|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 48, 31909-31915, November 27, 1998
From the Regulation of prolactin gene transcription
requires cooperative interactions between the pituitary-specific POU
domain protein Pit-1 and members of the ETS transcription factor
family. We demonstrate here that the ETS-2 repressor factor (ERF) is
expressed in pituitary tumor cells and that overexpression of
recombinant ERF inhibits prolactin promoter activity, but not the
closely related growth hormone promoter. In non-pituitary cell lines,
coexpression of ERF disrupts the cooperative interactions between Pit-1
and ETS-1 and blocks the induction of Pit-1-dependent
prolactin promoter activity by cAMP. The potential role of ERF in the
inhibitory response of the prolactin promoter to dopamine was examined
using pituitary tumor cells stably expressing dopamine
D2 receptors. The inhibitory responses of the
prolactin promoter to ERF and dopamine are additive, suggesting that
ERF has a complementary role in this hormonal response. A single Pit-1
DNA-binding element from the prolactin promoter is sufficient to
reconstitute the inhibitory response to ERF. DNA binding analysis using
either a composite Pit-1/ETS protein-binding site or a
Pit-1 element with no known affinity for ETS proteins revealed that ERF
interferes with Pit-1 binding. Together, these results demonstrate that
ERF is a specific inhibitor of basal and hormone-regulated
transcription of the prolactin gene and suggest a new level of
complexity for the interaction of ETS factors with Pit-1 target genes.
The transcription of the prolactin
(PRL)1 gene in the lactotroph
cells of the anterior pituitary is under predominantly inhibitory control mediated by dopamine released by hypothalamic neurons. Extensive analysis of tissue-specific and hormone-responsive DNA elements in the rat PRL gene promoter, however, has not lead to the
identification of specific inhibitory sites. Instead, this analysis has
revealed a series of apparently redundant DNA-binding sites for the
pituitary-specific transcription factor Pit-1 (GHF-1) that are both
necessary and sufficient for multihormonal regulation of
transcriptional activity, including the inhibitory response to dopamine
(1-6). Although Pit-1 has been implicated as the mediator of hormonal
responses conferred by the PRL gene promoter, the transcriptional
regulatory mechanisms involving Pit-1 remain obscure. Previous studies
demonstrated that Pit-1 is phos- phorylated in response to several
different signaling pathways (7-9); however, mutagenesis of the three
phosphoacceptor sites within the Pit-1 POU domain showed that this
modification is not a key step in hormonal regulation of the PRL gene
(10, 11). These data predict that Pit-1 is not the sole mediator of
hormonal responses conferred by the PRL gene promoter and that other
factors recruited to the Pit-1 DNA elements may function in the
capacity of positive or negative regulators of PRL gene transcription.
In this regard, some of the Pit-1 elements in the PRL promoter also
serve as binding sites for other transcription factors. For example,
members of the ETS transcription factor family interact with two
Pit-1-binding sites within the PRL promoter (12-15). The ETS family of
proteins mediate transcriptional responses to growth factors and
activators of the Ras/mitogen-activated protein kinase (MAPK) pathway,
and these composite PRL gene Pit-1/ETS protein DNA elements confer
responses to several different hormones acting through diverse signal
transduction pathways (12-15). One possible molecular mechanism for
multihormonal control of PRL promoter activity is the convergence of
different signal transduction pathways on the MAPK pathway, which in
turn modulates the cooperative interactions between ETS factors and
Pit-1 (13, 14). The cooperative interactions between Pit-1 and ETS
family members appear particularly important in establishing pituitary
lactotroph-specific PRL gene expression (15) and could account for the
differential basal and hormonally induced transcriptional responses of
the Pit-1-dependent PRL and growth hormone (GH) genes.
The above model predicts that factors interfering with the interactions
between Pit-1 and ETS proteins could selectively inhibit PRL gene
transcription. Recently, a novel member of the ETS family was
identified that acts as a transcriptional repressor. The ETS-2 repressor factor (ERF) is a 548-amino acid phosphoprotein with an
N-terminal DNA-binding domain homologous to that of other ETS family
members and a unique C-terminal repressor domain (16, 17). The
DNA-binding domain of ERF recognizes ETS-binding sites, and the
repressor activity of ERF can abrogate transactivation by ETS proteins.
Given the importance of the interaction of Pit-1 and ETS proteins to
PRL gene transcription, we hypothesized that ERF could act to inhibit
PRL promoter activity by antagonizing this interaction. Here we show
that the ERF gene transcript is expressed in GH pituitary tumor cells.
Using an expression vector encoding the ERF protein, we demonstrate
profound and specific suppression of PRL reporter gene expression in
both lactotroph cell lines and non-pituitary cells coexpressing the
Pit-1 and ETS-1 proteins. Moreover, expression of ERF effectively
blocked the induction of PRL gene transcription by the protein kinase A
pathway and acted in an additive manner with dopamine to suppress PRL
promoter activity. We demonstrate that tandem copies of a single PRL
promoter Pit-1 DNA element are sufficient to confer the inhibitory
response to ERF and that protein extracts from cells expressing ERF
inhibit Pit-1 binding to Pit-1 DNA elements. Together, these results
support the view that ERF can act as a potent inhibitor of PRL gene activity.
Cell Culture, Expression Vectors, and Transfection--
All cell
lines used in these studies were maintained as monolayers in Ham's
F-12/Dulbecco's modified Eagle's medium supplemented with 10% new
born calf serum. The cell culture medium was changed prior to
transfection as indicated for the individual experiments. For
transfection, cells were harvested by treatment with 0.05% trypsin and
0.53 mM EDTA and washed by centrifugation. The LZR1 cells
were transfected using calcium phosphate precipitation as described
(4). All other cell lines were transfected by electroporation with the
BTX ECM 600 electroporation system using conditions optimized for each
cell type. The cells were resuspended Ca2+/Mg2+
-free Dulbecco's phosphate-buffered saline, and 0.4-ml aliquots of the
cell suspension (containing ~1 × 106 cells) were
transferred into 0.2-cm gap electroporation cuvettes containing the
indicated luciferase reporter gene and varying concentrations of the
indicated expression vector DNAs. The total amount of DNA was kept
constant using empty vector DNA. Luciferase reporter plasmids
containing rat PRL promoter sequences spanning coordinates Analysis of ERF mRNA--
Total cellular RNA was isolated
from GH4ZR7 cells by the guanidinium thiocyanate/phenol/chloroform
method (21), and poly(A)+ RNA was isolated. The yield and
purity of RNA samples were assessed by the ratio of absorbance at 260 and 280 nm. mRNA was fractionated by denaturing agarose gel
electrophoresis and transferred to nylon membrane. The membranes were
sequentially hybridized with 1 × 106 cpm/ml
32P-labeled complementary DNA probes to human ERF and
glyceraldehyde-3-phosphate dehydrogenase at 45 °C for 16 h. The
blots were rinsed in 2× SSC and washed in succession with 2× SSC and
0.1% SDS, 0.5× SSC and 0.1% SDS, and 0.1× SSC and 0.1% SDS at
60 °C and exposed to Kodak XAR-5 film at Western Blotting and Electrophoretic Mobility Shift Assay
(EMSA)--
Transiently transfected HeLa cells were lysed at 4 °C
in detergent buffer as described previously (22). Samples were
fractionated by SDS-polyacrylamide gel electrophoresis on 10% gels.
The proteins were transferred to nitrocellulose for 1 h by
electroblotting at 100 V and then detected by Ponceau S staining. The
membranes were blocked with 5% nonfat dried milk in TBS-T buffer (20 mM Tris-HCl (pH 7.6), 137 mM NaCl, and 0.1%
Tween 20) and incubated with the Anti-Xpress antibody directed against
the enterokinase recognition sequence (1:10,000 final dilution;
Invitrogen) for 1 h at room temperature. Following washes in TBS-T
buffer, the membranes were incubated with a 1:50,000 final dilution of
horseradish peroxidase-conjugated anti-rabbit Ig (Pierce). The
membranes were washed in TBS-T buffer and incubated in ECL reagents
(NEN Life Science Products) for 1 min. The membranes were then exposed
to Kodak XAR-5 film for 5-15 min.
EMSAs were performed on whole cell extracts prepared from transiently
transfected HeLa cells as described previously (23). Duplex
oligonucleotides corresponding to the PRL 3P and PAL 1P Pit-1-binding
sites and the GATA gene EBS were as follows: PRL 3P,
5'-GGCTTCCTGAATATGAATAAGA; PAL 1P, 5'- CCTGATTACATGAATATTCATGAAGGTG; and GATA EBS, 5'-CTTCGAGGAAGGGCACAGTGCCTTCCTTTAAC. The
indicated duplex oligonucleotides were end-labeled using
[ Expression of ERF mRNA in PRL-secreting Cells--
RNA blot
analysis was performed to determine if ERF is expressed in pituitary
lactotroph cells. Using RNA from the dopamine-responsive GH4ZR7 cell
line probed with the human ERF cDNA, we detected a single
transcript ~2.6 kilobases in length (Fig.
1). This result is in agreement with that
reported by Sgouras et al. (16) for other tissues and cell
lines. The recent cloning of the ERF gene and 5'-regulatory sequences
revealed a number of potential promoter elements that could function in
hormonal regulation of ERF expression (24). The GH4ZR7 cells were
treated with several different hormones and agents known to alter gene
expression in GH pituitary cell lines to determine if ERF is
transcriptionally regulated. Treatment of GH4ZR7 cells with dopamine
for 5 or 24 h or exposure to forskolin, dexamethasone, or
retinoic acid had no affect on steady-state levels of ERF mRNA
(Fig. 1). These results indicate that expression of the ERF gene in
pituitary cells does not appear to be controlled at the level of
transcription.
Selective Inhibition of PRL Promoter Activity by ERF--
Because
cooperative interactions between Pit-1 and ETS-1 are key to the
regulation of PRL gene transcription (12-15), we determined the effect
of ERF expression on PRL promoter activity. The
Pit-1-dependent GH promoter was used for comparison.
Cotransfection of GH pituitary cells with an expression vector encoding
ERF and the luciferase reporter gene linked to the rat PRL promoter
(rPRL-Luc) demonstrated that ERF inhibits the basal activity of the PRL
promoter in a dose-dependent manner (Fig.
2A). In contrast, expression
of ERF had no significant impact on the rat GH promoter-luciferase
reporter gene (rGH-Luc) (Fig. 2B), suggesting selectivity in
the inhibitory actions of ERF at these Pit-1-dependent
promoters. In this regard, it should be noted that in cells expressing
ERF, we also achieved expression of other proteins from several
different genetic vectors using the cytomegalovirus, early SV40, or
Rous sarcoma virus promoters. This indicates that ERF is not a potent
inhibitor of transcription from these promoters.
Cotransfection studies to reconstitute the activation of the PRL
promoter in non-pituitary cells were used to determine the effect of
ERF expression on the functional interactions between Pit-1 and ETS-1.
COS-1 kidney cells were cotransfected with the rPRL-Luc reporter gene
and expression vectors encoding Pit-1, ETS-1, and ERF. Expression of
Pit-1 induced PRL promoter activity 5-fold, and coexpression of Pit-1
with ETS-1 resulted in ~30-fold induction (Fig.
3). Cotransfection of the Pit-1 and ETS-1
plasmids with increasing amounts of the ERF expression vector resulted in the dose-dependent inhibition of the Pit-1- and
ETS-1-mediated induction of PRL promoter activity. Together, these
results show that expression of the ERF protein inhibits rPRL (but not
rGH) basal promoter activity in pituitary cells and suggest that the inhibitory activity results from interference with the ability of Pit-1
and ETS-1 to cooperatively induce the PRL promoter.
ERF Suppression of cAMP-dependent Stimulation of the
PRL Promoter--
Previous studies demonstrated that functional
interactions between Pit-1 and ETS-1 are required for some hormonal
responses conferred by the PRL promoter (12-14). The protein kinase A
signaling pathway activates the MAPK signaling cascade through B-Raf,
resulting in activation of ETS family transcription factors (25). In
pituitary cells, this signaling cascade could induce the cooperative
interaction of an ETS protein with Pit-1, resulting in protein kinase
A-dependent activation of PRL transcription (13). We
examined the effect of ERF expression on protein kinase A induction of
PRL promoter activity and evaluated the role of p42 MAPK in this
response using the specific inhibitor of MAPK kinase-1 (MEK), the drug
PD098059 (26). Rat-1 fibroblast cells maintained in the absence of
serum were cotransfected with the rPRL-Luc reporter gene and the
indicated protein expression vectors. The transfected cells received no further addition or were treated with the permeable analog of cAMP,
CPT-cAMP. Addition of CPT-cAMP had no effect on basal rPRL promoter
activity in these non-pituitary cells (Fig.
4). In contrast, coexpression of Pit-1
induced reporter gene activity 5-fold, and treatment with CPT-cAMP
increased this activity an additional 2-fold. This response to CPT-cAMP
was completely blocked by addition of the MEK inhibitor PD098059. Under
these serum-free conditions, coexpression of the ETS-1 and Pit-1
proteins did not result in cooperative induction of rPRL promoter
activity (compare with Fig. 3). However, CPT-cAMP treatment of the
cells coexpressing Pit-1 and ETS-1 resulted in 8-fold induction of PRL
promoter activity, and this response was also inhibited by treatment
with PD098059. Similarly, coexpression of ERF resulted in inhibition of
the CPT-cAMP response mediated by the coexpressed Pit-1 and ETS-1
proteins, and the response to ERF was additive with the inhibitory
response to addition of the MEK inhibitor (Fig. 4). Together, these
results support the convergence of the protein kinase A and MAPK
signaling pathways in activation of PRL promoter activity and
demonstrate that ERF can inhibit this response.
ERF Regulation of the PRL Gene Promoter in Dopamine-responsive
Cells--
Dopamine binding to lactotroph D2 receptors
results in tonic inhibition of PRL promoter function (4, 27). We
examined the ability of ERF to modulate dopaminergic inhibition of rPRL promoter activity in the dopamine D2 receptor-expressing
GH4ZR7 cell line. Typical dose-response curves for both dopamine and the ERF expression plasmid are shown in Fig.
5A. Dopamine treatment of
GH4ZR7 cells transfected with the rPRL-Luc reporter gene caused a
1.7-fold decrease in reporter activity. Similarly, in GH4ZR7 cell
cultures transfected with the ERF plasmid, basal promoter activity was
reduced 2.6-fold, and the inhibitory response to ERF was enhanced
significantly by addition of dopamine (Fig. 5A).
The inhibitory response of the PRL promoter to D2 receptor
activation is restricted to pituitary cells and several other
neuroendocrine cell types. In a number of non-pituitary cell lines
stably expressing dopamine D2 receptors, dopamine
stimulates PRL promoter activity (6, 28). This response may result from
increased Ca2+ levels or phosphatidylinositol
4,5-bisphosphate hydrolysis (28, 29), and similar to other stimulatory
hormonal responses of the PRL promoter, Pit-1 markedly enhances the
dopamine induction in these cell types. A mouse Ltk ERF Inhibitory Responses Can Be Conferred by a Single Pit-1
Element--
The results comparing the rGH and rPRL promoters (Fig. 2)
indicated that ERF displayed specificity in inhibition of these Pit-1-dependent promoters. The PRL 3P Pit-1 DNA element, a
composite Pit-1/ETS site located between positions Functional Interaction of Pit-1 and ERF at Pit-1 DNA
Elements--
To begin to dissect the mechanisms for
ERF-dependent inhibition of PRL promoter activity, extracts
were prepared from HeLa cells expressing epitope-tagged Pit-1 and ERF
proteins for use in EMSA. Western blot analysis confirmed that similar
amounts of the recombinant proteins were made and indicated that the
tagged ERF protein migrated as a doublet (Fig.
7). The ERF protein is a substrate for
MAPK, and this pattern of migration could indicate that the protein is
partially phosphorylated in HeLa cells (16). EMSA was then used to
assess the binding of proteins from these transfected cell extracts to
the PRL 3P site. An endogenous HeLa cell protein bound to the PRL 3P
element, forming a single shifted complex (Fig.
8A, lane 1,
solid arrow), and extracts from HeLa cells expressing Pit-1
resulted in the formation of two additional shifted complexes
(lane 2, open arrows). This result is consistent with previous reports of Pit-1 binding to DNA elements as both a
monomer and dimer (13, 30, 31). Both of these complexes were cleared
from the reaction by addition of an antibody specific to Pit-1 (Fig.
8A, lane 3), and all three protein complexes were diminished by competition with increasing amounts of the unlabeled PRL
3P site oligonucleotide. In contrast, only the complex formed by
endogenous HeLa cell protein was competed for by the EBS from the
GATA gene (32), suggesting that this complex contains an ETS
family member (Fig. 8A).
To investigate potential interactions of ERF with the PRL 3P site, EMSA
reactions were prepared using increasing amounts of protein extract
from HeLa cells expressing ERF. Total protein was kept constant using
extract prepared from control HeLa cells transfected with vector alone.
The results shown in Fig. 8B demonstrate that no additional
shifted complexes were detected with extracts containing ERF. There
was, however, diminished binding of the endogenous HeLa cell protein to
the PRL 3P site with increasing amounts of ERF-containing cell extract
(Fig. 8B, left panel). Moreover, when Pit-1 cell
extract was held constant and increasing amounts of ERF cell extract
were added, both of the shifted complexes resulting from Pit-1 binding
(open arrows) and the HeLa cell protein (solid
arrow) were diminished (Fig. 8B, right
panel). One interpretation of these results is that ERF protein
binding to the EBS of the composite Pit-1/EBS site displaces both Pit-1
and ETS proteins. An alternative view would be that protein/protein
interactions between ERF and complexes including Pit-1 and ETS proteins
interfere with binding to the Pit-1 element. To differentiate these
potential mechanisms, we examined the effect of ERF on protein binding
to a synthetic palindromic Pit-1 DNA-binding element (PAL 1P site) (33), an element with no known affinity for ETS proteins. Extract from
HeLa cells expressing Pit-1 resulted in three complexes (Fig. 9A, open arrows)
that were cleared by addition of anti-Pit-1 antibody (lane
2). Competition with unlabeled PAL 1P site demonstrated the
specificity of the complexes containing Pit-1 and showed a shifted
complex forming with HeLa cell protein to be nonspecific (Fig.
9A, solid arrow). As was observed for the PRL 3P
site (Fig. 8B), no additional complexes were detected with
ERF cell extracts (Fig. 9B, lane 1). When a
constant amount of Pit-1 cell extract was titrated with increasing
amounts of ERF cell extract, only the Pit-1 complexes were reduced
(open arrows); the nonspecific complex was not affected by
increasing amounts of ERF cell extract (Fig. 9B). Taken
together, these results suggest that ERF inhibits Pit-1-dependent transcriptional activity through
interference with binding to specific promoter elements.
The predominant physiological control of PRL gene expression in
anterior pituitary lactotrophs is inhibitory, and the molecular mechanisms that contribute to the suppression of transcription are not
well understood. It has become increasingly clear that specific
endocrine regulation of PRL gene transcription requires the cooperative
interactions between Pit-1 and other transcription factors, including
members of the ETS family of proteins. More important, the closely
related GH gene is expressed in distinct pituitary cell types and has a
different pattern of endocrine regulation. Whereas the GH promoter
contains both Pit-1 DNA elements and potential ETS protein-binding
sites, this promoter does not support the cooperative interactions
between Pit-1 and ETS factors (14). Thus, it appears that the Pit-1/ETS
protein interactions provide a mechanism for differential regulation of
the PRL and GH gene promoters in anterior pituitary cells. This
interaction could also serve as a potential target for inhibitory
factors that selectively suppress PRL gene transcription, and the
results shown here indicate that the ETS family repressor protein ERF can function in this capacity.
The studies presented here demonstrate that mRNAs homologous to the
transcript encoding ERF are present in GH pituitary tumor cells,
indicating that these lactotroph cells have the capacity to synthesize
the ETS repressor protein. Consistent with the results reported by
Sgouras et al. (16), we found no evidence for hormonal regulation of the ERF transcript levels. However, these authors demonstrated post-transcriptional regulation of ERF repressor activity
through phosphorylation by MAPK, and our Western blot analysis of the
ERF protein expressed in HeLa cells indicated that the protein is
modified (see Fig. 7). The differential regulation of gene expression
by MAPK pathway modulation of ETS transcription factor activities
appears to be of both physiological and developmental importance. For
example, in Drosophila, a critical stage in eye development
occurs when activation of the MAPK pathway simultaneously inhibits the
ETS repressor protein Yan and stimulates the ETS activator Pointed
(34). A similar mechanism involving coordinate activation of ETS
proteins and reduction of ERF repressor activity by MAPK
phosphorylation could mediate transcriptional responses to hormones
(16, 17). Given the central role of Pit-1 and ETS proteins in the
hormonal regulation of PRL gene transcription, we undertook studies to
determine if the ERF protein could influence PRL promoter activity. Our
results demonstrate ERF to be a potent inhibitor of the PRL promoter,
but not the closely related GH promoter, in pituitary tumor cells.
Moreover, expression of the ERF protein in non-pituitary cells blocked
the activation of the PRL promoter by the coexpressed Pit-1 protein as
well as by the combined expression of Pit-1 and ETS-1. Furthermore, we
found that ERF inhibits the cAMP induction of
Pit-1/ETS-1-dependent PRL promoter activity in these
non-pituitary cells. A convergence of the protein kinase A signaling
pathway and the MAPK pathway resulting in the activation of ETS
proteins, such as Elk-1, was demonstrated (25), and we show here that
the Pit-1-dependent cAMP response is blocked by the MEK
inhibitor PD098059. Together, these results support the view that
induction of PRL gene transcription by the protein kinase A signaling
pathway is mediated by activation of the MAPK pathway and ETS proteins
and that the ETS repressor ERF can inhibit this response.
These results implicated ERF as a potential mediator of inhibitory
responses conferred by the PRL promoter. Because PRL transcription in
pituitary lactotrophs is under the inhibitory control of dopamine D2 receptor-coupled signaling, we used the
dopamine-responsive GH4ZR7 pituitary cell line to determine if ERF
participated in this inhibitory pathway. Our results indicate that
dopamine inhibition and ERF inhibition of PRL promoter activity are
additive. Our previous study demonstrated that isolated Pit-1 DNA
elements, including the PRL 1P site, which has no known affinity for
ETS proteins, are sufficient to confer dopamine inhibition (6). Moreover, site-directed mutagenesis of the EBSs that are part of the
composite Pit-1 elements does not prevent dopamine
inhibition.2 These results
suggest that ERF and dopamine may function by complementary mechanisms
to reduce transcription at the PRL promoter. In D2 receptor-expressing mouse L cells, dopamine treatment stimulated PRL
promoter activity. We observed here that ERF failed to block dopaminergic stimulation, indicating that not all PRL promoter responses are sensitive to ERF inhibition. It is important to note that
not all cis-active sites in the rPRL promoter are part of
composite Pit-1 elements. For example, an ETS site located in the
promoter region between We found that tandem copies of the PRL 3P Pit-1 site were sufficient to
confer the inhibitory response to ERF (Fig. 6), suggesting that ERF
could interact with this composite element. Using EMSA and extracts
from HeLa cells expressing Pit-1, we demonstrated binding of an
endogenous HeLa cell protein to the PRL 3P site as well as specific
shifted complexes formed by Pit-1. Competition studies demonstrated
that HeLa cell protein binding to the PRL 3P site also had affinity for
the GATA EBS oligonucleotide. More important, although
competition with the homologous PRL 3P site reduced both the
Pit-1-specific and HeLa protein complexes, competition with the EBS
oligonucleotide did not influence Pit-1 binding (Fig. 8). This
indicated that in this in vitro system, binding of Pit-1 to
the PRL 3P site is independent of the HeLa cell protein binding. Using
extracts from HeLa cells expressing ERF, we were unable to detect the
formation of any additional shifted complexes. There was, however,
diminished binding of both the endogenous HeLa cell protein and Pit-1
to the PRL 3P site in the presence of these extracts. This result could
be an indication that ERF binding to the EBS of the composite PRL 3P
element is capable of displacing both Pit-1 and ETS proteins,
suggesting that competition for DNA binding at this composite Pit-1
element is a potential mechanism of ERF inhibitory action.
This interpretation, however, is not supported by our EMSA results
using the PAL 1P site, an element with no known affinity for ETS
proteins. EMSA studies using extracts from HeLa cells expressing Pit-1
identified both Pit-1-specific complexes and a nonspecific complex
formed by HeLa cell protein. Using ERF-containing cell extracts, we
again found no evidence for the binding of ERF to this DNA element.
However, titration of a constant amount of Pit-1 cell extract with
increasing amounts of ERF cell extract resulted in diminished Pit-1
binding. In contrast, the binding of the nonspecific protein complex
was not influenced by increasing amounts of ERF cell extract (Fig. 9),
demonstrating selective effects of ERF on DNA/protein interactions. It
is possible that low affinity binding of ERF to these Pit-1 DNA
elements could account for the inhibitory actions of ERF and that the
EMSA conditions used here did not allow detection of these
interactions. However, this would predict inhibition of all
Pit-1-dependent promoters, including the rGH promoter, a
result not obtained in the present studies (Fig. 2). An alternative
view is that inhibitory activity results from the formation of protein
complexes with Pit-1 not requiring the ERF protein to form specific
contacts with DNA. Promoter element specificity could arise if the
pairing of Pit-1 and coactivator protein partners directs these ERF
protein interactions. The potential role of ERF in the pituitary
lactotroph has not been defined, nor has its ability to regulate the
endogenous PRL gene been determined. One approach to address this issue
would be to examine endogenous PRL gene transcription in a stable
pituitary cell line in which ERF is expressed under the control of an
inducible promoter. Taken together, our results suggest that ERF
inhibits Pit-1-dependent transcriptional activity through
interference with binding to specific promoter elements. In addition,
our results with ERF extend the view that ubiquitous ETS family
proteins, through unique partnerships with cell-specific transcription
factors, can serve to integrate and coordinate both stimulatory and
inhibitory transcriptional responses, leading to the control of
tissue-specific gene expression.
We thank Dr. George Mavrothalassitis for
supplying the cDNAs encoding ERF and ETS-1 and Drs. Paul Howard and
Rich Maurer for supplying the 3P-Luc vectors.
*
This work was supported by National Institutes of Health
Grant RO1-DK-43701 (to R. N. D.) and Medical Research Council of Canada Grant MT-10546 (to H. P. E.). This work was presented in part
at the Endocrine Society Meeting, June 11-14, 1997, Minneapolis, MN (Abstract P1-30).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Internal
Medicine, P. O. Box 578, University of Virginia Health Sciences Center, Charlottesville, VA 22903. Tel.: 804-982-3623; Fax:
804-982-0088; E-mail: rnd2v{at}virginia.edu.
The abbreviations used are:
PRL, prolactin; rPRL, rat prolactin; MAPK, Ras/mitogen-activated protein
kinase; GH, growth hormone; rGH, rat growth hormone; ERF, ETS-2
repressor factor; EMSA, electrophoretic mobility shift assay; EBS, ETS
protein-binding site; MEK, MAPK kinase-1; CPT-cATP, 8-(4-chlorophenylthio)adenosine 3',5'-triphosphate.
2
J. Liu and H. P. Elsholtz, unpublished data.
Selective Inhibition of Prolactin Gene Transcription by the
ETS-2 Repressor Factor*
§,,, and Departments of Internal Medicine and Cell
Biology, National Science Foundation Center for Biological Timing,
University of Virginia, Charlottesville, Virginia 22908 and the
¶ Department of Laboratory Medicine and Pathobiology, Banting and
Best Diabetes Centre, University of Toronto, Toronto,
Ontario M5G 1L5, Canada
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
422 to +34
or 306 to +34 relative to the transcription start site (rPRL-Luc) and
the rat GH promoter (235 to +8) have been described previously (14,
18, 19). The luciferase reporter gene containing four tandem copies of
the rPRL 3P Pit-1 element linked to the rPRL minimal promoter
(coordinates 36 to +34) was described previously (13). The expression
vector encoding the ERF protein used in these studies was prepared by
in-frame insertion of the ERF cDNA sequence from the pSG5-ERF
plasmid (16) into the pcDNA3.1-HisA expression vector (Invitrogen,
San Diego, CA). The expression vectors encoding Pit-1 (18) and c-ETS-1
(20) have been described.
70 °C.
-32P]ATP and T4 polynucleotide kinase. Whole cell
extracts from transfected HeLa cells were added alone or in the
indicated combinations to 15-µl reaction mixtures assembled on ice.
For immunoclearing experiments, 1 µl of anti-Pit-1 polyclonal
antibody was added to the reaction mixtures and incubated for 1 h
at 4 °C. The reaction mixtures were transferred to tubes containing
~50,000 cpm of the end-labeled probe. For competition studies,
unlabeled duplex oligonucleotides were added in excess as indicated.
The mixtures were then incubated for 20 min at room temperature and
loaded on prerun 6% polyacrylamide gels prepared in running buffer
containing 25 mM Tris-HCl (pH 8.3), 192 mM
glycine, and 1 mM EDTA. The gels were run at 150 V, dried,
and autoradiographed using Kodak XAR-5 film.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (121K):
[in a new window]
Fig. 1.
Constitutive expression of ERF transcripts in
PRL-secreting GH4ZR7 cells. Dopamine D2
receptor-expressing GH4ZR7 cells were maintained in cell culture and
received no treatment or were treated with hormones and agents known to
regulate transcription in this pituitary cell line. The treatment time
was for 5 h (except in lane 3, 24 h). Following
treatment, poly(A)+ RNA was isolated, and equivalent
amounts (~4 µg) were fractionated by denaturing agarose gel
electrophoresis. Following transfer, the RNA blots were hybridized
sequentially with full-length 32P-labeled human ERF and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA
probes. Lane 1, no treatment; lanes 2 and 3, dopamine (1 µM); lane 4,
forskolin (5 µM); lane 5, dexamethasone (0.1 µM); lane 6, retinoic acid, (0.3 µM). kb, kilobases.
View larger version (17K):
[in a new window]
Fig. 2.
Expression of ERF inhibits rPRL (but not rGH)
promoter activity in pituitary cells. GH3 cells were transfected
by electroporation with the rPRL-Luc or rGH-Luc reporter gene in the
absence or presence of increasing concentrations of the expression
vector encoding the ERF protein. Approximately 18 h after
transfection, the cells were collected for analysis of total protein
and luciferase activity. Values are average luminescence normalized to
protein content ± S.E. of three independent determinations.
View larger version (18K):
[in a new window]
Fig. 3.
Expression of ERF inhibits the cooperative
activation of the PRL promoter by Pit-1 and ETS-1 in COS-1 kidney
cells. The COS-1 cells were cotransfected with the rPRL-Luc
reporter gene in the absence or presence of expression vectors encoding
Pit-1 and ETS-1. The inhibitory activity of ERF on induction of rPRL
promoter activity by the combined expression of Pit-1 and ETS-1 was
assessed by cotransfection with increasing concentrations of the ERF
expression vector. The concentration of plasmid DNA in these
transfections was kept constant with empty vector DNA. The transfected
cells were maintained in culture overnight and then harvested for
determination of luciferase activity. Values are average luminescence
normalized to protein content ± S.E. of three independent
determinations.
View larger version (25K):
[in a new window]
Fig. 4.
Blockade of protein kinase A induction of
Pit-1-dependent rPRL promoter activity by the MEK inhibitor
PD098059 and by ERF. Rat-1 cells were maintained in medium
supplemented with 1% bovine serum albumin to reduce basal
transcriptional activity. These cells were then cotransfected with the
PRL-Luc reporter gene and the indicated expression vectors. The
transfected cells were pooled in this same medium and then used to
inoculate nine culture dishes. Triplicate dishes received no further
addition or were treated with 0.5 mM CPT-cAMP without or
with addition of 50 µM MEK inhibitor PD098059. After
overnight incubation, the cultures were collected for analysis of
luciferase activity. Values are average luminescence normalized to
protein content ± S.E. of three independent determinations.
View larger version (24K):
[in a new window]
Fig. 5.
ERF-mediated suppression of rPRL promoter
function in the dopamine-responsive GH4ZR7 pituitary and LZR1 mouse L
cell lines. A, GH4ZR7 cells were transfected with the
rPRL-Luc reporter construct (5 µg) without or with the ERF expression
vector (2 µg). After incubation for 16 h, the indicated cultures
were treated with dopamine (DA; 1 µM) for
5 h and harvested for determination of luciferase activity
(left panel). Identical transfection conditions were used
for determination of dose response to dopamine (upper right
panel) and ERF (lower right panel). The results are
expressed as the mean -fold change ± S.E. from duplicate plates
collected in four independent experiments. B, LZR1 cells
were mock-transfected or transfected with the expression vector for
Pit-1 or ERF (2 µg/plasmid) alone or in combination. Following
overnight incubation, the indicated cultures were treated with 1 µM dopamine for 5 h (right panel). The
cells were then harvested for determination of luciferase activity, and
the results are plotted as mean -fold change over basal ± S.E.
(left panel). The results shown in the right
panel are -fold change over the corresponding treatment group in
the left panel. The results are from duplicate plates
collected in four independent experiments.
cell
line stably expressing dopamine D2 receptors (LZR1) was used to determine the effect of ERF expression on the stimulatory responses to dopamine conferred by the rPRL promoter. The results shown
in Fig. 5B demonstrate that expression of Pit-1 in LZR1 cells induced the rPRL-Luc reporter gene 4-fold over basal levels and
that expression of ERF suppressed both basal and Pit-1-activated transcription. Treatment of LZR1 cells with dopamine induced basal rPRL-Luc activity <2-fold, but stimulated the promoter by 3.7-fold in
the presence of Pit-1 (Fig. 5B, right panel).
Interestingly, expression of ERF failed to suppress the stimulatory
response to dopamine, either in the presence or absence of Pit-1 (Fig. 5B). These results indicate that certain transcriptional
responses conferred by PRL promoter elements in the context of
non-pituitary cells are not inhibited by the ETS repressor, ERF.
165 and 150 base
pairs, is sufficient to confer hormonal responsiveness in non-pituitary cells expressing Pit-1 (13). We examined the ability of ERF to inhibit
transcriptional responses conferred by tandem copies of the PRL 3P DNA
element. HeLa cells were transfected with a luciferase reporter gene
coupled to four tandem copies of the PRL 3P site and the minimal PRL
promoter (4×3P-Luc). Expression of Pit-1 resulted in a 6-fold
induction of the reporter gene, and coexpression of the ERF protein
inhibited this response by 60% (Fig. 6).
Furthermore, coexpression of Pit-1 and ETS-1 together resulted in a
cooperative 25-fold induction of the PRL 3P site reporter gene
construct, and this response was reduced 90% by expression of ERF.
These results demonstrate that this Pit-1 DNA element is sufficient to
confer the inhibitory response to ERF.
View larger version (19K):
[in a new window]
Fig. 6.
The ERF protein inhibits transcriptional
responses conferred by tandem copies of the composite PRL 3P DNA
element. HeLa cells were cotransfected with a plasmid containing
the luciferase reporter gene linked to the minimal rPRL promoter
(coordinates 36 to +34) and four tandem copies of the PRL 3P site
(4×3P-Luc) and the indicated protein expression vectors. After
overnight incubation, the cultures were collected for analysis of
luciferase activity. Values are average -fold change in luminescence
over basal levels ± S.E. of three independent
determinations.
View larger version (91K):
[in a new window]
Fig. 7.
Expression of epitope-tagged Pit-1 and ERF
proteins in HeLa cells. Protein extracts were prepared from HeLa
cells transiently transfected with the empty pcDNA3.1 vector
(lane 1) or with the Pit-1 (lane 2) or ERF
(lane 3) expression vector. The protein extracts (50 µg)
were fractionation by denaturing polyacrylamide electrophoresis and
transferred to membranes. The Western blots were probed with an
antibody directed against the Anti-Xpress epitope tag. The positions of
the Pit-1 protein (open arrow) and a doublet formed by the
ERF protein (solid arrows) are indicated. A nonspecific
protein (NS) was also detected.
View larger version (94K):
[in a new window]
Fig. 8.
The ERF protein interferes with protein
binding to the composite PRL 3P DNA element. Whole cell
extracts were prepared from HeLa cells transfected with empty vector or
with the expression vector encoding either Pit-1 or ERF. EMSA was used
to assess binding of proteins to the duplex 32P-labeled PRL
3P Pit-1 site probe. The reactions were fractionated by nondenaturing
gel electrophoresis, and the probe was detected by autoradiography.
A, a single shifted complex was detected for proteins from
the control HeLa cell extract (lane 1, solid
arrow). Two additional DNA-protein complexes were formed by
extracts from cells expressing Pit-1 (lane 2, open
arrowheads), and these complexes were cleared by pretreatment with
an antibody directed against Pit-1 (lane 3). Competition
with excess unlabeled PRL 3P oligonucleotide (lanes
4-6) or excess unlabeled GATA gene EBS
oligonucleotide (lanes 7-9) from 3- to 30-fold
(indicated by the wedge) demonstrated the specificity of
these DNA-protein complexes. B, to examine potential
interactions of ERF with the PRL 3P DNA element, extract from control
HeLa cells was mixed with increasing amounts of extract from HeLa cells
expressing ERF (left panel). Then, to determine if the ERF
protein influenced Pit-1 binding to the PRL 3P site, a constant amount
of extract from HeLa cells expressing Pit-1 (3 µg) was mixed with
increasing amounts of ERF cell extract (3 or 9 µg); the total amount
of HeLa cell protein was kept constant with the control extract
(right panel).
View larger version (59K):
[in a new window]
Fig. 9.
The ERF protein interferes with Pit-1 binding
to the synthetic PAL 1P Pit-1 DNA element. The binding of protein
extracts prepared from HeLa cells expressing either Pit-1 or ERF to the
PAL 1P site probe was assessed by EMSA. A, three DNA-protein
complexes were detected with Pit-1 cell extracts (lane 1,
open arrowheads), and these complexes were cleared by
pretreatment with an antibody directed against Pit-1 (lane
2). In addition, a nonspecific complex (NS, solid
arrow) was also detected. Competition with excess unlabeled PAL 1P
oligonucleotide (lanes 3-5) from 3- to 30-fold
(indicated by the wedge) demonstrated specificity of
binding. B, the binding of protein extracted from HeLa cells
expressing Pit-1 (3 µg) was titrated with ERF cell extract (3-9
µg); total HeLa cell protein was kept constant with the control
extract (Con).
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
101 and 76 confers responsiveness to
insulin, insulin-like growth factor 1, and fibroblast growth factor
(35-37). This site is also required for responsiveness to the
phosphatidylinositol 3-kinase signaling pathway and may specify interactions with ETS family proteins that differ from those directed to the composite Pit-1 DNA elements (36, 37). Together, these results
indicate that ERF is unlikely to directly mediate transcriptional effects of dopamine on the PRL promoter. Our present data, however, do
not exclude a mechanism whereby dopamine D2 receptor
signaling could induce post-translational modifications of ERF that
enhance repressor activity that may be independent of binding to DNA elements.
ACKNOWLEDGEMENTS
FOOTNOTES
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Demarco, T. C. Voss, C. F. Booker, and R. N. Day Dynamic Interactions between Pit-1 and C/EBP{alpha} in the Pituitary Cell Nucleus Mol. Cell. Biol., November 1, 2006; 26(21): 8087 - 8098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. C. Voss, I. A. Demarco, C. F. Booker, and R. N. Day Functional interactions with Pit-1 reorganize co-repressor complexes in the living cell nucleus J. Cell Sci., August 1, 2005; 118(15): 3277 - 3288. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Romano, K. Magalon, A. Ciampini, C. Talet, A. Enjalbert, and C. Gerard Differential Involvement of the Ras and Rap1 Small GTPases in Vasoactive Intestinal and Pituitary Adenylyl Cyclase Activating Polypeptides Control of the Prolactin Gene J. Biol. Chem., December 19, 2003; 278(51): 51386 - 51394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. N. Day, T. C. Voss, J. F. Enwright III, C. F. Booker, A. Periasamy, and F. Schaufele Imaging the Localized Protein Interactions Between Pit-1 and the CCAAT/Enhancer Binding Protein {alpha} in the Living Pituitary Cell Nucleus Mol. Endocrinol., March 1, 2003; 17(3): 333 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Enwright III, M. A. Kawecki-Crook, T. C. Voss, F. Schaufele, and R. N. Day A PIT-1 Homeodomain Mutant Blocks the Intranuclear Recruitment Of the CCAAT/Enhancer Binding Protein {alpha} Required for Prolactin Gene Transcription Mol. Endocrinol., February 1, 2003; 17(2): 209 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Liu, R. E. Baker, C. Sun, V. C. Sundmark, and H. P. Elsholtz Activation of Go-coupled Dopamine D2 Receptors Inhibits ERK1/ERK2 in Pituitary Cells. A KEY STEP IN THE TRANSCRIPTIONAL SUPPRESSION OF THE PROLACTIN GENE J. Biol. Chem., September 20, 2002; 277(39): 35819 - 35825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Kievit, J. D. Lauten, and R. A. Maurer Analysis of the Role of the Mitogen-Activated Protein Kinase in Mediating Cyclic-Adenosine 3',5'-Monophosphate Effects on Prolactin Promoter Activity Mol. Endocrinol., April 1, 2001; 15(4): 614 - 624. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. Andersen and M. G. Rosenfeld POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease Endocr. Rev., February 1, 2001; 22(1): 2 - 35. [Abstract] [Full Text]
|
|
|
|
 |
|
 S.-i. Hashimoto, H. Nishizumi, R. Hayashi, A. Tsuboi, F. Nagawa, T. Takemori, and H. Sakano Prf, a novel Ets family protein that binds to the PU.1 binding motif, is specifically expressed in restricted stages of B cell development Int. Immunol., September 1, 1999; 11(9): 1423 - 1429. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |