|
J Biol Chem, Vol. 273, Issue 5, 2714-2720, January 30, 1998
Regulation of Type I Interferon Gene Expression by Interferon
Regulatory Factor-3*
Susan L.
Schafer ,
Rongtuan
Lin§,
Paul A.
Moore¶,
John
Hiscott§, and
Paula M.
Pitha **
From the Oncology Center and Department of
Molecular Biology and Genetics, The Johns Hopkins University,
Baltimore, Maryland 21231, the § Department of Microbiology
and Immunology, McGill University, Montreal, Quebec H3T 1E2 Canada,
and ¶ Human Genome Sciences, Incorporated,
Rockville, Maryland 20850
 |
ABSTRACT |
The genes of the family of interferon (IFN)
regulatory factors (IRF) encode DNA binding transcriptional factors
that are involved in modulation of transcription of IFN and
interferon-induced genes (ISG). The presence of IRF binding sites in
the promoter region of IFNA and IFNB genes
indicates that IRF factors recognizing these sites play an important
role in the virus-mediated induction of these genes. We have described
a novel human gene of this family, IRF-3, that is constitutively
expressed in a variety of cell types. IRF-3 binds to the
interferon-sensitive response element (ISRE) present in the ISG15 gene
promoter and activates its transcriptional activity. In the present
study, we examined whether IRF-3 can modulate transcriptional activity
of IFNA and IFNB promoter regions. Our results demonstrate that IRF-3
can bind to the IRF-like binding sites present in the virus-inducible
region of the IFNA4 promoter and to the PRDIII region of the IFNB
promoter but cannot alone stimulate their transcriptional activity in
the human cell line, 293. However, the fusion protein generated from
the IRF-3 binding domain and the RelA(p65) activation domain
effectively activates both IFNA4 and IFNB promoters. Cotransfection of
IRF-3 and RelA(p65) expression plasmids activates the IFNB
gene promoter but not the promoter of IFNA4 gene that
does not contain the NF-kB binding site. Surprisingly, activation of
the IFNA4 gene promoter by virus and IRF-1 in these cells was inhibited
by IRF-3. These data indicate that in 293 cells IRF-3 does not
stimulate expression of IFN genes but can cooperate with RelA(p65) to
stimulate the IFNB promoter.
 |
INTRODUCTION |
Viral infection leads to the transient expression of early
inflammatory genes. The proteins encoded by these genes enhance recognition of the infected cells by the host immune system. A group of
proteins, called interferons
(IFNs),1 can directly inhibit
viral replication. Type I IFNs are encoded by a family of closely
related genes and a single IFNB gene, which are all
localized on chromosome 9 (1, 2). The sequences that regulate inducible
transcription of these genes are localized within the 100-nucleotide
5 -end of the transcriptional start of IFNA and
IFNB genes (3, 4). These regions contain a number of a short
overlapping GAAAGT-rich sequences that serve as a binding sites for
multiple transcriptional factors. Several elements that function as
positive regulatory domains (PRD) in virus-infected cells were
identified in the promoter region of the IFNB gene (5). It
was further shown that the region designated as PRDII contains an NF-kB
binding site (6-8) to which the NF-kB heterodimers induced upon viral
infection bind as well as the HMG protein (9). The PRDIV domain was
shown to bind the ATF-2 factor and octamer binding protein (10), and
the PRDI and PRDIII regions serve as high affinity sites for the
binding of the interferon regulatory factors (IRF-1 and IRF-2) (6, 11,
12). The transcriptional activation of this promoter, in virus-infected
cells, is a result of the interaction among these multiple
transcriptional factors (13) where the virus-induced binding of
p50·p65 heterodimer plays a crucial role (14, 15). In contrast, the
IFNA gene promoter region does not contain an NF- B binding site.
However, both the murine and human IFNA virus-inducible regions (VRE)
contain multiple repeats to the GAAAGT and AAGTGA elements that could serve as binding sites for the IRF-1 and IRF-2 factors (16-18). In
addition, the deletion and mutation analysis of the murine IFNA4
promoter region identified an essential element, named F1 (19),
which serves as a recognition site for DNA binding proteins p68 and p96
(20). In the human IFNA1 promoter region, another essential binding
site interacting with the TG protein was identified (21). Recent
studies have identified a distinct multisubunit complex in
virus-induced cells (22).
The presence of IRF-like binding sites in the promoter region of the
IFNA and IFNB genes indicated that the IRF
factors recognizing these sites play an essential role in the induction
of IFN genes. The original results of Harada et al. (11)
suggested that the up-regulation of these genes is mediated by IRF-1,
while the closely related IRF-2 suppresses the expression of these
genes. However, the essential role of IRF-1 and IRF-2 in the regulation
of IFNA and IFNB gene expression in infected
cells was disputed by the finding that mice containing the homozygous
deletion of IRF-1 or IRF-2, or fibroblast derived from these mice, were
able to induce IFNA and IFNB gene expression upon
infection with Newcastle Disease virus (NDV) to the same level as the
wild-type mice or cells (23, 24). IRF-1 was shown to play an important
role in the antiviral effect of IFNs (25). IRF-1 binds the ISRE element present in many IFN-inducible gene promoters and activates expression of some of these genes (26, 27). However, activation of ISG genes by
IFNA and IFNB was shown to be mediated generally
by the multiprotein ISGF3 complex (28). The binding of this complex to
DNA is mediated by another member of the IRF family, p48, which, in
IFN-treated cells, interacts with phosphorylated STAT1 and STAT2
transcriptional factors forming the heterodimer complex, ISGF3
(29-32). The homozygous deletion of p48 in mice abolishes the
sensitivity of these mice to the antiviral effect of IFNs (25), and the
infected macrophages from p48 / mice show an impaired induction of
IFNA and IFNB genes (33). However, induction of
IFN genes in virus-infected p48 / splenocytes is not affected.
Several other members of the IRF family have been identified. The
ICSBP gene is expressed exclusively in the cells of the immune system (34, 35), and its expression can be enhanced by IFN .
ICSBP was shown to form a complex with IRF-1 and inhibit the
transactivating potential of IRF-1 (36, 37). The homozygous deletion of
ICSBP in mice leads to the alteration in the development of
the cell of macrophage lineage (38). Another lymphoid cell-specific IRF, Pip/LSIRF, was identified (39, 40), which can interact with
phosphorylated PU.1. It was shown that the Pip·PU.1 heterodimer can
bind to the immunoglobulin light chain enhancer and function as a B
cell-specific transcriptional activator. Expression of Pip/LSIRF can be
induced by antigenic stimulation, but not by IFN, and it was recently
shown that the Pip/LSIRF / mice failed to developed mature T and B
cells (41). Another novel member of the IRF family, IRF-7, was recently
identified by its ability to bind to an ISRE-like element in the
promoter region of the Qp gene of EBV (42, 43). Furthermore,
the genome of human herpesvirus 8 contains four open reading frames,
which show homology to the cellular IRF family of genes (44). These
data indicate that transcriptional factors of the IRF family may
modulate not only the expression of cellular genes but viral genes as
well.
We previously identified and described another member of the human IRF
family, IRF-3 (45). The IRF-3 gene encodes a 55-kDa protein
and is expressed constitutively in all tissues. Recombinant IRF-3 binds
to the ISRE element of the IFN-induced gene, ISG15, and
overexpression of IRF-3 activates transcription of this promoter in the
transient expression assay. Viral infection or IFN treatment does not
activate the expression of the IRF-3 gene.
In the present study, we address the question whether IRF-3 can
modulate the expression of IFNA and IFNB genes.
The IRF-1 site(s) plays an important role in the transcriptional
activation of these genes; therefore, it is important to determine
which member of the IRF family plays a role in the activation of
IFNA and IFNB genes in virus-infected cells. Our
results demonstrate that: 1) recombinant IRF-3 can bind to the IRF-like
binding sites present in the virus-inducible region of the IFNA and
IFNB promoters; 2) in 293 cells, overexpression of IRF-3 neither
activates transcription of the IFNA or IFNB promoters in a transient
expression assay nor induces expression of the endogenous IFN genes; 3)
fusion of the IRF-3 DNA binding domain with the RelA(p65)
transactivation domain generated a fusion protein that effectively
activated both the IFNA and IFNB promoters; and 4) activation of the
IFNA4 promoter region by IRF-1 in these cells is inhibited in the
presence of IRF-3.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Transfections--
293 cells were grown in
Dulbecco's modified Eagle's medium. In the transfection assays,
subconfluent 293 cells (2.5 × 106 cells/plate) were cotransfected
with 2.5 µg of reporter plasmid chloramphenicol acetyltransferase
(CAT) and the indicated amounts of the IRF or p65 expression plasmids,
using the calcium phosphate coprecipitation method (46). When
indicated, treatment with IFN (500 units/ml) or infection with NDV
(multiplicity of infection = 5) was done 24 h after
transfection for 16 h. Protein extracts, prepared by the
freeze-thaw method, and CAT assays were done as described previously
(19). To compensate for the possible differences in transfection
efficiency, each sample was cotransfected with -galactosidase
expressing plasmid (2.5 µg), and CAT activity was normalized to the
constant levels of -galactosidase (47). The total transfected DNA
was kept constant in each experiment. Each transfection with the CAT
reporter plasmids was repeated at least three times, and the data
presented represents averages of these experiments.
Plasmids--
The IRF-3 and IRF-1 expression plasmids in which
expression of IRF cDNA is under the regulation of the IE
cytomegalovirus promoter region and GST-IRF-1 and GST-IRF-3 fusion
plasmids were described previously (20, 45). The GST-IRF-3(133) fusion
plasmid consists of the 5 -DNA fragment that codes for the first 133 amino acids of IRF-3 cloned into pGEX2T (Pharmacia Biotech Inc.). The plasmids containing the various lengths of the IFNA4 promoter regions
inserted 5 of the CAT gene were described previously (17). The
IRF-1/p65, IRF-2/p65, and IRF-3/p65 plasmids encode the amino-terminal
portion of the indicated IRF protein (1-204 aa, IRF-1; 1-133
aa, IRF-3) fused to the carboxyl-terminal transactivating domain of
RelA(p65) (397-550 aa) (48). The IFNB-CAT and TH-CAT plasmids were
described previously (13).
Expression of GST Fusion Proteins--
The GST-IRF-1 and IRF-3
fusion proteins were purified from bacterial lysates by affinity
chromatography on a glutathione-agarose column (Sigma).
Electrophoretic Mobility Shift Analysis--
The indicated
amounts of purified GST-IRF-3 (full-length or 133 aa) fusion proteins
were preincubated for 10 min in a total volume of 20 µl of binding
buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5% glycerol,
0.5% Nonidet P-40, 10 mg/ml bovine serum albumin, and 62 µg/ml
poly(dI-dC)). The extracts were then incubated with the respective
32P-labeled oligonucleotide probe corresponding to the
different regions of the IFNA4 promoter for 15 min at room temperature. Protein-DNA complexes were then resolved in a nondenaturing 5% polyacrylamide gel. The following IE probes were used in these experiments: WT, GAGTGAAGTAAAGAAAGTGAAAAGAGAATTGGAAAG; 92, GAGTGAAGTAAAGAAAGTAAAAAGAGAATTGGAAAG; 94, GAGTGAAGTAAAGAAAATGAAAAGAGAATTGGAAAG; 87, GAGTGAAGTAAAGAAAGTGAAAAAAGAATTGGAAAG; 103, GAGTGAAATAAAGAAAGTGAAAAGAGAATTGGAAAG; 90, GAGTGAAGTAAAGAAAGTGAGAAGAGAATTGGAAAG; 92/87,
GAGTGAAGTAAAGAAAGTAAAAAAAGAATTGGAAAG. The
following IFNB-specific probes were used in these experiments: PRDI,
GGGAGAAAGTGAAAGTG; PRDII, GGGAAATTCCGGGAAATTCC; PRDIII,
GGAAAACTGAAAGGG; PRDI-II, GAGAAGTGAAAGTGGGAAATTCC; PRDIII-I,
GGAAAACTGAAAGGGAGAAGTGAAGT.
 |
RESULTS |
Modulation of IFNA4 Promoter Activity by IRF-3, IRF-1, and Mutants
of IRF-3--
The amino-terminal region of IRF-3 shows a high degree
of homology to IRF-1 and IRF-2 (Fig.
