JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 46, 30713-30718, November 13, 1998


Protein Kinase C delta  (PKCdelta ) Inhibits the Expression of Glutamine Synthetase in Glial Cells via the PKCdelta Regulatory Domain and Its Tyrosine Phosphorylation*

Chaya BrodieDagger §, Krisztina BogiDagger , Peter AcsDagger , Patricia S. LorenzoDagger , Lindsey BaskinDagger , and Peter M. BlumbergDagger

From the Dagger  Molecular Mechanisms of Tumor Promotion Section, Laboratory of Cellular Carcinogenesis and Tumor Promotion, NCI, National Institutes of Health, Bethesda, Maryland 20892 and the § Department of Life-Sciences, Bar-Ilan University, Ramat-Gan, Israel 52900

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Protein kinase C (PKC) plays an important role in the proliferation and differentiation of glial cells. In a recent study we found that overexpression of PKCdelta reduced the expression of the astrocytic marker glutamine synthetase (GS). In this study we explored the mechanisms involved in the inhibitory effect of PKCdelta on the expression of glutamine synthetase. Using PKC chimeras we first examined the role of the catalytic and regulatory domains of PKCdelta on the expression of glutamine synthetase. We found that cells stably transfected with chimeras between the regulatory domain of PKCdelta and the catalytic domains of PKCalpha or epsilon  inhibited the expression of GS, similar to the inhibition exerted by overexpression of PKCdelta itself. In contrast, no significant effects were observed in cells transfected with the reciprocal PKC chimeras between the regulatory domains of PKCalpha or epsilon  and the catalytic domain of PKCdelta . PKCdelta has been shown to undergo tyrosine phosphorylation in response to various activators. Tyrosine phosphorylation of PKCdelta in response to phorbol 12-myristate 13-acetate and platelet-derived growth factor occurred only in chimeras which contained the PKCdelta regulatory domain. Cells transfected with a PKCdelta mutant (PKCdelta 5), in which the five putative tyrosine phosphorylation sites were mutated to phenylalanine, showed markedly diminished tyrosine phosphorylation in response to phorbol 12-myristate 13-acetate and platelet-derived growth factor and normal levels of GS. Our results indicate that the regulatory domain of PKCdelta mediates the inhibitory effect of this isoform on the expression of GS. Phosphorylation of PKCdelta on tyrosine residues in the regulatory domain is implicated in this inhibitory effect.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Protein kinase C (PKC)1 is a family of phospholipid-dependent serine-threonine kinases that play important roles in the signal transduction and in the regulation of cell growth and differentiation (1, 2). At least eleven isoforms of PKC have been isolated so far, showing diversity in their structures, cellular distributions, and biological functions (3, 4). PKC is also the receptor for the potent tumor-promoting phorbol esters, which can substitute for DAG in PKC activation (5). The "classical" cPKCs alpha , beta 1, beta 2, and gamma  are Ca2+-dependent and PMA-responsive. The "novel" nPKCs delta , epsilon , eta , and theta  are Ca2+-independent but PMA-responsive, whereas the atypical PKC isoforms zeta  and lambda  do not depend on Ca2+ or respond to PMA.

PKCdelta , a member of the novel PKCs, has been associated with proliferation and differentiation of various cell types (6, 7). For example, overexpression of PKCdelta inhibited the proliferation of fibroblasts and induced monocytic differentiation of the myeloid progenitor cell line 32D (8). PKCdelta has also been shown to be downstream in the signaling pathway of the PDGF receptor (9). PKCdelta has been reported to undergo tyrosine phosphorylation in response to various stimuli such as PMA, epidermal growth factor, and PDGF (10-12). The phosphorylation site(s) and the role of tyrosine phosphorylation of PKCdelta in its activity and in its functional role are just beginning to be defined.

All PKC isoforms consist of an N-terminal regulatory domain and a C-terminal catalytic domain with serine-threonine kinase activity (1). In the classical PKC isoforms the regulatory domain contains a Ca2+-binding domain, and in both the classical and novel PKC isoforms the regulatory domain contains a pseudosubstrate region near the N terminus that is thought to inhibit the activity of the catalytic domain (13-15). The regulatory domain also contains a pair of highly conserved zinc fingers that bind phorbol esters (16). One of the approaches for dissecting the role of the regulatory and catalytic domains of different PKC isoforms is the use of PKC chimeras between the regulatory and catalytic domains of the different isoforms.

Glutamine synthetase (GS) is an important enzyme in the conversion of the excitatory amino acid glutamate to glutamine (17). GS has been used as an astrocytic marker, and its regulation has been studied especially with regard to cAMP (18) and glucocorticoids (19). A recent study suggested an important role for GS as a mediator of interactions between neurons and glial cells under pathological conditions (20). Thus, understanding the factors or mechanisms involved in the regulation of this enzyme has significant implications in understanding pathological processes in the central nervous system.

Recently, we reported that overexpression of PKCdelta in the C6 glial cell line reduced the expression of the astrocytic marker GS, whereas overexpression of PKCalpha and PKCepsilon did not significantly affect the expression of this protein (21). We have now characterized the inhibitory effect of PKCdelta on GS expression using chimeras between the regulatory and catalytic domains of PKCdelta , alpha , and epsilon . We found that the regulatory domain of PKCdelta mediates its inhibitory effect on GS expression. Furthermore, tyrosine phosphorylation in the regulatory domain of PKCdelta is implicated in this inhibition.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- Monoclonal anti-glutamine synthetase antibody, monoclonal anti-GFAP antibody, and anti-PKCalpha , beta , gamma , delta , eta , theta , zeta , and µ were obtained from Transduction Laboratories (Lexington, KY). Protein A/G-Sepharose was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). An affinity purified polyclonal anti-PKCepsilon antibody against a polypeptide corresponding to amino acids 726-737 of PKCepsilon was purchased from Life Technologies, Inc. Leupeptin, aprotinin, phenylmethylsulfonyl fluoride, and sodium vanadate were obtained from Sigma. Polyclonal rabbit antibody against GFAP was purchased from DAKO Corp. (Carpinteria, CA).

Generation of PKC Chimeras-- The PKC chimeras were generated by exchanging the regulatory and catalytic domains of PKCalpha , delta , and epsilon  as described by Acs et al. (22). PKCalpha /delta refers to the chimera with the PKCalpha regulatory domain and the PKCdelta catalytic domain, and PKCdelta /alpha refers to the reciprocal chimera. The PKC cDNAs were subcloned into the mammalian epsilon -epitope tagging mammalian expression vector MTH described in detail by Olah et al. (23). The vector was attached to the end of the C-terminal 12-amino acid tag, originally derived from the C-terminal sequence of PKCepsilon . The epsilon -tag or the overexpression did not affect the localization, translocation, or phorbol ester responsiveness of the wild type constructs relative to the respective endogenous isoforms (22, 24).

Site-directed Mutagenesis of PKCdelta -- Mouse PKCdelta was subcloned into the pGEM-T vector (Promega, Madison, WI) as described previously (25). This plasmid served as our "master" vector for the site-directed mutagenesis, using the Transformer site-directed mutagenesis kit from CLONTECH (Palo Alto, CA). Conversion of tyrosine residues at sites 52, 155, and 565 into phenylalanine was performed as described (25). The additional mutations of tyrosine residues at positions 64 and 187 to phenylalanine were introduced into the triple tyrosine-phenylalanine mutant of PKCdelta . The following oligonucleotides served as primers for selection and mutagenesis. The selection primer CGCCTGCAGGTCGACCATATGGGAGAG was used to change back the formerly introduced ClaI restriction site (25) in the pGEM-T vector in position 75 into the underlined SalI restriction site to facilitate selection. The primer ACGCCCACATCTTCGAAGGCCGTGTTATC was used to mutate the tyrosine residue at site 64 into phenylalanine (bold letters) and to create a BstBI restriction site (underlined) to facilitate the detection of mutant plasmids. The primer CTCAACAAGCAAGGCTTTAAATGCAGGCAATGC was used to mutate the tyrosine residue at site 187 into phenylalanine (bold letters) and to create a DraI restriction site (underlined) to facilitate the detection of the mutant plasmids. The mutations were confirmed by direct sequencing (Paragon Biotech Inc., Baltimore, MD). PKCdelta and PKCdelta 5 were subcloned into a metallothionein promoter-driven eukaryotic expression vector (MTH). The vector sequence encodes a C-terminal PKC-epsilon derived 12-amino acid tag (epsilon MTH) that is added to the expressed proteins (23).

C6 Glial Cultures and Cell Transfection-- C6 cells of early passage (C6-30 cells) were used in this study. Conditions for growth and transfection were as described previously (21). Experiments were routinely carried out on pools of transfected cells, but all the results were confirmed on two different individual clones for each of the different isoforms and chimeras.

Preparation of Cell Homogenates and Immunoblot Analysis-- Preparation of lysates from cells and the analysis of GS and of PKC by Western blotting were performed as described previously (21, 26).

[3H]PDBu Binding-- [3H]PDBu binding was measured using the polyethylene glycol precipitation assay (27). Briefly, cell lysates (4-60 µg of protein/assay) were incubated with 20 nM [3H]PDBu in the presence of phosphatidylserine. Nonspecific binding, determined in the presence of 30 µM nonradioactive PDBu, was subtracted to give specific binding. Data represent triplicate determinations in each experiment.

PKC Kinase Assay-- PKC activity was assayed by measuring the incorporation of 32P from [gamma -32P]ATP into substrate in the presence of 100 µg/ml phosphatidylserine and 1 µM PMA as described previously (27).

Immunoprecipitation-- Immunoprecipitation of PKCdelta was performed as described previously (22). Briefly, C6 cells overexpressing PKCdelta or PKCdelta 5 were serum-starved overnight and treated for 30 min with PMA (10 nM) or with PDGF (100 ng/ml). The samples were preabsorbed with 25 µl of protein A/G-Sepharose (50%) for 10 min, and immunoprecipitation was performed using 4 µg/ml anti-PKCepsilon antibody and 30 µl of protein A/G-Sepharose at 4 °C. Following washes, the pellets were resuspended in 25 µl of SDS sample buffer and boiled for 5 min. Before SDS-PAGE, samples were centrifuged again as described above, and all of each supernatant was subjected to Western blotting. Membranes were probed with anti-phosphotyrosine antibody or anti-PKCdelta antibody.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Differential Effects of PMA and Bryostatin 1 on GS and PKCdelta Expression-- Recently, we have reported that overexpression of PKCdelta reduced the level of GS expression in C6 cells, whereas it did not affect the expression of the astrocytic marker GFAP (21). To further examine the role of PKCdelta in this effect we utilized the two PKC activators PMA and bryostatin 1 because these two activators have been reported to differentially affect the activation and down-regulation of PKCdelta in other cell types (26, 29). For these studies we used the C6-30 cells because they express low levels of GS and GFAP and can be differentiated to either oligodendrocytes or astrocytes (30). Treatment of the cells with PMA (100 nM) for 24 h did not induce significant changes in the expression of GS, as described previously. In contrast, bryostatin 1 (100 nM) induced a marked decrease in the expression of GS (Fig. 1A), whereas it did not affect the expression of GFAP (data not shown). As illustrated in Fig. 1B, under these conditions 100 nM PMA induced down-regulation of all the major classical and novel PKC isoforms expressed in C6-30, whereas bryostatin 1 induced down-regulation of all these PKC isoforms except PKCdelta . PKCzeta and µ were not affected by either of the compounds. Similar down-regulation by PMA and bryostatin 1 was observed for PKCgamma , eta , and theta , which are weakly expressed in these cells (data not shown). As has been previously described for keratinocytes (31), co-treatment of the C6 cells with PMA and bryostatin 1 protected PKCdelta from down-regulation by PMA. Likewise, under these conditions GS expression was similar to that of bryostatin-treated cells (Fig. 1A). The results suggest an inverse relation between the expression of PKCdelta and GS. To further explore this point, we examined the effect of bryostatin on GS expression in cells already depleted of PKCdelta . Cells were treated for 24 h with 100 nM PMA followed by treatment with bryostatin 1 for 48 h. In these cells, PKCdelta remained down-regulated, and, correspondingly, bryostatin 1 did not reduce the expression of GS (Fig. 1C).


View larger version (29K):
[in this window]
[in a new window]
  		Fig. 1.   Effect of PMA and bryostatin 1 on GS and PKCdelta expression. C6 cells were treated with PMA (100 nM), bryostatin 1 (100 nM), or the combination of both compounds for 24 h and were then analyzed for the expression of GS and PKCdelta (A). Cells were treated for 24 h with either PMA or bryostatin 1, and the expression of the different PKC isoforms was determined (B). C6 cells were treated with PMA (100 nM) for 24 h to down-regulate the classical and novel PKC isoforms followed by treatment with bryostatin 1 for 48 h. The expression of GS and PKCdelta was then determined (C). Results represent Western blot analysis of one representative experiment; similar results were obtained in each of four additional experiments. Bryo, bryostatin; Med, medium.

Overexpression of PKC Chimeras-- To further characterize the role of PKCdelta in the inhibition of GS expression, we examined the relative contributions of the regulatory and catalytic domains of this isoform. For these studies, we used chimeras between the regulatory and catalytic domains of PKCalpha , delta  and epsilon , combined at the highly conserved hinge region. The chimeras were engineered in a way that allowed similar construction of the wild type PKC isoforms, thus providing us with exact positive controls (22). The presence of the epsilon -tag on the different constructs allowed better detection on Western blots and provided a good epitope for immunoprecipitation.

Cells were transfected with the different chimeras, PKC alpha /delta , delta /alpha , alpha /epsilon , epsilon /alpha , delta /epsilon , and epsilon /delta and with the PKC wild type isoforms PKCalpha /alpha , delta /delta , and epsilon /epsilon . To examine the level of protein expression, we analyzed by Western blotting three pooled cultures and five different overexpressing clones for each of the chimeras as well as for the vector controls. Fig. 2 illustrates a representative Western blot of C6 cells overexpressing the different PKC chimeras and the vector control. Using the previously described tagging system (23), we were able to detect specifically the transfected PKC isoforms with the antibody against PKCepsilon . The band corresponding to the endogenous PKCepsilon can also be seen. To establish that the overexpressed PKC chimeras were functionally active we measured specific [3H]PDBu binding and kinase activity on cell lysates. All PKC chimeras exhibited increased [3H]PDBu binding and kinase activity as compared with the control cells transfected with the empty vector (Table I). Moreover, binding and kinase activity were further enhanced in cells treated for 24 h with 20 µM ZnCl2, an inducer of the metallothionein expression vector (data not shown).


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2.   Overexpression of PKC chimeras in C6 cells. Stable transfectants of C6 cells expressing the different PKC chimeras or the control empty vector (M) were harvested and subjected to SDS-PAGE and Western blot analysis. The membranes were probed with anti-PKCepsilon antibody that recognizes the epsilon -tag. The immunoreactive bands for the different PKC chimeras were visualized as described under "Experimental Procedures." Results are from one representative experiment; similar results were obtained in each of three additional experiments. IB, immunoblot.

                              
View this table:
[in this window]
[in a new window]
 
Table I
[3H]PDBu binding and kinase activity of cells overexpressing different PKC chimeras
Specific [3H]PDBu binding was determined using the polyethylene glycol precipitation method as described under "Experimental Procedures." Data represent the mean values ± S.E. of triplicate determinations of a single experiment. Similar results were obtained in two experiments. Kinase activity was determined by measuring the incorporation of 32P from [gamma -32P]ATP into substrates in the presence of 100 µg/ml phosphatidylserine and 1 µM PMA as described under "Experimental Procedures." The values for the control and PKCdelta /delta chimeras are expressed as pmol/min/µg protein, and the values for the other chimeras and for the control empty vector were further normalized based on their level of expression relative to the PKCdelta /delta chimera.

GS Levels in Cells Overexpressing PKC Chimeras-- The effect of the PKC chimeras on the level of GS was examined. In cells overexpressing PKCdelta /delta , the level of GS was low as compared with control cells and similar to that reported previously for cells overexpressing wild type PKCdelta . In contrast, the level of GS was unchanged in cells overexpressing PKCalpha /alpha and epsilon /epsilon (Fig. 3A) or in cells overexpressing PKCalpha /epsilon and epsilon /alpha (data not shown). Similar to cells expressing PKCdelta /delta , cells overexpressing the chimeras containing the regulatory domain of PKCdelta , namely delta /alpha and delta /epsilon , also showed a reduced level of GS (Fig. 3A). Cells expressing PKC delta /alpha showed a greater reduction in the level of GS than cells expressing PKCdelta /epsilon . The effect of the regulatory domain of PKCdelta was specific for GS because no differences were observed in the expression of the other astrocytic marker, GFAP (data not shown). In contrast to the chimeras containing the regulatory domain of PKCdelta , chimeras containing just the catalytic domain of PKCdelta did not have a significant effect on GS expression. Thus, cells expressing PKCalpha /delta and epsilon /delta expressed GS levels similar to those of cells expressing PKCalpha /alpha or PKCepsilon /epsilon (Fig. 3A).


View larger version (30K):
[in this window]
[in a new window]
  		Fig. 3.   Expression of glutamine synthetase in C6 cells overexpressing PKC chimeras. C6 cells expressing different chimeras or the empty vector (M) were incubated in the absence or presence of 10 nM PMA for 48 h (A). Results are from one representative experiment; similar results were obtained in each of four additional experiments. The different transfectants were incubated for 24 h with 20 µM ZnCl2 (B). Densitometric analysis of the immunoblots was performed on five different clones and three pooled cultures. The results represent the means ± S.E. of three separate experiments. White bars, medium; shaded bars, zinc.

Treatment of the cells with 10 nM PMA, which induces activation of PKC without the marked down-regulation that occurs at 100 nM PMA, enhanced the response observed in untreated cells (Fig. 3A). Thus, PMA further reduced the expression of GS in cells overexpressing PKC delta /delta or the chimeras delta /alpha and delta /epsilon , which contain the delta  regulatory domain. Similar to what was observed in the vector control cells, transfectants expressing PKC alpha /alpha or epsilon /epsilon or chimeras that contain the delta  catalytic domain showed a smaller decrease in GS expression presumably mediated by the endogenous PKCdelta . Similar results were obtained in transfectants expressing PKC alpha /epsilon and epsilon /alpha (data not shown).

We also examined the expression of GS in cells treated for 24 h with 20 µM ZnCl2. Under these conditions, cells overexpressing PKCdelta /delta or chimeras containing the regulatory domain of PKCdelta showed a larger decrease in GS expression as compared with PMA-treated cells, whereas cells expressing chimeras that contain the delta  catalytic domain had levels of GS similar to those of the control vector cells (Fig. 3B).

Tyrosine Phosphorylation of PKCdelta Occurs in the Regulatory Domain-- The translocation and activation of PKCdelta in response to PMA and physiological stimuli such as epidermal growth factor and PDGF have been shown to be associated with tyrosine phosphorylation of this isoform (10-12). However, the sites of phosphorylation and the role of this process in the activity and function of PKCdelta are still unclear.

We first examined which domain is involved in the tyrosine phosphorylation of PKCdelta . Cells overexpressing PKCdelta /delta or the various chimeras containing either the regulatory or the catalytic domains of PKCdelta were stimulated with PMA and PDGF. Following immunoprecipitation of PKCdelta and Western blotting, membranes were probed with anti-phosphotyrosine antibody or with anti-PKCdelta antibody. As can be seen in Fig. 4, PKCdelta /delta , PKCdelta /alpha , and PKCdelta /epsilon underwent tyrosine phosphorylation in response to PMA. In contrast, no tyrosine phosphorylation was observed in cells overexpressing PKCalpha /delta or PKCepsilon /delta , thus suggesting that tyrosine phosphorylation in response to these stimuli occurred on the regulatory domain of the enzyme.


View larger version (44K):
[in this window]
[in a new window]
  		Fig. 4.   Tyrosine phosphorylation of PKCdelta chimeras in response to PMA. C6 cells transfected with PKC chimeras were treated with PMA (10 nM) for 30 min. Cells were then harvested, and immunoprecipitation of PKCdelta was performed as described under "Experimental Procedures." Following SDS-PAGE, membranes were stained with anti-phosphotyrosine antibody (anti-PTyr) or anti-PKCdelta antibody. The results represent one of three independent experiments, all of which yielded similar results.

Overexpression of a PKCdelta Mutant That Lacks Five Tyrosine Residues-- Studies in vitro (25) and in vivo (12) suggested five putative phosphorylation sites in PKCdelta , one in the catalytic domain (Tyr565) and four in the regulatory domain (Tyr52, Tyr64, Tyr155, and Tyr187). Because four of the putative phosphorylation sites in PKCdelta are located in the regulatory domain, we examined the role of tyrosine phosphorylation of PKCdelta in its inhibitory effect on GS expression.

For these experiments we utilized a PKCdelta mutant in which the five putative tyrosine phosphorylation sites were mutated to phenylalanine (delta 5 mutant). Cells were transfected with PKCdelta or PKCdelta 5, and the level of expression was determined using Western blot analysis. Using the previously described tagging system (23), we were able to detect specifically the transfected PKC isoforms with the antibody against PKCepsilon . Fig. 5A illustrates a representative Western blot of C6 cells overexpressing PKCdelta , PKCdelta 5, and the vector control. The levels of the overexpressed PKCdelta and PKCdelta 5 in the transfected cells were about 7-9-fold higher than the endogenous PKCdelta as determined using an anti-PKCdelta specific antibody (data not shown). Cells overexpressing PKCdelta or PKCdelta 5 showed an increased level of [3H]PDBu binding from 1.45 ± 0.04 pmol/mg protein in the vector control cells to 7.29 ± 0.21 pmol/mg protein in cells transfected with PKCdelta and 8.82 ± 0.23 pmol/mg protein in cells transfected with PKCdelta 5. Although they had similar levels of [3H]PDBu binding, cells overexpressing PKCdelta had an increased kinase activity of 465 ± 49% over the vector control cells, whereas cells overexpressing PKCdelta 5 showed an increase of only 87 ± 11% over control cells. The transfected PKCdelta and delta 5 displayed similar localization in untreated cells and translocated similarly to the membrane in response to PMA (data not shown).


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 5.   Tyrosine phosphorylation and GS expression in cells transfected with PKCdelta and PKCdelta 5 mutant. Stable transfectants of C6 cells overexpressing the empty vector (M), PKCdelta , or PKCdelta 5 were harvested and subjected to SDS-PAGE and Western blot analysis. The membranes were probed with anti-PKCepsilon antibody that recognizes the epsilon -tag (A). C6 cells stably transfected with either PKCdelta or the PKCdelta 5 were treated with PMA (10 nM) or PDGF (100 ng/ml). Immunoprecipitation of PKCdelta was performed following 30 min of treatment, and membranes were stained with anti-phosphotyrosine (anti-PTyr) and anti-PKCdelta antibodies (B). After 48 h of treatment, cells were harvested, and the level of GS was determined using Western blotting (C). Results are from one representative experiment; similar results were obtained in each of five additional experiments.

Tyrosine Phosphorylation of PKCdelta Plays a Role in the Inhibitory Effect on GS Expression-- We first examined the degree of tyrosine phosphorylation of PKCdelta and PKCdelta 5 in response to PMA and PDGF. Cells were treated with either compound for 30 min, PKCdelta was immunoprecipitated using the epsilon -tag specific antibody, and membranes were stained with anti-phosphotyrosine antibody. As illustrated in Fig. 5B, PMA and PDGF induced marked tyrosine phosphorylation of PKCdelta within 5-30 min. In contrast, these compounds induced negligible tyrosine phosphorylation of the PKCdelta 5 mutant. We then examined the level of GS in cells that were overexpressing PKCdelta or PKCdelta 5 and were either untreated or treated with PMA (10 nM) or PDGF (100 ng/ml). PMA (10 nM) activates PKC without the marked down-regulation that occurs at a concentration of 100 nM. We found that cells overexpressing the PKCdelta 5 mutant displayed a slightly higher level of GS compared with the control vector cells and markedly higher levels compared with cells overexpressing PKCdelta wild type. Treatment of cells overexpressing PKCdelta with PMA (10 nM) or PDGF (100 ng/ml) induced a marked decrease in GS expression. In contrast, similar treatments of cells expressing the delta 5 mutant did not exert a significant effect on GS expression (Fig. 5C).

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Protein kinase C comprises a family of eleven closely related isoforms that are involved in the differentiation and proliferation of various cell types (1-3). In a recent study, we have shown differential roles of specific PKC isoforms in the proliferation and differentiation of glial cells (21). Specifically, PKCalpha and PKCdelta inhibited astrocytic differentiation by reducing the expression of the astrocytic markers GFAP and GS, respectively. In the present study we have explored the mechanisms involved in the inhibitory effect of PKCdelta on GS expression.

We found that the regulatory domain of PKCdelta is responsible for the inhibitory effect of this isoform on the expression of GS. Chimeras have been used to dissect the contribution of individual PKC domains to the specific functions of different PKC isoforms, and both the catalytic and the regulatory domains of PKC have been implicated in determining isoform-specific functions. For example, the catalytic domain of PKCbeta was found to confer isoform-specific function in the differentiation of erythroleukemia cells (32), and the catalytic domain of PKCdelta in reciprocal delta - and epsilon -chimeras mediated PMA-induced macrophage differentiation of mouse promyelocytes (33). In contrast, the regulatory domain of PKCepsilon enhanced cell growth and induced colonies in soft agar in NIH 3T3 cells, and the catalytic domain played a role in determining the saturation density of cell growth (34). Thus, it appears that either the regulatory or the catalytic domain can confer isoform-specific effects and that this depends on the cell type, the specific PKC isoform and the specific function studied.

PKCdelta has been shown to become tyrosine phosphorylated in response to various stimuli. In NIH 3T3 cells, PKCdelta is tyrosine phosphorylated upon PMA and PDGF stimulation (10, 12), in response to carbachol, substance P, and PMA stimulation in parotid acinar cells (35) and through activation of the IgE receptor in RBL-2H3 cells (36). Tyrosine phosphorylation of PKCdelta was also observed in response to epidermal growth factor stimulation in keratinocytes (11) and in ras-transformed keratinocytes (37). It appears that the sites of tyrosine phosphorylation and the effect of this phosphorylation on the activity of PKCdelta or on its function depend somewhat on the specific system. PKCdelta contains 19 tyrosines located in both the regulatory and catalytic domains, and different tyrosines have been implicated as possible phosphorylation sites. Thus, Tyr187 has been shown to be phosphorylated in 32D and NIH 3T3 cells in response to PMA or PDGF stimulation (12). However, a mutation in this tyrosine failed to alter either the activity of PKCdelta or the ability of PKCdelta to induce monocytic differentiation (12). In another study, Tyr52 was suggested to mediate the tyrosine phosphorylation of PKCdelta upon stimulation of the IgE receptor in RBL-2H3 cells but not upon stimulation with PMA (25).

We found, similar to what has been recently described by Acs et al. in fibroblasts (34), that tyrosine phosphorylation of PKCdelta was confined to the regulatory domain of this isoform, suggesting that the tyrosines phosphorylated in response to PMA and PDGF are located on this domain. The role of the tyrosine phosphorylation of PKCdelta in its inhibitory effect on GS expression was examined using a PKCdelta mutant in which five putative sites of tyrosine phosphorylation were mutated to phenylalanine (delta 5 mutant). This mutant was constructed based on in vitro assessment of the activity as tyrosine kinase substrates of the oligopeptides corresponding to the sequences around each of the 19 tyrosines in PKCdelta (25) as well as on in vivo studies (12). Our results indicate that the delta 5 mutant had a markedly diminished tyrosine phosphorylation in response to PMA and PDGF, indicating that at least some of these tyrosines are functional phosphorylation sites in this system. In addition, the cells overexpressing the PKCdelta 5 mutant showed normal levels of GS as compared with cells overexpressing PKCdelta . These results suggest that tyrosine phosphorylation of PKCdelta plays a role in the inhibitory effect exerted by this isoform on GS expression. We found that although treatment of cells overexpressing PKCdelta 5 with PMA induced a similar pattern of translocation to that of PKCdelta , the kinase activity of these cells was significantly lower, at least as evaluated using myelin basic protein as a substrate. It is currently not clear what is the effect of the tyrosine phosphorylation of PKCdelta on the activity of the enzyme toward its different substrates in this system. Different effects have been reported in different systems, suggesting changes in substrate specificity rather than simply in level of absolute activity (25, 38).

The astrocytic glutamine synthetase is an important enzyme in the removal of the toxic substances NH3 and glutamate and in the conversion of these substances into glutamine (39). Changes in GS expression have been associated with human pathology (40), and GS has been reported to protect against neuronal degeneration following trauma or ischemia (20). GS expression has been reported to be regulated by cAMP, glucocorticoids, and insulin (18, 19, 41). GS mRNA is regulated by the glucocorticoid response element, NF-kappa B, and by contact with neuronal cultures (40, 42, 43). Because GS has also been used as an astrocytic marker, understanding of its regulation provides important information on astrocytic differentiation as well as on pathological conditions in the central nervous system. Our results imply a negative role for PKCdelta in GS expression, with a modulatory effect via tyrosine phosphorylation. A possible mechanism by which PKCdelta reduces the expression of GS may be through the induction of c-Jun, which has been implicated in negative regulation of GS transcription (42).

In conclusion, our results demonstrate that the regulatory but not the catalytic domain of PKCdelta determines the inhibitory effect of this isoform on the expression of GS. Our findings further emphasize a potentially important role of tyrosine phosphorylation of PKCdelta in this system. It is currently not clear which tyrosine kinases are involved in this process; however, tyrosine kinases of the Src family have been implicated in both the tyrosine phosphorylation of PKCdelta and the function of glial cells (28). Studies are currently underway to identify the specific tyrosine(s) involved in the phosphorylation of PKCdelta in this system and the tyrosine kinases that phosphorylate it at these sites.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: MMTP/LCCTP/NCI, Bldg. 37, Rm. 3A01, 37 Convent Dr. MSC 4255, Bethesda, MD 20892-4255.

The abbreviations used are: PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; GFAP, glial fibrillary acidic protein; GS, glutamine synthetase; PAGE, polyacrylamide gel electrophoresis; PDGF, platelet-derived growth factor; Bryo, bryostatin 1.
    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Nishizuka, Y. (1992) Science 258, 607-614[Abstract/Free Full Text]
  2. Newton, A. C. (1995) J. Biol. Chem. 270, 28495-28498[Free Full Text]
  3. Johannes, F. J., Prestle, J., Deiterich, S., Oberhagemann, P., Link, G., and Pfizenmaier, K. (1995) Eur. J. Biochem. 227, 303-307[Medline] [Order article via Infotrieve]
  4. Jaken, S. (1996) Curr. Opin. Cell Biol. 8, 18-173[CrossRef][Medline] [Order article via Infotrieve]
  5. Mosior, M., and Newton, A. C. (1995) J. Biol. Chem. 270, 25526-25533[Abstract/Free Full Text]
  6. Mischak, H., Goodnight, J., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz, M. G., Blumberg, P. M., Pierce, J. H., and Mushinski, J. F. (1993) J. Biol. Chem. 268, 6090-6096[Abstract/Free Full Text]
  7. Fukumoto, S., Nishizawa, Y., Hosoi, M., Koyama, H., Yamakawa, K., Ohno, S., and Morii, H. (1997) J. Biol. Chem. 272, 13816-13822[Abstract/Free Full Text]
  8. Mischak, H., Pierce, J. H., Goodnight, J., Kazanietz, M. G., Blumberg, P. M., and Mushinski, J. F. (1993) J. Biol. Chem. 268, 20110-20115[Abstract/Free Full Text]
  9. Li, W., Yu, J. C., Michieli, P., Beeler, J. F., Ellmore, N., Heidaran, M. A., and Pierce, J. H. (1994) Mol. Cell. Biol. 14, 6727-6735[Abstract/Free Full Text]
  10. Li, W., Mischak, H., Yu, J. C., Wang, L. M., Mushinski, J. F., Heidaran, M. A., and Pierce, J. H. (1994) J. Biol. Chem. 269, 2349-2352[Abstract/Free Full Text]
  11. Denning, M. F., Dlugosz, A., Threadgill, D. W., Magnuson, T., and Yuspa, S. H. (1996) J. Biol. Chem. 271, 5325-5331[Abstract/Free Full Text]
  12. Li, W., Li, W., Chen, X. H., Kelley, C. A., Alimandi, M., Zhang, J., Chen, Q., Bottaro, D. P., and Pierce, J. H. (1996) J. Biol. Chem. 271, 26404-26409[Abstract/Free Full Text]
  13. Nishizuka, Y. (1988) Nature 334, 661-665[CrossRef][Medline] [Order article via Infotrieve]
  14. Hug, H., and Sarre, T. F. (1993) Biochem. J. 291, 329-343
  15. Sossin, W. S., and Schwartz, J. H. (1991) Trends Biochem. Sci. 18, 207-208
  16. Burns, D. J., and Bell, R. M. (1991) J. Biol. Chem. 266, 18330-18338[Abstract/Free Full Text]
  17. Schousboe, A., Westergaard, N., Sonnewald, U., Peterson, S. B., Huang, R., Peng, L., and Hertz, I. (1993) Dev. Neurosci. 15, 359-366[Medline] [Order article via Infotrieve]
  18. Jackson, M. J., Zielke, H. R., and Max, S. R. (1995) Neurochem. Res. 20, 201-207[CrossRef][Medline] [Order article via Infotrieve]
  19. Gorovits, R., Yakir, A., Fox, L. E., and Vardimon, L. (1996) Mol. Brain Res. 43, 321-329[Medline] [Order article via Infotrieve]
  20. Gorovits, R., Avidan, N., Avisar, N., Shaked, I., and Vardimon, L. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7024-7029[Abstract/Free Full Text]
  21. Brodie, C., Kuperstein, I., Acs, P., and Blumberg, P. M. (1998) Mol. Brain Res. 56, 108-117[Medline] [Order article via Infotrieve]
  22. Acs, P., Bogi, C., Lorenzo, P. S., Marquez, A. M., Biro, T., Szallasi, Z., and Blumberg, P. M. (1997) J. Biol. Chem. 272, 22148-22153[Abstract/Free Full Text]
  23. Olah, Z., Lehel, C., Jakab, G., and Anderson, W. B. (1994) Anal. Biochem. 221, 94-102[CrossRef][Medline] [Order article via Infotrieve]
  24. Szallasi, Z., Bogi, K., Gohari, S., Biro, T., Acs, P., and Blumberg, P. M. (1996) J. Biol. Chem. 271, 18299-18301[Abstract/Free Full Text]
  25. Szallasi, Z., Denning, M. F., Chang, E. Y., Rivera, J., Yuspa, S. H., Lehel, C., Olah, Z., Anderson, W. B., and Blumberg, P. M. (1995) Biochem. Biophys. Res. Commun. 214, 888-894[CrossRef][Medline] [Order article via Infotrieve]
  26. Szallasi, Z., Smith, C. B., Pettit, G. R., and Blumberg, P. M. (1994) J. Biol. Chem. 269, 2118-2124[Abstract/Free Full Text]
  27. Kazanietz, M. G., Areces, L. B., Bahador, A., Mischak, H., Goodnight, J., Mushinski, J. F., and Blumberg, P. M. (1993) Mol. Pharmacol. 44, 298-307[Abstract]
  28. Bhat, N. R. (1995) Dev. Neurosci. 17, 267-284[Medline] [Order article via Infotrieve]
  29. Szallasi, Z., Du, L., Levine, R., Lewin, N. E., Nguyen, P. N., Williams, M. D., Pettit, G. R., and Blumberg, P. M. (1996) Cancer Res. 56, 2105-2111[Abstract/Free Full Text]
  30. Brodie, C., and Vernadakis, A. (1991) Glia 4, 269-275[CrossRef][Medline] [Order article via Infotrieve]
  31. Szallasi, Z., Denning, M., Smith, C. B., Dlugosz, A. A., Yuspa, S. H., Pettit, G. R., and Blumberg, P. M. (1994) Mol. Pharmacol. 46, 840-850[Abstract]
  32. Walker, S. D., Murray, N. R., Burns, D. J., and Fields, A. P. (1995) Proc. Natl. Acad. Sci U. S. A. 92, 9156-9160[Abstract/Free Full Text]
  33. Wang, Q. J., Acs, P., Goodnight, J., Giese, T., Blumberg, P. M., Mischak, H., and Mushinski, J. F. (1997) J. Biol. Chem. 272, 76-82[Abstract/Free Full Text]
  34. Acs, P., Wang, Q. J., Bogi, K., Marquez, A. M., Lorenzo, P. S., Biro, T., Szallasi, Z., Mushinski, J. F., and Blumberg, P. M. (1997) J. Biol. Chem. 272, 28793-28799[Abstract/Free Full Text]
  35. Denning, M. F., Dlugosz, A. A., Howett, M. K., and Yuspa, S. H. (1993) J. Biol. Chem. 268, 26079-26081[Abstract/Free Full Text]
  36. Soltoff, S. P., and Toker, A. (1995) J. Biol. Chem. 270, 13490-13495[Abstract/Free Full Text]
  37. Smith, H., Chang, E. Y., Szallasi, Z., Blumberg, P. M., and Rivera, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9112-9116[Abstract/Free Full Text]
  38. Kadotani, M., Nishiuma, T., Nanahoshi, M., Tsujishita, Y., Ogita, K., Nakamura, S. I., Kikkawa, U., and Asaoka, Y. (1997) J. Biochem. (Tokyo) 121, 1047-1053[Abstract/Free Full Text]
  39. Battaglioti, G., and Martin, D. L. (1991) Neurochem. Res. 16, 151-156[CrossRef][Medline] [Order article via Infotrieve]
  40. Belin, M. F., Didier-Bazes, M., Akaoka, H., Hardin-Pouzet, H., Bernard, A., and Giraudon, P. (1997) Glia 21, 154-161[CrossRef][Medline] [Order article via Infotrieve]
  41. Tholey, G., Sena, A. H., and Ledig, M. (1986) J. Neurochem. 47, 1490-1492[CrossRef][Medline] [Order article via Infotrieve]
  42. Berko-Flint, Y., Levkovitz, G., and Vardimon, L. (1994) EMBO J. 13, 646-654[Medline] [Order article via Infotrieve]
  43. Mearow, K. M., Mill, J. F., and Freeze, F. (1990) Glia 3, 385-392[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
H. Okhrimenko, W. Lu, C. Xiang, D. Ju, P. M. Blumberg, R. Gomel, G. Kazimirsky, and C. Brodie
Roles of Tyrosine Phosphorylation and Cleavage of Protein Kinase C{delta} in Its Protective Effect Against Tumor Necrosis Factor-related Apoptosis Inducing Ligand-induced Apoptosis
J. Biol. Chem., June 24, 2005; 280(25): 23643 - 23652.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. C. Braun, S. H. Garfield, and P. M. Blumberg
Analysis by Fluorescence Resonance Energy Transfer of the Interaction between Ligands and Protein Kinase C{delta} in the Intact Cell
J. Biol. Chem., March 4, 2005; 280(9): 8164 - 8171.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Pula, D. Crosby, J. Baker, and A. W. Poole
Functional Interaction of Protein Kinase C{alpha} with the Tyrosine Kinases Syk and Src in Human Platelets
J. Biol. Chem., February 25, 2005; 280(8): 7194 - 7205.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Q. Wang, X. Wang, and B. M. Evers
Induction of cIAP-2 in Human Colon Cancer Cells through PKC{delta}/NF-{kappa}B
J. Biol. Chem., December 19, 2003; 278(51): 51091 - 51099.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.