|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 49, 32857-32863, December 4, 1998
From the With this work we have completed the
characterization of the syringomycin synthetase gene cluster. In
particular, by sequencing additional 28.5 kilobase pairs we show that
the nine modules involved in the binding of the nine amino acids of
syringomycin are localized on SyrB and SyrE, with SyrE carrying eight
modules. The recombinant SyrB and the first and second modules of SyrE
(SyrE1 and SyrE2) have been expressed in Escherichia coli
and purified. The biochemical data indicate that SyrB binds threonine,
the putative precursor of the last amino acid of syringomycin, whereas
SyrE1 and SyrE2 bind serine, the first and the second amino acids of
syringomycin, respectively. On the basis of the sequence analysis and
the biochemical data presented here, it appears that syringomycin
synthetase is unique among peptide synthetases in that its genetic
organization does not respect the "colinearity rule" according to
which the order of the amino acid binding modules along the chromosome
parallels the order of the amino acids on the peptide. This feature,
together with the absence of a single transcription unit and the
absence of epimerase-like domains make syringomycin synthetase more
related to the eukaryotic peptide synthetases than to the bacterial counterparts.
Most phytopathogenic strains of Pseudomonas syringae
pv. syringae secrete cyclic lipodepsipeptide toxins with
phytotoxic activity and a wide spectrum of antimicrobial and antifungal
properties. The cyclic lipodepsinonapeptide syringomycin is a key
virulence determinant of P. syringae pv. syringae
strain B301D and contributes to disease symptom development (1, 2) by
disrupting ion transport and the electrical potential of host plasma
membranes (3). Syringomycin is composed of a polar peptide head, having the sequence
Ser-D-Ser1-D-Dab-Dab-Arg-Phe-Dhb-(3-OH)Asp-(4-Cl)Thr,
linked to a hydrophobic 3-hydroxy fatty acid tail with 10, 12, or 14 carbon atoms (4).
Transposon mutagenesis has revealed that insertions in a chromosomal
region larger than 25 kb result in the loss of syringomycin production
probably as a consequence of the inactivation of one or more large
proteins proposed to be part of the syringomycin synthetase complex (1,
5).
Four independently transcribed genes, syrB, syrC,
syrD, and syrP, covering approximately a 7-kb
region, have been sequenced and partially characterized (5-7).
syrB shares strong similarities with the amino acid binding
domains of peptide synthetases (5), while syrC encodes a
thioesterase-like enzyme, a protein often found at one end of bacterial
peptide synthetase operons (5, 8). Interestingly, syrD,
transcribed in the opposite orientation with respect to syrB
and syrC, codes for a protein remarkably similar to the
superfamily of ATP binding cassette transporter proteins involved in
target-specific secretion. It has been proposed that the
syrD product might be involved in the transport of
syringomycin across the cytoplasmic membrane (6). Finally,
syrP (7), which is located between syrB and
syrD, exhibits similarity to the phosphotransfer regions of
histidine kinases such as CheA (9) and Ypd1 (10), and it has been
proposed to participate in a phosphorelay mechanism of signal
transduction that controls syringomycin synthesis and influences the
virulence of P. syringae.
The structural features and, most relevant, the available sequence
information indicate that syringomycin is synthesized by means of a
multienzymatic complex. However, the genetic analysis carried out so
far would suggest that the syringomycin synthetase system differs from
the typical bacterial peptide synthetases. In fact, all bacterial
peptide synthetases are organized in operon-type structures, with the
amino acid binding domain coding regions aligned along the chromosome
according to the "colinearity rule" (11, 12). In syringomycin, a
gene coding for one of the putative amino acid binding domains (the
syrB gene) is not part of an operon encoding all the amino
acid binding domains. Furthermore, on the basis of transposon
mutagenesis experiments it could be predicted that additional
structural genes are located downstream from
syrC.2
In an attempt to shed light on the structural organization of the
syringomycin synthetase genes, we sequenced the 30 kbp region located
downstream from syrC. From the sequence analysis as well as
from the biochemical data presented here we show that the syringomycin synthetase has unique structural features more similar to eukaryotic peptide synthetases than to the bacterial counterparts. Furthermore, the unusual architecture with which two amino acid binding modules are
structured provides an additional example of how elegantly nature takes
advantage of the organization of peptide synthetases in functionally
independent domains to generate new enzymes.
Media and Strains--
Escherichia coli strains were
grown at 37 °C in LB (Luria-Bertani) medium with the appropriate
antibiotics. P. syringae pv. syringae B301D (5) was grown in
SRM-C medium (10 g/liter mannitol, 6 g/liter
L-chlorohistidine, 0.2 g/liter
MgSO4·7H2O, 0.02 g/liter FeSO4·7H2O, 0.1 g/liter
CaCl2·2H2O, 0.8 g/liter
NaH2PO4·H2O, 0.8 g/liter K2HPO4)
at 28 °C for 48 h.
DNA Preparation--
P. syringae pv.
syringae B301D chromosomal DNA was purified from 25 ml of
overnight culture grown at 28 °C in SRM-C medium. The pellet was
washed in 5 ml of physiological solution (50 mM NaCl), then
resuspended in ET buffer (10 mM EDTA, 10 mM
Tris-HCl, pH.8.0), and 10 mg of lysosyme was added and incubated
without shaking at 37 °C for 15 min. After addition of the same
volume of lysis solution (10% Sarkosyl, 250 µg/ml proteinase K in ET buffer) and further incubation at 37 °C for 15 min DNA was extracted twice with phenol/chloroform, precipitated with isopropyl alcohol, rinsed with 75% ethanol, and finally dissolved in 1 ml of water. Plasmid DNA was purified using the QIAPREP-spin or Plasmid
MIDI kit (Qiagen, Hilden, Germany) following the supplier protocol.
PCR Amplification and DNA Manipulations--
The amplifications
of the syr fragments were performed using
AmpliTaqTM rTth DNA polymerase XL
with proof-reading activity (Perkin-Elmer, Vaterstetten, Germany),
3.3 × XL buffer from Perkin-Elmer, and a specific set of primers.
The reaction was performed in a final volume of 100 µl containing
10-20 ng of chromosomal DNA from P. syringae pv.
syringae B301DR, strain (5), 20-40 pmol of primers (equimolar), 800 µM deoxyribonucleoside triphosphates
(dNTPs), 1.5 mM magnesium acetate, 1 unit of
rTth DNA polymerase, XL, and a combination of degenerated
and known sequence primers.
For reaction 1 (see Fig. 1) the forward primer was:
5'-GGAGACGAGCCAATTGATTTCGC-3' (position 68-90, upstream from
syrE) whereas for reactions 2 and 3 the forward primer was
5'-AACGACCCGCAGGCACGTCTGTAC-3' (positions 2654-2677 and 5918-5941).
For all the reactions the reverse primer was:
5'-TTNA(G/A)N(C/G)(T/A)(G/A)TGNCCNCCNA(G/A)(G/A)TC(G/A)AA(G/A)AA-3', corresponding to the core sequence T (Table I and Fig. 2).
For inverse PCR, 1 µg of P. syringae pv. syringae B301DR
chromosomal DNA was digested with EcoRI or ClaI
at completion. The restriction enzymes were then inactivated by
phenol/chloroform, and the digestion product was purified on
SephacrylTM S200 (Amersham Pharmacia Biotech) before
self-ligation with the T4 DNA ligase (N.E. Biolabs, Schwalbach/Taunus,
Germany). Then 1-2 ng of the self-ligated chromosomal DNA were used
for the inverse PCR in combination with two primers
complementary to the sequences located near the 5' termini of the
target DNA. The primers used were:
5'-TCCGAGCCTCCACCGGCAGCTGCCGCCAGTGC-3' (position 3297-3266) and
5'-GCTTCGAGTTCGAGGCAACCAGCCAGG-3' (position 15420-15446) for reaction
4; 5'-GATCTCCAGAGTCATGCCGATG-3' (position 244-223) and 5'-CTCCGGATGCTGATGATGCGCTGATCAGCC-3' (position 9558-9584) for reaction
5; 5'-GGGCCAGACTCGTCGCGAGTGGCATATTCC-3' (position 15882-15853) and
5'-CCCGATCGAAATTGCC- GTAGCCAATGAGGC-3' (position
23932-23961) for reaction 6. The PCR products were gel-purified using
the QIAEXTM II Gel Extraction Kit as described
by the manufacturer's protocol (Qiagen, Hilden, Germany). The
pCRTM II vector, purchased from Invitrogen (Leek, The
Netherlands) was used for cloning the PCR products. Transformation of
E. coli INV DNA Sequencing--
Sequence analysis was performed with an ABI
sequencer (Amersham Pharmacia Biotech), following a modified Sanger
protocol according to the manufacturer's specifications. The plasmids
with an insert of the expected size were sequenced using the universal
T7 and M13 reverse primers as well as synthesized oligonucleotides
homologous to specific internal regions of the cloned fragments. Each
cloned fragment was sequenced on both strands.
Protein Sequencing--
Automated sequence analysis of the
36-kDa SyrB2 protein was performed using a Beckman sequencer (LF 3000)
equipped with an on-line phenylthiohydantoin-derivative analyser
(System Gold) according to the manufacturer's instructions. Before
sequencing, the protein was separated onto a 12.5% acrylamide gel and
transferred to a polyvinylidene difluoride membrane.
Cloning and Expression of SyrB, SyrE1, and
SyrE2--
syrB, syrE1, and syrE2 were amplified
from P. syringae chromosomal DNA using UltmaTM
DNA polymerase with proof-reading activity (3 units) (Perkin-Elmer, Vaterstetten, Germany) and 20 µM dNTPs, 1.5 mM MgCl2, 0.3 µM primers. The
sequences of the synthesized oligonucleotides, designed to include
restriction sites useful for cloning (bold letters show the
restriction sites) were syrB-EcoRI
(5'-CGGAATTCCGATTACGAACACTGACGAATCGC-3') and
syrB-HindIII
(5'-CCCAAGCTTGAGGCTATTGTCGTATACGTGTGCG-3') for
the syrB domain, syrE1-EcoRI
(5'-GGGAATTCTGGGCGGCCAGCGGGTTCTGTCC-3' (position
342-364)) and syrE1-SacI
(5'-CCCGAGCTCGATATCGCCGAGCATGTCGCGG-3' (position
4018-3997)) for the syrE1 domain; and syrE2-EcoRI
(5'-GGGAATTCTCCCTGTCCGTGATACTGCAGG-3' (position
3860-3881)) and SyrE2-HindIII
(5'-CCCAAGCTTATCAATCAGCGCCAGTAACC-3' (position 7102-7083)) for the syrE2 domain. The PCR products
were gel-purified using the JETSORB Gel Extraction Kit
(Genomed, Bad Oeynhausen, Germany), digested with the EcoRI
and HindIII or SacI restriction enzymes (NEB,
Schwalbach/taunus, Germany) and cloned into pGEX-KG. Plasmids from
three independent clones were sequenced to confirm the absence of any
PCR errors. The ligation mixtures were used to transform E. coli TOP10. For the purification of the GST-fused domains, the
recombinant clones were used to inoculate 500 ml of LB medium
(Luria-Bertani) supplemented with ampicillin (100 µg/ml), and the
cells were grown at 26 °C with moderate shaking until an
A600 value of 0.7-0.8 was reached. Then, IPTG
was added to a final concentration of 100 µM, and the
cultures were grown for an additional 5 h. The cell pellets were
resuspended in 5 ml of phosphate-buffered saline and lysed using a
French press apparatus (SLM Aminco, Spectronic Instruments). After the
addition of 10 units of DNase and a 15-min incubation at room
temperature, the cell lysates were centrifuged at 37,000 × g for 90 min, and the supernatants were filtered (45-µm
filters, Millipore) and loaded onto 1-ml
glutathione-SepharoseTM 4B columns (Amersham Pharmacia
Biotech). The GST fusion proteins were then eluted with 750 µl of
glutathione elution buffer (Amersham Pharmacia Biotech). Thrombin
digestions were performed according to the manufacturer's specifications.
Enzymatic Activity--
ATP/PPi exchange activity
was performed as described previously (13). Briefly, 4 µg of
partially purified fusion proteins (or their thrombin cleavage
products) were added to a solution containing the amino acid to be
tested at a final concentration of 4 mM in 200 µl of 50 mM Tris-HCl, pH 7.8, 2 mM ATP, 10 mM MgCl2, 1 mM EDTA, 5 mM dithioerythritol, 0.5 mM pyrophosphate, and
0.5-2 µCi [32P]pyrophosphate (NEN Life Dupont
(Milano)). The reactions were allowed to proceed at 37 °C for 1 h and stopped by adding 0.4 ml of a 20 mM pyrophosphate
solution in 10% trichloroacetic acid containing 2% activated charcoal
(Norit A). After a 15-min incubation at 4 °C the samples were
filtered through 24-mm glass-fiber filters (934-AHTM, Whatman). The
filters were washed three times with distilled water, and radioactivity
was measured by scintillation counting.
L-4-Chlorothreonine was prepared by hydrolyzing, in 6 N HCl under nitrogen, the
N-carbobenzoxy-4-chlorothreonine methyl ester, which was
synthesized starting from glutamic acid as already described (14).
Sequence Analysis of syrE, a 28.4-kbp Gene Located Downstream from
syrC--
For the sequencing of the chromosomal region downstream from
SyrC, a "chromosome walking" strategy was used (Fig.
1). For the first amplification step
(reaction 1, Fig. 1), the forward primer was
designed on the basis of the available sequence of the 3' end of
syrC whereas a degenerated oligonucleotide, matching the
conserved "T" box of the amino acid binding modules of peptide synthetases (Table I), was used as
reverse primer, hypothesizing the existence downstream from
syrC of such modules. Once amplified, the first fragment was
cloned and sequenced, and its 3' end sequence was used to design a
second forward primer. The same reverse primer as for reaction 1 was
used for the second amplification. Finally, a third amplification step
was carried out using the same strategy. Therefore, to proceed with the
sequence analysis, an inverted PCR approach was used (15). The
chromosomal DNA was digested with appropriate restriction enzymes and
self-ligated. After self-ligation, amplification products were
generated with synthetic oligonucleotides (see "Materials and
Methods") and cloned for sequence analysis.
Using this strategy, the 28.4-kbp region downstream from the
syrC gene was fully sequenced (GenBankTM
accession number AF047828). The sequence analysis revealed the presence
of a single ORF, named syrE, which is translated in the same
direction as syrB and syrC. Although the absence
of a start codon preceded by a canonical ribosome binding site prevents the easy localization of the beginning of the protein, based on the
sequence homology with other peptide synthetases modules, we predict
that SyrE starts with the ATG located 134 bp downstream from the
syrC stop codon. The correctness of the start codon
localization is further supported by the fact that 12 of the 16 upstream nucleotides (AAACAGGTGCTTTGAGATG) are conserved in
the same region preceding the ATG of the syrB gene
(ACACAGGAGCTTTGGTCATG). Therefore,
SyrE is predicted to be a 9454-amino acid-long protein, with a
calculated molecular mass of 1,038,663 Da. Similar to what was found
for syrB, syrC, and syrP (5, 7), no
typical E. coli
As illustrated in Fig. 1, the sequence analysis of SyrE revealed that
the protein is organized in eight highly homologous modules having the
typical organization of the amino acid binding domains of all peptide
synthetases so far characterized (8). In fact, the eight modules have
in common the three major domains known as condensation, adenylation,
and thiolation domains (8) (Fig. 2). In
particular, the common boxes identified within all amino acid binding
modules (8) are highly conserved (Table I). Interestingly, the overall
identity among the SyrE modules is unusually high. In particular, if
only the adenylation domains are taken into account, the identities
range from 45% (between module E5 and E8) to 90% (between modules E1
and E2 and between E3 and E4).
Another unexpected feature of SyrE is the absence of any racemase-like
domain. Indeed, considering that two of the nine amino acids of
syringomycin are in the D configuration (the second and the
third amino acid (4)) one would expect that, as it is the case for all
bacterial peptide synthetases so far characterized (16-18), these two
amino acid binding modules are followed by racemase units.
Unique is the organization of the SyrE8 module. In addition to the
condensation, adenylation, and thiolation domains, the module carries a
thioesterase domain (TE), a motif constantly found fused to the last
amino acid binding domains of all bacterial peptide synthetases (8,
16-20). However, the architecture of the SyrE8 module is such that the
TE motif is kept apart from the thiolation domain by an intervening
sequence that includes a condensation domain and a second thiolation
domain (Fig. 2). Looking at the architecture from another perspective,
one can say that between the thiolation domain of SyrE8 and the TE
motif a ninth module is present in which the adenylation domain is missing.
Interestingly, when the SyrE modules are compared with the other
syringomycin synthetase subunit, SyrB1, a module having both the
adenylation and thiolation domains but not the condensation domain
(Fig. 2), the overall homology is in the 37% range, remarkably lower
than the homology found among the SyrE modules.
Amino Acid Specificity of SyrB, SyrE1, and SyrE2--
As mentioned
above, the high homology between SyrE1 and SyrE2 and between SyrE3 and
SyrE4 strongly suggests that the homologous domains recognize the same
amino acid. Because in syringomycin the first and the second amino acid
are serine and the third and forth amino acid 2,4-diaminobutyric acid
(Dab), one would predict that SyrE1 and SyrE2 recognize Ser and SyrE3
and SyrE4 Dab. This organization would be in contrast with the
colinearity rule of peptide synthetases according to which the order
with which the amino acid binding modules are aligned along the
chromosome parallels the sequence of the peptide. In fact, the genetic
organization of syringomycin synthetase is such that the
syrE1 module is preceded by the syrB module, and
therefore one would expect that SyrB and SyrE1 recognize serine and
SyrE2 and SyrE3 Dab.
In the attempt to shed light on the domain organization and specificity
in syringomycin we isolated the syrB, syrE1, and
syrE2 genes using the PCR approach described under
"Materials and Methods." Three fragments were obtained, one of
2,847 bp encoding the putative SyrB protein of 949 amino acid (105 kDa), the syrE1 domain of 3,678 bp encoding a protein of
1226 amino acids (135 kDa), and the syrE2 domain of 3,243 bp
encoding a protein of 1081 amino acids (119 kDa). These DNA fragments
were inserted into plasmid pGEX in such a way that the modules could be
expressed in E. coli fused to the C-terminal end of the GST
protein. Although we used the ULTmaTM DNA polymerase with
proof-reading activity to perform the PCR reactions, three independent
clones for each construct were randomly selected and sequenced to rule
out the possibility of PCR-generated errors. In all cases the sequences
were identical. However, the sequence analysis of the plasmids carrying
the syrB gene revealed a difference from the published
syrB sequence (5) in that the G originally found at position
2207 was absent, leading to a change in the reading frame and to a stop
codon at position 2211. Interestingly, since an ATG codon is present at
position 2229, which is preceded by a putative ribosome binding site
sequence (AGGAA), one could predict that a second protein can be
generated from syrB, translated with the same reading frame
as the preceding one.
In conclusion, syrB encodes two putative proteins, SyrB1 of
613 amino acids (67 kDa) carrying the typical adenylation and thiolation domains (Figs. 1 and 2) and SyrB2 of 331 amino acids (36 kDa), with a still unknown function.
When the total proteins from the clones carrying the three genes were
analyzed by SDS-polyacrylamide gel electrophoresis, it appeared that
the fusions proteins were expressed (Fig.
3), mostly as insoluble material.
However, when the cells were grown at 26 °C and the expression of
the fusion proteins was induced with a low concentration of IPTG (100 µM) a sufficient amount of proteins partitioned in the
soluble fraction thus allowing their partial purification using a
glutathione affinity column (Fig. 3). The three fusions, GST-SyrB1,
GST-SyrE1, and GST-SyrE2, migrated according to the expected molecular
size on SDS-polyacrylamide gel (96, 164, and 148 kDa, respectively,
Fig. 3). After purification, minor contaminants were still present that
could represent host proteins retained on the glutathione affinity
column (as is the case for the 30-kDa protein species found in all
protein preparations) or the degradation products of the fusion
proteins. Furthermore, as expected, the clone carrying the
syrB gene also produced a 36-kDa protein not retained on the
affinity column (Fig. 3A, lane 3). To confirm
that the 36-kDa protein species corresponded to SyrB2, the band was cut
out from a polyvinylidene difluoride membrane and subjected to
N-terminal sequencing. The sequence of the first seven amino acids was
MSKKFAL, corresponding to the N-terminal sequence of SyrB2.
The purified SyrB1 and SyrE1 proteins were also subjected to thrombin
digestion (in both fusions a thrombin recognition site is located at
the junction between the GST protein and the amino acid binding
domain). As shown in Fig. 3A, lane 4, and
3B, lane 5, the digestions gave two bands, one
with a molecular mass of 29 kDa corresponding to the GST moiety whereas
the other with a molecular mass of 67 kDa and 135 kDa corresponded to
SyrB1 and SyrE1, respectively.
The fusion proteins were then utilized to determine the amino acid
specificity of SyrB1, SyrE1, and SyrE2. To this purpose, the partially
purified proteins were incubated with each of the amino acids present
in syringomycin, including threonine as both the L isomer
and 4-chloro-substituted derivative and the 3-hydroxy derivative of the
aspartic acid. In the case of SyrB1 (Fig.
4A), threonine was the only
amino acid able to promote pyrophosphate exchange from PPi
to ATP, whereas SyrE1 and SyrE2 turned out to be specific for serine.
Similar results were obtained when the thrombin-cleaved domains from
GST-SyrB1 and GST-SyrE1 were used in the assay (Fig. 4B).
These data indicate that SyrE1, SyrE2, and SyrB1 recognize the first,
the second, and the last amino acids of syringomycin, respectively.
With the present work we have completed the characterization,
started by Gross and co-workers (1, 5), of the genetic region which in
P. syringae is responsible for the synthesis of the
lipopeptide syringomycin. From the previously published work as well as
from the data reported here, it appears that syringomycin synthetase
has a number of features both at the genetic and structural level that
make it unique among all bacterial peptide synthetases so far characterized.
The first unusual feature is the organization of the syringomycin
synthetase structural genes. Four genes had been previously identified
to be involved in the synthesis of syringomycin, syrB and
syrC with putative structural properties and syrD
and syrP with secretory and regulatory functions (5-7). We
have now completed the characterization of the syringomycin gene
cluster and from this work we found that syrB is actually
organized in two ORFs, syrB1 and syrB2 encoding
two proteins with a molecular mass of 67 kDa and 36 kDa, respectively.
The 67-kDa protein carries all the relevant conserved regions of the
amino acid binding modules of peptide synthetases. Still unknown is the
putative function of SyrB2. Furthermore, an additional structural gene
(syrE) was localized downstream from syrC
encoding a protein of 9454 amino acids with a predicted molecular mass
of 1,038,663 Da, the largest bacterial protein so far
identified.3
Secondly, our biochemical data indicating that SyrB1 binds threonine,
the putative precursor of the amino acid found at the ninth position in
syringomycin, and SyrE1 binds the first amino acid serine, clearly show
that the colinearity rule, according to which the order of the amino
acid binding modules along the chromosome parallels the order of the
amino acids in the peptide, does not hold for the syringomycin
synthetase system. These experimental data fit nicely the observation
that in SyrB1 the condensation domain typically found at the N terminus
of the first domains of lipopeptide synthetases is missing whereas such
a domain is fused to SyrE1. This is the first example of such an
organization among all peptide synthetases studied so far.
Interestingly, very recently we have demonstrated that in surfactin
synthetase the coordinated transcription of the enzyme subunits can be
altered and the amino acid binding modules can be dissociated without substantially affecting the synthesis of surfactin at both the qualitative and quantitative level (19). These data, together with the
experimental evidence showing that the purified surfactin synthetase
subunits can reassociate in vitro to give a functional enzyme (22), led us to the conclusion that protein-protein interactions rather than coordinated transcription and translation guide the correct
assembling of peptide synthetases. In this context, syringomycin synthetase is a natural example of what we have demonstrated by gene manipulations.
Thirdly, in all prokaryotic peptide synthetases the thioesterase
moiety, which appears to be involved in the release of the mature
peptide chain from the enzyme, is fused to the C-terminal end of the
last amino acid binding module (8). In the case of syringomycin
synthetase, the TE domain is found fused to the C terminus of SyrE8 and
not, as one would predict, at the end of SyrB1. Apart from its unusual
feature, this structural organization poses the question on how can a
premature peptide of eight amino acids not be released before the
completion of syringomycin synthesis. Most likely, the answer to this
question is found in the atypical architecture of SyrE8. Differently
from the other synthetases in which the TE domain is directly fused at
the C-terminal end of the last amino acid binding module, in SyrE8 an
intervening sequence keeps TE apart from the thiolation motif and most
likely prevents the thioesterase from releasing the 8-amino acid
peptide. Even more interesting is the fact that the intervening
sequence is constituted by an amino acid binding module in which the
adenylation domain is missing. Considering that in SyrB1 the
adenylation domain is not preceded by the condensation domain, one
could envisage a situation in which a fully functional module is
reconstituted by the proper interaction of SyrB1, which provides the
amino acid specificity domain, with the intervening sequence of SyrE8,
which provides the condensation and the thiolation domain (Fig.
5).
Finally, because the second and third amino acids of syringomycin are
in the D configuration (D-serine and
D-aminobutyric acid (4)), comparisons to other bacterial
peptide synthetases predict the presence of an epimerization domain
fused to the C terminus of both SyrE2 and SyrE3. However, such domains
are missing in the SyrE subunit. Therefore, the mechanism by which
D-amino acids are incorporated into syringomycin could
involve the direct binding of the D-isomers to the
adenylation domains, as postulated for the eukaryotic cyclosporin
and Helminthosporium carbonum toxin synthetases (23,
24).
In the attempt to shed light on the mechanism of D-amino
acid incorporation, we have also cloned and expressed the SyrE2 domain to determine its amino acid specificity. From our data it appears that
SyrE2 recognizes L-serine, in line with the sequence
analysis showing a 90% identity between the adenylation modules of
SyrE1 and SyrE2. This raises the interesting question on how and when the change of configuration takes place during syringomycin
biosynthesis. A possible mechanism could envisage that racemization
occurs at the peptidyl or at the aminoacyl stage, as has been proposed
for the incorporation of D-valine in both GrsA and TycA
(25, 26), provided that an external racemase takes part in the
synthetase complex. Considering that various amino acid racemases and
epimerases with broad substrate specificity have been characterized
from several Pseudomonas and Aeromonas strains
(27, 28), it is likely that some of them might play a role in
syringomycin biosynthesis. The mechanism of racemization in
syringomycin synthetase could therefore differ from the one proposed
for the D-amino acid incorporation in cyclosporin A and
Helminthosporium carbonum toxin, where the direct
binding of D-amino acids has been postulated. However, it
has to be pointed out that there is no experimental evidence showing
that purified, recombinant domains of eukaryotic peptide synthetases
bind the D-isomers. Therefore, the existence of these two
different pathways of D-amino acid incorporation still
awaits experimental demonstration.
As far as substrate specificity is concerned, the observation that
SyrB1 appears to bind threonine and not its chloro derivative is
interesting, suggesting that, as is the case for serine epimerization, threonine modification also occurs after recognition and possibly at
the peptidyl level. This is in line with the observation that a
deschloro analogue of syringomycin is produced in vivo when P. syringae pv. syringae is grown under
chlorine-free conditions (29).
The length of SyrE, the absence of racemase motifs, and the independent
transcription of the coding genes make syringomycin synthetase more
similar to the eukaryotic enzymes than to the prokaryotic counterparts.
For instance, the 9454-amino acid-long SyrE resembles the cyclosporin
synthetase constituted by a single giant protein of 15,282 amino acids
containing 11 modules (23), and as is the case for syringomycin
synthetase, no racemase-like domain can be identified in cyclosporin
synthetase (23).
How can an enzyme with eukaryotic features be present in a
prokaryotic organism? One possible explanation is direct gene transfer from an eukaryotic organism to P. syringae. In line with
this hypothesis is (i) the relative poor homology between SyrB and SyrE
as compared with the homologies existing among SyrE modules (50%
identities among SyrE domains versus the lesser 37%
identity between SyrB and any of the SyrE modules) and (ii) the GC
content of syrB. While it is similar to the average GC
content of other P. syringae pv. syringae genes
(59.5% (5)), the GC content of syrE is 62.5%. The
horizontal transfer of a peptide synthetase gene from prokaryotes to
eukaryotes has already been postulated in the case of the ACV
( If SyrE has been acquired from a eukaryotic organism, why has its
structure not changed during evolution to become more similar to the
prokaryotic enzymes? Among the possible explanations an attractive one
is that the gene could be transcribed and translated in the infected
plant cells to exacerbate its pathogenic functions. It should not be
difficult to test this hypothesis experimentally. Of relevance is the
fact that the syringomycin synthetase genes are activated in response
to specific plant signal molecules (7, 32), thus making syringomycin
synthetase the only known thiotemplate system for toxin synthesis
regulated by external host factors.
We thank Giorgio Corsi for the artwork and
Antonietta Maiorino for her expert secretarial assistance.
*
This work was supported in part by a grant from the European
Community, IV Framework Program (to G. G.), in part by Grant 97-35303-4460 from the National Research Initiative Competitive Grants
Program of the U. S. Department of Agriculture, Science and Education
Administration (to D. C. G.), partially by the contribution of the
"Istituto Pasteur Fondazione Cenci Bolognetti," Università di
Roma "La Sapienza" (grant to I. G.), and by Ministero della Università e della Ricerca Scientifica e Tecnologica (MURST).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF047828.
The abbreviations used are:
D-Ser, the D-isomer of Ser; Dab, 2,4-diaminobutyric acid; D-Dab, the D-isomer of Dab; Dhb, 2,3-dehydroaminobutyric acid; (3-OH)Asp, 3-hydroxyaspartic acid; (4-Cl)Thr, 4-chlorothreonine; bp, base pair(s); kb, kilobase(s); kbp, kilobase pair(s); PCR, polymerase chain reaction; GST, glutathione
S-transferase; IPTG, isopropyl-1-thio-b-D-galactopyranoside; TE, thioesterase.
2
B. K. Scholz-Schroeder, I. Grgurina, and D. Gross, unpublished observations.
3
GenBankTM sequence data base,
http://www.NCBI.nlm.nih.gov (submission 7/98).
Characterization of the Syringomycin Synthetase Gene Cluster
A LINK BETWEEN PROKARYOTIC AND EUKARYOTIC PEPTIDE
SYNTHETASES*
,,
Department of Molecular Biology, Chiron
S.p.A., Via Fiorentina, 1 53100 Siena, Italy, the
§ Department of Biochemical Sciences, A. Rossi Fanelli,
"La Sapienza," University of Rome, P.le Aldo Moro, 5, 00185 Rome,
Italy, and the ¶ Department of Plant Pathology, Washington
State University, Pullman, Washington 99164-6430
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
F' One ShotTM competent cells was
carried out according to the manufacturer's recommendations. The
transformants were selected on agar plate containing 100 µg/ml
ampicillin and then grown overnight at 37 °C in LB medium with 50 µg/ml kanamycin for the preparation of the transformed plasmid DNA.
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (20K):
[in a new window]
Fig. 1.
Cloning, sequencing, and biochemical
characterization of the syringomycin biosynthesis genes. A,
the organization along the chromosome of the syrB,
syrC, and syrE genes is shown, as well as the PCR
and inverse PCR clones used in this study. B, gene fragments
corresponding to the domains that were overexpressed and purified from
E. coli to analyze their substrate specificity in an
ATP/PPi exchange reaction. E, EcoRI;
C, ClaI; Pr, promoter.
Highly conserved motifs of the syringomycin synthetase modules
70-like promoter is present
upstream from syrE. A 
-independent terminator-like
structure, with a calculated free energy of stability of 
6.5
kcal/mol, was observed 53 bp downstream of the syrE stop codon.
View larger version (22K):
[in a new window]
Fig. 2.
Schematic representation of the organization
of the nine Syr modules. The condensation, adenylation,
thiolation, and thioesterase domains are defined as described by
Marahiel et al. (8). The highly conserved core motifs of the
catalytic domains are shown in Table I.
View larger version (73K):
[in a new window]
Fig. 3.
SDS-polyacrylamide gel electrophoresis of the
GST/SyrB, GST/SyrE1, and GST/SyrE2 fusions expressed in E. coli. A, SyrB1 module. Lanes: 1,
whole cell extract before induction with IPTG; 2, whole cell
extract after induction for 5 h at 26 °C with IPTG (100 µM); 3, partially purified GST/SyrB1 fusion;
4, purified product cleaved by thrombin. B, SyrE1
and SyrE2 modules. Lanes: 1, whole cell extract
of GST/SyrE2 after induction for 5 h at 26 °C with IPTG (100 µM); 2, soluble fraction of the cell extract
of GST/SyrE2; 3, partially purified GST/SyrE2 fusion;
4, partially purified GST/SyrE1 fusion; 5,
purified GST/SyrE1 product cleaved with thrombin. M,
apparent molecular mass marker. The black arrows
show the band corresponding to the purified GST fusions before and
after digestion with thrombin. The white arrow
shows the product of the syrB2 gene.
View larger version (14K):
[in a new window]
Fig. 4.
Substrate specificities of SyrB,
SyrE1, and SyrE2 modules. A, the ATP/PPi
exchange activity of the partially purified GST fusion proteins were
measured in the presence of the amino acids contained in syringomycin.
The highest activities were set to 100% ( 
85,000 cpm for the SyrB
modules and 21,000 cpm for the SyrE1 and SyrE2 modules; this
represents the average of at least 5 experiments with 2 independent
clones for each domain). The SyrB1, SyrE1, and SyrE2 domains were able
to activate L-threonine and L-serine,
respectively. B, ATP/PPi exchange activity of
the SyrB1 and SyrE1 fusion proteins before and after cleavage with
thrombin. The results are similar in the presence or absence of the GST
moiety.
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (28K):
[in a new window]
Fig. 5.
Schematic representation of the synthesis and
assembly of the syringomycin synthetase. The syringomycin
synthetase subunits are transcribed on different messenger RNAs. The
SyrB subunit, which activates the last amino acid of syringomycin, has
to interact specifically with the C-terminal end of SyrE in order to
build up a functional enzyme.
-(L--aminoadipyl)-L-cysteinyl-D-valine) synthetase (30, 31). Our data would suggest that in peptide synthetases
such gene exchange could also go in the other direction.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Head Molecular
Biology Department, Chiron SpA, Via Fiorentina, 1, 53100 Siena, Italy.
Tel.: 39-577-243506; Fax: 39-577-243564; E-mail: grandi{at}iris02.biocine.it.
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  E. J. Dimise, P. F. Widboom, and S. D. Bruner Structure elucidation and biosynthesis of fuscachelins, peptide siderophores from the moderate thermophile Thermobifida fusca PNAS, October 7, 2008; 105(40): 15311 - 15316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-F. Dubern, E. R. Coppoolse, W. J. Stiekema, and G. V. Bloemberg Genetic and functional characterization of the gene cluster directing the biosynthesis of putisolvin I and II in Pseudomonas putida strain PCL1445 Microbiology, July 1, 2008; 154(7): 2070 - 2083. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. de Bruijn, M. J. D. de Kock, P. de Waard, T. A. van Beek, and J. M. Raaijmakers Massetolide A Biosynthesis in Pseudomonas fluorescens J. Bacteriol., April 15, 2008; 190(8): 2777 - 2789. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Li, W. Deng, J. Song, W. Ding, Q.-F. Zhao, C. Peng, W.-W. Song, G.-L. Tang, and W. Liu Characterization of the Saframycin A Gene Cluster from Streptomyces lavendulae NRRL 11002 Revealing a Nonribosomal Peptide Synthetase System for Assembling the Unusual Tetrapeptidyl Skeleton in an Iterative Manner J. Bacteriol., January 1, 2008; 190(1): 251 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Fujimori, S. Hrvatin, C. S. Neumann, M. Strieker, M. A. Marahiel, and C. T. Walsh Cloning and characterization of the biosynthetic gene cluster for kutznerides PNAS, October 16, 2007; 104(42): 16498 - 16503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Fischbach, J. R. Lai, E. D. Roche, C. T. Walsh, and D. R. Liu Directed evolution can rapidly improve the activity of chimeric assembly-line enzymes PNAS, July 17, 2007; 104(29): 11951 - 11956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Yin and T. M. Zabriskie The enduracidin biosynthetic gene cluster from Streptomyces fungicidicus. Microbiology, October 1, 2006; 152(Pt 10): 2969 - 2983. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Wang, S.-E. Lu, A. R. Records, and D. C. Gross Characterization of the Transcriptional Activators SalA and SyrF, Which Are Required for Syringomycin and Syringopeptin Production by Pseudomonas syringae pv. syringae J. Bacteriol., May 1, 2006; 188(9): 3290 - 3298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Grunewald and M. A. Marahiel Chemoenzymatic and |