1A). Au et al. (49)
showed that IRF-1 is an effective activator of the IFNA4 promoter in
transient cotransfection assays, whereas IRF-2 inhibits the
IRF-1-mediated activation (14). We have analyzed whether IRF-3 plays
any role in the regulation of the IFNA4 promoter. The IFNA4 promoter
contains an IRF-1 binding sites in its inducible region (IE) (Fig. 1B) and additional IRF-1-like sites can be located in the upstream region
of this promoter. Human 293 cells were cotransfected with murine
IFNA( 464)-CAT reporter plasmid and IRF-1 or IRF-3 (Fig. 2). Results of the transient transfection
showed that IRF-1 is an effective transactivator as shown previously
(20), whereas IRF-3 does not transactivate the IFNA promoter. Next, we
wanted to determine whether IRF-3 modulates the IRF-1-mediated
transactivation of this promoter. Cotransfection of IRF-1 and IRF-3
showed that IRF-3 inhibited IRF-1-mediated activation of IFNA promoter
in a concentration-dependent manner. At the ratio of IRF-3
to IRF-1 of 2:1, the activation was reduced by 50%. The next question
was if IRF-3-mediated inhibition of IFNA was through competition for the same binding site or due to protein-protein interaction as shown
with ICSBP and IRF-1 (34). We, therefore, examined whether variants of IRF-3 with carboxyl-terminal deletions would also be
inhibitory. Since proline-rich regions are often involved in protein-protein interaction, we also cotransfected IRF-1 with IRF-3
that had its proline-rich region deleted (Fig.
3). However, the proline-deleted form of
IRF-3 could still inhibit IRF-1 activation of IFNA promoter, indicating
that the proline-rich region of IRF-3 did not play any role in the
observed inhibition. Plasmids encoding the truncated forms of the IRF-3
protein (327 and 240 aa) were also potent inhibitors of IRF-1 activity.
These data suggest that IRF-3 and IRF-1 compete for the same or
overlapping binding site on the IFNA promoter and that the truncated
proteins may bind more strongly than the full-length IRF-3.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
A, amino-terminal amino acid homology of
IRF-1, -2, and -3. Conserved amino acids between the proteins are in
bold type. B, schematic representation of IFNA
and IFNB promoters.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Modulation of the IFNA4 promoter by IRF-3,
IRF-1, and mutants of IRF-3. 293 cells were cotransfected with 2.5 µg of IFNA4-CAT plasmid and 5 µg of the indicated expression
plasmids IRF-3, IRF-3dPRo, IRF-3(327), IRF-2(244), except IRF-1, for
which 2.5 µg was used. Cultures were harvested 48 h after
transfection and assayed for CAT activity. The data from IRF-3dPro,
IRF-3(327), and IRF-3(244) are not shown, but they exhibited the same
low level of activation as wild-type IRF-3. Standard deviations are shown by the T-bars.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
Modulation of the IFNA4 promoter and its
deleted mutants by IRF-3, IRF-1, and their chimeric fusion
proteins. 293 cells were cotransfected with 2.5 µg of the
different IFNA4-CAT plasmids and 5 µg of the indicated expression
plasmids, IRF-3, IRF-1, IRF-3/p65, and IRF-1/p65. Cultures were
harvested 48 h after transfection and assayed for CAT activity.
The chimeric fusion plasmids have the amino-terminal DNA binding domain
of IRF-3 or IRF-1 fused to the carboxyl-terminal transactivation domain
of p65. Standard deviations are indicated by the
T-bars.
|
|
Activation of IFNA4 Promoters by IRF-3, IRF-1, and RelA (p65)
Chimeric Fusion Proteins--
Since IRF-3 could not transactivate the
IFNA4-CAT promoter in 293 cells, we wanted to determine if this was a
result of weak binding or the inability to transactivate this promoter
in 293 cells. Therefore, a plasmid encoding a chimeric protein
containing the amino-terminal binding domain of IRF-3 (1-133 aa) and
the carboxyl-terminal transactivating domain of RelA(p65) (397-550 aa)
was generated. 293 cells were cotransfected with IFNA4-CAT and the
chimeric fusion protein IRF-3/p65 or with the previously described
chimeric plasmid IRF-1/p65 used as a positive control (48). The levels
of transactivation show that IRF-1/p65 and IRF-3/p65 chimeric fusion
proteins were equally effective transactivators of the full-length
IFNA( 464) promoter (Fig. 3), indicating that IRF-3 does bind but does
not transactivate the IFNA4 promoter. In contrast to the IRF-3/p65
plasmids, cotransfection of IRF-3 and p65 plasmids in trans
could not transactivate the IFNA promoter (data not shown). Since there
is no obvious NF-kB binding site in IFNA promoters, the inability of
p65 to cooperate with IRF-3 in trans further supports the
idea that NF-kB binding does not play a role in the activation of the
IFNA4 promoter. Transfection of the chimeric fusion plasmids with a
series of IFNA promoter deletions resulted in a gradual reduction in
reporter gene transactivation, suggesting the presence of multiple
IRF-1 and IRF-3 binding sites in the upstream ( 464) region of the
IFNA promoter, which may act in a cooperative manner.
Virus Induction of IFNA4-CAT--
We previously found that in L929
cells transfection of IRF-3 alone did not activate the IFNA promoter,
but it enhanced NDV-induced activation (45). To determine whether IRF-3
also cooperates with NDV in 293 cells, the cells were cotransfected
with IFNA4-CAT, IRF-3, or IRF-1 and infected with NDV. As shown in Fig.
4, NDV induces the IFNA promoter
effectively, but the induction is inhibited in the presence of IRF-3.
In contrast, combination of IRF-1 with the viral infection shows an
additive effect on the activity of the IFNA4 promoter as previously
shown by Au et al. (49).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
Induction of IFNA4-CAT by virus. 293 cells were cotransfected with 2.5 µg of IFNA4-CAT and 5 µg of the
expression plasmids IRF-3 or IRF-1. Samples were split 12 h after
transfection, and the indicated samples were infected with NDV for
16 h. Cultures were harvested and assayed for CAT activity.
Standard deviations are indicated by the T-bars.
|
|
Effect of IRF-3 on the Activation of the IFNB Promoter--
The
VRE of IFNB promoter contains two IRF binding sites (PRDI and PRDIII)
and an NF-kB binding site (PRDII). To examine the effect of IRF-3 on
the activity of IFNB promoter, we used the IFNB-CAT plasmid, which
contains the IFNB promoter ( 281 to +19) inserted in front of the CAT
gene (Fig. 5A). In a transient
transfection assay, overexpression of IRF-1 and IRF-3 did not
transactivate the IFNB-CAT promoter in 293 cells, while a slight
activation of this promoter was seen upon cotransfection with RelA(p65)
expression plasmid. When IRF-1 and IRF-3 expressing plasmids were
cotransfected together with the RelA(p65) expression plasmid (in
trans), transactivation of the IFNB promoter was observed
(13- and 8-fold, respectively), demonstrating that IRF-3 and IRF-1 can
synergize with p65 and activate transcriptional activity (2-fold) of
the IFNB promoter. The chimeric fusion protein IRF-1/p65 did not
significantly transactivate the IFNB promoter. However, the IRF-3/p65
chimeric fusion protein was a strong transactivator (16-fold),
suggesting that IRF-3/p65 is able to bypass the requirement for
cooperation between NF-kB and IRF-3 binding for the activation of the
IFNB promoter (14, 15). These results also suggest that IRF-3 can
strongly interact with one or more PRD domains of the IFNB
promoter.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 5.
Activation of the IFNB promoter.
A, 293 cells were cotransfected with 5 µg of the IFNB-CAT
reporter gene and the expression plasmids indicated below the bar
graph. Induction of CAT activity was analyzed at 48 h
post-transfection. B, 293 cells were transfected with 5 µg
of TH-CAT (PRDI tetramer), and the expression plasmids are indicated
below the bar graph. Induction of CAT activity was analyzed at 48 h post-transfection. Standard deviations are shown by the
T-bars.
|
|
To further characterize the IFNB transactivation mediated by IRF-3, we
used the TH-CAT reporter, which contains a tetrahexamer (AAGTGA)
element that functions as a strong binding site for IRF-1 (Fig.
5B). As expected, both IRF-1 and IRF-1/p65 chimeric fusion proteins strongly transactivated reporter gene activity. However, transactivation of TH-CAT by IRF-3/p65 was only marginal, suggesting that IRF-3 does not bind effectively to this PRDI-like element. These
data suggested that IRF-3 binding to the IFNB promoter and IRF-3/p65
transactivation may be mediated by an IRF site present in the IFNB
promoter that is distinct from the PRDI element.
Binding of IRF-3 to the PRD Domains of the IFNB
Promoter--
Binding of recombinant IRF-3 to the PRD domains of
the IFNB promoter was, therefore, analyzed by gel mobility shift
analysis. The amino-terminal 133-aa DNA binding fragment of IRF-3,
produced as a GST-fusion protein in Escherichia coli, bound
with high affinity to PRDIII but only weakly to PRDI; no stable binding
with PRDII was observed (Fig. 6).
Interestingly, the IRF-3 protein bound efficiently to probes consisting
of PRDI-II and PRDIII-I regions. At low concentrations of IRF-3, only a
single DNA-protein complex was formed with the PRDIII-I probe; however,
as the concentration of IRF-3 was increased, a second complex of slower
mobility was formed, indicating a cooperative interaction of IRF-3 with
other sites within the PRDIII-I element.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Binding of the amino-terminal fragment (133 aa) of IRF-3 to the IFNB promoter. The indicated amounts of
GST-IRF-3(133) were bound to radiolabeled probes of the different PRD
regions of the IFNB promoter and resolved by EMSA. Lanes
1-4 and 5-8 show binding to the probes PRDIII-1 and
PRDI-II, respectively. Lanes 9-11, 12-13, and
14-15 are GST-IRF-3(133) binding to PRD regions III, I, and
II, respectively.
|
|
Binding of IRF-3 to the IFNA Promoter--
Since IRF-3 displayed
strong binding to the PRDIII region of the IFNB promoter, we searched
for the sequence homologies to PRDIII (AGGAAAACTG) region in the IFNA
promoter. Two sequences similar to PRDIII were found. One sequence
TGGAGTAGTG is located at positions
252 to 243, and the second, GTGAAAAGAG, is
located in the IE region of the promoter from position 94 to 85.
This latter sequence overlaps with the IRF-1 binding site. The binding of GST-IRF-3 and truncated GST-IRF-3 (133 aa) to the 252 to 243 radiolabeled oligonucleotide probe was analyzed by EMSA. However, neither the full-size IRF-3 nor its amino-terminal fragment were able
to bind this sequence (data not shown). We next analyzed the binding of
the GST-IRF-3 proteins to IE probe ( 109 to 75) and compared it with
binding of GST-IRF-1 to this probe. As shown in Fig.
7A, 50 ng of GST-IRF-1 bound
the radiolabeled IE probe, resulting in a formation of single complex.
As the concentration of protein was increased from 50 to 100 ng, a
second complex of slower mobility was formed. Full-length GST-IRF-3
bound very effectively to the IE probe with formation of multiple bands
(Fig. 7B). The multiple bands are a result of binding of
full size GST-IRF-3 and several smaller GST-IRF-3 proteins, the
products of proteolytic cleavage of the full size protein. We,
therefore, constructed a 3 -truncated GST-IRF-3 (133 aa) protein that
was expressed as a single protein. Binding studies with this truncated
IRF-3 yielded a single DNA-protein complex. When the concentration of
GST-IRF-3(133) was increased from 15 to 50 ng, a second IRF-3/DNA
complex of a slower mobility was formed (Fig. 7B). In
addition, lower amounts of GST-IRF-3 were required for formation of the
slower mobility complex than that of GST-IRF-1, suggesting that IRF-3
binds more tightly to the IE probe than GST-IRF-1. Competition studies
showed that formation of the IRF-3(133) homodimers (slower mobility
complex) was prevented by 50-fold excess of cold IE probe but to
compete formation of the faster mobility complex required 100-fold
excess of cold IE probe (Fig.
8C). The formation of
GST-IRF-3(133) complexes were also prevented in the presence of
oligomers corresponding to ISRE (ISGI5) or by a tetramer of the PRDI
site but not by the oligonucleotide corresponding to the F1 probe
(49). Since the F1 probe did not bind the GST-IRF-3 protein (data
not shown), we concluded that the IRF-3 binding site is located in the
3 portion of the IE region but does not extend into the 5 portion of
the IE, where the IRF-1 and F1 binding sites overlap (Fig. 1B).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
Binding of IRF-1, IRF-3, and the
amino-terminal region of IRF-3(133) to the IE element of the IFNA
promoter. A, the indicated amount of GST-IRF-1 was incubated
with radiolabeled IE probe and resolved by EMSA. B, the
indicated amounts of GST-IRF-3 and GST-IRF-3 amino-terminal fragment
(133) were incubated with radiolabeled IE probe and resolved by EMSA.
C, 50 ng of GST-IRF-3(133) was preincubated with the 50×
and 100× cold IE probe or 50× cold ISRE, PRDI (which is a tetramer of
the PRDI site), and F1 probes followed by incubation with
radiolabeled IE and resolved by EMSA.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 8.
Binding of GST-IRF-3(133) to the IE element
and its mutants. 50 ng of GST-IRF-3(133) was incubated with the
indicated radiolabeled probes. The numbers indicate the
position of the mutation. The exposure of the autoradiogram of
B is lighter than A.
|
|
To determine a putative binding region for IRF-3, we made point
mutations in the IE region of IFNA4 that showed homology to PRDIII and
flanking regions. As shown in Fig. 8A, a mutation at nucleotide 92, which is part of the putative IRF-1 binding site, resulted in a decrease in the levels of the slower mobility complex. Point mutations at positions 87 and 103 of IE did not affect the binding; however, both of these nucleotides are external to the region
of PRDIII sequence homology. We have previously shown that mutations at
positions 103 and 92 decrease virus-mediated activation of the IFNA4
promoter.2 However, the
change in nucleotide 90 (A to G) decreased overall binding of
GST-IRF-3(133) as shown in Fig. 8B (a lighter exposure than
Fig. 8A). This part of IE has homology to PRDIII.
Competition studies using cold IE90 oligonucleotide demonstrated that
this oligonucleotide competed less efficiently than IE (data not
shown), supporting the conclusion that nucleotide 90 is important for IRF-3 binding. The double mutant, which had alterations at positions 92 and 87, showed only a slight reduction in IRF-3 binding when compared
with IE (Fig. 8B) and competed with binding to labeled IE
probe as efficiently as wild-type IE (data not shown). Thus, from this
gel shift analysis, we conclude that IRF-1 and IRF-3 share overlapping
binding sites in the IFNA promoter and that the GAAAA sequence is
important for IRF-3 binding.
 |
DISCUSSION |
In this paper, we have analyzed the role of IRF-3 in the
virus-mediated induction of the IFNA and IFNB
genes. Our results show that overexpression of IRF-3 in 293 cells does
not activate the transcription of IFNA4 or IFNB promoter regions in a
transient expression assay while it can bind to the VRE of the
IFNA and IFNB genes. Two IRF-1 binding sites,
PRDI and PRDIII, were identified in the virus-inducible region of the
IFNB promoter. Our binding studies demonstrated that the recombinant
IRF-3, or its 3 -deleted mutant (133 aa), binds strongly to PRDIII but
not to PRDI. When binding of IRF-3 to an oligonucleotide encompassing
PRDIII-PRDI was analyzed, only a single protein-DNA complex was
detected at low concentration; however, at higher IRF-3 protein
concentrations, IRF-3 bound as two molecules either as a dimer or more
likely to two distinct sites. This result indicates cooperativity of IRF-3 binding to high affinity (PRDIII) and low affinity (PRDI) binding
sites.
Although IRF-1 contains an activation domain in its carboxyl-terminal
end (48), it cannot by itself activate transcription of the IFNB
promoter in a transient transfection assay. In our previous study (45),
we had not detected the presence of an activation domain in IRF-3.
However, our recent results with the two-hybrid yeast
assay3 as well as the results
of others (50) indicate that IRF-3 has transactivation potential when
expressed as a Gal4 fusion protein. Similarly to IRF-1, IRF-3 alone
does not activate the IFNB promoter in 293 cells. In contrast,
cotransfection of IRF-3 with a RelA(p65) expressing plasmid resulted in
transcriptional activation of the IFNB promoter. These data indicate
that the interaction between NF-kB (p50/p65) and IRF-3 is sufficient
for a transcriptional activation of this promoter. Interestingly, the
requirement for this interaction can be bypassed by the IRF-3/p65 and
IRF-2/p65 (48) chimeric fusion proteins but not by the chimeric fusion protein IRF-1/p65. We assume that this difference indicates that IRF-3
binds more strongly to the IFNB promoter than IRF-1. It has been shown
that virus-induced binding of p50/p65 heterodimer to the NF-kB site in
the IFNB promoter plays a critical role in the activation of IFNB
promoter in infected cells (14, 15). Mutations of the PRDI site in the
IFNB promoter that abolish binding of IRF-1 were shown to decrease
virus-mediated inducibility of this promoter (6, 51), indicating that
nuclear factor binding to this element is essential for the
transcriptional activation of this promoter. However, neither IRF-1 nor
IRF-3 can act alone as a transcriptional activator of this promoter in
transient cotransfection assays, indicating that the activation may
require cooperation between different transcription factors (14, 15).
The requirement of complex formation between Pip and PU.1 for
activation of the immunoglobulin light chain gene was recently
demonstrated (39). Our recent data4 shows complex formation
between IRF-3 and the p300/CBP proteins, which are basal components of
the transcriptional complexes (52). This interaction is facilitated by
virus-mediated phosphorylation of IRF-3. Since the interaction of
RelA(p65) with the amino-terminal domain of p300/CBP was recently
demonstrated (53), it is likely that the cooperation between IRF-3 and
p65 may be facilitated by p300/CBP.
Promoters of the various IFNA genes differ from the majority of other
cytokine gene promoters by the absence of a consensus NF-kB binding
site. Nevertheless, these genes are induced in cells of lymphoid origin
by viral infection in a cell type-specific manner (17, 54). Au et
al. (49) has shown that, in a transient expression assay in L929
cells, overexpression of IRF-1 can induce both the murine IFNA4
promoters and synergize with the NDV-activated stimulation of the IFNA4
promoter. Furthermore, in these cells, overexpression of IRF-3
significantly enhanced virus-mediated activation of this promoter (45).
In contrast, in 293 cells, IRF-3 does not active the IFNA4 promoter
region but inhibits the IRF-1-mediated activation. The IFNA4 promoter
contains in its inducible element (IE) an IRF binding site (55); the
right half of the IE element of the IFNA4 promoter contains four
adenosine residues (GAAAAG), thus resembling the half of the PRDIII
site (GAAAAC) that strongly binds IRF-3. This is in contrast to the PRDI binding site that contains only three adenosine nucleotides (GAAAG) and is a weak binding site for IRF-3 but a strong site for
IRF-1. In this study, we have shown that IRF-3 binds effectively to
IFNA4 IE and that mutations in positions 92 and 90 affect IRF-3 binding, while the replacement of the 3 G by A in position 87 is
without any effect. By mutation analysis, we have previously shown (49)
that the IE site is important for the virus-inducible transcriptional
activation of this promoter and that a single mutation at nucleotide 92 completely abolished virus-mediated induction of the IFNA4 promoter in
L929 cells.2
Two other IRF family members have been identified that
inhibit IRF-1 mediated transactivation.
IRF-2 shows the same DNA binding specificity as IRF-1 and inhibits
IRF-1-stimulated transcription of both the IE and ISRE elements by
competing for the binding site (48, 56). In contrast, ICSBP,
which binds only weakly to the ISRE element and not to PRDI, inhibits
the IRF-1 transactivation by direct interaction with the 3 -end of the
IRF-1 protein, thus interfering with its transactivation capability
(34, 37). Our data indicate that the observed IRF-3-mediated inhibition of IRF-1 in 293 cells occurs through competition for the binding site(s) since the 5 part of IRF-3(133) protein, containing only the
DNA binding domain, is also an effective competitor of IRF-1. Furthermore, we have been unable to demonstrate a direct interaction between immobilized GST-IRF-3 and IRF-1 (data not shown). These data
indicate that several members of the IRF family may function as
conditional repressors of IRF-1-targeted genes. Since IRF-1 is
effectively induced both by virus and IFNs, the expression of
IRF-1-regulated genes may reflect a balance between levels of IRF-1 and
the negative regulators of the IRF family. However, experiments with
mice in which various IRF genes were deleted indicate that the role of
the transcriptional factors of the IRF family extends beyond the
response to viral infection. Most of these factors were found to be
critical for the proper development and/or function of immune lineage
cells. In this respect, it is interesting to note that IRF-4/LSIRF/Pip
can be induced only by antigenic stimulation of lymphocytes (41) and
IRF-3 can be induced in peripheral blood mononuclear cell and
macrophages by phytohemagglutinin of phorbol 12-myristate
13-acetate,
respectively.5
In conclusion, our data demonstrate that IRF-3 modulates the expression
of type I IFN genes in 293 cells. It cooperates with RelA(p65) to
stimulate the transcriptional activity of the IFNB gene promoter, while
it inhibits IRF-1 and virus-mediated transactivation of the IFNA4 gene
promoter. Studies done since this manuscript has been reviewed indicate
that in mouse cells, containing homozygous deletions of
IRF-1 and IRF-2 genes, and in embryo fibroblasts, high levels of overexpression of IRF-3 alone can stimulate
transcriptional activity of IFNA4 and IFNB promoters and greatly
enhance the virus-mediated induction of these promoters. Interestingly,
our preliminary results also indicate that overexpression of E1A can
inhibit the IRF-3-mediated transcriptional modulation of the IFNA4 and
IFNB promoters. The fact that we failed to detect activation of IFNA4
and IFNB promoters by IRF-3 alone in 293 cells may be due to the
expression of E1A in these
cells.6 Although the exact
role of IRF-3 in the virus-mediated pathway is presently unclear, the
fact that IRF-3 is phosphorylated in infected cells but not in
IFN-treated cells4 suggests
that IRF-3 may be an important component of virus-induced signaling.
 |
ACKNOWLEDGEMENTS |
We thank Dr. W.-C. Au and W. Lowther for
providing several of the plasmids used in this study.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant AI 19737 (to P. M. P.), National Service Award
CA09071 (to S. L. S.), and by grants from the Medical
Research Council of Canada and National Cancer Institute (to J. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: The Johns Hopkins
University, Oncology Center, 418 N. Bond St., Baltimore, MD 21231-1001. Fax: 410-955-0840; E-mail: parowe{at}welchlink.welch.jhu.edu.
1
The abbreviations used are: IFN, interferon;
IRF, interferon regulatory factor; ISG, interferon-stimulated gene;
ISRE, interferon-sensitive response element; NDV, Newcastle disease
virus; CAT, chloramphenicol acetyltransferase; GST, glutathione
S-transferase; EMSA, electrophoretic mobility shift analysis; IE,
inducible element; PRD, positive regulatory domain; VRE,
virus-inducible regions; aa, amino acid.
2
W. C. Au and P. M. Pitha, unpublished
data.
3
W. J. Lowther and P. M. Pitha,
unpublished data.
4
R. Lin and J. Hiscott, submitted for
publication.
5
Y. Shirazi and P. M. Pitha, unpublished
data.
6
W. C. Au, Y. T. Juang, W. J. Lowther, and P. M. Pitha, manuscript in preparation.
 |
REFERENCES |
-
Diaz, M. O.,
Pomykala, H. M.,
Bohlander, S. K.,
Maltepe, E.,
Malik, K.,
Brownstein, B.,
Olopade, O. I.
(1994)
Genomics
22,
540-552[CrossRef][Medline]
[Order article via Infotrieve]
-
Lengyel, P.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5893-5895[Abstract/Free Full Text]
-
Hiscott, J.,
Nguyen, H.,
and Lin, R.
(1995)
Semin. Virol.
6,
161-173
-
Pitha, P. M.,
and Au, W.-C.
(1995)
Semin. Virol.
6,
151-159
-
Maniatis, T,
Whittemore, L.,
Du, W.,
Fan, C.,
Keller, A. D.,
Palombella, V. J.,
Thanos, D. N.
(1992)
Transcription Regulation, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Fujita, T.,
Kimura, Y.,
Miyamoto, M.,
Barsoumian, E. L.,
Taniguchi, T.
(1989)
Nature
337,
270-272[CrossRef][Medline]
[Order article via Infotrieve]
-
Hiscott, J.,
Alper, D.,
Cohen, L.,
Leblanc, J. F.,
Sportza, L.,
Wong, A.,
Xanthoudakis, S.
(1989)
J. Virol.
63,
2557-2566[Abstract/Free Full Text]
-
Visvanathan, K.,
and Goodbourn, S.
(1989)
EMBO J.
8,
1129-1138[Medline]
[Order article via Infotrieve]
-
Thanos, D.,
and Maniatis, T.
(1992)
Cell
71,
777-789[CrossRef][Medline]
[Order article via Infotrieve]
-
Du, W.,
and Maniatis, T.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
2150-2154[Abstract/Free Full Text]
-
Harada, H.,
Fujita, T.,
Miyamoto, M.,
Kimura, Y.,
Maruyama, M.,
Furia, A.,
Miyata, T.,
and Taniguchi, T.
(1989)
Cell
58,
729-739[CrossRef][Medline]
[Order article via Infotrieve]
-
Miyamoto, M.,
Fujita, T.,
Kimura, Y.,
Maruyama, M.,
Harada, H.,
Sudo, Y.,
Miyata, T.,
and Taniguchi, T.
(1988)
Cell
54,
903-913[CrossRef][Medline]
[Order article via Infotrieve]
-
Leblanc, J. F.,
Cohen, L.,
Rodrigues, M.,
and Hiscott, J.
(1990)
Mol. Cell. Biol.
10,
3987-3993[Abstract/Free Full Text]
-
Garoufalis, E.,
Kwan, I.,
Lin, R.,
Mustafa, A.,
Pepin, N.,
Roulston, A.,
Lacoste, J.,
and Hiscott, J.
(1994)
J. Virol.
68,
4707-4715[Abstract/Free Full Text]
-
Thanos, D.,
and Maniatis, T.
(1995)
Cell
83,
1091-1100[CrossRef][Medline]
[Order article via Infotrieve]
-
Naf, D.,
Hardin, S. E.,
and Weissmann, C.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
1369-1373[Abstract/Free Full Text]
-
Raj, N. B. K.,
Israeli, R.,
Kellum, M.,
and Pitha, P. M.
(1989)
J. Biol. Chem.
264,
11149-11157[Abstract/Free Full Text]
-
Ryals, J.,
Dierks, P.,
Ragg, H.,
and Weissmann, C.
(1985)
Cell
41,
495-507
-
Raj, N. B. K.,
Au, W.-C.,
and Pitha, P. M.
(1991)
J. Biol. Chem.
266,
11360-11365[Abstract/Free Full Text]
-
Au, W.-C.,
Su, Y.,
Raj, N. B. K.,
Pitha, P. M.
(1993)
J. Biol. Chem.
268,
24032-24040[Abstract/Free Full Text]
-
MacDonald, N. J.,
Kuhl, D.,
Maguire, D.,
Naf, D.,
Gallant, P.,
Goswamy, A.,
Hug, H.,
Bueler, H.,
Chatruvedi, M.,
de la Fuente, J.,
Ruffner, H.,
Meyer, F.,
Weissmann, C.
(1990)
Cell
60,
767-779[CrossRef][Medline]
[Order article via Infotrieve]
-
Genin, P.,
Braganca, J.,
Darracq, N.,
Doly, J.,
and Civas, A.
(1995)
Nucleic Acids Res.
23,
5055-5063[Abstract/Free Full Text]
-
Matsuyama, T.,
Kimura, T.,
Kitagawa, M.,
Pfeffer, K.,
Kawakami, T.,
Watanabe, N.,
Kundig, T. M.,
Amakawa, R.,
Kishihara, K.,
Wakeham, A.,
Potter, J.,
Furlonger, C. L.,
Narendran, A.,
Suzuki, H.,
Ohashi, P. S.,
Paige, C. J.,
Taniguchi, T.,
Mak, T. W.
(1993)
Cell
75,
83-97[CrossRef][Medline]
[Order article via Infotrieve]
-
Reis, L. F.,
Ruffner, H.,
Stark, G.,
Aguet, M.,
and Weissmann, C.
(1994)
EMBO J.
13,
4798-4806[Medline]
[Order article via Infotrieve]
-
Kimura, T.,
Kadokawa, Y.,
Harada, H.,
Matsumoto, M.,
Sato, M.,
Kashiwazaki, Y.,
Taruntani, M.,
Sok-Pin Tan, R.,
Takasugi, T.,
Matsuyama, T.,
Mak, T. W.,
Noguchi, S.,
Taniguchi, T.
(1996)
Genes to Cells
1,
115-124 [Abstract]
-
Kamijo, R.,
Harada, H.,
Matsuyama, T.,
Bosland, M.,
Gerecitano, J.,
Shapiro, D.,
Le, J.,
Koh, S. I.,
Kimura, T.,
Green, S. J.,
Mak, T. W.,
Taniguchi, T.,
Vilcek, J.
(1994)
Science
263,
1612-1615[Abstract/Free Full Text]
-
Kimura, T.,
Nakayama, K.,
Penninger, J.,
Kitagawa, M.,
Harada, H.,
Matsuyama, T.,
Tanaka, N.,
Kamijo, R.,
Vilcek, J.,
Mak, T. W.,
Taniguchi, T.
(1994)
Science
264,
1921-1924[Abstract/Free Full Text]
-
Veals, S. A.,
Schindler, C.,
Leonard, D.,
Fu, X.-Y.,
Abersold, J.,
Darnell, J. E., Jr.,
Levy, D. E.
(1992)
Mol. Cell. Biol.
12,
3315-3324[Abstract/Free Full Text]
-
Bluyssen, H. A. R.,
Muzaffar, R.,
Vlieststra, R. J.,
van der Made, A. C. J.,
Leung, S.,
Stark, G. R.,
Kerr, I. M.,
Trapman, J.,
Levy, D. E.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5645-5649[Abstract/Free Full Text]
-
Darnell, J. E., Jr.,
Kerr, I. M.,
Stark, G. R.
(1994)
Science
264,
1415-1421[Abstract/Free Full Text]
-
Fu, X.-Y.,
Schindler, R. C.,
Improta, T.,
Aebersold, R.,
and Darnell, J. E., Jr.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7840-7843[Abstract/Free Full Text]
-
Schindler, C.,
Fu, X.-Y.,
Improta, T.,
Aebersold, R.,
and Darnell, J. E., Jr.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7836-7839[Abstract/Free Full Text]
-
Harada, H.,
Matsumoto, M.,
Sato, M.,
Kashiwazaki, Y.,
Kimura, T.,
Kitagawa, M.,
Yokochi, T.,
Sok-PinTan, R.,
Takasugi, T.,
Kadokawa, Y.,
Schindler, C.,
Schreiber, R. D.,
Noguchi, S.,
Taniguchi, T.
(1996)
Genes to Cells
1,
995-1005 [Abstract]
-
Nelson, N.,
Marks, S.,
Driggers, P. H.,
Ozato, K.
(1993)
Mol. Cell. Biol.
13,
588-599[Abstract/Free Full Text]
-
Weisz, A.,
Marx, P.,
Sharf, R.,
Appella, E.,
Driggers, P. H.,
Ozato, K.,
Levi, B.-Z.
(1992)
J. Biol. Chem.
267,
25589-25596[Abstract/Free Full Text]
-
Bovolenta, C.,
Driggers, P. H.,
Marks, M. S.,
Medin, J. A.,
Politis, A. D.,
Vogel, S. N.,
Levy, D. E.,
Sakaguchi, K.,
Appella, E.,
Coligan, J. E.,
Ozato, K.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5046-5050[Abstract/Free Full Text]
-
Sharf, R.,
Azriel, A.,
Lejbkowicz, F.,
Winograd, S. S.,
Ehrlich, R.,
Levi, B.-Z.
(1995)
J. Biol. Chem.
270,
13063-13069[Abstract/Free Full Text]
-
Holtschke, T.,
Lohler, J.,
Kanno, Y.,
Fehr, T.,
Giese, N.,
Rosenbauer, F.,
Lou, J.,
Knobeloch, K-P.,
Gabriele, L.,
Waring, J. F.,
Bachmann, M.,
Zinkernagel, R.,
Morse, H. C.,
Ozato, K.,
Horak, I.
(1996)
Cell
87,
307-317[CrossRef][Medline]
[Order article via Infotrieve]
-
Eisenbeis, C. F.,
Singh, H.,
and Storb, U.
(1995)
Genes Dev.
9,
1377-1387[Abstract/Free Full Text]
-
Matsuyama, T.,
Grossman, A.,
Mittrucker, H.-W.,
Siderovski, D. P.,
Kiefer, F.,
Kawakami, T.,
Richardson, C. D.,
Taniguchi, T.,
Yoshinaga, S. K.,
Mak, T. W.
(1995)
Nucleic Acids Res.
12,
2127-2136[Abstract/Free Full Text]
-
Mittrucker, H-W.,
Matsuyama, T.,
Grossman, A.,
Kundig, T. M.,
Potter, J.,
Shahinian, A.,
Wakeham, A.,
Patterson, B.,
Ohashi, P.,
Mak, T.
(1997)
Science
275,
540-543[Abstract/Free Full Text]
-
Nonkwelo, C.,
Ruf, I. K.,
and Sample, J.
(1997)
J. Virol.
71,
6887-6897[Abstract]
-
Zhang, L.,
and Pagano, J. S.
(1997)
Mol. Cell. Biol.
17,
5748-5757[Abstract]
-
Russo, J. J.,
Bohenzky, R. A.,
Chien, M.-C.,
Chen, J.,
Yan, M.,
Maddalena, D.,
Parry, J. P.,
Peruzzi, D.,
Edelman, I. S.,
Chang, Y.,
Moore, P.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
14862-14867[Abstract/Free Full Text]
-
Au, W.-C.,
Moore, P. A.,
Lowther, W.,
Juang, Y.-T.,
and Pitha, P. M.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
11657-11661[Abstract/Free Full Text]
-
Mosca, J. D.,
Bednarik, D. P.,
Raj, N. B. K.,
Rosen, C. A.,
Sodroski, J. G.,
Haseltine, W. A.,
Pitha, P. M.
(1987)
Nature
325,
67-70[CrossRef][Medline]
[Order article via Infotrieve]
-
MacGregor, G. R.,
and Caskey, C. T.
(1989)
Nucleic Acids Res.
17,
2365[Free Full Text]
-
Lin, R.,
Mustafa, A.,
Nguyen, H.,
Gewert, D.,
and Hiscott, J.
(1994)
J. Biol. Chem.
269,
17542-17549[Abstract/Free Full Text]
-
Au, W.-C.,
Raj, N. B. K.,
Pine, R.,
and Pitha, P. M.
(1992)
Nucleic Acids Res.
20,
2877-2884[Abstract/Free Full Text]
-
Ronco, L. V., Stevenson, L., Vidal, M., and Howley, P. M. (1997) J. Interferon Res. 17, Suppl. 2, 1-7
-
Goodbourn, S.,
and Maniatis, T.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
1447-1451[Abstract/Free Full Text]
-
Jankenecht, R.,
and Hunter, R.
(1996)
Nature
383,
22-23[CrossRef][Medline]
[Order article via Infotrieve]
-
Perkins, N. D.,
Felzien, L. K.,
Betts, J. C.,
Leung, K.,
Beach, D. H.,
Nabel, G.
(1997)
Science
275,
523-527[Abstract/Free Full Text]
-
Hiscott, J.,
Cantell, K.,
and Weissmann, C.
(1984)
Nucleic Acids Res.
12,
3727-3746[Abstract/Free Full Text]
-
Tanaka, N.,
Kawakami, T.,
and Taniguchi, T.
(1993)
Mol. Cell. Biol.
13,
4531-4538[Abstract/Free Full Text]
-
Harada, H.,
Kitagawa, M.,
Tanaka, N.,
Yamamoto, H.,
Harada, K.,
Ishihara, M.,
and Taniguchi, T.
(1993)
Science
259,
971-974[Abstract]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Ricour, S. Delhaye, S. V. Hato, T. D. Olenyik, B. Michel, F. J. M. van Kuppeveld, K. E. Gustin, and T. Michiels
Inhibition of mRNA export and dimerization of interferon regulatory factor 3 by Theiler's virus leader protein
J. Gen. Virol.,
January 1, 2009;
90(1):
177 - 186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Paun, J. T. Reinert, Z. Jiang, C. Medin, M. Y. Balkhi, K. A. Fitzgerald, and P. M. Pitha
Functional Characterization of Murine Interferon Regulatory Factor 5 (IRF-5) and Its Role in the Innate Antiviral Response
J. Biol. Chem.,
| |