|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 46, 30651-30659, November 13, 1998
From the The differentiation of chloroplasts into
chromoplasts involves a series of biochemical changes that culminate
with the intense accumulation of long chain chromophore carotenoids
such as lycopene, rhodoxanthin, astaxanthin, anhydroeschsoltzxanthin,
capsanthin, and capsorubin. The signal pathways mediating these
transformations are unknown. Chromoplast carotenoids are known to
accumulate in green tissues experiencing stress conditions, and studies
indicate that they provide efficient protection against oxidative
stress. We tested the role of reactive oxygen species (ROS) as
regulators of chromoplast carotenoid biosynthesis in vivo.
The addition of ROS progenitors, such as menadione,
tert-butylhydroperoxide, or paraquat and prooxidants such
as diamide or buthionine sulfoximine to green pericarp discs of pepper
fruits rapidly and dramatically induce the simultaneous expression of
multiple carotenogenic gene mRNAS that give rise to capsanthin.
Similarly, down-regulation of catalase by amitrole induces expression
of carotenogenic gene mRNAs leading to the synthesis of capsanthin
in excised green pericarp discs. ROS signals from plastids and
mitochondria also contribute significantly to this process. Analysis of
the capsanthin-capsorubin synthase promoter in combination with a
Plastids are plant organelles whose diverse functions include
photosynthesis, gravity perception, and biogenesis of micro- and
macromolecules. These functions do not occur in all plastids but are
associated with structurally distinct plastid types. Plastid differentiation is a highly coordinated process involving programmed, multi-phase events that are transduced by a variety of stimuli. These
transducers activate numerous morphological and biochemical changes
that ultimately affect plastid compartmentalization. This is
particularly evident in chloroplasts undergoing the transformation to
chromoplasts, an event characterized by the synthesis and accumulation of carotenoids into unique plastid substructures. These changes are
accompanied by the yellow to red color shift in flowers, fruits, and roots of certain plants (1, 2). Although the molecular events
controlling these alterations are largely unknown, emerging evidence
suggests that reactive oxygen species
(ROS)1 may play a vital role
in this process (3). In this paper we present data showing how
oxidative stress affects carotenogenesis in plants.
Data from several model systems indicate that ROS operate at the
molecular level. Homeostatic variations in ROS levels are known to
activate normal and pathological events during animal cell development
(4, 5). For example, it has been shown that hydrogen peroxide acts as a
potent activator of NF- Plants are also subject to oxidative stresses (6, 7). Being immobile
and because of oxygenic photosynthesis, they have the highest internal
oxygen concentrations of any other organism. The concentration of
molecular oxygen in plant leaf cells is 250 µM, which
exceeds the concentration of 0.1 µM found in mammalian mitochondria (8). It has been estimated that 1% of the oxygen consumed
by plants is diverted into active oxygen (9). As a consequence, plant
cells have developed an array of nonenzymatic and enzymatic mechanisms
for scavenging this toxic component. Neutralization by isoprenoids such
as carotenoids and tocopherols (10, 11) are examples of nonenzymatic
mechanisms. Plants and other organisms also rely on the enzymatic
scavenging of ROS by catalase, glutathion peroxidase, ascorbate
peroxidase, and superoxide dismutase (6).
The damaging effects of ROS have been examined during plant stress (12)
and senescence (7). More recently, they have also been implicated in
plant-pathogen interactions (13-15).
Multiple observations also suggest that oxidative stress regulates
carotenoid biosynthesis during the chloroplast to chromoplast transition in plants. First, in Reseda odorata leaves,
rodoxanthin, a chromoplast-specific carotenoid, shows a de
novo accumulation following stembark removal (16). Apparently this
procedure causes a transient disruption of turgor pressure, which leads
to oxidative stress (17). Second, in Aloe vera (18) and
Cryptomeria (19), stress from drought and high irradiance or
low temperatures induces the de novo accumulation of
rhodoxanthin in chloroplasts, which subsequently undergo a
transformation into photosynthetically active chloro-chromoplasts.
Similarly, it is known that drought and low or high temperatures can
induce oxidative stress (12). These conditions lead to the de
novo accumulation of anhydroeschsoltzxanthin, a chromoplast
carotenoid in Buxus sempervirens leaves (20). One
explanation is that the extended chromophores of rhodoxanthin and
anhydroeschsoltzxanthin provide better photodynamic screens for
protection from the oxidative stresses generated under these conditions
than do normal leaf carotenoids, in good agreement with data based on
model studies (21-23). This mechanism is also observed in nonplants,
such as the yeast Phaffia rhodozyma, where singlet oxygen
and peroxyl radicals control the biosynthesis of astaxanthin, another
carotenoid with an extended chromophore (24).
These data point to oxidative stress as a potent driving force for the
expression of carotenoid biosynthetic genes during the chloroplast to
chromoplast transition in plants. To test this, we made use of pepper
(Capsicum annuum) fruit system (3). As pepper fruits ripen
and chloroplasts differentiate into chromoplasts, they accumulate large
quantities of carotenoids that include capsanthin and capsorubin,
compounds responsible for the red color change. Their pathway is shown
in Fig. 1. Several cDNAs for enzymes
of this pathway have been characterized (for a review, see Ref. 2). Using these as molecular probes and the promoter directing the biosynthesis of the chromoplast-specific carotenoid, capsanthin, we
show that ROS are potent inducers of carotenogenic gene mRNAs expression during chromoplast development.
Plant Material--
Bell pepper (C. annuum cv Yolo
Wonder) plants were grown under controlled greenhouse conditions, and
fruits were taken at the mature green stage.
Pericarp Disc Incubation--
After sterilization with 2%
sodium hypochlorite, pericarp discs (1.5 cm in diameter) were excised
with a cork borer. The discs were immediately treated with 20 µM diphenylene iodonium and 200 µM
aristolochic acid, unless otherwise stated, to avoid any wound-induced oxidative stress from challenged cells. Test solutions of 50 µl containing different compounds were deposited in the center of the
discs. Generally, six discs were incubated in the presence of light in
12-well titration plates (Corning Glass) at 25 °C as described
previously (25).
Polysome Isolation--
Free and membrane-bound polysomal
fractions were isolated from frozen pericarp discs using previously
described procedures (26).
Nuclear Run-on Analysis--
Nuclei were isolated from pericarp
discs using a previously described procedure (27). The
32P-labeled RNAs were hybridized to nitrocellulose
membranes containing 20 µg of plasmid DNA corresponding to different probes.
HPLC Analysis--
Pigment and tocopherol analyses were carried
out as described previously (28, 29).
Molecular Analysis--
Total RNAs were isolated from frozen
polysomal fractions or pericarp discs as described previously (30). The
carotenogenic gene probes were available from previous studies. These
include geranylgeranyl pyrophosphate synthase (Ggps) (31),
phytoene synthase (Psy) (32), phytoene desaturase
(Pds) (33), lycopene cyclase (34) (Lcy),
zeaxanthin epoxidase (35) (Zepd), and capsanthin capsorubin
synthase (Ccs) (36). The heat shock probe (Hsp 70 cDNA) was partially characterized from pepper and is available upon
request. Total RNA (20 µg) were blotted, and a pepper cDNA encoding 25 S ribosomal RNA was used to ensure that equivalent amounts
of RNA were blotted. The purified probes were used for hybridization according to standard procedures (37).
The capsanthin-capsorubin synthase promoter was isolated from genomic
pepper DNA according to the polymerase chain reaction method described
previously (38). To this end 15 µg of pepper DNA was digested with
ScaI, DraI, StuI, and PvuII
yielding blunt fragments that were ligated to the adaptor primer. After
amplification of the StuI fragment using the adaptor primer
and the gene-specific probe: CATTAGAGAAAATGCAAGATTTAT (36), a 650 base
pair was amplified by polymerase chain reaction (38) and sequenced to
give capsanthin-capsorubin promoter-1 (Ccs 1) (accession
number Y14165). Two restriction sites, PstI (5'end) and
BamHI (3'end), were introduced to subclone the promoter
fragment in frame of Escherichia coli Other Analytical Methods--
Aconitase activity was determined
as described previously (41). Analysis of methanesulfinic acid after
dimethyl sulfoxide (Me2SO) treatment was carried out as
described before (42). Protein concentration was determined by the
Bio-Rad assay.
Wound-induced Expression of Carotenogenic Gene mRNAs--
Chromoplasts in pepper fruits begin differentiating when the fruit
reaches its mature green stage, and full conversion requires approximately 14 days. Chloroplast to chromoplast differentiation can
be conveniently assessed using green pericarp discs isolated from
pepper fruits. This in vitro system offers advantages
because the discs mimic the developmental changes that occur in whole fruit, and the time course for ripening is more uniform and rapid (25).
When discs were incubated alone, in the absence of other treatments,
the time-dependent accumulation of two carotenogenic gene
transcripts encoding geranylgeranyl pyrophosphate synthase (Ggps) and capsanthin-capsorubin synthase (Ccs)
(Fig. 2A) was observed, in
good agreement with previous work (43). However, when discs were
incubated in the presence of diphenylene iodonium and aristolochic acid
(Fig. 2A), accumulation of these two gene transcripts was
blocked. Diphenylene iodonium (DPI) inhibits plasmalemma superoxide
synthase in plant cells (14), whereas aristolochic acid (AT) is a
specific inhibitor of phospholipase A2 activity (44). Wounding is known
to induce heat formation in fruits (45), and to drastically affect
their pigmentation (46) and metabolism (47, 48). Mechanical destruction
of cell walls (49) and associated osmotic perturbations (17) lead to
oxidative bursts, which generate ROS by a superoxide synthase located
in the plasmalemma of challenged cells. Wounding can also induce
lipolytic activity (50), yielding fatty acid precursors for jasmonic
acid synthesis, which could also potentially activate the expression of
Ggps and Ccs (51). Under our conditions, DPI and
AT inhibit these responses. Because of its electrophilicity, DPI
probably does not permeate cells and reacts only at the periphery of
the cut discs. When DPI and AT are combined, they appear to abolish any
signals that are transduced by the oxidative burst or jasmonate pathway
of challenged peripheral cells.
To test whether ROS might induce carotenogenic genes in developing
chromoplasts, DPI- and AT-treated pericarp discs were used to
manipulate the in vivo formation of ROS in a predictable way to evaluate their effect on carotenogenesis.
Induction of the Expression of Carotenogenic Gene mRNAs
Following Inhibition of Carotenogenesis--
Inhibition of plant
carotenoids during the early steps of their biosynthesis leads to
elevated photooxidation. Using the desaturase inhibitor metflurazon in
our pericarp disc system, we observed a significant accumulation of
phytoene in treated versus untreated discs (Fig.
2B). Similar data were observed with other desaturase and
cyclase inhibitors, namely, diflufenican, LS 80707, and
2-(4-chlorophenylthio)-triethylamine (Fig. 2B). Under our
conditions these inhibitors did not alter xanthophyll content. However,
the carotene fraction, which is virtually all
The fact that oxidative stress serves as a driving force behind
carotenogenesis can be inferred from the effect of herbicides, which
inhibit phytoene desaturase (fluridone and norflurazon, SAN 6706) or
The induction of these genes could be explained by a number of ways.
Although feedback regulation may be responsible, two other
possibilities could explain this induction. The first is photooxidative
stress, caused by the absence of biologically active carotenoids that
protect excited chlorophylls. However, under our conditions,
xanthophylls are virtually unaltered, suggesting that this mechanism is
not likely to be operative. Inhibition of carotenoid biosynthesis by
metflurazon and related substituted pyridazinones offers a second
possible mechanism. These compounds inhibit photosynthetic electron
transport at the micromolar level (54, 57). Also, aryloxyalkylamine
derivatives, structurally similar to
2-(4-chlorophenylthio)-triethylamine, act as uncouplers of
photophosphorylation by dissipating the proton gradient (58). These
photosynthetic perturbations trigger futile electron cycling and
generate ROS (12), which could ultimately act to induce carotenogenic
gene mRNAs expression. This is supported by work showing that
superoxide anions generated by the Mehler reaction lead to induction of
carotenoid biosynthesis in Dunaliella salina (59). This was
further examined in our system by evaluating the effects of
different ROS progenitors.
Induction of the Expression of Carotenogenic Gene mRNAs by
Artificial, Exogenous ROS Progenitors--
To test the involvement of
superoxide anion, we used menadione, which is partially reduced
in vivo to yield a semiquinone radical that reduces
molecular oxygen into a superoxide anion (60). When pericarp discs were
treated with this cyclic redox system, a strong accumulation of
Ggps and Ccs mRNAs was observed (Fig.
3A). Because superoxides are
usually metabolized via hydroperoxides, we decided to test their
effects.
Organic hydroperoxides, widely produced during plant metabolism,
participate in the synthesis of jasmonic acid and traumatin. Studies on
animal cells reveal that a 10 Down-regulation of ROS-scavenging Enzymes Induces the Expression of
Carotenogenic Gene mRNAs--
Hydrogen peroxide produced during
normal plant metabolism diffuses freely across biological membranes. As
hydrogen peroxide is a potent signal molecule in plants (14, 15), we
attempted to down-regulate the activity of catalase, ascorbate
peroxidase, and glutathion peroxidase, which are prominent enzymatic
peroxide scavengers. We reasoned that intracellular increases in
hydrogen peroxide would induce an effect similar to that observed when exogenous artificial peroxides are added. To this end we used amitrole
(3-amino-1,2,4-triazole) to inhibit catalase activity (68). The
specificity of amitrole is well documented in plants where it does not
block histidine biosynthesis, as in bacteria (68). We also observed
that under in vivo, physiological concentrations, amitrole
did not inhibit lycopene cyclase (69), contrary to previous reports
(for a review, see Ref. 54). The amitrole concentration used (20 mM) was optimum for inhibiting different plant catalase isozymes (70) and resulted in a massive increase in expression of
different carotenogenic gene transcripts (Fig. 3C). This was paralleled by a de novo synthesis of the
chromoplast-specific carotenoid, capsanthin, which was not detected in
control discs (Fig. 4).
The potential involvement of hydrogen peroxide is reinforced by the
fact that aconitase activity of treated pepper discs was progressively
down-regulated to 50% after 24 h of treatment. In its catalytic
form, aconitase has a cubane cluster
[4Fe+
Overall, these data suggest cross-talk between ROS-scavenging enzymes
and plastid carotenogenesis, which might be inferred by the link
between catalase and carotenoid biogenesis as shown by earlier studies
with fungi and plants. In Fusarium aquaeductuum, carotenogenesis is photoinductible, and the effect of light can be
mimicked by hydrogen peroxide (75). Studies of chloroplast pigment-deficient mutants in plants indicate that catalase activity is
strongly reduced (76). Also, barley mutants deficient in catalase show
an alteration in plastid ultrastructure (77). In Dunaliella
bardawil, carotenoid overaccumulation is paralleled by an increase
in catalase activity (78). A similar increase is observed during the
ripening of Carica papaya fruits (79), where chromoplast
differentiation and increases in carotenoid accumulation are observed.
In this regard, it is notable that pear fruit ripening can be induced
by inhibition of catalase, which causes the build-up of peroxides (80).
Similarly, the ripening of saskatoon fruit is paralleled by increased
oxidative stress (81).
The link between catalase and plastid carotenogenesis is further
strengthened by studies involving the catalase inhibitor amitrole. It
is interesting to note that treatments of maize (82), wheat (83),
radish (84), and barley (85) seedlings with amitrole lead to the
de novo accumulation of lycopene, a chromoplast-specific carotenoid. Because amitrole is not a carotenoid cyclase inhibitor (69), we propose that elevated hydrogen peroxide, due to catalase inhibition, initiates the production of ROS, which subsequently elicit
lycopene synthesis as a defense or adaptation response. Indeed,
chromoplast carotenoids possessing extended chromophores such as
lycopene, capsanthin, or capsorubin are particularly well suited for
quenching ROS compared with normal leaf carotenoids (21, 22). In this
respect, it is noteworthy that several maize mutants, when grown
autotrophically at high light intensity, become bleached and accumulate
lycopene (86). Similarly, cupric ions, which act as strong oxidants by
inducing the formation of hydroxyl radicals in plastids via the
Haber-Weiss mechanism (87), activate the synthesis of lycopene in
tomato fruits (88).
Glutathion peroxidase and ascorbate peroxidase can replace catalase as
scavengers of hydrogen peroxides, but they have much broader substrate
specificities. This necessitated an evaluation of their
down-regulation. To this end p-aminophenol, an irreversible inhibitor of ascorbate peroxidase (89), diamide, a potent oxidant of
reduced glutathion (GSH) (90), and buthionine sulfoximine, an
irreversible inhibitor of
In assessing the effect of oxidative stress caused by GSH depletion, it
was noted that thiol reagents capable of operating in the dark, such as
p-chloromercuribenzoate or
p-hydroxymercuribenzoate, can substitute for light to
photoinduce carotenogenesis in F. aquaeductuum (92). This
specificity was reversed by cysteine or 2-mercaptoethanol (93). This
oxidative mechanism has also been observed in Brevibacterium
sp. KY-4313, which forms the long carotenoid chromophore,
canthaxanthin. This was inhibited when GSH is present in the culture
medium (94).
Our demonstration that endogenously generated ROS inaugurate the
expression of carotenogenic gene mRNAs in plants raises the question of the role played by plastids and mitochondria in this process, since these organelles represent two main sites of oxygen production in plant cells.
ROS Signals Generated From Plastids and Mitochondria Induce the
Expression of Carotenogenic Gene mRNAs--
The herbicide paraquat
(1,1'-dimethyl-4,4-bipyridinium ion) has a strong negative redox
potential (E'0 =
In mitochondria it has been shown that hydrogen peroxide is produced
during normal electron transfer reactions and that this process
accounts for 1-2% of the oxygen taken up (96). This activity is
enhanced by antimycin A treatment (96). It is also known that
mitochondrial electron transfer participates in signal transduction of
the tumor necrosis factor (97). When molecular oxygen is reduced to the
superoxide anion, it is then converted to hydrogen peroxide by
mitochondrial superoxide dismutase. Based on this, we used rotenone,
thenoxyltrifluoroacetone, and antimycin A, to block cytochrome electron
transport chain (Fig. 6A). One might expect that this would exacerbate the formation of superoxide anion and hydrogen peroxide from mitochondria. We noted that antimycin A markedly induced the expression of Ggps and Ccs
mRNAs (Fig. 6B) compared with rotenone and
thenoxyltrifluoroacetone, which prematurely abort the electron transfer
pathway.
Our data suggest that plant mitochondria participate in signal
mechanisms involving ROS. Similarly, in the dark, antimycin A, an
electron transport inhibitor between cytochrome b and
c1, replaces the light-induced accumulation of
carotenoid in Mycobacterium marinum (98) and
Leptosphaeria michotii, a fungus (99). Relevant to this is
the yeast, P. rhodozyma, which shows a maximum accumulation of carotenoids in the later phases of culture, when respiration becomes
insensitive to cyanide (24). This effect is mimicked by antimycin. A
likely explanation is that electron transport is short-circuited,
leading to the formation of superoxide anions and hydrogen peroxide,
which trigger carotenoid biogenesis.
Run-on Transcription and Specific Integration of Carotenogenic Gene
mRNAs into Polysomal Fractions--
To better understand the role
of ROS, pericarp discs treated with different ROS-inducing compounds
were used to analyze transcription and integration of Ggps
and Ccs mRNAs into polysomal fractions. Run-on analysis
showed that Ggps was barely transcribed in control tissues,
whereas Ccs was not transcribed (Fig.
7). Conversely, the transcription of
Ggps and Ccs was stimulated in amitrole, tert-butylhydroperoxide, and diamide-treated discs.
Expression of a pepper heat shock protein 70 (Hsp 70)
mRNA, used as a control, was identical in all treatments, thus
demonstrating the specificity of the observed effects (Fig. 7).
Analysis of polysomal fractions revealed that amitrole specifically
induced the recruitment of Ggps and Ccs mRNAs
into the high molecular mass polysomal fraction of treated discs
(Fig. 8).
ROS Drive the Functioning of Capsanthin-Capsorubin Synthase
Promoter--
The partial Ccs-1 promoter was characterized
and displayed homologies to several cis-acting elements
previously characterized (Fig.
9A). The
EcoRI-ScaI fragment ofCcs cDNA
(36) hybridized specifically to a pepper 3.2-kilobase pair
ScaI genomic fragment containing the coding domain and the
5'-untranslated region of Ccs including the partial promoter
(Ccs-1) (Fig. 9B). Transient assays were used to
analyze the function of the Ccs-1 promoter under different
oxidative stress conditions using protoplasts from mature green fruits
pericarp displaying at least 90% viability as judged by fluorescein
diacetate staining. Linear plasmids containing a ROS Scavenging Delays Carotenoid Overaccumulation and Chromoplast
Differentiation--
Based on the results, we determined whether ROS
could mediate the differentiation of chloroplasts to chromoplasts. We
reasoned that if endogenously produced ROS were quenched, we would
expect to be able to demonstrate their regulatory role. To this end, intact pepper fruits were dipped in 10% Me2SO, a radical
quencher (42), and allowed to ripen for 12 days at room temperature. Data obtained (Fig. 10) reveal a
significant reduction of the expression of Ggps and
Ccs mRNAs and reduced accumulation of chromoplast ketocarotenoids capsanthin and capsorubin in treated fruits compared with controls (Fig. 10). Moreover, this was paralleled by an increase in the formation of methanesulfinic acid in treated fruits (Fig. 10),
demonstrating that OH· radicals formed during the ripening
period were quenched. This may explain why Me2SO inhibits
chromoplast carotenoid accumulation in ripening tomato fruit (100).
It appears that ROS, produced as a consequence of aerobic life, are
widely used for signal transduction because they are ubiquitous, diffusible, and uncharged (i.e. hydrogen peroxide)
molecules. Virtually all cellular compartments have the ability to
neutralize the toxic effects of ROS, which could otherwise lead to cell
death at high concentrations (101). This secondary messenger role of ROS is further supported by the fact that oxidative stress induces a
transient movement of cytosolic calcium in plants (102). Taken together, our results suggest that in vivo, transient,
oxidative stress plays a key role in the induction of chromoplast
carotenoid biosynthesis and in the transformation of chloroplasts into
chromoplasts (3). In a similar vein, although the mechanism has not
been explored, exposure to O3 leads to increased
carotenogenesis in poplar (103) and Norway spruce (104). The specific
activation of carotenogenic genes under our experimental conditions is
further supported by the fact that none of the ROS species used in this work induced the accumulation of capsidiol, a typical isoprenoid stress
metabolite produced in elicited pepper cells (43). Future work is
needed to scrutinize the signal transduction pathways involved in the
massive biogenesis of carotenoids during chromoplast differentiation.
We thank Christophe Bastian,
Régis Bindner, and Xavier Combeau for helpful technical assistance.
*
This research was supported in part by the European
Community Agro-industry Programme (FAIR CT96 1633).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) Y14165.
¶
To whom correspondence should be addressed: Institut de
Biologie Moléculaire des Plantes, CNRS and Université Louis
Pasteur, 67084 Strasbourg, France. Tel.: 33 3 88 41 72 31; Fax:
33 3 88 61 44 42; E-mail: camara{at}medoc.U-strasbg.fr.
The abbreviations used are:
ROS, reactive oxygen
species; HPLC, high performance liquid chromatography; DPI, diphenylene
iodonium; AT, aristolochic acid.
Induction and Control of Chromoplast-specific Carotenoid
Genes by Oxidative Stress*
,¶
Institut de Biologie Moléculaire des
Plantes, CNRS and Université Louis Pasteur, 67084 Strasbourg,
France and the § Department of Botany, Arizona State
University, Tempe, Arizona 85287-1601
ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References
-glucuronidase reporter gene reveals strong activation in
transformed pepper protoplasts challenged with the above ROS.
Collectively these data demonstrate that ROS act as a novel class of
second messengers that mediate intense carotenoid synthesis during
chromoplast differentiation.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
B, a transcription factor that is involved in
inflammation, immune responses, and acute-phase responses in animal
cells (4).
View larger version (25K):
[in a new window]
Fig. 1.
Pathway of carotenoid biosynthesis in pepper
chromoplasts. Enzymes whose cDNAs have been cloned and used in
the text are indicated in italics.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References
-glucuronidase gene
using pBI101 plasmid (39). The promoter activity was tested by
transient expression using protoplasts prepared from mature green
pepper fruit pericarp according to the polyethylene glycol procedure
(40). Before transformation, the plasmid vector was linearized, and a
sample (40 µg) of purified plasmid DNA was administered to 2.5 × 106 protoplasts. -Glucuronidase activity was
monitored after a 12-h transfection as described previously (39).
RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
View larger version (26K):
[in a new window]
Fig. 2.
RNA gel blot analysis of the expression of
geranylgeranylpyrophosphate synthase (Ggps) and
capsanthin-capsorubin synthase (Ccs) from C. annuum
pericarp discs after wounding and herbicide treatment.
A, from left to right, control fruit (unwounded); wounded
(excised pericarp discs); wounded discs treated with 20 µM DPI and 200 µM AT. Wounded discs were
incubated for 12 h. Wounded discs were incubated for different
times as indicated. B, analysis of the pigment content after herbicide
treatment. Pericarp discs were incubated for 24 h with 20 µM of metflurazon (Metflu), diflufenican
(Diflu), LS 80707, and 5 mM
2-(4-chlorophenylthio)-triethylamine (CPTA). Chl
refers to total chlorophylls. C, expression of carotenogenic
genes following herbicide treatments (metflurazon) (20 µM) for the indicated times. Total RNA (20 µg) were
used and blotted as described previously. A pepper 25 S ribosomal RNA
probe was used as a noninducible control.
-carotene from control
tissues, was altered in inhibitor-treated discs as shown by the
accumulation of phytofluene and 
-carotene (Fig. 2B). The
expression of carotenogenic gene mRNAs for Ggps,
Psy, Pds, and Lcy, which encode the
consecutive enzyme steps from geranylgeranylpyrophosphate to
-carotene, showed a general increase following metflurazon (Fig.
2C), and this trend was practically observed for the
different inhibitors (3). However, transcripts for the
xanthophyll-producing enzymes zeaxanthin epoxidase (Zepd)
and capsanthin-capsorubin synthase (Ccs), also showed an
unexpected increase in the presence of these inhibitors (Fig.
2C). Thus, blocking carotenogenesis appears to activate the
expression of genes for carotenoid biosynthesis. This agrees with
previous data where the expression of Psy and Pds
mRNAs (52, 53) were examined in tomato seedlings grown in the dark
or light.
-carotene desaturase (J852) on barley seedlings (54). Here,
phytoene, phytofluene, and -carotene accumulation is elevated 2-fold
higher on a molar basis than the levels of carotenoid end products
(-carotene and xanthophylls) produced by control seedlings (54).
Similar results were observed in wheat seedlings treated with SAN 9789 (55) and in Phycomyces whose phytoene desaturase was blocked
with several inhibitors (56).
View larger version (42K):
[in a new window]
Fig. 3.
RNA gel blot analysis of the expression of
carotenogenic genes following ROS treatments and aminotriazole.
A, changes induced by menadione (1 mM).
B, changes induced by tert-butylhydroperoxide (1 mM). C, effect of down-regulation of catalase by
aminotriazole (20 mM).
9 to 107
M concentration of lipid hydroperoxides exert regulatory
roles (61). We observed that tert-butylhydroperoxide causes
the pronounced induction of different carotenogenic gene mRNA
expression except for lycopene cyclase (Fig. 3B) and that
the concentration optimum was extremely low. Levels above 5 mM resulted in a strong bleaching effect, exhibiting a 95%
decrease in chlorophyll and carotenoid content. This toxic effect could
have been due to excess free radical formation, which can greatly
enhance the autoxidation of polyunsaturated molecules in an ambient
oxygen atmosphere. This has been observed with -carotene (62, 63)
and xanthophylls (64). Because the hydrophobicity of organic peroxides
allows them to react with membrane components, we also examined the
pattern of 
-tocopherol evolution as a consequence of peroxide
treatment. Data revealed that after 24 h, tocopherol content
decreased to 50% following peroxide treatment, suggesting that
-tocopherol participates in peroxyl radical quenching. Tocopherols
appear to control the extent of peroxyl radical formation more
effectively than carotenoids because they trap the lipid peroxyl
radical (11). The quench rate of peroxyl radicals by -tocopherol
ranges between 105 M1
s1 and is far more rapid than the autopropagation of
peroxyl radicals, which ranges between 101 to 5 × 102 M1 s1 (65). Our
results with artificial compounds extend previous observations showing
that oxidative stress induced the accumulation of the long-chromophore
carotenoid, astaxanthin, in the yeast P. rhodozyma (24, 66)
and the algae Hematococcus pluvialis (67). This argues that
under physiological conditions, carotenogenic genes might be subject to
regulation by endogenously generated ROS. This was further examined in
our study.
View larger version (31K):
[in a new window]
Fig. 4.
HPLC analysis of carotenoid isolated from
C. annuum pericarp discs and seedlings treated with
aminotriazole. A, pigments from control discs.
B, pigments from pericarp discs treated with 20 mM aminotriazole for 24 h. The lipid extract was
fractionated into xanthophylls + chlorophylls (chl a,
chl b) and carotenes fractions before HPLC analysis, and
detection was at 440 nm. The arrows indicate the position of
carotenoids and chlorophylls.
4S]2+, which after loss of the labile
iron atom due to in vitro oxidation by superoxides or
peroxides, is converted to an inactive enzyme containing a paramagnetic
cluster [2Fe+4S]1+ (71-73). In this
context, it is noteworthy that in animal cells, aconitase is involved
in signaling induced by nitric oxide (74).
-glutamylcysteine synthetase (91), were
used. Results showed that treating pericarp discs with these inhibitors
to block ascorbate peroxidase and to limit the availability of GSH
strongly activated the expression of carotenogenic genes (Fig.
5A).
View larger version (55K):
[in a new window]
Fig. 5.
RNA gel blot analysis of the expression of
carotenogenic genes following prooxidant treatments. A,
changes induced by p-aminophenol (1 mM), diamide
(2 mM), and buthionine sulfoximine (2 mM).
B, changes induced by paraquat (1 mM) and
paraquat plus Me2SO (DMSO) (10%).
0.446 v) and diverts electron transport
from photosystem I (57). In the presence of paraquat, photosynthetic
electrons are transferred to molecular oxygen, yielding superoxide
anions. Although paraquat has secondary effects, such as the disruption
of membrane integrity, plastids are its main target. This is reinforced
by the fact that paraquat-resistant plants possess up to a 300%
increase in plastid superoxide dismutase content (95). Pericarp discs
treated with paraquat showed a strong induction of
capsanthin-capsorubin synthase mRNA accumulation (Fig.
5B). The effect was strongly reduced in the presence of 10%
dimethyl sulfoxide (Me2SO). This suggests the involvement of a free radical mechanism, as Me2SO is generally nontoxic
and is stoichiometrically oxidized by hydroxyl radical, HO·, to
yield methanesulfinic acid (42). The scavenging reaction afforded by
Me2SO thus explains this reduced expression.
View larger version (26K):
[in a new window]
Fig. 6.
Mitochondrial electron transport inhibition
and subsequent activation of carotenogenic gene expression.
A, electron transfer steps inhibited by
thenoxyltrifluoroacetone (TTFA), rotenone, and antimycin.
B, RNA gel blot analysis of the expression of carotenogenic
genes following in vivo inhibition of the mitochondrial
electron pathway by TTFA (10 µM), rotenone (5 mM), antimycin A (10 µM). The incubation time
was 6 h. cyt., cytochrome.
View larger version (52K):
[in a new window]
Fig. 7.
Nuclear run-on analysis of geranylgeranyl
pyrophosphate (Ggps) and capsanthin-capsorubin synthases
(Ccs) mRNAs from C. annuum pericarp discs
subjected to oxidative stress. Discs were treated for 6 h.
From left to right: control discs, aminotriazole (20 mM)-,
tert-butylhydroperoxide (t-BOOH)- (1 mM), and diamide (2 mM)-treated discs used for
nuclei extraction. As a control, C. annuum Hsp 70 probe was
used.
View larger version (54K):
[in a new window]
Fig. 8.
Analysis of the recruitment of C. annuum geranylgeranylpyrophosphate synthase (Ggps)
and capsanthin-capsorubin synthase (Ccs) mRNAs into
polysomal fractions during oxidative stress induced by
aminotriazole. A, polysome profiles following
aminotriazole treatment (20 mM) for 6 h. The gradients
were fractionated as indicated (F1 to F5). B and
C, total RNA extracted from the polysomal fractions were
used for Northern blot analysis.
-glucuronidase
reporter gene driven by the Ccs-1 promoter were introduced
into green fruit protoplasts and incubated for 12 h in the
presence of prooxidants. Data from three independent experiments revealed that the promoter was dramatically activated by the GSH reagents, diamide and buthionine, and by amitrole, the catalase inhibitor (Fig. 9C). Similarly,
tert-butylhydroperoxide and paraquat, two ROS progenitors,
activated the Ccs-1 promoter. Collectively, data from these
homologous transient expression experiments strongly suggest that
Ccs expression is controlled by ROS.
View larger version (26K):
[in a new window]
Fig. 9.
Nucleotide sequence and oxidative stress
regulation of Ccs 1 promoter. A, nucleotide
sequence of the partial Ccs 1 promoter. The ATG, CAA, and
TATA boxes are indicated in bold. The transcription start
(+1) is indicated by an arrow. Homologies to
cis-acting elements are indicated: ABA (abscisic
acid-responsive) (105); ELI (elicitor-responsive) (106);
HD (homeodomain) (107); WUN (wound-responsive)
(108). B, restriction map of the genomic fragment containing
Ccs cDNA. The structure of the 3.2-kilobase pair
ScaI fragment containing the partial promoter hybridizing to
the EcoRI-ScaI fragment of Ccs
cDNA probe is shown. C, linearized plasmid
pCcs 1- -glucuronidase (GUS) (40 µg) was used
for 2.5 × 106 protoplasts transformation. Following a
12-h incubation with the above listed reagents, -glucuronidase
activity was monitored by measuring the rate of conversion of
4-methylumbelliferyl glucuronide to methylumbelliferone. Data obtained
are the mean from three different protoplasts preparations. S.E.
normalized as a proportion of the mean is shown.
View larger version (24K):
[in a new window]
Fig. 10.
Effect of Me2SO on the
regulation of chromoplast differentiation in intact fruits.
A, RNA gel blot analysis of the expression of
Ggps and Ccs mRNAs following
Me2SO treatment. B, effect of Me2SO
on the accumulation of chromoplast ketocarotenoids (capsanthin and
capsorubin). Control and treated samples are indicated, respectively,
by black and open bars. C, formation
of methanesulfinic acid following Me2SO treatment. Mature
green fruits were immersed into 10% Me2SO for 1 h
before incubation at 25 °C. Control fruits were similarly treated
with water. Total fruit pericarp was used for analysis. Control fruits
revealed no accumulation in contrast to treated fruits (black
bars).
ACKNOWLEDGEMENTS
FOOTNOTES
REFERENCES
Top
Abstract
Introduction
Procedures
Results & Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Alos, M. Roca, D. J. Iglesias, M. I. Minguez-Mosquera, C. M. B. Damasceno, T. W. Thannhauser, J. K. C. Rose, M. Talon, and M. Cercos An Evaluation of the Basis and Consequences of a Stay-Green Mutation in the navel negra Citrus Mutant Using Transcriptomic and Proteomic Profiling and Metabolite Analysis Plant Physiology, July 1, 2008; 147(3): 1300 - 1315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-H. Ha, J.-B. Kim, J.-S. Park, S.-W. Lee, and K.-J. Cho A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper J. Exp. Bot., September 25, 2007; (2007) erm132v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Teramoto, T. Itoh, and T.-a. Ono High-Intensity-Light-Dependent and Transient Expression of New Genes Encoding Distant Relatives of Light-Harvesting Chlorophyll-a/b Proteins in Chlamydomonas reinhardtii Plant Cell Physiol., September 15, 2004; 45(9): 1221 - 1232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kato, Y. Ikoma, H. Matsumoto, M. Sugiura, H. Hyodo, and M. Yano Accumulation of Carotenoids and Expression of Carotenoid Biosynthetic Genes during Maturation in Citrus Fruit Plant Physiology, February 1, 2004; 134(2): 824 - 837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bouvier, C. Suire, J. Mutterer, and B. Camara Oxidative Remodeling of Chromoplast Carotenoids: Identification of the Carotenoid Dioxygenase CsCCD and CsZCD Genes Involved in Crocus Secondary Metabolite Biogenesis PLANT CELL, January 1, 2003; 15(1): 47 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Teramoto, A. Nakamori, J. Minagawa, and T.-a. Ono Light-Intensity-Dependent Expression of Lhc Gene Family Encoding Light-Harvesting Chlorophyll-a/b Proteins of Photosystem II in Chlamydomonas reinhardtii Plant Physiology, September 1, 2002; 130(1): 325 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Grünewald, M. Eckert, J. Hirschberg, and C. Hagen Phytoene Desaturase Is Localized Exclusively in the Chloroplast and Up-Regulated at the mRNA Level during Accumulation of Secondary Carotenoids in Haematococcus pluvialis (Volvocales, Chlorophyceae) Plant Physiology, April 1, 2000; 122(4): 1261 - 1268. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |