![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 5, 2526-2531, January 30, 1998
From the The apparent Km, but not
Vmax, for influx of methotrexate (MTX) mediated
through the plasma membrane of S180 cells by the one-carbon, reduced
folate transporter as well as the KD for binding to
the transporter were 4-fold higher than in L1210 cells correlating with
the greater intrinsic resistance of the former to this folate analogue.
In contrast, no difference was observed between each cell type with
regard to efflux of [3H]MTX mediated by this same
transporter in ATP-depleted cells. The difference in influx
Km in the case of this 10-methyl substituted N1O
analogue of folic acid was not seen with more effective permeants, such
as the unsubstituted N1O aminopterin or C1O analogues. Thus, values for
influx Km for aminopterin, which were 1-1.2
µM in each cell type, increased as a result of substitution at N1O (MTX) 3-fold in L1210 cells but 12-fold in S180
cells. Nucleotide sequencing of reverse transcriptase-polymerase chain
reaction-generated cDNA and of polymerase chain reaction-generated genomic DNA identified a single nucleotide difference between each cell
type at +890 within exon 3 of the RFC-1 gene. This was in the form of a
G (L1210 cells) to A (S180 cells) transition. Codon 297, the site of
this transition, encodes either Ser or Asn in L1210 or S180 cells,
respectively, which is located between the seventh and eight
membrane-spanning helices. This amino acid difference had no effect on
the electrophoretic mobility or amount of the transporter in each cell
type that was shown by Western blotting with anti-RFC-1 peptide
antibodies to migrate as 46 kDa in each case. Proof that this
nucleotide difference alone accounted for the alteration in influx
between each cell type was obtained by S180 RFC-1 cDNA
versus L1210 RFC-1 cDNA transfection of an L1210 cell
variant with undetectable MTX influx and RFC-1 gene expression. In this
case, the higher Km for MTX influx associated with
S180 cells was duplicated only in the S180 RFC-1 transfectants. These
results appear to document the first example of a nucleotide alteration
within the RFC-1 gene, which influences the interaction of MTX with the
encoded plasma membrane transporter. An analysis of topology, in
addition to other considerations, suggests that the site of the amino
acid difference found in the transporter from L1210 and S180 cells
occurs within or near the binding site on the external plasma membrane
surface.
Mammalian cells have an absolute requirement for exogenous folates
(1, 2) for growth and macromolecular biosynthesis. This is fulfilled by
the internalization of folate compounds into these cells by either
carrier-mediated or receptor-mediated mechanisms (3-6) depending upon
their level of expression. In the case of tumor cells, mediated
internalization of folate compounds occurs primarily by the one-carbon,
reduced folate transporter (3-5). The same carrier-mediated system is
involved in the internalization of cytotoxic folate analogues. This and
the low level of expression of this system in many tumor cells
resistant to these analogues (7-9) established its pharmacologic
relevance.
Early studies in drug-naive murine tumor models documented (10) a
positive relationship between the extent of internalization of
MTX1 mediated by the
one-carbon reduced folate transporter and intrinsic resistance to this
analogue. A limited amount of information has also been derived (11)
regarding a similar relationship among human cancers. In our own
studies (12) of drug-naive murine tumors, a correlation was documented
between the saturability of transport inward (reciprocal of influx
Km) and intrinsic resistance. In this case, influx
saturability was as much as 4-fold higher for the most
antifolate-sensitive tumor cells (L1210) compared with the most
resistant tumor cells (S180) among the group examined. In contrast,
neither Vmax for MTX influx nor the rate
constant for its efflux mediated by a separate
ATP-dependent mechanism (13) varied significantly among
these tumors (12).
Both rodent (14, 15) and human (16-19) cDNA clones have recently
been isolated that encode a transporter (RFC-1) with properties similar
to that of the one-carbon reduced folate transporter. However,
unresolved issues pertaining to the size of the transporter encoded
(4-9) are of lingering concern. In the case of the murine RFC-1 gene,
it is known from the deduced amino acid sequence that the gene is
capable of encoding (14) a 58-kDa protein, while the apparent size of
this transporter in murine tumor cells determined (9, 20, 21) by at
least two methods was actually 46 kDa.
In the present report, we report on a nucleotide difference within the
open reading frame of the L1210 and S180 cell RFC-1 genes that appears
to explain the variation in the saturability of the one-carbon, reduced
folate transporter for MTX and intrinsic resistance to this analogue
between these cell types. We also show that the size of the transporter
in the plasma membrane resulting from expression of murine RFC-1
cDNA in transfectants of tumor cells originally lacking the
transporter is in fact manifest as a 46-kDa protein following SDS-PAGE
and Western blotting with anti mouse RFC-1 peptide antibodies. Both
findings together provide the strongest support yet for the notion that
the RFC-1 gene encodes the classical one-carbon, reduced folate
transporter. We also address the issue of the directional orientation
of the transporter within the plasma membrane using an analysis of
topology as well as other considerations.
Tumor Cell Lines and Culture Conditions--
L1210 and S180
cells were maintained in RPMI 1640 medium containing 10% fetal calf
serum according to previously published (7) procedures. For the various
experiments, cells in logarithmic phase of growth (5 ± 1 × 105 cells/ml) were harvested by centrifugation and washed
once in 0.14 M NaCl plus 0.01 M potassium
phosphate prior to pelleting or resuspension in transport buffer (22).
L1210/R32 cells were derived as described previously (7) by serial
passage in increasing concentrations of MTX and cloned by limiting
dilution. This clonal variant was greater than 100-fold more resistant
to MTX and exhibited essentially no influx of [3H]MTX
when compared with parental L1210 cells. The preparation of these cells
for the various experiments was the same as that given above with
maintenance by growth in the presence of 1 µM MTX in RPMI
medium plus fetal calf serum.
Transport and Binding Studies--
Transport experiments were
carried out at 37 °C with cell suspensions (3-5 × 107 cells/ml) prepared in transport buffer (22) at pH 7.5. Measurements of mediated influx and efflux of radiolabeled folate
analogues were carried out by standard procedures (7, 12, 22) utilizing methods for sampling and processing of cells for radioactivity counting
described earlier (7, 12, 22). Conditions employed for these
experiments utilized (22) corrections for surface binding of permeants
and ensured measurements of undirectional influx and efflux. Procedures
utilized to derive values for influx Km and
Vmax and the efflux rate constant have been
described in detail (7, 12, 22). Values for total intracellular water, membrane potential, total protein, and dihydrofolate reductase content
for both cell types used in these experiments were very similar
(22).
A Single Amino Acid Difference within the Folate Transporter
Encoded by the Murine RFC-1 Gene Selectively Alters its Interaction
with Folate Analogues
IMPLICATIONS FOR INTRINSIC ANTIFOLATE RESISTANCE AND DIRECTIONAL
ORIENTATION OF THE TRANSPORTER WITHIN THE PLASMA MEMBRANE OF TUMOR
CELLS*
,
,
, and
§¶
Program in Molecular Pharmacology Memorial,
Sloan-Kettering Cancer Center, New York, New York 10021 and the
§ Graduate School of Medical Sciences, Cornell University,
New York, New York 10021
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References
Western Blotting-- Antibodies against two murine RFC-1-specific peptides were prepared in rabbits according to standard protocols (24). Composition of the peptides and preparation of the peptide antigens have been described (25). Antibodies were purified by immunoaffinity chromatography with the peptides linked to cyanogen bromide-activated Sepharose (26). Western blotting with enhanced chemiluminescence (Amersham) detection was carried out by a standard procedure (27) following SDS-polyacrylamide gel electrophoresis of solubilized and alkaline-washed plasma membrane proteins (28).
Northern Blotting--
Standard procedures (29) were used for
detection by blotting of RFC-1 mRNA in tumor cells using a murine
RFC-1 cDNA probe (14) prepared by RT-PCR. Poly(A)+ RNA
was extracted directly (30) from cell lysates using an oligo(dt)
cellulose column. An aliquot (10 µg) of the RNA was analyzed (29) by
Northern blotting using the RFC-1 cDNA probe normalizing to
mRNA content with a human
-actin probe, PCD-
-actin (31).
Labeling of each probe was by random priming (Random Primers DNA
labeling kit, Boehringer Mannheim) using [
-32P]dCTP
(3000 Ci/mmol and 10-20 ng of insert).
Sequencing of DNA-- Double-stranded DNA was sequenced in both directions according to the dideoxy method of Sanger et al. (32) using Sequenace Version 2.0 (U.S. Biosciences, Cleveland, OH). Oligonucleotide primers based on the mouse RFC-1 cDNA sequence were used to sequence cDNA prepared by RT-PCR and genomic DNA. Additional primers were prepared on the basis of the sequence data when necessary.
RT-PCR--
Five µg of poly(A)+ RNA in 20 µl of
reaction mixture with Superscript II RT was used to synthesize first
strand cDNA from L1210 and S180 cells according to the
manufacturer's instructions (Life Technologies, Inc.). For each cell
type, two DNA fragments of mRFC-1 were amplified encompassing the total
published (33) sequence. Amplification was done with 1 µl of each
cDNA sample prepared as above mixed with 30 pmol each of the
gene-specific primers. The primer sets used to obtain each PCR product
were as follows: sense primer 5
-AGCGCTGTGGGACGCAGAGCT-3
and antisense primer 5
-GCAATGGGCACAAGGAACTG-3
; sense primer
5
-GTGACCTTTGTGCTTTTCCGT-3
and antisense primer
5
-TTTAAACAAGCACCTCCGATA-3
. In addition to the primers, the reaction
mixture consisted of 4 µl of 2.5 mM deoxynucleotide
triphosphate, 5 µl of 10 × PCR buffer containing 2.5 mM MgCl2, 0.5 µl Tag polymerase (5 units/µl), and 0.5 µl of Pfu polymerase (5 units/µl)
in a total of 50 µl. Conditions for PCR consisted of an initial 3 min
of denaturation at 94 °C followed by 35 cycles of 1 min at 94 °C,
30 s at 60 °C, and extension for 1.5 min at 72 °C. After the
35 cycles were completed, the final extension was carried out for 5 min
at 72 °C. The PCR products were purified in a 1% agarose gel using
GeneClean according to the manufacturer's (Bio101) instructions. The
yield was checked by re-electrophoresis on 1% agarose, and the gel was
used for transblotting and hybridization with an internal
region-specific probe. The remaining purified PCR product was ligated
into the EcoRV site of pSK+ bluescript
(Stratagene) and transformed into Escherichia coli DH5
and sequenced.
PCR of Genomic DNA--
Six independent amplifications were
carried out on the S180 genomic DNA encompassing the base pair
difference between L1210 and S180 cells. The primers used were as
follows: sense primer 5
-GAAAATGCTCGGCAACCACAG-3
and antisense primer
5
TCAGCAGTGTGGAGGCGGCA-3
. The same PCR conditions described above were
used, and following transformation of the ligated product in
pSK+ bluescript sequencing was carried out.
Plasmid Preparation for Transfection Experiments--
The
previously prepared first strand cDNA from L1210 and S180 cells was
used to generate PCR products spanning the open reading frame from
start to stop codons. A primer harboring a portion of the mRFC-1
sequence (ACGGGGTACCCCGGGAATTCCGGCCACCATGGTGCCCACTGGCCAGGTG) including
the start codon with a cleavable EcoRI site at the 5
-end was used as the sense primer. The antisense sequence
(5
-CCGAATTCTCGAGTCAAGCCTTGGCTTCGACTC) including the stop codon
and a 5
-cleavable XhoI site was used as the other primer.
The PCR reaction conditions were as described above except that the
extension time was increased from 1.5 to 3 min for each cycle. After
completing the PCR reaction, the products were purified and digested by
EcoRI and XhoI and ligated into the pCDNA-3
eukaryotic expression vector at these restrictions sites to yield
T-pS180RFC-1 and T-pL1210RFC-1. After confirming the identity of each
clone, the plasmid was held for transformation.
Preparation of Transfectants-- Variant MTX-resistant L1210 cells (L1210/R32) with essentially no RFC-1-mediated transport inward of folate compounds was electroporated (500 V, 200 microfarads) with 40 µg of BglII linearized construct (T-pS180RFC-1, T-pL1210RFC-1) or vector alone (T-pCDNA-3). The final volume of the cell suspension during electroporation was 800 µl of RPMI 1640 medium plus 10% fetal calf serum. Forty-eight hours after electroporation, the cell number was adjusted to 5 × 105 cells/ml in complete RPMI 1640 medium containing 1 mg/ml of G418, and clonal selection was carried out by limiting dilution in the same medium. Clones were analyzed by Northern blotting for the presence of the neomycin gene and for RFC-1 gene transcripts before use.
Transfection of human ZR-75-1/MTXR cells with L1210 cell RFC-1 (pRFC-1) and vector alone (pREP3) was described earlier (14). These transfectants (generously provided by J. Moscow and K. Cowan of the National Cancer Institute) were maintained over several transfer generations in folate-free improved minimal essential medium (zinc option) with 5% dialyzed fetal calf serum and 100 nM trimetrexate, 25 nM DL-L5CHO-folate H4, and 200 µg/ml of hygromycin prior to use. The vector transfected ZR-75-1/MTXR cells were maintained in improved minimal essential medium (zinc option) with 5% fetal calf serum and 100 µM MTX.Materials--
[3
,5
,9-3H]MTX (specific activity,
10-20 Ci/mmol), [3
,5
,9-3H]AMT (specific activity,
10-15 Ci/mmol), 10-deaza-[3
,5
,9-3H]AMT (specific
activity, 10-15 Ci/mmol), and [3
,5
,9-3H]EDX (specific
activity, 15-20 Ci/mmol) were purchased from Morevak Biochemicals
(City of Industry, CA) and purified prior to use by high performance
liquid chromatography (34). Unlabeled MTX was provided by the Drug
Procurement and Synthesis Branch (Division of Cancer Treatment,
National Cancer Institute, Bethesda, MD). Both radioactive and
nonradioactive samples of MTX were found by re-chromatography (34) to
be greater than 98% pure.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
A comparison of the properties of membrane transport of various folate analogues by ATP replete L1210 and S180 cells that were obtained in the appropriate functional studies, and the effects of these analogues on their growth are summarized in Table I. From these data, the following points can be made. First, among the three kinetic parameters for mediated MTX transport examined, i.e. Km and Vmax for influx and rate constant for efflux, a difference only with respect to the value for influx Km, a measure of influx saturability, was observed between these two cell types, which was 4-fold higher in S180 cells than in L1210 cells. Second, the 4-fold greater resistance of S180 cells than L1210 cells to inhibition of growth by MTX can be entirely accounted for by this difference in saturability for MTX influx. Third, the difference in saturability observed with MTX was specific for this 10-alkyl substituted N1O analogue of folic acid. That is to say, in the case of the more effective permeant, the unsubstituted N1O analogue, AMT, saturability and relative growth inhibition obtained were similar for these cell types. Values for both influx Km and IC50 for AMT were 3-fold or 12-fold lower, respectively, than for MTX in L1210 and S180 cells. Finally, saturability for influx and growth inhibitory potency with each cell type similar to AMT were also obtained with a C1O analogue of folic acid (10dAMT) and its 10-alkyl substituted derivative (EDX).
|
Net intracellular accumulation of [3H]MTX in tumor cells
under physiological conditions including an exogenous energy source does not solely reflect the function of the one-carbon, reduced folate
transporter mediating bidirectional flux. Instead, net accumulation of
this analogue is dependent upon the mediation (reviewed in Refs. 3 and
13) of influx by this transporter and the action of a separate
ATP-dependent efflux pump (13). Depletion of ATP by
prolonged incubation of tumor cells without D-glucose
inactivates (3, 13) the efflux pump, and the kinetics for net
accumulation of [3H]MTX revert to a simple carrier model
in which the transporter now mediates its bidirectional flux. Proof
that this shift in kinetics does actually occur under these conditions
was obtained (35) from experiments in which efflux by ATP-depleted
cells, but not ATP replete cells, could be ablated by an inhibitor
specific for the one-carbon, reduced folate transporter. We have taken advantage of these mechanistic insights to demonstrate in ATP-depleted cells that, in contrast to influx, efflux of [3H]MTX
mediated by the one-carbon, reduced folate transporter was the same in
both S180 and L1210 cells. Data in Fig. 1
show that mediated efflux of [3H]MTX by ATP-depleted
L1210 and S180 cells occurred with a much lower velocity than in ATP
replete cells. However, mediated efflux of this analogue was the same
for both cell types whether the cells were ATP depleted
(Kef = 0.035 ± 0.006 min
1)
or ATP replete (Kef = 0.21 ± 0.03 min
1).
|
In addition to the above, other findings showed that one-carbon, reduced folate transport in L1210 and S180 cells was similar in regard to other functional properties. Mediated [3H]MTX influx exhibited (data not shown) the same pH optimum (pH 7.5). Also, [3H]MTX influx in each case was stimulated to the same extent by the presence intracellularly of micromolar concentrations of L-L5-formyl-tetrahydrofolate. This manifestation of accelerated heteroexchange diffusion (22) occurred in each case at a level (data not shown) 2-fold greater in cells preloaded with this natural folate compared with control cells.
More rigorous evidence that the difference in saturability of influx for [3H]MTX observed between L1210 and S180 cells was solely a manifestation of a membrane surface interaction with the transporter in each case could be demonstrated in low-temperature binding experiments. In these experiments, very brief exposure of cells to low concentrations of [3H]MTX in a nonionic buffer at 0-4 °C essentially eliminates (22, 23) mediated internalization of this analogue, while simple diffusion through the plasma membrane at this temperature and concentration range is virtually nil. Under these conditions, the data documented (Table II) saturation kinetics for specific [3H]MTX binding with both cell types. Moreover, a 4-fold higher value for KD for binding indicating lower saturability was obtained with S180 cells compared with L1210 cells. This result was consistent with the lower saturability (higher value for Km) for mediated influx of [3H]MTX obtained for S180 cells with the same nonionic buffer (Table II).
|
Nucleotide sequencing of the RFC-1 gene in S180 cells in the form of multiple RT-PCR-generated cDNA products revealed (Fig. 2) a single nucleotide difference in the open reading frame of this cell type when compared with the RFC-1 cDNA sequence for L1210 cells (14, 33) and for normal mouse liver (33). The data shown in this figure document a G to A transition at nucleotide +890 in S180 cells. This difference was confirmed by sequencing the products of 12 independent PCR reactions (data not shown) utilizing genomic DNA as template. In this case, however, roughly half of the PCR products generated contained an A at position +890 while the remaining products contained a G at position +890 as in the case of L1210 cell RFC-1 cDNA. The results obtained with the cDNA versus genomic DNA suggests that only one of two alleles in S180 cells bears the base pair transition and that the origin of this transition was an unselected mutational event at some time during the development or life history of this tumor. The reason for the preferential expression at the level of RFC-1 mRNA in S180 cells of the allele bearing A at position +890 is not apparent at this time. However, as in the case of other mono-allelically expressed genes (36), G890 may occur in a silent (non-transcribed) allele. Codon 297, the site of this nucleotide difference, encodes either Ser (L1210 cells) or Asn (S180 cells) between the seventh and eight membrane-spanning helices. A comparison of the nucleotide sequence of the various rodent and human RFC-1 genes within the immediate vicinity of codon 297 suggests (Fig. 3) that the nucleotide difference at this codon in S180 cells compared with L1210 cells occurs within a stretch of DNA that was relatively conserved among these species. However, considerable diversity is apparent at the level of the amino acid sequence within this region. The significance of these findings, if any, is unknown.
|
|
Proof that this nucleotide alteration alone accounted for the difference in influx Km between each cell type was shown in the following manner. S180 RFC-1 cDNA was used to transfect an L1210 cell variant (L1210/R32) with marked down-regulation of RFC-1 gene expression as shown by both Northern blotting (Fig. 4) of RFC-1 mRNA and Western blotting (Fig. 5A) of plasma membrane protein with antimouse RFC-1 peptide antibodies. While blotting of mRNA from L1210 (Fig. 4) and S180 (data not given) cells revealed a similar amount of a RFC-1 mRNA and the same amount of a plasma membrane protein (Fig. 5A) in each case that migrated as 46 kDa, no RFC-1 mRNA or 46-kDa protein were detected in L1210/R32 cells. However, a 46-kDa plasma membrane protein was detected (Fig. 5B) in L1210/R32 cells transfected with S180 and L1210 cell RFC-1-derived cDNA but not when transfected with vector alone. It should also be mentioned that in a similar experiment using the same antibody, a 46-kDa protein was also detected (Fig. 5C) in L1210 RFC-1 transfectants of a transport defective, human tumor cell line (ZR-75-1/MTXR) that was originally cloned by Cowan and co-workers (14). When functional studies with the S180 RFC-1 cDNA transfectants were carried out (Fig. 6), they duplicated the same saturability for [3H]MTX influx typical of S180 cells. Specifically, the same 4-fold greater value for influx Km was documented with these transfectants compared with that obtained with L1210 cells or L1210 RFC-1 cDNA transfectants in the same experiment.
|
|
|
The difference in saturability for influx of MTX between L1210 and S180 cells described earlier (12) and in the current study, and the underlying nucleotide and amino acid alterations observed, explain the difference in intrinsic resistance of these cell lines both in the context of an in vitro cell culture assay and during therapy with this folate analogue in vivo (12). A striking finding from the functional studies, also described here, pertains to the marked specificity of this difference in saturability of influx engendered by the nucleotide alteration for this 10-alkyl substituted N1O analogue of folic acid. Saturability of influx for the more effective permeants, the unsubstituted N1O analogue and two C1O analogues, was unchanged between each cell type. Of great interest, as well, were findings showing that in contrast to influx, efflux of MTX mediated by the same transporter was no different between these murine tumors as were the other functional properties of MTX transport examined.
The finding of a nucleotide difference at +890 in the RFC-1 gene of L1210 versus S180 cells has a number of important implications for the biology of one-carbon reduced folate transport. In the first place, it provides an explanation at the level of the RFC-1 gene for the difference in saturability for mediated MTX influx observed between these two cell types. The highly specific nature of the effect of the nucleotide alteration at +890 in the RFC-1 gene suggests that the amino acid at position 297 influences the interaction between the binding site of the transporter at the external membrane surface and the alkylated N1O position of the folate analogue. However, the data presented above does not allow one to conclude that the amino acid encoded by codon 297 in each cell type is at or within the binding site of the transporter at the plasma membrane surface. However, additional considerations render such a conclusion reasonable. A topology analysis based upon the distribution of specific amino acid residues at each membrane surface utilizing the algorithm of Persson and Argos (37) predicts that the directional orientation of the transporter within the plasma membrane places both NH2- and COOH termini (Fig. 7) at the cytoplasmic membrane surface. Therefore, the site of the amino acid alteration observed between the L1210 and S180 cell transporters must reside within the 7th and 8th membrane-spanning helices at the external plasma membrane surface. This orientation would account for the lack of glycosylation of this murine protein in either murine cells (38) or human cell transfectants (14), since the only potential glycosylation site identified exists at the cytoplasmic membrane surface, while N-glycosylation is known to occur at consensus sites eventually extending through the external membrane surface. The postulated orientation of the murine transporter is also by analogy consistent with that expected for the heavily glycosylated (39, 40) human homologue. The only potential glycosylation site identified (16-19) in this protein exists at Asn58 between the first and second membrane-spanning helices, which would be expected to be at the external membrane surface as predicted by the same topology algorithm (37). Finally, the orientation postulated for the murine transporter is also consistent with other findings showing that there was no effect of this nucleotide alteration on mediated efflux of MTX by this same transporter in either cell type.
|
Two findings from these studies provided the strongest evidence yet as to the functional identity of the RFC-1 gene. First, the nucleotide alteration at +890 in the coding region of the RFC-1 gene from L1210 and S180 cells was associated with a difference in the value for Km for MTX influx mediated by the one-carbon, reduced folate transporter in each cell type. Second, the transporter encoded by RFC-1 gene transfectants migrated during SDS-PAGE like the one-carbon, reduced folate transporter (9, 20, 21) as a 46-kDa protein. The basis for the discrepancy between the size of the protein delineated by SDS-PAGE and the size deduced from the nucleotide sequence (58 kDa) is unknown. Although aberrant mobility during SDS-PAGE is often observed for membrane proteins, this may not be the explanation for the discrepancy noted in the present case. Alternative means for determining molecular mass have yielded (21) the same result. Also, the same protein encoded by the RFC-1 gene in murine intestinal epithelium migrates as a 58-kDa protein (25) under the same conditions of SDS-PAGE.
With regard to the basis for the effect of amino acid alteration on the interaction of MTX with the one-carbon reduced folate transporter in each cell type, an overly meaningful analysis is difficult, given the findings to date. However, some speculation on this issue seems appropriate. It appears that either basicity (N10) or hydrophobicity (C10) at position 10 of the folate analogue will satisfy the requirements for an effective interaction of this position at Ser297 or Asn297 within the transporter in each case. Alkylation at N1O introduces substantial bulk at this position, which could be less sterically tolerated in the case of the transporter in S180 cells, thus accounting for the lower saturability for MTX in this case. The fact that a similar introduction of bulk by alkylation of C1O had no effect on the interaction of this analogue with either transporter is consistent with the notion that the interaction with C1O analogues relies on the hydrophobicity introduced at this position. The additional bulk introduced by alkylation in this case appears to be offset by the increase in hydrophobicity that also results. Clearly, additional studies will be necessary to address this issue in detail.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Cancer Institute Grants CA08748 and CA56517.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence and reprint requests should be addressed. Tel.: 212-639-7953; Fax: 212-794-4342; E-mail: sirotnaf{at}mskcc.org.
1 The abbreviations used are: MTX, methotrexate, AMT, aminopterin; 10dAMT, 10-deaza-aminopterin; EDX, edatrexate (10-ethyl-10-deaza-aminopterin); PCR, polymerase chain reaction; RT, reverse transcriptase; RFC, reduced folate carrier.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Deng, Z. Hou, L. Wang, C. Cherian, J. Wu, A. Gangjee, and L. H. Matherly Role of Lysine 411 in Substrate Carboxyl Group Binding to the Human Reduced Folate Carrier, as Determined by Site-Directed Mutagenesis and Affinity Inhibition Mol. Pharmacol., April 1, 2008; 73(4): 1274 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kaufman, I. Ifergan, L. Rothem, G. Jansen, and Y. G. Assaraf Coexistence of multiple mechanisms of PT523 resistance in human leukemia cells harboring 3 reduced folate carrier alleles: transcriptional silencing, inactivating mutations, and allele loss Blood, April 15, 2006; 107(8): 3288 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kneuer, K. U. Honscha, and W. Honscha Sodium-dependent methotrexate carrier-1 is expressed in rat kidney: cloning and functional characterization Am J Physiol Renal Physiol, March 1, 2004; 286(3): F564 - F571. [Abstract] [Full Text] |
||||
![]() |
W. F. Flintoff, F. M. R. Williams, and H. Sadlish The Region between Transmembrane Domains 1 and 2 of the Reduced Folate Carrier Forms Part of the Substrate-binding Pocket J. Biol. Chem., October 17, 2003; 278(42): 40867 - 40876. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Volk and E. Schneider Wild-Type Breast Cancer Resistance Protein (BCRP/ABCG2) is a Methotrexate Polyglutamate Transporter Cancer Res., September 1, 2003; 63(17): 5538 - 5543. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sadlish, F. M. R. Williams, and W. F. Flintoff Functional Role of Arginine 373 in Substrate Translocation by the Reduced Folate Carrier J. Biol. Chem., October 25, 2002; 277(44): 42105 - 42112. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Volk, K. M. Farley, Y. Wu, F. Li, R. W. Robey, and E. Schneider Overexpression of Wild-Type Breast Cancer Resistance Protein Mediates Methotrexate Resistance Cancer Res., September 1, 2002; 62(17): 5035 - 5040. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Worm, A. F. Kirkin, K. N. Dzhandzhugazyan, and P. Guldberg Methylation-dependent Silencing of the Reduced Folate Carrier Gene in Inherently Methotrexate-resistant Human Breast Cancer Cells J. Biol. Chem., October 19, 2001; 276(43): 39990 - 40000. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Volk, K. Rohde, M. Rhee, J. J. McGuire, L. A. Doyle, D. D. Ross, and E. Schneider Methotrexate Cross-Resistance in a Mitoxantrone-selected Multidrug-resistant MCF7 Breast Cancer Cell Line Is Attributable to Enhanced Energy-dependent Drug Efflux Cancer Res., July 1, 2000; 60(13): 3514 - 3521. [Abstract] [Full Text] |
||||
![]() |
R. Zhao, I. G. Sharina, and I. D. Goldman Pattern of Mutations that Results in Loss of Reduced Folate Carrier Function under Antifolate Selective Pressure Augmented by Chemical Mutagenesis Mol. Pharmacol., July 1, 1999; 56(1): 68 - 76. [Abstract] [Full Text] |
||||
![]() |
P. L. Ferguson and W. F. Flintoff Topological and Functional Analysis of the Human Reduced Folate Carrier by Hemagglutinin Epitope Insertion J. Biol. Chem., June 4, 1999; 274(23): 16269 - 16278. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Wong, L. Zhang, T. L. Witt, S. A. Proefke, A. Bhushan, and L. H. Matherly Impaired Membrane Transport in Methotrexate-resistant CCRF-CEM Cells Involves Early Translation Termination and Increased Turnover of a Mutant Reduced Folate Carrier J. Biol. Chem., April 9, 1999; 274(15): 10388 - 10394. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Jansen, R. Mauritz, S. Drori, H. Sprecher, I. Kathmann, M. Bunni, D. G. Priest, P. Noordhuis, J. H. Schornagel, H. M. Pinedo, et al. A Structurally Altered Human Reduced Folate Car |