA.
View larger version (14K):
[in a new window]
Fig. 7.
Kinetics of the Ape1 nicking reaction.
Reaction mixtures with (closed symbols) or without
(open symbols) 250 fmol of Pol were mixed with the
indicated Ape1 protein (6.3 fmol) (circles) or buffer
(triangles) at time 0 under the standard assay conditions
containing 0.1 mM dCTP in a 25-µl final volume. Two-µl
samples were removed at the indicated times and mixed with 5 µl of a
stop solution containing 60% formamide and 20 mM EDTA. The
products were analyzed on a 20% polyacrylamide gel containing 8 M urea. The intensities of intact and incised DNA bands
were measured by a Molecular Imager system, and the amount of incision
was quantitated. The first time point was at 15 s after addition
of the Ape1 proteins. Essentially the same result was obtained in two
independent experiments, one of which is shown; we estimate the
measurement errors in these determinations to be 5%. wt,
wild-type.
actually depletes the Ape1 reaction products,
the amount of the substrate, the product, and the DNA fragment extended
one nucleotide by Pol were measured at various concentrations of
Pol (Fig. 8A). In the
presence of dCTP, the incised product (21-mer) was converted to a
22-mer by the gap-filling activity of Pol (Fig. 8, A and
B). The total amount of incised DNA (21-mer + 22-mer)
increased in a manner dependent on the Pol concentration up to ~15
nM and then continued to increase with a lower Pol dependence up to a plateau. The beginning of this plateau (at 50-100
nM Pol) was identical to concentration at which almost all the incised product (21-mer) had been converted to the 22-mer form
(Fig. 8B). The total amount of incision (21-mer + 22-mer) in
this single time point experiment was inversely correlated with the
amount of the Ape1-incised compound (21-mer) present (Fig.
8B). On the other hand, in the absence of dCTP, the smaller enhancing effect of Pol on the Ape1 reaction might not be enzymatic (Fig. 8C), but rather the Ape1-incised DNA molecules may be
sequestered through binding by high concentrations of Pol. These
results are consistent with the result from EMSA that Ape1 has high
affinity for its incised product.
View larger version (29K):
[in a new window]
Fig. 8.
Effect of Pol on the Ape1 nicking
reaction. A, nicking assay showing an autoradiograph.
Reactions (containing 100 nM substrate and the indicated
concentration of Pol, with or without 0.1 mM dCTP) were
initiated by adding wild-type Ape (3.1 fmol). After incubation for 10 min at 37 °C, the reactions were stopped by addition of 2 µl of
250 mM EDTA and analyzed on a 20% polyacrylamide gel
containing 8 M urea. B, quantitation of reaction
products in the presence of dCTP. Each band of the reaction in the
presence of dCTP was measured by a Molecular Imager system and
calculated as a fraction of the total DNA. C, the effect of
dCTP. The incision products were quantified as for B.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
, can capture the Ape1
product to overcome this limitation. Furthermore, analysis of
catalytically impaired mutant Ape1 proteins demonstrated that substrate
binding and the chemical steps of phosphodiester cleavage are separable
by certain mutations.
-elimination. We found that Ape1 binds tightly to a
5'-incised AP site, which together with the foregoing observations
indicates a strong binding determinant for the gap or "space"
itself, as originally suggested by Weiss (22) for exonuclease III.
Beyond this conclusion, the 3'-OH and 5'-phosphate moieties of the
gapped substrate are evidently not important binding determinants. One
observation that seems at first inconsistent with this model is the
report that Ape1 can incise a duplex oligonucleotide 5' to a
3,N4-benzetheno-2'-deoxycytidine residue
(47). However, molecular modeling suggests that the local structure at
the adduct site is similar to that of an AP site (48), with the
adducted base shifted away from the base in the opposite strand.
enhances Ape1 activity. This observation supports the suggestion from
EMSA experiments that the incised DNA product would be a competitive
inhibitor by strongly binding to Ape1 protein. The activating effect of
Pol on Ape1 is most likely due to its gap-filling activity, as the
activation was most effective when a nucleoside triphosphate was
present to allow DNA synthesis. These experiments also extended the
range of experiments in which the F analog and a hydrolytic AP site are
handled identically by Ape1 (19, 28, 39).
onto the
incised abasic site by specific protein-protein interactions and in the
process enhances the deoxyribose-phosphate excision reaction of Pol
(5, 39). We demonstrated here that Ape1 protein has high affinity for
the product of the DNA Pol excision reaction, a
one-nucleotide-gapped DNA. Although it is unknown how often
one-nucleotide gaps arise in DNA in vivo, this binding activity of Ape1 protein for one-nucleotide gaps might promote repair
of those gaps by allowing Ape1 to act as a molecular matchmaker (49)
for Pol and gapped DNA.
ACKNOWLEDGEMENTS
expression plasmid. We are grateful to
Dr. Yongjie Xu for critical suggestions and help with the figures and
to Donny Wong for helpful comments on the manuscript.
FOOTNOTES
Present address: Dept. of Developmental Biology and Oncology,
Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553, Japan.
, DNA polymerase ; PCR, polymerase chain reaction; MMS, methyl methanesulfonate; BSA, bovine
serum albumin; PAGE, polyacrylamide gel electrophoresis.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  V. M. Castillo-Acosta, L. M. Ruiz-Perez, W. Yang, D. Gonzalez-Pacanowska, and A. E. Vidal Identification of a residue critical for the excision of 3'-blocking ends in apurinic/apyrimidinic endonucleases of the Xth family Nucleic Acids Res., April 1, 2009; 37(6): 1829 - 1842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chen, F.-Y. Dupradeau, D. A. Case, C. J. Turner, and J. Stubbe DNA oligonucleotides with A, T, G or C opposite an abasic site: structure and dynamics Nucleic Acids Res., January 17, 2008; 36(1): 253 - 262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Maher and L. B. Bloom Pre-steady-state Kinetic Characterization of the AP Endonuclease Activity of Human AP Endonuclease 1 J. Biol. Chem., October 19, 2007; 282(42): 30577 - 30585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Masuda and K. Kamiya Role of Single-stranded DNA in Targeting REV1 to Primer Termini J. Biol. Chem., August 25, 2006; 281(34): 24314 - 24321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Takeuchi, T. Ruike, R.-i. Nakamura, K. Shimanouchi, Y. Kanai, Y. Abe, A. Ihara, and K. Sakaguchi Drosophila DNA Polymerase {zeta} Interacts with Recombination Repair Protein 1, the Drosophila Homologue of Human Abasic Endonuclease 1 J. Biol. Chem., April 28, 2006; 281(17): 11577 - 11585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-S. Sung, M. S. DeMott, and B. Demple Long-patch Base Excision DNA Repair of 2-Deoxyribonolactone Prevents the Formation of DNA-Protein Cross-links with DNA Polymerase {beta} J. Biol. Chem., November 25, 2005; 280(47): 39095 - 39103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ahn, J. A. Harrigan, F. E. Indig, D. M. Wilson III, and V. A. Bohr Regulation of WRN Helicase Activity in Human Base Excision Repair J. Biol. Chem., December 17, 2004; 279(51): 53465 - 53474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Maita, T. Anzai, H. Aoyagi, H. Mizuno, and H. Fujiwara Crystal Structure of the Endonuclease Domain Encoded by the Telomere-specific Long Interspersed Nuclear Element, TRAS1 J. Biol. Chem., September 24, 2004; 279(39): 41067 - 41076. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wong and B. Demple Modulation of the 5'-Deoxyribose-5-phosphate Lyase and DNA Synthesis Activities of Mammalian DNA Polymerase {beta} by Apurinic/Apyrimidinic Endonuclease 1 J. Biol. Chem., June 11, 2004; 279(24): 25268 - 25275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-C. Shen and L. A. Loeb Mutations in the {alpha}8 Loop of Human APE1 Alter Binding and Cleavage of DNA Containing an Abasic Site J. Biol. Chem., November 21, 2003; 278(47): 46994 - 47001. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wong, M. S. DeMott, and B. Demple Modulation of the 3'->5'-Exonuclease Activity of Human Apurinic Endonuclease (Ape1) by Its 5'-incised Abasic DNA Product J. Biol. Chem., September 19, 2003; 278(38): 36242 - 36249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Priet, J.-M. Navarro, N. Gros, G. Querat, and J. Sire Functional Role of HIV-1 Virion-associated Uracil DNA Glycosylase 2 in the Correction of G:U Mispairs to G:C Pairs J. Biol. Chem., February 7, 2003; 278(7): 4566 - 4571. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-D. Junker, S. T. Hoehn, R. C. Bunt, V. Marathius, J. Chen, C. J. Turner, and J. Stubbe Synthesis, characterization and solution structure of tethered oligonucleotides containing an internal 3'-phosphoglycolate, 5'-phosphate gapped lesion Nucleic Acids Res., December 15, 2002; 30(24): 5497 - 5508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. DeMott, E. Beyret, D. Wong, B. C. Bales, J.-T. Hwang, M. M. Greenberg, and B. Demple Covalent Trapping of Human DNA Polymerase beta by the Oxidative DNA Lesion 2-Deoxyribonolactone J. Biol. Chem., March 1, 2002; 277(10): 7637 - 7640. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. T. Hoehn, C. J. Turner, and J. Stubbe Solution structure of an oligonucleotide containing an abasic site: evidence for an unusual deoxyribose conformation Nucleic Acids Res., August 15, 2001; 29(16): 3413 - 3423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Vidal, I. D. Hickson, S. Boiteux, and J. P. Radicella Mechanism of stimulation of the DNA glycosylase activity of hOGG1 by the major human AP endonuclease: bypass of the AP lyase activity step Nucleic Acids Res., March 15, 2001; 29(6): 1285 - 1292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yang, W. M. Clendenin, D. Wong, B. Demple, M. M. Slupska, J.-H. Chiang, and J. H. Miller Enhanced activity of adenine-DNA glycosylase (Myh) by apurinic/apyrimidinic endonuclease (Ape1) in mammalian base excision repair of an A/GO mismatch Nucleic Acids Res., February 1, 2001; 29(3): 743 - 752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Hill, T. K. Hazra, T. Izumi, and S. Mitra Stimulation of human 8-oxoguanine-DNA glycosylase by AP-endonuclease: potential coordination of the initial steps in base excision repair Nucleic Acids Res., January 15, 2001; 29(2): 430 - 438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Rothwell, B. Hang, M. A. Gorman, P. S. Freemont, B. Singer, and I. D. Hickson Substitution of Asp-210 in HAP1 (APE/Ref-1) eliminates endonuclease activity but stabilises substrate binding Nucleic Acids Res., June 1, 2000; 28(11): 2207 - 2213. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. O. Bennett The Saccharomyces cerevisiae ETH1 Gene, an Inducible Homolog of Exonuclease III That Provides Resistance to DNA-Damaging Agents and Limits Spontaneous Mutagenesis Mol. Cell. Biol., March 1, 1999; 19(3): 1800 - 1809. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Masuda, R. A. O. Bennett, and B. Demple Rapid Dissociation of Human Apurinic Endonuclease (Ape1) from Incised DNA Induced by Magnesium J. Biol. Chem., November 13, 1998; 273(46): 30360 - 30365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Unk, L. Haracska, R. E. Johnson, S. Prakash, and L. Prakash Apurinic Endonuclease Activity of Yeast Apn2 Protein J. Biol. Chem., July 14, 2000; 275(29): 22427 - 22434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Masuda, M. Takahashi, N. Tsunekuni, T. Minami, M. Sumii, K. Miyagawa, and K. Kamiya Deoxycytidyl Transferase Activity of the Human REV1 Protein Is Closely Associated with the Conserved Polymerase Domain J. Biol. Chem., April 27, 2001; 276(18): 15051 - 15058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Kenny, F. Mendez, M. Sandigursky, R. P. Kureekattil, J. D. Goldman, W. A. Franklin, and R. Bases Heat Shock Protein 70 Binds to Human Apurinic/Apyrimidinic Endonuclease and Stimulates Endonuclease Activity at Abasic Sites J. Biol. Chem., March 16, 2001; 276(12): 9532 - 9536. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |