|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 48, 32265-32272, November 27, 1998
From the There has been speculation as to the existence of
the mouse equivalent of human type I keratin 16 (K16). The function of
this keratin is particularly intriguing because, in normal epidermis, it is usually confined to hair follicles and only becomes expressed in
the suprabasal intrafollicular regions when the epidermis is traumatized. Previous studies suggested that K16 is highly expressed in
the skin of mice carrying a truncated K10 gene. We therefore used the
skin of heterozygous and homozygous mice to create a cDNA library,
and we report here the successful cloning and sequencing of mouse K16.
Recent in vitro studies suggested that filaments formed by
human K16 are shorter than those formed by other type I keratins. One
hypothesis put forward was that a proline residue in the 1B subdomain
of the helical domain was responsible. The data presented here
demonstrate that this proline is not conserved between mouse and human,
casting doubt on the proposed function of this proline residue in
filament assembly. In vitro assembly studies showed that
mouse K16 produced long filaments in vitro. Also, in
contrast to previous observations, transfection studies of PtK2 cells
showed that mouse K16 (without the proline) and also human K16 (with
the proline) can incorporate into the endogenous K8/K18 network without
detrimental effect. In addition, K16 from both species can form
filaments de novo when transfected with human K5 into
immortalized human lens epithelial cells, which do not express
keratins. These results suggest that reduced assembly capabilities due
to unusual sequence characteristics in helix 1B are not the key to the
unique function of K16. Rather, these data implicate the tail domain of
K16 as the more likely protein domain that determines the unique functions.
Keratins are a family of proteins that form the intermediate
filament cytoskeleton in epithelial cells. They are divided into two
groups, the type I acidic keratins and the type II basic keratins (1).
The first step in keratin intermediate filament
(KIF)1 assembly is the
formation of heterodimers between a type I and a type II keratin
(2, 3). Although any type I keratin can bind with any type II keratin,
only certain pairs of keratins exist in vivo (4). These
pairs are expressed in a tissue-type and developmentally regulated
manner (5). However, for some keratins, such as K17, a specific/unique
partner has not been found.
K16 and its partner, K6, are expressed in various stratified epithelia
including those of the oral cavity, esophagus, genital tract, and
epidermis (6). In the epidermis, they are normally confined to the hair
follicles, sweat and sebaceous glands, although they are also expressed
in the suprabasal layer of palmoplantar epidermis (6, 7). The
expression of these two keratins is of particular interest since,
together with K17, they are expressed in hyperproliferative situations
such as benign and malignant tumors, keratinocytes in culture,
hyperproliferative skin diseases such as psoriasis, and wound healing
(8-11). K6, K16, and K17 are therefore sometimes referred to as the
"hyperproliferation-associated" keratins. Often associated with the
expression of these keratins is the down-regulation of the
differentiation-specific keratins 1 and 10, which normally predominate
in the suprabasal epidermis (12). In vitro studies suggest
that K16 has unique properties that could affect the structural
organization of KIFs (13). Specifically, K16 appears to form shorter
filaments than K14 with the type II keratins K5 and K6a. If this
property of making shorter filaments is important for the modulation of
keratinocyte behavior via alterations in the cytoskeleton during wound
healing and in hyperproliferating keratinocytes, then the K16 sequence
would be expected to be highly conserved among mammalian species.
Mutations in keratin genes, including K16, have now been identified as
the underlying cause of several inherited epithelial disorders (14).
Mutations in human K16 (hK16) result in pachyonychia congenita type I,
which is characterized by nail dystrophy, focal palmoplantar
keratoderma, and oral keratoses reflecting the expression pattern of
this keratin (15). Despite the apparently important functions of K16 in
humans, there has been some speculation as to the existence of a K16
gene in mice (16). Using a mouse model for the inherited skin disease
bullous congenital ichthyosiform erythroderma, our previous studies
suggested that K16 is highly expressed in the acanthotic epidermis of
these mice (17). Although there is some evidence to suggest that the
hyperproliferation-associated keratins are controlled, at least in
part, post-transcriptionally (18), we observed a significant increase
in the putative mRNA levels of K16 in K10 mutant mice. It therefore
seemed logical to assume that a cDNA library generated from the
skin of these mutant mice would facilitate the isolation of the gene
for mouse K16 (mK16). Here we describe the cloning and sequencing of a
complete cDNA for mK16 isolated from such a library made from the
skin of K10 mutant mice. Using the mK16 cDNA, in vitro
assembly studies and transfection studies were carried out to assess
previous hypotheses relating specific K16 sequences to function.
Cloning and Sequence Analysis of mK16 cDNA--
Skin was
removed from three homozygous, two heterozygous, and one wild-type
neonatal C57Bl6 mouse as described previously (17). mRNA was
extracted using a Quickprep micro mRNA purification kit (Amersham
Pharmacia Biotech). cDNA synthesis and library construction were
carried out using a Zap Express cDNA synthesis kit (Stratagene, Cambridge, United Kingdom). The library was screened with a probe prepared by polymerase chain reaction of hK16 cDNA using the
forward primer CTGGCTTTGGTGGTGGTTT and the reverse primer
AGGCAGCTCAGTTCTAGGAGC (40 cycles of denaturing at 94 °C for 30 s, annealing at 55 °C for 30 s, and synthesis at 72 °C for 1 min). Random-primed DNA labeling of the probe with digoxigenin was
carried out using a DIG-high prime labeling and detection kit
(Boehringer Mannheim). The probe was diluted to 10 ng/ml in standard
buffer and 50% formamide and hybridized at 37 °C overnight. The
filters were washed two times in 2× SSC (20× SSC = 3 M sodium chloride, 300 mM sodium citrate),
0.1% SDS at room temperature (5 min) and two times in 0.5× SSC, 0.1%
SDS at 55 °C (15 min). Positive colonies were detected by a
colorimetric method using nitro blue tetrazolium and
5-bromo-4-chloro-3-indolyl phosphate (Sigma, Poole, UK) as described in
the manufacturer's instructions. The positive clones were excised as
pBK-CMV phagemids and sequenced with T3 or M13 primers using an
automated sequencer (ABI 377). Mouse cDNA, excised by an
EcoRI/XhoI digestion from a pBK-CMV phagemid and
labeled as described above, was used as a probe to screen for longer
length clones.
To obtain the sequence of the 5'-end, the rapid amplification of
cDNA ends (RACE) protocol was followed using a RACE kit (Boehringer Mannheim). The following primers were used for amplification: SP1,
GGATCTTCACCTCCAGGTCTC; SP2, CCACCAAATCCACTACCAAGTCC; and SP3,
CTGCTGAAGCTCCCACCATAG. Sequencing of the RACE product was achieved
using the SP3 primer. Complete sequence analysis of mK16 cDNA was
obtained using the forward primers F1 (GACCATTGAGGACCTGAAGAG), F2
(TGTATGCAGCTGTCCCAGATC), F3 (CCTCAGCATGGCCACCTGCAG), and F4 (CTGAGGAGCTGAACAAAGAGG) and the reverse primers R1
(ATCTGGGACAGCTGCATACAG), R2 (AGCCTGGCATTGTCAATCTGC), R3
(GGCAGTTGTGGGTGAGGAGGC), and SP1 (see above). We were also able to
sequence the mK14 clone 5.1 using the mK16 primers R1 and F1 and the
plasmid-specific primers T3 and M13( Immunofluorescence--
A polyclonal antibody to mK16 (RPmK16)
was obtained by immunizing rabbits with the C-terminal peptide
GSTSFSQSQSQSSRD of mK16 linked to keyhole limpet hemocyanin. Frozen
sections were fixed in methanol/acetone (1:1) at Tranfection of mK16 cDNA into PtK2 Cells--
Complete mK16
was created by reverse transcription-polymerase chain reaction from RNA
extracted from K10 heterozygous mouse skins using Taq
polymerase, forward primer F3, and reverse primer R3 and cloned into
pGEM (Promega). Five clones were sequenced in both directions, and one
clone with a single silent mutation was selected for subcloning of the
mK16 cDNA into the EcoRI site of the expression vector
pcDNA3 (Invitrogen).
Transfection was carried out on subconfluent PtK2 cells grown on
13-mm2 glass coverslips using the calcium phosphate
precipitation method. cDNAs of hK14 and hK16 cloned into pcDNA3
were used as controls. A mutant hK16 in pCR3 was also transfected. This
cDNA was obtained from a patient with pachyonychia congenita and
contains an L130P mutation. At 24, 48, and 72 h after
transfection, the cells were fixed for 1 min at
After removing coverslips from the culture dishes, the remaining cells
were scraped from the dish and solubilized in SDS sample buffer (100 µl). One-dimensional SDS-PAGE and immunoblotting were carried out as
described previously (19). Primary antibodies were diluted as follows:
LE65 and LL025 (1:5) and RPmK16 (1:5000) in Tris-buffered saline, 0.1%
Tween 20. Secondary antibodies were anti-mouse or anti-rabbit
immunoglobulins conjugated to alkaline phosphatase diluted 1:1000
(Dako, Bucks, UK). Detection was with nitro blue
tetrazolium/5-bromo-4-chloro-3-indolyl phosphate.
Transfection of Eye Lens Cell Line H36CEI--
H36CEI cells are
derived from human epithelial cells of the eye lens (20). Subconfluent
cells grown on 13-mm 2 glass coverslips were individually
transfected in a well of a 24-well plate with 0.6 µg of mK16, hK16,
hK5, or hK14 cDNA in pcDNA3. Double transfections were with 0.3 µg of hK5 cDNA and 0.3 µg of each type I keratin cDNA.
Transfection was achieved by linking the plasmid DNA to inactivated
adenovirus particles (5 × 108) using 10 mM polyethyleneimine as described previously (21). Staining
was carried out as described for PtK2 cells. Polyclonal antibody BL-18
to K5 was diluted 1:500 in phosphate-buffered saline.
Keratin Expression in Bacteria and Purification--
hK5, mK16,
and hK16 cDNAs were generated with an NdeI restriction
site introduced at the beginning by reverse transcription-polymerase chain reaction using a 5'-primer with a 3-base pair extension of CAT.
After sequencing to check that no errors had been incorporated, the
cDNAs were cloned into pT7-7 (mK16) (22) or pET-23b (hK16 and hK5)
(Novagen) vectors. These plasmids were individually transformed into
Escherichia coli strain BL21(DE3) pLysS and grown to
A600 ~ 0.5 before inducing protein expression
with isopropyl- In Vitro Filament Assembly and Electron
Microscopy--
Recombinant type I and II keratins were mixed in a 1:1
molar ratio at a concentration of 0.2 mg/ml. Assembly was achieved either by a rapid dialysis procedure against 2.5 mM
Tris-HCl (pH 7.5), 25 mM 2-mercaptoethanol at 4 °C for
16-20 h (13, 24) or by a staged dialysis procedure essentially as
described (25). Briefly, samples in 8 M urea-containing
buffer were dialyzed in 4 M urea-containing buffer and then
in 10 mM Tris-HCl (pH 8.0), 25 mM
2-mercaptoethanol. An additional dialysis against Tris-HCl (pH 7.5) was
included for direct comparison with the rapid dialysis procedure. The
assembly was completed in 10 mM Tris-HCl (pH 7.0), 50 mM NaCl, 1 mM MgCl2, 25 mM 2-mercaptoethanol. Assembly was monitored at all stages
by electron microscopy. Proteins were diluted to 1:10 and negatively
stained using 1% (w/v) uranyl acetate. Grids were examined in a Jeol
1200EX transmission electron microscope using an accelerating voltage
of 80 kV.
Sedimentation Assay--
The efficiency of filament formation
was assessed by sedimentation assay (25, 26). Briefly, the assembly
mixture was layered on top of 0.85 M sucrose in the final
assembly buffer and centrifuged for 30 min at 80,000 × g at 20 °C in a Beckman TLS-55 rotor using a TL100
bench-top ultracentrifuge. The final pellet was dissolved directly in
SDS-PAGE sample buffer, and the remaining protein in the supernatant
was precipitated (27) before also being resuspended in sample buffer.
Both protein samples were dissolved in volumes directly proportional to
the original sample volume for direct comparison by SDS-PAGE.
cDNA Cloning and Sequencing of mK16--
We have generated a
Zap Express mouse cDNA library from the skin of mice created as a
model for the skin disease bullous congenital ichthyosiform
erythroderma. Using the hK16 probe, two mK16 clones (4.2 and 8.1) and
one K14 clone (5.1) were isolated as pBK phagemids. None of the clones
contained full-length keratin cDNAs, so the library was rescreened
with mK16 cDNA from the longer of the two clones. Two additional
clones containing K16 were obtained (7.31 and 2.11), the largest of
which was 50 base pairs short of the 5'-end (clone 7.31). The shared
sequence of all four clones was identical. We obtained the 5'-sequence
including the start codon and 10 base pairs of untranslated sequence
using RACE. The complete cDNA sequence obtained from
sequence analysis of the clones and the RACE product is shown in Fig.
1. When scanned against the data base,
the sequence is most highly related to hK16 (GenBankTM
accession number S79867). After the TAA stop codon, there is a 157-base
pair untranslated region including a poly(A) addition signal (AATAAA)
and an 18-residue poly(A) tail.
The K14 clone 5.1 was identical in sequence to the mK14 clone pkSCC52
reported previously (GenBankTM accession number J02644)
(28). Our sequence analysis extends the mK14 sequence by an additional
17 amino acids upstream of QNLNDRLATY. The additional amino acids are
identical to mK16.
Comparison of mK16 Amino Acid Sequence with Other Keratin
Sequences--
The sequence codes for a protein of 469 amino acids
with a calculated Mr of 51,514. All keratins
have structural similarities, including an Mouse-specific K16 Polyclonal Antibody--
The C terminus of mK16
is longer than that of hK16 and contains two additional charged
residues. Therefore, it is perhaps of no surprise that a polyclonal
antibody (RPmK16) raised against the last 15 amino acid residues has
proved to be specific for mK16 and does not recognize hK16. We have
tested the antibody on human skin specimens including scalp, axilla,
thigh, face, breast, lip, palate, and finger and observed no staining
of hair follicles or suprabasal epidermis, as is readily seen with the monoclonal antibody to hK16 (LL025) (33). Similarly, the human keratinocyte cell line HaCaT, which constitutively expresses K16, did
not stain with RPmK16 (34). Mouse epidermis, however, was recognized by
this antibody. Hair follicles and whisker follicles were positive in
normal mouse epidermis (data not shown). Also, positive staining of the
suprabasal layer of the acanthotic epidermis of K10 mutant mice was
observed (data not shown) and was similar to the results obtained with
LL025 (35).
Transfection of PtK2 Cells with mK16 cDNA--
Previous
studies have reported that forced expression of hK16 in PtK2 cells
causes the endogenous K8/K18 network to retract from the cytoplasmic
periphery (13, 24). This reorganization was described as increasing
with time, and at 72 h post-transfection, >50% of the
transfected cells showed a juxtanuclear location of the keratin
filaments (13). We therefore chose this time point to examine the
effect of transfected mK16 in PtK2 cells. In 95% of the transfected
cells, mK16 was incorporated into the existing K8/K18 network, forming
normal filaments at 72 h post-transfection (Fig.
3a). In the remainder of the
cells, small regular circular structures were observed (Fig.
3b), as described in other transfection experiments of PtK2
cells with normal and mutant human keratins (36-38). No perinuclear
keratin filaments were observed comparable to those described by
Paladini et al. (13). At 24 h post-transfection, mK16
had already incorporated into the endogenous K8/K18 filament matrix as
shown by double immunofluorescence microscopy (Fig. 3, c and
d).
For comparison, we also transfected PtK2 cells with plasmids containing
either hK16 (containing the proline in coil 1B) or hK14 cDNA.
Similar well extended filaments were observed as well as some small
spherical aggregates found in 5% of the transfected cells (Fig.
3e). Retracted filaments (13, 24) were only observed in
transfections with K16 cDNA carrying a point mutation (L130P) obtained from a patient with pachyonychia congenita (Fig.
3f).
Both the monoclonal antibody to hK16 (LL025) and the polyclonal
antibody RPmK16 were used to stain transfected cells (33). Whereas
LL025 stained cells transfected with either mK16 or hK16, RPmK16 only
stained cells transfected with mK16. Analysis of transfected cells by
immunoblotting showed hK16 and mK16 to have similar relative mobilities
on SDS-polyacrylamide gels and confirmed the species specificity of
RPmK16 (Fig. 4).
Transfection of mK16 into H36CEI Cells--
To determine if mK16
could form filaments in the absence of an established keratin network,
we carried out cotransfections of mK16 with hK5 into a human lens
epithelial cell line (H36CEI). This cell line has vimentin (but not
keratin) intermediate filaments (20). At 24 h post-transfection,
>50% of the transfected cells showed extensive networks of keratin
filaments when stained with BL-18 (Fig.
5a). The filaments formed were
comparable to those obtained in double transfections of hK14 or hK16
with hK5 in a similar percentage of transfected cells (Fig. 5,
b and c). The remainder of the transfected cells
either had not formed filaments or contained very short filaments.
Sometimes large clumps of keratins were seen in the cells. These
irregular filaments were seen in K5/K14-transfected cells as well as in
K5/K16-transfected cells. No filaments were formed in single
transfections.
In Vitro Assembly of mK16--
The assembly properties of mK16
were of particular interest due to the report that hK16, under certain
conditions, forms shorter filaments with hK5/hK6 than does hK14 (13).
Keratins from human and mouse were expressed in bacteria and purified
by ion-exchange chromatography for in vitro assembly
studies. Two different methods of assembly were performed; one used a
rapid dialysis procedure, and the other employed a staged dialysis
procedure to remove the urea from the protein solution. In both cases,
the type I keratins were mixed in a 1:1 molar ratio with hK5. The rapid
dialysis procedure was achieved by overnight dialysis into 2.5 mM Tris (pH 7.5) from 8 M urea-containing
buffers. These conditions produced shorter filaments for a K5/K16
pairing than for K5/K14 (13, 24). Under these assembly conditions, hK16
with hK5 formed numerous very short filaments (Fig.
6a), similar to those observed
previously (13). In contrast, mK16 and K5 formed an abundance of much
longer filaments (Fig. 6c). Using the staged dialysis
procedure, both mK16 and hK16 formed long filaments at pH 7.5 (Fig. 6,
b and d).
To assess the efficiency of the in vitro assembly
experiment, a sedimentation assay was performed. In agreement with the
electron microscopy results, the K5/hK16 filaments in the rapid
dialysis procedure were not efficiently sedimented due to their short
length (data not shown), unlike the K5/mK16 filaments, which sedimented under the conditions of the assay (Fig.
7). Addition of 50 mM salt to
the assembly mixture promoted complete assembly of both keratins. The
staged dialysis of keratins also led to complete assembly of keratin
filaments (data not shown).
This study demonstrates unequivocally the existence of a mouse
gene for K16. The amino acid sequence of mK16 is 85% homologous to
that of hK16. hK16 possesses a proline in the helix 1B segment (13).
This is not a unique situation, as another intermediate filament
(CP49ins) possesses a proline in a similar position (32). Proline
residues are not usually seen in helical proteins, and they would be
expected to disrupt the regular helicity of the structure (39, 40).
This proline, it was reasoned, could be responsible for the shorter
filaments formed when K16 rather than K14 was assembled in
vitro or in fibroblasts with either K5 or K6b. In other positions
in the There are several published sequences for hK16 with and without the
proline residue (43-46), and it is possible that several different K16
genes exist, as observed with K6 (47). However, no other evidence
suggesting more than one hK16 gene exists at present. In our
experience, the human sequence containing the proline
(GenBankTM accession number S79867) is the correct one. All
four mK16 clones obtained from the expression library in this study
were of identical sequence, so we would expect that the sequence
reported here (without the proline in coil 1B) is the predominant form of mK16, if not the only form.
Our data do indicate some differences in the in vitro
assembly properties of hK16 and mK16. For instance, mK16 forms long filaments using the rapid dialysis procedure, whereas hK16 produces only short filaments with an identical type II partner. Long filaments can be produced in vitro with hK16 or mK16 with hK5 by the
staged dialysis procedure. The results obtained using the two methods suggest that hK16 and mK16 have different assembly properties, which
may be due to sequence differences between the two keratins. The
proline residue is likely to be at least partly responsible for these
differences since it has been shown by mutation analysis to affect
tetramer stability (24). The reduced tetramer stability of hK16 may
mean that this keratin requires more time to reach an energetically
favorable state, as provided by the staged dialysis procedure. The
weaker interactions at the tetramer stage do not, however, affect the
end point of assembly in vitro where both hK16 and mK16 form
long filaments. There are also no apparent differences when filaments
assemble in transiently transfected cells. The fact that the mouse
protein does not share the in vitro filament assembly
properties of the human protein suggests that the assembly pathway is
secondary to the unique function of this keratin.
In contrast to previous studies (13, 24), we observed no irregularity
of the KIF cytoskeleton in K16 transfection studies. In PtK2 cells, we
see that both mouse and human K16 are capable of incorporating into the
existing K8/K18 keratin filaments. We only see irregular filament
formation when the transfected keratin gene carries a pathogenic point
mutation as found in patients with keratin disorders. It is possible
that the different observations can be accounted for by varying levels
of expression of the K16 constructs. However, we used the same method
of transfection with an identical expression vector as Paladini
et al. (13), and we would therefore expect similar
transfection efficiencies. Also, both mK16 and hK16 form filaments
similar to those formed by hK14 and hK5 in the lens epithelial cell
line H36CEI. One possible explanation for these differences from
previously published data (13) is a difference in K16 sequence. The
original clone of hK16 sequenced by Paladini et al. (43)
begins with the sequence MAT rather than MTT, which is an error caused
by a cloning artifact. Other than this very minor difference, our hK16
is identical in sequence. This variation is unlikely to explain the
different observations, as the mouse sequence also begins with MAT not
MTT, but at present, it is the only apparent difference to explain the
two sets of results.
Subtle differences in the In conclusion, it would appear there is little unusual about the
assembly properties of K16 that are likely to be functionally significant for the following reasons. 1) Our transfection studies show
that K16 can not only integrate into an existing keratin network, but
can also form filaments de novo in vivo. 2) The decreased assembly capability of hK16 in vitro only occurs under
certain conditions and is not apparently shared by mK16. 3) Both hK16 and mK16 are equally capable of forming long filaments in
vitro with K5. The restricted distribution of K16 in normal tissue
and its altered expression pattern in hyperproliferative states such as
wound healing and tumorigenesis suggest a specific and specialized role
for this keratin. The existence of a mK16 strengthens the evidence for
an essential role for this protein that is not provided by other
keratins. The unique sequence of the tail domain of K16 is highly
conserved between mouse and human and is a favored candidate to provide
clues to the function of this protein. Mutation analysis by genetic
manipulation could be useful to resolve this issue.
We thank Dr. D. W. Melton for providing
the mice for this project. We are grateful to N. J. Wilson and
G. J. Magee for sequencing the keratin cDNAs and to P. H. Ogden and Dr. A. R. Prescott for help with transfections.
*
This work was supported by Cancer Research Campaign Grant
SP2060/01 (to E. B. L.) and Wellcome Trust Grant 46746 (to R. A. Q.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF053235.
§
To whom correspondence should be addressed. Tel.: 44-1382-344805;
Fax: 44-1382-224117; E-mail: R.M.PORTER{at}dundee.ac.uk.
The abbreviations used are:
KIF, keratin
intermediate filament; K, keratin; hK16, human keratin 16; mK16 mouse
keratin 16, RACE, rapid amplification of cDNA ends; PAGE, polyacrylamide gel electrophoresis.
cDNA Cloning, Expression, and Assembly Characteristics of
Mouse Keratin 16*
§,,
Cancer Research Campaign Cell Structure
Research Group,
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
20).
20 °C for 5 min
and incubated with RPmK16 diluted 1:500 in phosphate-buffered saline
(pH 7.5) for 1 h at room temperature. The secondary antibody was
fluorescein isothiocyanate-conjugated goat anti-rabbit IgGs (Sigma).
Slides were mounted in 10% Mowiol, 2.5% diazabicyclo[2.2.2]octane (Sigma).
20 °C in
methanol/acetone (1:1). RPmK16 was diluted in phosphate-buffered saline
(1:500), and LL025 (K16), LL001 (K14), LE65 (K18) were applied
undiluted. All primary incubations were for 1 h. After washing
coverslips in H2O, Cy3-conjugated goat anti-rabbit IgGs
(heavy and light chains; Jackson ImmunoResearch Laboratories, Inc.,
Stratech, UK), fluorescein isothiocyanate-conjugated sheep anti-mouse
antibodies (Sigma), or goat anti-rabbit antibodies (Sigma) were diluted
1:50 in phosphate-buffered saline and incubated for 30 min. Coverslips
were mounted in Citifluor (Agar, Stansted, UK) and sealed with nail varnish.
-D-thiogalactopyranoside (0.5 mM) for 4 h. Inclusion body preparation was carried
out as described previously (23). Keratins were purified by
ion-exchange chromatography using a Merck-Hitachi Biochromatography
system with a 10 × 150-mm Fractogel-EMD DEAE-650S column (Merck)
equilibrated in 8 M urea, 20 mM Tris-HCl (pH
8), 2 mM EDTA, 1 mM dithiothreitol. Fractions
of 2 ml were eluted with a linear salt gradient of 0-0.4 M
NaCl over 40 min at 1 ml/min and analyzed by SDS-PAGE.
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (63K):
[in a new window]
Fig. 1.
Nucleotide sequence and deduced amino acid
sequence of mouse keratin 16 cDNA. The sequence obtained from
the largest clone (7.31) and the RACE product includes 10 base pairs
upstream of the initial codon coding for methionine and 157 base pairs
of 3'-untranslated sequence.
-helical rod domain
interrupted by short non-helical linker regions and non-helical head
and tail domains. The rod domain is bounded by the highly conserved
helix initiation and helix termination motifs and consists of four
segments (1A, 1B, 2A, and 2B) of conserved length (29). The sequence of
mK16 is 85% homologous to that of hK16 (Fig.
2), with the central -helical rod
domain being most highly conserved (89% identical over 308 amino acids
starting at KVTMQNLNDRLATY and finishing at TYRRLDGE). The helix
initiation motif differs from that of hK16 in that it contains a
threonine rather than a serine. Although mutations in this motif can
cause very severe disorders, this particular change is apparently
tolerated and is also observed in mK14 (28). The helix termination
motif also differs from that of hK16 by one amino acid residue; in this
case, an aspartic acid residue replaces a glutamic acid residue. This
glutamic acid is highly conserved in epithelial keratins; however, an
aspartate is seen at this position in type I hard -keratins found in
hair and in CP49/phakinin, an intermediate filament protein of the eye
lens (29-32). A significant difference in the -helical region is
the lack of the proline residue in the 1B domain that has been
postulated to be responsible for the formation of rather shorter
keratin filaments by hK16 (13). The head domain of mK16 shares 71%
homology with hK16, over the first 113 amino acids of mK16. This region of hK16 has sequence that is identical to that of hK14 and hK17 (see
Troyanovsky et al. (44) for an alignment). Of these shared residues, 88% are conserved in the mouse sequence. In the tail domain,
70% of mK16 amino acids are present in hK16. Of particular note, 13 of
the last 19 residues of hK16 are conserved. This region bears no
homology to hK14 or hK17 and is likely to make K16 unique.
View larger version (44K):
[in a new window]
Fig. 2.
Comparison of amino acid sequences of mK16
and hK16. The amino acid sequences are optimally aligned.
Dashes were introduced to obtain optimal
alignment of residues. Lines were drawn to
indicate identical residues, and asterisks denote
non-identical residues.
View larger version (142K):
[in a new window]
Fig. 3.
Staining of transfected PtK2 cells. PtK2
cells transfected with mK16 and stained with RPmK16 72 h
post-transfection showed excellent formation of mK16-containing
filaments in 95% of the transfected cells (a) and spherical
bodies in the remaining 5% (b). PtK2 cells transfected with
mK16 at 24 h post-transfection and co-stained with
RPmK16/fluorescein isothiocyanate for mK16 (c) and with
LE65/Cy3 for KIFs (d) clearly showed incorporation into the
endogenous keratin intermediate filament network. PtK2 cells
transfected with hK16 and stained with LL025 also showed normal keratin
intermediate filaments (e). Abnormal filaments were observed
in cells transfected with hK16 with a L130P mutation (f).
LE65 staining is shown so that normal PtK2 keratin filaments can be
compared with the abnormal retracted filaments in the cell in the
center of the picture.
View larger version (27K):
[in a new window]
Fig. 4.
Western analysis of transfected cells.
Lanes 1 and 3, hK16-transfected cell lysate
stained with LL025 and RPmK16, respectively; lanes 2 and
4, mK16-transfected cell lysate stained with LL025 and
RPmK16, respectively. Molecular masses are indicated on the right in
kilodaltons.
View larger version (52K):
[in a new window]
Fig. 5.
Transfection of keratins into lens cell line
H36CEI. H36CEI cells were transfected with hK5 and hK14
(a), hK5 and hK16 (b), and hK5 and mK16
(c). All cells were stained with BL-18/Cy3 and the
corresponding monoclonal antibody to the type I keratin/fluorescein
isothiocyanate. BL-18/Cy3 staining is shown in each case.
View larger version (142K):
[in a new window]
Fig. 6.
Electron micrographs of K5/K16 filaments
assembled in vitro. K5/hK16 formed short filaments
(a) when assembled by the rapid dialysis procedure and long
filaments (b) using the staged dialysis procedure. K5/mK16
formed long filaments using the rapid dialysis procedure (c)
and the staged dialysis procedure (d). Scale
bar = 250 nm.
View larger version (14K):
[in a new window]
Fig. 7.
Sedimentation assay of K5/K16 assembly.
The rapid dialysis procedure was used to assemble in vitro
K5/hK16 or K5/mK16 before ( ) and after (+) addition of 50 mM NaCl. Keratins in the supernatant (sn), in
the pellet (p), and before (b) sedimentation were
subjected to SDS-PAGE. Note that in the absence of salt, most of the
K5/hK16 protein was in the supernatant, in agreement with the electron
microscopy data showing that this keratin combination formed short
incomplete filaments using the rapid dialysis procedure.
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-helix, a proline can be detrimental to KIF assembly, and in
many epidermal keratins including K16, such a proline can lead to skin
disease (41). In one study, a proline residue was introduced
experimentally into the -helical domain at a number of different
points; however, an effect on filament assembly was observed only when
it was introduced at the ends of the helical region (42). To support
the possibility that the proline could be responsible for the unique
properties of K16, Wawersik et al. (24) replaced this
residue with valine, the corresponding amino acid in hK14, and showed
that hK16 could be made to form more stable tetramers. The mouse
sequence for K16 lacks this proline residue, which is replaced by a
phenylalanine (see Phe-191 in Fig. 2). As this proline is not conserved
between mouse and human, it is unlikely to play a key role in the
function of K16.
-helical domain may lead to different
filament-forming abilities and cytoskeletal rigidity. However, the
sequence of mK16 shows a high degree of amino acid sequence conservation to hK14, hK17, and hK16 in the -helix (44). There is
also a high degree of sequence homology (83%) between mK14 and mK16 in
the -helical rod domain (28). The most unique amino acid sequences
of individual keratins are found in the head and tail domains. Common
features are observed between keratins with similar expression
patterns. For example, the end domains of both type I and II keratins
of simple epithelial keratins are rich in serine residues, whereas
those of complex epithelia are rich in glycine residues, and hair
keratins are rich in cysteine (48). It seems therefore likely that
these domains should at least be partly responsible for the
individuality of the keratin molecule. So far, too few disease-causing
mutations have been identified in the head and tail domains to give
clues as to the function of the head and tail domains (reviewed in Ref.
14). The most unique region of K16 is found in the C terminus since it
shows 70% homology (over 49 residues) to hK16, but only 12% homology to the C terminus of mK14. In contrast, the N terminus of mK16 is 72%
homologous to that of hK14.
ACKNOWLEDGEMENTS
FOOTNOTES
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. M. Bernot, C.-H. Lee, and P. A. Coulombe A small surface hydrophobic stripe in the coiled-coil domain of type I keratins mediates tetramer stability J. Cell Biol., March 14, 2005; 168(6): 965 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Egberts, M. Heinrich, J.-M. Jensen, S. Winoto-Morbach, S. Pfeiffer, M. Wickel, M. Schunck, J. Steude, P. Saftig, E. Proksch, et al. Cathepsin D is involved in the regulation of transglutaminase 1 and epidermal differentiation J. Cell Sci., May 1, 2004; 117(11): 2295 - 2307. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Der Perng, S. F. Wen, P. van den IJssel, A. R. Prescott, and R. A. Quinlan Desmin Aggregate Formation by R120G {alpha}B-Crystallin Is Caused by Altered Filament Interactions and Is Dependent upon Network Status in Cells Mol. Biol. Cell, May 1, 2004; 15(5): 2335 - 2346. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W. Owens, N. J. Wilson, A. J. M. Hill, E. L. Rugg, R. M. Porter, A. M. Hutcheson, R. A. Quinlan, D. van Heel, M. Parkes, D. P. Jewell, et al. Human keratin 8 mutations that disturb filament assembly observed in inflammatory bowel disease patients J. Cell Sci., April 15, 2004; 117(10): 1989 - 1999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Merritt, M. Y. Berika, W. Zhai, S. E. Kirk, B. Ji, M. J. Hardman, and D. R. Garrod Suprabasal Desmoglein 3 Expression in the Epidermis of Transgenic Mice Results in Hyperproliferation and Abnormal Differentiation Mol. Cell. Biol., August 15, 2002; 22(16): 5846 - 5858. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Reichelt and T. M. Magin Hyperproliferation, induction of c-Myc and 14-3-3{sigma}, but no cell fragility in keratin-10-null mice J. Cell Sci., January 7, 2002; 115(13): 2639 - 2650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Wawersik, S. Mazzalupo, D. Nguyen, and P. A. Coulombe Increased Levels of Keratin 16 Alter Epithelialization Potential of Mouse Skin Keratinocytes In Vivo and Ex Vivo Mol. Biol. Cell, November 1, 2001; 12(11): 3439 - 3450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Wojcik, M. A. Longley, and D. R. Roop Discovery of a novel murine keratin 6 (K6) isoform explains the absence of hair and nail defects in mice deficient for K6a and K6b J. Cell Biol., August 6, 2001; 154(3): 619 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Peters, J. Kirfel, H. Bussow, M. Vidal, and T. M. Magin Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex Mol. Biol. Cell, June 1, 2001; 12(6): 1775 - 1789. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wawersik and P. A. Coulombe Forced Expression of Keratin 16 Alters the Adhesion, Differentiation, and Migration of Mouse Skin Keratinocytes Mol. Biol. Cell, October 1, 2000; 11(10): 3315 - 3327. [Abstract] [Full Text]
|
|
|
|
|
|
P. Wong, E. Colucci-Guyon, K. Takahashi, C. Gu, C. Babinet, and P. A. Coulombe Introducing a Null Mutation in the Mouse K6{alpha} and K6{beta} Genes Reveals their Essential Structural Role in the Oral Mucosa J. Cell Biol., August 21, 2000; 150(4): 921 - 928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Wojcik, D. S. Bundman, and D. R. Roop Delayed Wound Healing in Keratin 6a Knockout Mice Mol. Cell. Biol., July 15, 2000; 20(14): 5248 - 5255. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. D. Perng, P. J. Muchowski, P. van den IJssel, G. J. S. Wu, A. M. Hutcheson, J. I. Clark, and R. A. Quinlan The Cardiomyopathy and Lens Cataract Mutation in alpha B-crystallin Alters Its Protein Structure, Chaperone Activity, and Interaction with Intermediate Filaments in Vitro J. Biol. Chem., November 19, 1999; 274(47): 33235 - 33243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Paladini and P. A. Coulombe The Functional Diversity of Epidermal Keratins Revealed by the Partial Rescue of the Keratin 14 Null Phenotype by Keratin 16 J. Cell Biol., September 6, 1999; 146(5): 1185 - 1201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Perng, L Cairns, P van den IJssel, A Prescott, A. Hutcheson, and R. Quinlan Intermediate filament interactions can be altered by HSP27 and alphaB-crystallin J. Cell Sci., January 7, 1999; 112(13): 2099 - 2112. [Abstract] [PDF]
|
|
|
|
|
|
M. Chidgey, C. Brakebusch, E. Gustafsson, A. Cruchley, C. Hail, S. Kirk, A. Merritt, A. North, C. Tselepis, J. Hewitt, et al. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation J. Cell Biol., November 26, 2001; 155(5): 821 - 832. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |