| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 46, 30614-30621, November 13, 1998
From the Department of Developmental Biology, Beckman Center for
Molecular and Genetic Medicine, Stanford University School of Medicine,
Stanford, California 94305-5427
The mitochondrial genome of eukaryotic cells is
maintained by a mechanism distinct from that employed in the nucleus.
Mitochondrial DNA replication at the leading-strand origin is coupled
to transcription through the formation of an RNA-DNA hybrid known as an
R-loop. In vivo and in vitro evidence has
implicated an RNA processing enzyme, RNase MRP, in primer maturation.
In our investigation of mammalian RNase MRP, we have analyzed its
specific endoribonuclease activity on model R-loops. We demonstrate
here that human RNase MRP cleaves this distinctly configured substrate
at virtually all of the major DNA replication sites previously mapped
in vivo. We further show that the processed RNA products
remain stably base-paired to the template DNA strand and are functional
for initiating DNA synthesis on a closed circular plasmid. Thus,
in vitro initiation of leading-strand mtDNA synthesis
requires only the actions of RNA polymerase and RNase MRP for the
generation of replication primers.
Transcription of mtDNA is directed by cis-acting
elements located at the 5' boundary of the regulatory sequence known as
the D-loop, a region which also houses the leading-strand origin of replication, OH (1). Each of the two strands of the
circular mtDNA is transcribed by bacteriophage-like mtRNA polymerase,
producing polycistronic transcripts, which are processed into rRNAs,
tRNAs, and mRNAs (2). Transcripts from the light (L)-strand
promoter yield eight tRNAs, the message for NADH dehydrogenase subunit 6, and the primer precursors for leading-strand mtDNA replication. Earlier studies provided strong evidence for transcript-priming at the
mtDNA OH in human and mouse organelles (3, 4).
Surprisingly, primer RNA species were found to co-purify with mtDNA in
CsCl-ethidium bromide equilibrium density gradients (4); this result
has been recently extended by the detection of in vivo
RNA-primed DNA strands by polymerase chain reaction analysis (5).
In vitro mitochondrial transcription assays have shown that
a significant fraction of nascent transcripts in the direction of
leading-strand replication remains base-paired at the mtDNA
OH (6), a phenomenon that can explain the observed physical
association of primer RNAs and mtDNA. Since the L-strand promoter
transcripts represent genes located downstream of the DNA replication
start sites, a specific RNA processing event was hypothesized for
primer RNA 3'-end maturation. RNase MRP was originally identified as an
activity in mitochondrial extracts that fulfilled at least one of the
criteria for a specific primer maturation endonuclease (7). We have
recently reported that mouse RNase MRP has the capacity to process a
model R-loop substrate containing the OH (8). In this
report, we extend these studies to examine this unusual RNA processing
activity in the human mitochondrial system and further demonstrate that such processed RNA primers are capable of initiating DNA replication on
a model double-stranded circular mtDNA template in
vitro.
Construction of Substrates--
RNA was synthesized by SP6
transcription generated from pK408SP which was digested with
restriction endonuclease FokI. This RNA was radiolabeled
with [5'-32P]pCp (3000 Ci/mmol, NEN Life Science
Products) and T4 RNA ligase as described elsewhere (7). Labeled RNA was
purified by urea-polyacrylamide gel electrophoresis and used to
assemble the R-loop with the supercoiled pK408SP template by the
formamide annealing method described previously (9). For the
construction of the RNA-cDNA heteroduplex hybrid, an
oligonucleotide that is complementary to position 294-314 on pK408SP
(oligo HF314, 5'-d(TTGATTCCTGCCTCATCCTAT)) was annealed onto the
purified radiolabeled pK408SP-derived RNA by heat denaturation at
95 °C for 5 min and slow cooling to 37 °C over 30 min. The reaction mixture was adjusted to 50 mM Tris-HCl, pH 8.0, 50 mM KCl, 10 mM MgCl2, 2 mM dithiothreitol, 0.2 mM spermidine, and 0.4 mM dATP, dCTP, dGTP, and dTTP (Amersham Pharmacia Biotech). 10 units of AMV1 reverse
transcriptase (Life Technologies, Inc.) were added and incubated at
37 °C for 30 min. The resulting RNA-DNA hybrid was phenol-extracted,
concentrated by ethanol precipitation, and then resolved in a 4%
native polyacrylamide gel in 45 mM Tris borate-EDTA buffer
at pH 8.3. Individual species were located by autoradiography, and
full-length products were excised and eluted into 0.5 M
ammonium acetate, 0.1% SDS, overnight at room temperature. The
solution containing the hybrid was ethanol-precipitated, redissolved in water, and passed through a Sephadex G-50 (Amersham Pharmacia Biotech)
spin column.
Enzymes and Activity Assays--
RNase MRP was purified from
human KB cells, and assays were carried out as reported previously (7,
10). We detected no deoxyribonuclease activity nor any nonspecific
ribonuclease activity in our final RNase MRP preparation.
Oligonucleotide LRI, used previously for specific RNase MRP inhibitions
(8), contains the following sequence, 5'-d(GGTCCGGGGACTTTCC). Murine
and bovine endo G preparations were kindly provided by Dr. Michael J. Lieber. Reaction conditions were identical to those in Lee and Clayton (8) except endo G was added at various dilutions ranging from 1:1 to
1:1000. Digestion times at 37 °C were also varied for 15-120 min.
Reactions were quenched by phenol extraction and ethanol precipitation,
and the products were resolved as described in Lee and Clayton (8).
Micrococcal nuclease treatment of the endo G fractions had no effect on
its nonspecific cleavage activity on the R-loop and RNA-cDNA
substrates. No reproducible specific cleavage products were observed on
either substrate. Sequencing-grade ribonucleases T1 and U2 were
purchased from Amersham Pharmacia Biotech. Bacteriophage SP6 RNA
polymerase, Escherichia coli RNase H, and RNase T2 were
purchased from Life Technologies, Inc. Micrococcal nuclease and DNase I
were purchased from Boehringer Mannheim. Modified bacteriophage T7 DNA
polymerase (Sequenase® version 2) was purchased from Amersham Life Sciences.
Structural Probing Assays--
1-10 pmol of radiolabeled RNA or
R-loops were incubated in RNase MRP reaction buffer for 15 min at
37 °C in a total reaction volume of 25 µL. Serial dilutions
ranging from 1:10 to 1:106 of RNase T1, T2, V1, and U2 were
tested to generate a uniform cleavage pattern. 1 µL of appropriately
diluted ribonuclease (between 1:103 and 1:104)
was added to the sample and incubated at 37 °C for 10 s. RNase H reactions were carried out using 0.03 unit of enzyme and digested at
37 °C for 1 min. All reactions were quenched by phenol extraction, and samples were recovered by ethanol precipitation. Products were
resolved in 6% polyacrylamide gels containing 8 M urea.
In Vitro DNA Synthesis Reactions--
General methods to
generate R-loops via transcription using bacteriophage SP6 RNAP and
supercoiled templates were described in Lee and Clayton (9). Briefly,
0.5-1.5 nM DNA template, 0.4 mM complete NTP
mixture, and 10 units of SP6 RNAP were mixed in a total reaction volume
of 100 µL. When the RNA was to be internally radiolabeled, 100 µCi
of [
For DNA synthesis, the gel-filtered R-loop sample was treated with
RNase MRP or mock-treated (negative control) as above; the RNase MRP
reactions were inhibited by the addition of 40 µM of
oligo LRI. Thereafter, the reaction mixture was adjusted to 125 µM dATP, dCTP, dGTP, and dTTP (Pharmacia) and 13 units of modified T7 DNAP was added in a total reaction volume of 100 µL (buffer containing 20 mM Tris-HCl, pH 8, 10 mM
MgCl2, 50 mM KCl, and 5 mM
dithiothreitol). For synthesis of radioactive DNA, the reaction mixture
described above was supplemented with 25 µCi of
[
Primer extension analysis was carried out using oligo HF314
radiolabeled at the 5' terminus with T4 polynucleotide kinase (New
England Biolabs) and [ Assembly of R-loops and Structural Analysis--
Model R-loops
were reconstituted using a recombinant plasmid containing the human
mtDNA OH sequence (pK408SP) and RNA synthesized in
vitro using bacteriophage SP6 RNAP (10). The reconstituted human
R-loop exhibited chromatographic and electrophoretic properties (Fig.
1, A and B),
consistent with previously observed model R-loops (9). When the R-loop
is digested with E. coli RNase H, an endoribonuclease specific for the RNA strand in an RNA-DNA heteroduplex, a biased cleavage pattern is observed, indicating a specific region of high
cleavage frequency (Fig. 1C, lane 2). These
cleavage sites correspond to the mapped positions of the RNA-DNA
contacts within R-loops generated by transcription (6). Consistent with
previous observations, these RNA-DNA contacts localized to the
guanine-rich CSB II, one of three short elements conserved between
human and mouse mtDNAs (11). Sequence mutations within this element
completely abolish all transcription-coupled R-loop formation and
prevent the assembly of stable R-loops by the formamide annealing
method.2 Furthermore, under
our transcription reaction and formamide annealing conditions, R-loop
formation was not observed with unrelated nucleic acid sequences of
comparable size and base content (data not shown).
To assess the global structure of this stable R-loop, the RNA strand of
the R-loop was systematically digested with ribonucleases of various
specificities. In an effort to maintain a cleavage frequency of no more
than one nick per RNA molecule, ribonuclease reactions were carried out
using dilute enzyme concentrations and brief digestion times (1 min for
RNase H reactions; 10 s for all others). Because the structure of
the RNA may change after an initial cleavage event, it was important to
minimize potential experimental artifacts in obtaining structural information.
RNase V1 from cobra venom has been used to probe for regions of
potential RNA-RNA base pairing because of its preferential cleavage of
RNA in double helical or stacked base conformations (12). Aside from
those regions in RNA-DNA pairings as demonstrated by E. coli
RNase H sensitivity (Fig. 1C, lane 2), much of
the full-length of the RNA was digested by RNase V1 in a semiperiodic pattern (Fig. 1C, lane 5), implicating the
participation of those residues in RNA-RNA base-pairing. RNase T2 from
Aspergillus oryzae, a ribonuclease which cleaves after any
unpaired residue, cleaved the RNA strand in the R-loop at those sites
generally protected from RNase V1 cleavage (Fig. 1C,
lane 8), suggesting those regions to be single-stranded.
Although the highly reproducible cleavage patterns may reflect a
composite of multiple subpopulations of differing RNA conformations,
these results indicate that the RNA strand in the R-loop is only
partially base paired to the DNA template.
The surprisingly complex structure of the RNA strand in the R-loop was
compared with the free RNA by probing with two highly specific
ribonucleases (Fig. 1D). The cleavage patterns generated by
RNase T1 from A. oryzae (specific for unpaired guanine) and RNase U2 from Ustilago sphaerogena (unpaired adenine Human RNase MRP Cleaves the R-loop Substrate--
Having obtained
gross structural information on the R-loop, we then asked if human
RNase MRP can cleave this substrate in a physiologically relevant
manner. RNase MRP was purified from human KB cells as described
previously (7, 10), and a standard amount was added to reaction
mixtures containing 0.5-1.5 nM R-loop substrate.
Digestions were quenched by phenol extraction, and samples were
recovered by ethanol precipitation. Reaction products were resolved in
6% polyacrylamide gels containing 5 M urea and visualized
by autoradiography. Addition of the human RNase MRP fraction resulted
in multiple cleavage products (Fig.
2A, lane 3). To
confirm that RNase MRP catalyzed this reaction, the ribonucleoprotein composition of the holoenzyme was targeted for selective inhibition. Micrococcal nuclease was previously used to digest the RNA subunit of
RNase MRP and thereby abolish enzymatic activity (13). A standard
amount of the RNase MRP fraction was treated with micrococcal nuclease
in the presence of Ca2+ (an essential metal cofactor), the
digestion was quenched with EGTA (a calcium-specific chelator), and
then assayed for R-loop processing activity by the addition of the
substrate. Consistent with previous results, the observed R-loop
processing activity was abolished (Fig. 2A, lane
7), demonstrating a requirement for RNA in the R-loop cleavage
reaction. The requirement for protein subunits in the reaction was
tested by heat inactivation or by treatment of the enzyme fraction with
proteinase K, a serine protease active on native polypeptides. After
digestion of the fraction with proteinase K, all R-loop processing
activity was again abolished (Fig. 2A, lane 9).
In contrast, inactivated proteinase K had no inhibitory effect (Fig.
2A, lane 8).
The specificity of the RNase MRP RNA subunit involved in the cleavage
reaction was previously shown by using an antisense oligonucleotide
directed against the 265-nucleotide MRP RNA (13). Addition of the
antisense oligonucleotide, oligo LRI (8), inhibited the observed R-loop
cleavage reaction in a concentration-dependent manner (Fig.
2B, lanes 3-5). In contrast, an unrelated
oligonucleotide of comparable length, oligo 5.8S, had no effect at the
concentrations tested (Fig. 2B, lanes 7-10).
Since we have previously shown that oligo LRI had no inhibitory effect
on the related ribonucleoprotein endonuclease RNase P, these data
suggest that the observed R-loop processing reaction is catalyzed
specifically by RNase MRP (8).
Certain antisera from humans with clinical autoimmune syndromes are
known to bind particular ribonucleoproteins selectively. The Th/To
human autoantiserum was previously shown to immunoprecipitate the RNase
MRP ribonucleoprotein and thereby deplete enzymatic activity (14).
Crude Th/To serum was adsorbed onto Staphylococcus aureus
protein A-Sepharose beads (PAS), washed, and incubated with a standard
amount of the human enzyme fraction. After centrifugation, the
supernatant was assayed for activity. Control experiments were carried
out in parallel using serum from a normal subject. While R-loop
processing was unaffected by immunoprecipitation with the normal serum
(Fig. 2C, lane 2), the Th/To serum depleted the
observed R-loop processing activity (Fig. 2C, lane
3).
To determine whether the unique structure of the R-loop is required for
the cleavage reaction, we assayed a simple RNA-DNA heteroduplex
constructed with the same RNA substrate and its cDNA made by
reverse transcription (see "Experimental Procedures"). This RNA-DNA
hybrid was digested by E. coli RNase H in a nonspecific manner, yielding no oligoribonucleotides of significant length (Fig.
2D, lane 2). In contrast, this substrate was not
cleaved by RNase MRP (Fig. 2D, lane 3), an
observation consistent with previous reports (7, 8). This experiment
also demonstrates the absence of nonspecific RNase H activities in the
RNase MRP preparation. Interestingly, this type of RNA-cDNA
heteroduplex was reported to be a substrate for endo G, an abundant
mitochondrial endonuclease proposed to generate primers for mtDNA
replication (15). Therefore, in an effort to rule out contamination of
our RNase MRP preparations, purified endo G was used to obtain a
cleavage pattern on our model substrates. Under our reaction
conditions, endo G efficiently degraded the RNA strand as well as the
DNA template of our R-loop and heteroduplex in a nonspecific manner, generating no population of oligoribonucleotides with a distinctive length (data not shown). Thus, the R-loop processing observed with our
RNase MRP preparation is not due to the action of endo G. We
conclude from these and the above results that the observed R-loop
cleavage reaction is an activity of RNase MRP.
Mapping of the cleavage sites on the R-loop was achieved by resolving
the RNase MRP reaction products next to RNA sequencing ladders in
polyacrylamide-urea gels (Fig.
3A). The cleavage sites, arbitrarily labeled 1 through 7, were then compared with the positions of previously mapped sites of RNA priming and DNA synthesis initiation. Although the human in vivo mapping data are complex with
regard to the extensive microheterogeneity of RNA and nascent DNA
termini, we observed alignment of the majority of the RNase MRP
cleavage sites with a significant number of the in vivo
priming sites, most notably the major DNA synthesis initiation site
positioned ~16-20 bases downstream of CSB I, classically defined as
the principal OH (Fig. 3B, cleavage site
6). Remarkably, RNase MRP cleavage site 6 corresponds precisely
with the major H-strand 5' termini more recently mapped by Kang
et al. (5) using a polymerase chain reaction method. By
inspection, the cleavage site selection followed no apparent sequence
rule. This finding is consistent with previous results in the mouse
system, where R-loop cleavage sites do not bear any obvious sequence
homology. More importantly, the sites of cleavage for each species,
differing in spatial and sequence parameters, reflect the correct
placement with respect to mapping of nascent in vivo DNA
strands. Conservation of accurate processing across species supports
the role of RNase MRP in primer RNA formation.
To address the issue of physiological relevance, we have examined
whether the RNase MRP cleavage products are functional as replication
primers. Although mtRNA polymerase and mtDNA polymerase (pol RNase MRP Processing Is Required for Initiating DNA Synthesis in
Vitro--
Transcription was carried out in the presence of
[
Using the transcription-generated R-loops, we next assessed the fate of
the hybridized RNA following the action of RNase MRP. Digestions were
carried out as before, but RNase MRP reactions were quenched by the
addition of oligo LRI (40 µM) to permit rapid handling
steps. Because we wished to know whether the processed RNAs remained
base-paired to the DNA template, the reaction samples were passed over
a high molecular weight exclusion column (Sepharose CL-4B). Recovered
samples were then phenol extracted, ethanol-concentrated, and resolved
in denaturing gels as before. As shown in Fig. 4, lane 3,
RNase MRP generated only marginally visible discrete-length RNA
fragments against the smear of radioactivity. However, the relative
amount of the ~130-nt cluster of bands is significantly reduced,
indicating that these RNAs were not of sufficient stability to elute
with the DNA template in the second gel filtration step.
To address whether the RNAs that remained following the action of RNase
MRP could be extended by a DNAP, the R-loop substrate was treated with
RNase MRP as above and, following the digestion, the mixture was
adjusted to 125 µM each of the four nonradioactive dNTPs
and 13 units of modified T7 DNAP (Sequenase® version 2) in a total
reaction volume of 100 µl (see "Experimental Procedures"). We
note that a relatively large amount of T7 DNAP was required to
visualize final products, perhaps reflecting this enzyme's low
activity on duplex DNA templates. After incubation at 37 °C for 15 min, the entire reaction volume was again passed through the gel
filtration column, followed by phenol extraction and precipitation. Of
the many bands still within the radioactive smear, several discrete-length products ranging in size from ~130 to ~300 nt were
readily visible (Fig. 4, lane 4). Since the DNAP reactions were carried out on a supercoiled plasmid template, these species probably represent DNA synthesis termination events due to a
topological constraint. The ~300-nt product would require helix
unwinding of ~9% of the total DNA template length (3.4 kilobase
pairs), consistent with relaxation of a circle of this size (9).
Therefore, T7 DNAP is not expected to be capable of extending beyond
this point without accessory factors. A similar observation was
reported for the yeast mtDNA supercoiled templates in sequential mtRNA polymerase and mtDNA polymerase reactions (16). The ~130-nt cluster
of bands was more prominent in this particular autoradiogram (Fig. 4,
lane 4), but this effect did not correlate with DNAP activity in repeated experiments (data not shown) and may represent some flow-through in the gel filtration step. Addition of T7 DNAP alone
resulted in few discrete products (Fig. 4, lane 5). Hence, these results suggest that the appearance of nascent DNA products is
dependent on the action of RNase MRP. In these experiements, since the
only radioactive entity is RNA, the newly formed products must be
composed of both RNA and DNA.
To confirm this observation, we carried out a parallel experiment in
which the R-loop was generated by transcription in the presence of
nonradioactive NTPs and subsequently digested with RNase MRP in the
standard manner. DNA synthesis was then carried out in the presence of
[
To probe further the structure of the RNA-containing nascent DNA, an
equivalent amount of the completed DNAP reaction was each treated with
RNase H or RNase T2, as described above. After the ribonuclease
digestions, the samples were passed through the gel filtration column
and further processed in the standard manner. Digestion of these DNA
products with RNase H and RNase T2 each generated smaller fragments
ranging from ~90 to ~150 nt in length, indicating that the length
of the RNA component of the nascent chain is significant (Fig. 4,
lanes 7 and 8, respectively). By comparing the
largest bands in Fig. 4, lane 6, with those of lanes 7 and 8, we can estimate the length of the RNA
component of the nascent DNA chains to be ~150 to 190 nt.
Interestingly, the RNase H result demonstrates that the DNAP extension
products contain RNA at their 5' termini in a configuration also
accessible to RNase T2, a structural presentation similar to those
reported by others (17, 18). Close scrutiny of the bands in Fig. 4, lanes 7 and 8, reveals that the RNase H-generated
products are larger by 1 or 2 nt relative to those generated by RNase
T2; this is also consistent with the observations of other
investigators (17, 18). We also note that, after the ribonuclease
treatments, the total amount of radioactivity that passes through the
gel-filtration column is decreased by 75-90% relative to the
untreated RNase MRP-DNAP reaction, suggesting that the loss of the RNA
component destabilizes the nascent DNA strand from the template. These
results demonstrate that the processed RNAs in the R-loops remain on
the DNA template and are capable of providing 3' termini for initiating DNA synthesis on a closed circular model mtDNA template.
Because the in vitro DNA synthesis reactions were performed
on circular DNA templates, we wished to obtain more precise positional information on the RNA-primed nascent DNA strands. Transcription, RNase
MRP, and T7 DNAP reactions were performed as before, but in the absence
of labeled nucleotides. RNA-primed DNA products were then analyzed by
primer extensions using AMV reverse trancriptase and a 5'-end-labeled
oligonucleotide complementary to the 3' region of the furthest RNase
MRP cleavage site. Products were resolved next to
dideoxyribonucleotide-terminated sequencing reactions using the same
radiolabeled oligonucleotide. The experimental control demonstrates
that the SP6 RNAP reaction yields essentially full-length RNA
originating from the promoter (Fig. 5,
lane 2). However, when RNase MRP and T7 DNAP are included in
the reaction, multiple primer extension products are visible, some
minor species extending as far as CSB I (Fig. 5, lane 3).
This result is consistent with that observed with the internally
labeled DNA synthesis reactions described above (Fig. 4). Although
there is a background of multiple primer extension products due to the
presence of the template plasmid (Fig. 5, compare lanes 1 and 5), the observed cluster of bands is reproducible and
depends on the actions of RNase MRP and T7 DNAP. These products were
treated with RNase T2 to determine the precise locations of the RNA to
DNA transitions. As shown in Fig. 5, lane 4, the transitions
map precisely to the RNase MRP cleavage sites 5, 6, and 7. By comparing
the difference in size of the primer extension products, we deduce that
the RNA component of the nascent DNA chains is approximately 157, 172, and 185 nt. Hence, it appears that only the RNase MRP-generated primer
RNA termini that map downstream of CSB I are extended by T7 DNAP. This
result is consistent with the in vivo distribution of RNA to
DNA transitions observed in human mitochondria (3). We suggest that our
reconstituted heterogeneous DNA replication system correctly
recapitulates the in vivo replication mechanism.
The results of our studies suggest that the initiation of DNA
replication at the mammalian mtDNA OH involves
transcription-coupled synthesis of a structurally complex pre-primer
RNA that remains stably hybridized to the DNA template. We have
demonstrated the RNA processing activity of human RNase MRP on model
R-loops either assembled in vitro or generated by
transcription. Since we have found that RNase MRP cleaves at virtually
all of the known priming sites, the action of this single enzyme can
account for the heterogeneous primer RNA species observed in
vivo. We have also demonstrated that the products of RNase MRP
cleavage remain stably base paired to the DNA template strand, and
these RNA fragments are capable of initiating DNA synthesis in
vitro using a heterologous bacteriophage DNAP. Although relatively
inefficient, we have shown that in vitro activation of the
mtDNA leading-strand origin can be achieved simply by the actions of
RNAP and RNase MRP.
Compelling observations support a conserved mechanism among animal
mitochondria, the universal proximity of known transcriptional promoters and replication origins, and the ability of RNase MRP from
various species to process the respective mtRNAs in all cases where it
has been investigated. However, a true in vitro mtDNA replication system awaits the availability of well defined mammalian mitochondrial enzymes. The sequence of the putative human mtRNA polymerase catalytic subunit is now known (19); however, the precise
composition of the holoenzyme remains ill defined. Characterizations of
the mtDNA polymerase (pol Our in vitro model system has permitted the clear
demonstration of transcription-coupled DNA synthesis that requires a
critical RNA processing step. The remarkable correlation of in
vitro cleavage sites on the model R-loops with the known RNA to
DNA transitions at the mtDNA OH suggests that the RNase MRP
reaction proceeds in vivo. How substrate recognition is
achieved by RNase MRP remains unclear, but our current work implies
that a specific higher order RNA structure is important. Functionally,
the mtDNA initiation mechanism is similar to those of certain
prokaryotic systems such as the ColE1 replicon and bacteriophage T7
where RNA-DNA hybrids are critical intermediates of
transcription-generated RNA primers. For ColE1, the large (555 nt)
mature primer is produced by the action of RNase H (23, 24); while for
T7, replication occurs by the sequential actions of phage-encoded RNAP
and DNAP presumably via the formation of transient but sufficiently
stable RNA-DNA hybrids (25, 26). The mitochondrial system is unique in
this regard, requiring a ribonucleoprotein enzyme to generate the
mature primer termini. Why such an enzyme has been evolutionarily
selected to process the mitochondrial primer RNAs is enigmatic, but the highly organized structure of the preprimer RNA suggests a unique substrate-enzyme interaction.
Phylogenetic sequence comparisons have suggested the presence of
tRNA-like structures at known or presumed OH regions of
several mammalian species (27). The presence of these structures is intriguing because of biochemical and antigenic similarity of RNase MRP
to the universally found ribonucleoprotein RNase P, which catalyzes the
5' maturation of pre-tRNAs (28). Our initial R-loop structural studies
indicate that the RNA structure is not confined to a canonical RNA-DNA
hybrid throughout its length, and it is likely to exist as a
specifically folded entity. We suggest that this folded structure is
the substrate feature recognized by RNase MRP. Additional speculation
on a common ancestral past between RNase MRP and RNase P is based on
the proposed nucleolar function of RNase MRP in rRNA processing in
S. cerevisiae (29-31). Indeed, it is probably more than
coincidental that, for mammalian mtDNA, the two rRNAs are immediately
separated and flanked by tRNAs. How the distinct nuclear and mtRNA
processing roles of RNase MRP are coordinated and regulated remains a
challenging question for further investigation.
We thank Jackie Doda for technical assistance
with mammalian cell lines. We also thank Tim Brown and David Garman for
critical review of the manuscript.
*
This work was supported by NIGMS, National Institutes of
Health Grant R37-GM33088-27 (to D. A. C.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Howard Hughes Medical
Institute, 4000 Jones Bridge Rd., Chevy Chase, MD 20815-6789. Tel.: 301-215-8807; Fax: 301-215-8828; E-mail: clayton{at}hhmi.org.
The abbreviations used are:
AMV, avian
myeloblastosis virus; PAS, protein A-Sepharose; nt, nucleotide; LRI, long range interaction; RNAP, RNA polymerase; DNAP, DNA polymerase; CSB, conserved sequence block.
2
D. Y. Lee and D. A. Clayton,
manuscript in preparation.
Initiation of Mitochondrial DNA Replication by Transcription
and R-loop Processing*
and
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-32P]UTP (300 Ci/mmol, NEN Life Science Products)
were included in the transcription mixture. Reactions were quenched by
phenol extraction and ethanol precipitated. Dried pellets were
redissolved in 50 mM Tris-HCl, pH 8, and applied onto a 1.5 cm × 3-cm benzoylated-naphthoylated-DEAE cellulose column as
described in Lee and Clayton (9). After the ion-exchange fractionation,
the mixture was passed through a 1.5 cm × 6-cm Sepharose CL-4B
(Amersham Pharmacia Biotech) column in 20 mM Tris-HCl, pH
8, 50 mM KCl. The substrate concentration was quantitated,
aliquoted, and adjusted to standard RNase MRP reaction conditions.
RNase MRP digestions were carried out in a total reaction volume of 25 µL; reactions were stopped by the addition of 40 µM
oligo LRI. Thereafter, the entire reaction mixture was passed through a
Sepharose CL-4B (equilibrated in 20 mM Tris-HCl, pH 8, 50 mM KCl) spin column constructed in a 3-ml syringe barrel. Negative RNase MRP controls were treated in the same manner. Samples were phenol extracted and recovered by ethanol precipitation.
-32P]dATP (3000 Ci/mmol, NEN Life Science Products).
Reactions were incubated at 37 °C for 15 min, after which the entire
reaction mixture was passed through a 1.5 cm × 3-cm Sepharose
CL4B column. Thereafter, samples were phenol-extracted, concentrated by
ethanol precipitation, and resolved in denaturing gels.
-32P]ATP (6000 Ci/mmol, NEN Life
Science Products). Oligo HF314 was annealed, and 10 units of AMV
reverse transcriptase were added as described above for the cDNA
synthesis reactions. Samples were incubated at 37 °C for 30 min
followed by phenol extraction and ethanol precipitation. Ribonuclease
digestion of DNA synthesis reaction was carried out by incubation with
10 units of RNase T2, followed by phenol extraction. After ethanol
precipitation, samples were analyzed by primer extension as described
previously. Deoxyribonuclease treatment was carried out in an analogous
manner but with 10 units of RNase-free DNase I. Sequenase-dideoxyribonucleotide DNA sequencing reactions were carried
out as described by the kit manufacturer (U. S. Biochemical Corp.).
Products were resolved in 6% polyacrylamide, 8 M urea gels.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (64K):
[in a new window]
Fig. 1.
Analysis of reconstituted human mitochondrial
R-loop substrate. A, the assembled RNA-DNA hybrid was
resolved by electrophoresis using a 0.8% agarose gel in 45 mM Tris borate, pH 8.3 (TB buffer) and stained with
ethidium bromide. The size standard (1 kilobase pair DNA ladder) was
resolved in lane 1; the supercoiled pK408SP plasmid used for
R-loop assembly in lane 2; and the purified RNA-DNA hybrid
in lane 3. The slower migrating complex (labeled
hyb) is the R-loop form which is topologically relaxed
relative to the free plasmid. B, 32P-end-labeled
RNA and the reconstituted R-loop are resolved in an agarose gel,
transferred to nitrocellulose, and autoradiographed. Lane 1 is the 32P-labeled size standard; lane 2, the
free RNA; and lane 3, the R-loop. C, the
reconstituted R-loop is partially digested with E. coli
RNase H (lane 2), RNase V1 (lane 5), and RNase T2
(lane 8). Partial hydrolysis of the RNA served as markers
(lanes 3 and 6). Negative control reactions are
shown in lanes 1, 4, and 7. The
diagram to the right of the panel shows the relative positions of the
CSBs. D, partial RNase T1 digestion of the R-loop substrate
denatured in the presence of 5 M urea (lane 2);
the free RNA (lane 3) and the native R-loop (lane
4). Partial RNase U2 digestion of urea-denatured R-loop
(lane 5); the free RNA (lane 6); and the native
R-loop (lane 7). A mock reaction control is shown in
lane 1.
unpaired guanine) revealed that the RNA strand in the R-loop was folded into a structure surprisingly similar to that of the free RNA. For
RNase T1, differences between the free RNA and R-loop cleavage patterns
were limited to the CSB II-CSB III region, where the RNA is base-paired
with the DNA template as judged by the RNase H cleavage pattern. The
cleavage sites located at the 3' boundary of CSB II in the free RNA
were reduced in the R-loop; likewise, the relatively efficient cleavage
site located between CSB II and CSB III is protected in the R-loop
(Fig. 1D, lane 3 versus lane
4). Interestingly, the guanine residues of CSB II are well protected against RNase T1 cleavage even in the free RNA, implying that
this region may be configured in a manner that is sterically occluded
from the enzyme. For RNase U2, since there is only one adenine residue
in CSB II, which is protected in the free RNA, there is little overall
difference between the cleavage patterns of the free RNA and R-loop
(Fig. 1D, lane 6 versus lane
7), a surprising observation that has been previously reported for
the mouse mtRNA sequence (9). Hence, for both ribonucleases used in
this assay, there is little discernible difference in the cleavage pattern between the free and R-loop form of the RNA. Although the
physiological relevance for the extensively folded RNA structure in the
R-loop complex is presently under investigation, our initial experimental results suggest it is likely to be important in RNase MRP
substrate recognition.2 This similarity in higher order
structure may also explain the ability of RNase MRP to cleave the free
RNA substrate as previously reported (8, 10).
View larger version (48K):
[in a new window]
Fig. 2.
Human RNase MRP cleaves the R-loop
substrate. Abbreviations shown above each lane are the following:
cont, control; H, RNase H; MRP or
M, RNase MRP; Ca, calcium; MN,
micrococcal nuclease; protK, proteinase K; norm,
normal serum; Th/To, autoimmune serum. A, the
R-loop form (lane 1) was quantitatively digested with E. coli RNase H (lane 2) and with purified human RNase MRP
(lane 3) for 60 min under standard conditions. Addition of
calcium chloride (lane 5), or micrococcal nuclease alone
(lane 6) had no effect on the cleavage reaction.
Predigestion of the RNase MRP fraction with micrococcal nuclease with
calcium chloride resulted in loss of R-loop cleavage activity
(lane 7). Predigestion of the RNase MRP fraction with the
serine protease proteinase K abolished the activity (lane
9), while phenylmethylsulfonyl fluoride
(PMSF)-inactivated proteinase K had no effect (lane
8). B, addition of antisense oligo LRI to the RNase MRP
reaction mixture inhibits the R-loop cleavage activity. The
oligonucleotide preparation contains no ribonuclease contamination
(lane 1) and increasing concentrations (lanes
3-5) effectively blocked R-loop processing activity. Addition of
a standard amount of RNase MRP in each trial is indicated with a + over
the lane. In the right panel the same procedure was employed but using
an unrelated oligonucleotide 5.8S. Addition of
oligonucleotide 5.8S had no effect on R-loop processing activity
(lanes 8-10); negative control, lane 6.
C, imunoprecipitation of RNase MRP abolishes R-loop cleavage
activity. Negative controls include precipitation with PAS alone
(lane 1) and PAS-adsorbed immunoglobulins from normal human
serum (lane 2). Treatment with PAS-adsorbed immunoglobulins
from To/Th serum (lane 3) effectively abolished the R-loop
cleavage activity. D, RNA-DNA heteroduplex constructed with
the same RNA and cDNA synthesized by reverse transcription is not
cleaved by RNase MRP. The RNA-cDNA hybrid (lane 1) is
digested with E. coli RNase H to yield oligoribonucleotide
products (lane 2), but is resistant to cleavage by RNase MRP
(lane 3).
View larger version (16K):
[in a new window]
Fig. 3.
Mapping of the RNase MRP cleavage sites.
A, autoradiogram of RNase MRP cleavage reaction products
resolved adjacent to enzymatic RNA sequencing ladders. Only RNase U2 (A
G) and RNase T1 (G-specific) reactions are shown and labeled over
corresponding lanes. RNase MRP cleavage reaction and negative reaction
are also indicated above their respective lanes. Arrowheads
to the right of the panel indicate the cleavage sites arbitrarily
numbered 1 through 7. B, position of RNase MRP cleavage
sites on the L-strand RNA sequence from the start of transcription
(LSP(+1)) are indicated with numbered arrowheads.
CSB III, II, and I are indicated, as well as the in vivo
mapped 3' termini of primer RNAs (R3') and 5' sites of
nascent DNA strands (D5'). The major DNA initiation start
site is bolded and coincides with RNase MRP cleavage site 6. The
asterisk located immediately upstream of CSB II shows the
previously demonstrated cleavage site of RNase MRP on the free L-strand
RNA substrate (19).
)
activities have been biochemically fractionated from mammalian cell
extracts, such preparations are not of sufficient purity to
characterize sequential in vitro enzymatic reactions on
R-loop substrates reliably. Therefore the well defined activities of recombinant bacteriophage SP6 RNAP and T7 DNAP were employed to follow
the fate of the transcription-generated RNA primers as a function of
RNase MRP activity.
-32P]UTP using SP6 RNAP on supercoiled plasmid
pK408SP, and the resulting R-loop was purified by ion-exchange
chromatography on benzoylated-naphthoylated-DEAE cellulose and
gel-filtration (see "Experimental Procedures"). These purification
steps were required to remove the abundant amount of variable-length
free RNAs from those assembled into R-loops. Hybridized RNAs were
demonstrated by their persistence after size-exclusion chromatography
and sensitivity to E. coli RNase H (Fig.
4, lanes 1 and 2,
respectively). The same procedure using the parental vector, pSP65,
resulted in no detectable hybridized RNA (data not shown). Also, R-loop
formation via transcription required superhelical tension in the
template plasmid as previously reported (9). Consistent with earlier
observations (6, 9), the nonspecific smear of radioactivity in Fig. 4,
lane 1 contains a group of strong transcriptional pause or
termination products of ~130 nt. If we assume that these RNA
fragments represent full-length strands initiating from the promoter,
their 3' termini would map to the 5' boundary of CSB II. A shorter
autoradiographic exposure (data not shown) indicated that this cluster
of bands is of the same size as those observed in Fig. 4, lane
4, and, less intensely, in lane 5. We have noticed that
this effect was dependent on the NTP and enzyme concentrations as well
as reaction times (data not shown), suggesting that multiple rounds of
transcription may be blocked at the CSB II site perhaps due to the
strong RNA-DNA base pairing in that region. It is also possible that
these abortive transcripts may have remained hybridized to the DNA
template by base pairing at the CSB III region, an element previously
reported to influence greatly the stability of the RNA-DNA interaction (6). We also note that due to the high specific radioactivity of the
transcript, which was necessary to detect final products after the
multiple reaction and purification steps, the RNA was unavoidably
subject to radiochemical hydrolysis, contributing to the nonspecific
background smear (Fig. 4, lanes 1 and 3-5).
View larger version (37K):
[in a new window]
Fig. 4.
RNase MRP R-loop cleavage products remain on
the DNA template and can function as primers for DNA synthesis in
vitro. Transcription using bacteriophage SP6 RNAP and
[ -32P]UTP in a complete NTP mixture resulted in a
persistent R-loop on supercoiled pK408SP; this hybrid eluted in the
void volume of a Sepharose CL-4B column (lane 1). RNA-DNA
base pairing was verified by digestion with E. coli RNase H
as shown by loss of radioactive RNA following passage through a second
CL-4B column (lane 2). Digestion with RNase MRP and a second
gel filtration step generated a complex pattern of products which
remained bound to the template plasmid (lane 3). Addition of
T7 DNAP and free dNTPs to the resultant RNA-bound plasmid generated
multiple extension products of up to ~300 bases in length following
passage through the gel filtration column (lane 4). In the
absence of RNase MRP, addition of T7 DNAP resulted in few extension
products (lane 5). In the right panel, RNA was
synthesized with SP6 RNAP and nonradioactive NTPs. The nonradioactive
R-loop was digested with RNase MRP followed by the addition of T7 DNAP
and [-32P]dATP in a complete dNTP mixture; thereafter
passed through the sizing column (lane 6). After the DNA
synthesis reaction, the sample was digested with E. coli
RNase H (lane 7) or RNase T2 (lane 8) and again
subject to gel filtration. Open arrowheads
indicate the position of RNase MRP-generated RNA fragments and
filled arrowheads indicate the major extension
products resulting from the action of T7 DNAP.
-32P]dATP (plus complete dNTP mix) and T7 DNAP as
described above. Following the same procedure, the reaction samples
were passed through a final gel filtration column, concentrated, and
resolved in denaturing gels. Again, multiple bands were observed,
indicating the synthesis of new DNA strands that matched the major
bands observed in the RNA-labeled experiment (Fig. 4, lane
6; compare with lane 4). The cluster of ~130-nt bands
is not visible in these experiments, suggesting that the presumed
abortive RNA products are not substrates for T7 DNAP. This parallel
experiment permitted the clear identification of nascent DNA products,
devoid of the RNA breakdown that was observed when the transcripts were radiolabeled.
View larger version (39K):
[in a new window]
Fig. 5.
Primer extension analysis of in vitro
synthesized nascent DNA chains. R-loop synthesis, RNase MRP
processing, and T7 DNAP reactions were carried out as described but in
the absence of radionuclides. Products were further processed as
described and hybridized to a 5'-end-labeled oligonucleotide
complementary to position 294-314 of the H-strand (see "Experimental
Procedures"). The oligonucleotide was extended with AMV reverse
transcriptase (lanes 1-5). The same primer was used for
dideoxyribonucleotide sequencing. Lanes G, A,
T, and C indicate the respective chain
terminator. Lane 1 is the circular DNA template (pK408SP)
alone. Lane 2 is the SP6 RNAP reaction alone. Lane
3 is the RNase MRP + T7 DNAP reaction. Lane 4 is the
RNase MRP + T7 DNAP product sample treated with RNase T2. Lane
5 is the RNase MRP + T7 DNAP reaction treated with DNase I. Arrowheads indicate the positions of RNA to DNA transitions
corresponding to RNase MRP cleavage sites 5, 6, and 7.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
) from Drosophila indicate that it is a multimeric holoenzyme with at least two subunits (20, 21), but
the mammalian counterparts still remained poorly characterized. Pol appears to lack associated 5' to 3' exonuclease and RNase H activities
(22), features that are compatible with the proposed R-loop mechanism
since we have shown that RNase H activity destabilizes the RNA-DNA
hybrid. This condition presents a potentially important consequence
because of the strong RNA-DNA interaction which may impede the complete
replication of the H-strand. Therefore we postulate a separate
mitochondrial RNase H activity that is involved in primer RNA removal.
It is also conceivable that RNase MRP, given its ability to cleave at
multiple sites, may be involved in primer RNA excision once DNA
synthesis has initiated; this remains to be tested. It is also
interesting that the nascent DNAs in our heterologous DNA synthesis
system appear to be unstable after ribonuclease treatment (Fig. 4,
lanes 7 and 8). These findings suggest that the
RNA-DNA hybrid may influence the stability of the nascent DNA chain on
the template DNA strand, perhaps by functioning as a tether that
resists branch migration. In this way, such an RNA-DNA association may
contribute to the stability of nascent H-strands in vivo as
manifested in the three-stranded "D-loop" structure of mtDNA (1). A
more complete understanding of how initiation is controlled requires
further characterization of the mitochondrial transcription and DNA
replication machineries.
ACKNOWLEDGEMENTS
FOOTNOTES
Medical Scientist Training Program Trainee of the National
Institute of General Medical Sciences (GM07365-19).
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  D. J. Coughlin, J. A. Pleiss, S. C. Walker, G. B. Whitworth, and D. R. Engelke Genome-wide search for yeast RNase P substrates reveals role in maturation of intron-encoded box C/D small nucleolar RNAs PNAS, August 26, 2008; 105(34): 12218 - 12223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Tan, D. S. Goerlitz, R. G. Dumitrescu, D. Han, F. Seillier-Moiseiwitsch, S. M. Spernak, R. A. Orden, J. Chen, R. Goldman, and P. G. Shields Associations between cigarette smoking and mitochondrial DNA abnormalities in buccal cells Carcinogenesis, June 1, 2008; 29(6): 1170 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Howe, R. E. R. Nisbet, and A. C. Barbrook The remarkable chloroplast genome of dinoflagellates J. Exp. Bot., March 3, 2008; (2008) erm292v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Hyvarinen, J. L. O. Pohjoismaki, A. Reyes, S. Wanrooij, T. Yasukawa, P. J. Karhunen, J. N. Spelbrink, I. J. Holt, and H. T. Jacobs The mitochondrial transcription termination factor mTERF modulates replication pausing in human mitochondrial DNA Nucleic Acids Res., October 8, 2007; 35(19): 6458 - 6474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Gill, J. Aulds, and M. E. Schmitt A specialized processing body that is temporally and asymmetrically regulated during the cell cycle in Saccharomyces cerevisiae J. Cell Biol., April 10, 2006; 173(1): 35 - 45. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. I. Piruat and J. Lopez-Barneo Oxygen Tension Regulates Mitochondrial DNA-encoded Complex I Gene Expression J. Biol. Chem., December 30, 2005; 280(52): 42676 - 42684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Srivastava and C. T. Moraes Double-strand breaks of mouse muscle mtDNA promote large deletions similar to multiple mtDNA deletions in humans Hum. Mol. Genet., April 1, 2005; 14(7): 893 - 902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Salinas, S. Wierzbicki, L. Zhou, and M. E. Schmitt Characterization and Purification of Saccharomyces cerevisiae RNase MRP Reveals a New Unique Protein Component J. Biol. Chem., March 25, 2005; 280(12): 11352 - 11360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Irvine, N. Adachi, D. K. Shibata, G. D. Cassell, K. Yu, Z. E. Karanjawala, C.-L. Hsieh, and M. R. Lieber Generation and Characterization of Endonuclease G Null Mice Mol. Cell. Biol., January 1, 2005; 25(1): 294 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Maniura-Weber, S. Goffart, H. L. Garstka, J. Montoya, and R. J. Wiesner Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells Nucleic Acids Res., November 16, 2004; 32(20): 6015 - 6027. [Abstract] [Full Text] [PDF]
|
|
