| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 51, 34399-34405, December 18, 1998
From the The yeast DRS2 gene, which is
required for growth at 23 °C or below, encodes a member of a P-type
ATPase subgroup reported to transport aminophospholipids between the
leaflets of the plasma membrane. Here, we evaluated the potential role
of Drs2p in phospholipid transport. When examined by fluorescence
microscopy, a drs2 null mutant showed no defect in the
uptake or distribution of fluorescent-labeled 1-palmitoyl-2[6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl
(NBD))aminocaproyl]phosphatidylserine) or
1-myristoyl-2[6-NBD-aminocaproyl]phosphatidylethanolamine. Quantification of the amount of cell-associated NBD fluorescence using flow cytometry indicated a significant decrease in the absence of
Drs2p, but this decrease was not restricted to the aminophospholipids (phosphatidylserine and phosphatidylethanolamine) and was dependent on
culture conditions. Furthermore, the absence of Drs2p had no effect on
the amount of endogenous PE exposed to the outer leaflet of the plasma
membrane as detected by labeling with trinitrobenzene sulfonic acid.
The steady state pool of Drs2p, which was shown to reside predominantly
in the plasma membrane, increased upon shift to low temperature or
exposure to various divalent cations (Mn2+,
Co2+, Ni2+, and Zn2+ but not
Ca2+ or Mg2+), conditions that also inhibited
the growth of a drs2 null mutant. The data presented here
call into question the identification of Drs2p as the exclusive or
major aminophospholipid translocase in yeast plasma membranes
(Tang, X., Halleck, M. S., Schlegel, R. A., and Williamson,
P. (1996) Science 272, 1495-1497).
Most biological membranes appear to possess a nonrandom
distribution of phospholipids between the two leaflets of the bilayer (1). An asymmetric organization of phospholipids, in which phosphatidylethanolamine
(PE)1 and phosphatidylserine
(PS) are enriched in the inner leaflet facing the cytoplasm, and
phosphatidylcholine (PC), sphingomyelin, and glycolipids are
predominantly located on the outer leaflet, has been well documented
for the plasma membranes of numerous cell types (2, 3). The loss of
this asymmetric distribution and the resulting appearance of PS at the
cell surface triggers a variety of intercellular communication and
signaling processes, such as platelet activation (4), clearance of
senescent red cells (5), and phagocytosis of apoptotic cells (6, 7). However, the establishment and regulation of this asymmetric
distribution as well as its physiological function in single cells are
poorly understood. It is generally thought that the transbilayer
movement ("flip-flop") of phospholipids is mediated by
ATP-dependent flippases, and several proteins with flippase
activity have been identified in mammalian cells. The ABC transporters,
human MDR1 and MDR3 (8, 9), mouse mdr2 (10), and yeast Pdr5p and Yor1p
(11) have been shown to exhibit outward-directed phospholipid flippase activity.
A recent report on the cloning of a flippase from bovine chromaffin
granules has implicated a novel subgroup within the P-type ATPase
family in the inward-directed transport of aminophospholipids (12).
Most P-type ATPases, represented by a group of 18 genes in the genome
of the yeast Saccharomyces cerevisiae (13), are biochemically well characterized and known to function in the transport
of mono- or divalent cations (14). The Na+/K+
ATPases, various Ca2+ ATPases of animal cells as well as
the H+-ATPases of fungi and plants belong to this family of
ion transporters, which share a characteristic set of conserved regions
and a similar transmembrane topology (14). The members of the new
subgroup differ from the ion-transporting ATPases in several amino
acids within transmembrane segments critically involved in ion
translocation. Apart from the bovine cDNA, the yeast
DRS2 gene and four related yeast genes (13) as well as
sequences from Plasmodium falciparum and
Caenorhabditis elegans appear to carry these changes (12) whereby negatively charged residues have been replaced by bulky, hydrophobic groups. The observation of a defect in fluorescent-labeled PS (P-C6-NBD-PS) internalization in a drs2
mutant at low temperature has been interpreted as evidence for the
biochemical function of this group of enzymes as aminophospholipid
translocases (12).
In this report, we examined the potential role of Drs2p in phospholipid
transport using fluorescence microscopy, flow cytometry, and TNBS
labeling. The deletion of DRS2 had no effect on the uptake or distribution of fluorescent-labeled PS (P-C6-NBD-PS) or
PE (M-C6-NBD-PE) detected by fluorescence microscopy.
Quantification of the amount of cell-associated NBD fluorescence
indicated a significant decrease in the absence of Drs2p, but this
decrease was not exclusive to the aminophospholipids (PE and PS) and
was dependent on culture conditions. The absence of Drs2p had no effect on the amount of endogenous PE exposed to the outer leaflet of the
plasma membrane as detected by labeling with TNBS. The steady state
pool of Drs2p, which was shown to reside predominantly in the plasma
membrane, increased upon shift to low temperature or exposure to
various heavy metal cations, conditions that inhibited the growth
of a drs2 null mutant. The data presented here call into
question the identification of Drs2p as the exclusive or major
aminophospholipid translocase in yeast plasma membranes (12).
Yeast Strains and Growth Conditions--
All yeast strains used
in this study were derived from the S288C-related wild-type strain YR98
(MAT Construction of drs2-1::URA3 and HA::DRS2
Alleles--
To construct drs2-1::URA3, the
5.9-kb EcoRI fragment carrying the entire DRS2
gene was isolated from a DRS2-containing plasmid (a gift
from J. Woolford) and subcloned into pUC19 (18). Subsequently, the
3.5-kb BstEII-HpaI fragment within the
DRS2 ORF was replaced with URA3 sequences by
inserting the 1.1-kb HindIII fragment of URA3 via
blunt-end ligation. DNA from the resulting plasmid was digested with
EcoRI and used to transform YR98. The replacement of the
DRS2 gene by drs2-1::URA3 DNA was
verified in one of the Ura+ transformants (YR884) by
Southern blot analysis.
To obtain the HA::DRS2 allele, a 27-base pair
insertion of HA-encoding DNA (19) was introduced into the 1.1-kb
EcoRI-XhoI fragment of DRS2 by joining
the polymerase chain reaction products of two independent polymerase
chain reaction reactions on a DRS2 template via recombinant
polymerase chain reaction (20). One reaction utilized primers A
(5'-ggcggccgGAATTCAGCCAAGAGACGTAAG, capital letters indicate
bases pairing with the DRS2 template; the EcoRI
site is in italics) and B
(5'-AGCGTAGTCTGGGACGTCGTATGGGTAATTCATGGTAAAATCAGGGAATGAAAGAAC, underlined letters correspond to bases encoding the 9-amino acid HA
epitope); the other reaction used primers C
(5'-TACCCATACGACGTCCCAGACTACGCTGACGACAGAGAAACCCCCCCAAAGAGG) and D (5'-CTTATTCCTCGAGTCTAGATA, XhoI
site). A mixture of the two reaction products together with primers A
and D was used to amplify a recombinant
EcoRI-XhoI DRS2 fragment, which
carried the HA DNA inserted between the second and third
codon of the DRS2 open reading frame. To obtain a
full-length HA::DRS2 allele, the recombinant
fragment was digested with CelII and XhoI and subcloned to replace the CelI-XhoI fragment
within the 5.9 kb of wild-type DRS2 DNA
(EcoRI-EcoRI) present in pUC19. For chromosomal integration of HA::DRS2, DNA from the resulting
plasmid was cut with EcoRI and transformed into
drs2-1::URA3 cells together with pRS425, a
LEU2-containing plasmid. In one of the Leu+
transformants (YR886) able to grow at 23 °C like wild type,
expression of HA-Drs2p was verified by Western blot analysis.
Vesicle Preparation--
P-C6-NBD-PS,
M-C6-NBD-PE, M-C6-NBD-PC, DOPC and
N-Rh-DOPE were from Avanti Polar Lipids Inc. (Alabaster,
AL). Phospholipids were stored at Internalization of NBD-phospholipids into Yeast Cells--
Cells
were grown overnight in SDC at 30 °C, diluted, and allowed to grow
to an A600 of 0.2. Donor vesicles containing
40% P-C6-NBD-PS, M-C6-NBD-PE, or
M-C6-NBD-PC, 58% DOPC, and 2% N-Rh-DOPE (50 µM total final lipid concentration) were added to the
cells and incubated for 30 min. Cells were washed 3 times with ice-cold SDC/NaN3 before analysis by fluorescence microscopy and
flow cytometry.
Fluorescence Microscopy--
Fluorescence microscopy was
performed on a Zeiss Axiovert microscope equipped with barrier filters
that allowed no detectable crossover of NBD and rhodamine fluorescence.
The fluorescence image was enhanced with a VE1000-SIT
image-intensifying camera (DAGE-MTI Inc., Michigan City, IN),
digitized, and stored. Image manipulation and editing were performed
with Metamorph software (Universal Imaging Corp., West Chester, PA).
Flow Cytometry--
Flow cytometric analysis of the
NBD-phospholipid-labeled cells was performed with a FACScan cytometer
(Becton-Dickinson Immunocytochemistry, San Jose, CA) equipped with an
argon laser operating at 488 nm. Ten µl of a 50 mg/ml stock solution
of propidium iodide was added to approximately 4 × 105 cells in 200 µl of SDC/NaN3 immediately
before dilution (~3×) and flow cytometric analysis. Ten thousand
cells were analyzed without gating during acquisition. Analysis was
performed with Lysis II (Becton-Dickinson Immunocytochemistry Systems)
software. A dot plot of forward scatter versus the red
fluorescence channel (propidium iodide) was used to set a gate that
excluded dead cells from the analysis. The remaining live cells were
plotted on a histogram of green fluorescence (NBD-phospholipid) and
analyzed to obtain the average and standard deviation of the
distribution of NBD fluorescence per cell.
TNBS Labeling--
Cells were grown for 18 h at 30 °C to
mid-logarithmic phase (A600 = 0.4-0.7) in SDC
containing 500 µCi of
[32P]KH2PO4 (specific activity 1 Ci/mmol; NEN Life Science Products). Plasma membrane, outer leaflet PE
was labeled with TNBS as described previously (22). Cells were
harvested by centrifugation, washed twice in ice-cold 40 mM
NaCl, 120 mM NaHCO3, pH 8.4, resuspended in the
same buffer containing 5 mM TNBS (Sigma), and immediately placed on ice for 1 h with periodic vortex mixing. After TNBS labeling, cells were washed by centrifugation three times in fresh buffer, pelleted, and disrupted by vortexing with glass beads. Cellular
lipids were extracted with chloroform/methanol (2:1) and separated by
two-dimensional TLC (1st solvent:
chloroform/methanol/ammonium hydroxide (65:35:5); 2nd
solvent: chloroform/methanol/acetone/acetic acid/water
(50:10:20:10:5)). Spots were identified by comparison with known
standards. The percentages of PE, PS, trinitrophenylnucleotide-PE and
trinitrophenylnucleotide-PS were quantified by phosphorimaging with a
PhosphorImager SI scanning instrument (Molecular Dynamics, Sunnyvale,
CA). The percent viability was determined by counting the number of
cells labeled after dilution into 0.02% methylene blue with a
hemocytometer and did not differ significantly between the two strains.
The data are presented in the text as the average percentage of
trinitrophenylnucleotide-PE or -PS relative to total cellular PE or PS
±S.D. for four trials.
Construction of the drs2-1::URA3 Null Allele--
Using
a drs2::TRP1 mutant allele, wherein the 1.4-kb
BglII-NcoI fragment corresponding to the segment
from positions 529 to 1201 within the DRS2 open reading
frame (1355 amino acids) was replaced by the yeast TRP1 gene
(see Fig. 1), Ripmaster et al. (23) show that DRS2 is required for mitotic growth at
23 °C or below. Because these authors also reported that a 2.2-kb
EcoRI-BglII fragment encoding the first 528 amino
acids at the N terminus of Drs2p was still able to complement a
cold-sensitive drs2 mutant, we constructed a new
drs2 mutant allele essentially lacking the entire
DRS2 coding sequence. In this
drs2-1::URA3 null allele, the 3.5-kb
BstEII-HpaI fragment encoding amino acids 33 to
1206 of the DRS2 open reading frame was substituted by the
yeast URA3 gene. Transformation of a haploid wild-type
strain (YR98) with drs2-1::URA3 DNA produced the
congenic drs2-1::URA3 strain YR884 used in all
subsequent studies. Growth of YR884 was examined on different solid
media (yeast extract/peptone/glucose (YPD)), synthetic complete and
minimal medium) at 23, 30, and 37 °C. On all media tested, this
drs2-1::URA3 strain grew well at 37 and 30 °C
but was unable to grow at 23 °C (data not shown), as reported for the drs2::TRP1 mutant (23).
Loss of DRS2 Does Not Alter the Internalization and Distribution of
NBD-labeled Aminophospholipids Detected by Fluorescence
Microscopy--
The internalization and distribution of the
NBD-labeled aminophospholipids, P-C6-NBD-PS and
M-C6-NBD-PE, were observed by fluorescence microscopy in
the drs2-1::URA3 strain and its isogenic DRS2 parent (Fig. 2). No
significant differences were detected between the two strains at
30 °C (permissive for growth) or at 23 °C (nonpermissive for
growth). In previous experiments, it was concluded that
M-C6-NBD-PE was internalized exclusively by inward-directed
transport across the plasma membrane (flip), resulting in its
distribution to the nuclear envelope, endoplasmic reticulum, and
mitochondria (24). Internalized M-C6-NBD-PE was not
degraded intracellularly, but was readily transported outward across
the plasma membrane (flop), where it was degraded by periplasmic
phospholipases (24). The similar pattern of fluorescence distribution
observed for P-C6-NBD-PS and M-C6-NBD-PE (Fig.
2) suggests that both of these aminophospholipids are internalized
and distributed by similar mechanisms in both the
drs2-1::URA3 and DRS2 strains.
To address the possibility that P-C6-NBD-PS was
internalized by endocytosis, Tang et al. (12) labeled
drs2
Thus, for all labeling conditions in which detectable amounts of
NBD-aminophospholipids were obtained, the loss of Drs2p had no effect
on their internalization and distribution. These observations are
inconsistent with the previous study in which P-C6-NBD-PS internalization was abolished in a drs2 mutant strain (12). The previous conclusion by Tang et al. (12) about the
function of Drs2p was based on "back exchange" experiments and was
not confirmed by direct observation of internalization and distribution by fluorescence microscopy. In the back exchange measurement, inward-directed transport (flip) is inferred from the amount of NBD-phospholipid that cannot be extracted from the surface of labeled
cells by incubation with bovine serum albumin. This technique has been
used successfully for many years to assay NBD-phospholipid transport in
blood cells and reconstituted vesicles (1, 25). However, the report by
Tang et al. (12) was the first use of back exchange to
measure flip in yeast, and in the absence of proper controls,
differences in the amount of NBD-phospholipid aggregates sticking to
the cell wall or trapped in the periplasm or differences in the rate of
NBD-phospholipid hydrolysis by periplasmic phospholipases may have been
misinterpreted as differences in inward translocation. Direct
observation of NBD-phospholipid internalization by fluorescence
microscopy is not subject to these artifacts. One of the advantages of
labeling cells with liposomes containing trace amounts of
N-Rh-DOPC is that the rhodamine fluorescence can be used to
determine the extent of cell-associated NBD fluorescence resulting from
stuck vesicles (26, 24). This is not possible when cells are labeled
with Me2SO-solubilized NBD-phospholipids.
Quantification of NBD-labeled Phospholipid Accumulation by Flow
Cytometry--
To make a more quantitative evaluation of the results
obtained by fluorescence microscopy, cells were labeled with either P-C6-NBD-PS, M-C6-NBD-PE, or
M-C6-NBD-PC, and the average cell-associated NBD
fluorescence per cell was obtained by flow cytometry. Fluorescent lipid
accumulation was measured for drs2-1::URA3 and
DRS2 strains grown at 30 °C in two different media (YPAD
and SDC). Accumulation of the three NBD- phospholipids was compared at
30° and 23 °C, the nonpermissive growth temperature for
drs2-1::URA3. The ratio of the cell-associated
fluorescence in drs2-1::URA3 to that of DRS2 is presented in Table I
for the two temperatures and growth media. Similar results were
obtained for the two strains and growth media at 30 and 23 °C.
However, the results differed dramatically depending on the growth
media. For cells grown in YPAD, the NBD fluorescence in the null strain
versus its parent was decreased from ~30 and 50% for the
two NBD-aminophospholipids as well as the choline lipid,
M-C6-NBD-PC. On the other hand, for cells grown in SDC, the
null strains actually accumulated ~16% more P-C6-NBD-PS but ~30% less M-C6-NBD-PE. The reduction in
P-C6-NBD-PS and M-C6-NBD-PE internalization
observed for cells grown in YPAD is consistent with the interpretation
that Drs2p is an aminophospholipid translocase responsible for 30 to
50% that of the internalization measured in the parent strain.
However, given the similar reduction in M-C6-NBD-PC
internalization, one would have to surmise that Drs2p was not
functionally homologous to its mammalian counterpart in its ability to
discriminate between amino and choline head groups. On the other hand,
the observation that P-C6-NBD-PS internalization is
actually increased in cells lacking Drs2p grown in SDC does not support
the conclusion that Drs2p is an aminophospholipid translocase. It is conceivable that drs2-1::URA3
cells grown in SDC up-regulate a functional homologue that
overcompensates for P-C6-NBD-PS but not for
M-C6-NBD-PE internalization. A more likely interpretation is that the absence of Drs2p indirectly alters the
NBD-phospholipid internalization.
The average cell-associated fluorescence resulting from identical
labeling procedures is highly dependent on the strain and the stage of
growth. In unpublished
experiments,2
M-C6-NBD-PE accumulation varied as much as 10-fold between
different wild-type laboratory strains. Furthermore, its accumulation
was dramatically reduced in cells allowed to grow to mid-log (optical density >1.0).3 Thus,
isogenic backgrounds and identical growth conditions are essential for
meaningful comparisons between strains to be made. The existence
of unidentified regulatory mechanisms that control the extent of
NBD-phospholipid internalization provides a means by which the loss of
DRS2 could indirectly decrease NBD-lipid internalization.
Loss of Drs2p Does Not Alter the Amount of Endogenous
Aminophospholipid in the Outer Leaflet of the Plasma Membrane--
The
amount of endogenous PS and PE in the outer leaflet of the plasma
membrane of drs2-1::URA3 and DRS2
strains was measured by TNBS labeling. No significant differences were
observed in the percent of total PS or PE exposed to the outer leaflet
between the two strains. Very little (<0.5%) of the total cellular PS was exposed to the outer leaflet, making it difficult to detect; however, no measurable differences were observed between the two strains. A readily detectable and reproducible amount of PE was labeled
by TNBS. The percentage of total cellular PE exposed to the outer
leaflet of the plasma membrane was 1.4 ± 0.3 for the drs2-1::URA3 strain and 1.6 ± 0.4 for the
isogenic DRS2 parent strain. Thus, the loss of Drs2p had no
significant effect on the amount of PE or PS residing in the outer
leaflet of the plasma membrane.
Drs2p Localizes to the Plasma Membrane--
To facilitate
detection of the Drs2p protein, we constructed a derivative of the
DRS2 gene, HA::DRS2, harboring a
27-base pair sequence encoding the nine amino acid HA epitope (16, 19) inserted in-frame after the second DRS2 codon (see Fig. 1).
Haploid strain YR886 containing HA::DRS2 at the
chromosomal DRS2 locus grew indistinguishable from
DRS2 strains, indicating that the expressed HA-Drs2p protein
was fully functional (data not shown). To determine the subcellular
localization of HA-Drs2p, extracts from strain YR886
(HA::DRS2) were fractionated by sucrose gradient centrifugation. All fractions collected from the gradients were tested
by SDS-polyacrylamide gel electrophoresis and Western blotting for the
presence of marker proteins specific for plasma membrane (H+-ATPase Pma1 (27)) and endoplasmic reticulum (dolichol
phosphate mannose synthase Dpm1 (28-30)). Golgi and vacuolar membranes
were identified by monitoring activities of GDPase (31) and
The Steady-state Level of Drs2p Is Dependent on Growth Phase and
Temperature--
In monitoring expression of HA-Drs2p in
HA::DRS2 cells growing in YPD medium at 30 °C,
we found a substantial alteration of the steady-state level of HA-Drs2p
with the growth phase of the culture. Fig.
5A (top panel)
shows a Western blot analysis of crude membranes prepared from
HA::DRS2 cells at various stages of growth
(A600 of 0.6, 1.1, and 2.0). HA-Drs2p was fairly
abundant during early and mid logarithmic growth but essentially
disappeared as cells entered stationary phase. In contrast, the
steady-state level of the plasma membrane H+-ATPase
(Pma1p), which like Drs2p, is a member of the P-type ATPase family, did
not show such a dramatic decrease, although Pma1p appeared somewhat
reduced in cells approaching stationary phase (Fig. 5A,
bottom panel). However, as demonstrated in Fig.
5B, cells entering stationary phase while growing at
23 °C retained a substantial amount of HA-Drs2p. This finding was
consistent with the observed requirement of DRS2 for growth
at this temperature (23). Taken together, these data suggested an
important function for Drs2p, particularly during early growth phases
at 30 °C and during growth at lower temperatures.
The Steady-state Level of Drs2p Increases upon Treatment with Heavy
Metals--
In the course of our genetic analysis, we discovered a
hypersensitivity of drs2-1::URA3 mutants toward
various heavy metals. As displayed in Fig.
6, serial dilutions of a
drs2-1::URA3 culture were spotted onto solid
minimal media containing the indicated concentrations of manganese
(II), cobalt (II), nickel (II), or zinc (II) chloride. Evidently, the
drs2-1::URA3 strain was particularly sensitive to
Zn2+ and Co2+, and the hypersensitivity toward
Mn2+ and Ni2+ was less pronounced. This growth
inhibition by divalent cations was apparently restricted to transition
elements, because drs2-1::URA3 grew like wild
type in the presence of high concentrations of Mg2+ and
Ca2+ (see Fig. 6).
We also examined the steady-state levels of HA-Drs2p accumulating in
cells during growth in the presence of various metal cations. To this
end, HA::DRS2 cells were inoculated into YPD media
to which the indicated amounts of metal chlorides have been added. At an A600 of 0.6, 1.1, and 2.0, aliquots
were withdrawn and analyzed for the presence of HA-Drs2p in crude
membrane fractions. As seen in Fig. 7,
all cations inhibitory to growth, i.e. Co2+,
Ni2+, Mn2+, and Zn2+, also led to a
pronounced accumulation of HA-Drs2p relative to the control culture. In
contrast, the presence of Mg2+, Ca2+, or
monovalent cations had only slight effects on the steady-state level of
HA-Drs2p. Both observations, the hypersensitivity of drs2-1::URA3 cells to heavy metals and the
intracellular accumulation of HA-Drs2p triggered by the same divalent
cations, indicated that cells required Drs2p function to effectively
endure the toxic effects of these transition elements.
The current knowledge about the mechanisms leading to
internalization of phospholipids into the yeast S. cerevisiae stems primarily from studies utilizing phospholipid
molecules carrying one short acyl chain labeled with a fluorescent NBD
group. Digital, video-enhanced fluorescence microscopy and
spectrofluorometry have shown that at least two distinct pathways for
phospholipid internalization exist: 1) transport by endocytosis to the
vacuole, which partially accounts for the uptake of the NBD-labeled PC analog, M-C6-NBD-PC (26) and 2) transport by a nonendocytic pathway to the nuclear envelope and mitochondria. This route accounts for the remainder of the M-C6-NBD-PC internalization,
whereas the NBD-labeled analogs of the aminophospholipids, M-C6-NBD-PE (24) or P-C6-NBD-PS (33), appear to be exclusively internalized via
this pathway. Based on the inhibition of M-C6-NBD-PE uptake by
treatment with NEM at low temperature, this pathway is thought to
involve a protein-mediated translocation of phospholipids from the
outer to the inner leaflet of the plasma membrane (24). Because these
NBD-labeled aminophospholipids are more water-soluble than their
endogenous counterparts (34), they most likely spontaneously redistribute between the inner leaflet of the plasma membrane and
membranes of other intracellular organelles. Because cells are also
able to translocate M-C6-NBD-PE outward across the plasma membrane
(24), the extent of intracellular accumulation depends on the
steady-state distribution of the NBD-labeled phospholipid established
between the inner and outer leaflets of the plasma membrane by the
coordinate regulation of the influx and efflux pathways. As a result,
the extent of intracellular accumulation can be considered to be an
amplification of the steady-state amount of the NBD-labeled
aminophospholipid residing in the inner leaflet that is established by
the regulation of the influx and efflux pathways. This view is
corroborated by the analysis of pdr1-11 and
pdr3-11 mutant strains, in which the net influx of
M-C6-NBD-PE is reduced from 50- to 100-fold. These strains
also exhibited a three to four-fold increase in the amount of
endogenous PE residing in the outer leaflet of the plasma membrane
(24). In this case, a decrease in the intracellular accumulation of
M-C6-NBD-PE correlated with an increase in the amount of
endogenous PE residing in the outer leaflet of the plasma membrane.
Given the identification of DRS2 as the exclusive or at
least major functional aminophospholipid transporter in the plasma membrane of S. cerevisiae (12), we compared the
intracellular accumulation of P-C6-NBD-PS and
M-C6-NBD-PE as well as the percent of TNBS-labeled PS and
PE in the outer leaflet of the plasma membrane between a
drs2-1::URA3 mutant strain and its isogenic
DRS2 parent. The deletion of the DRS2 gene had no
effect on the internalization and distribution of
P-C6-NBD-PS and M-C6-NBD-PE detected by
fluorescence imaging, nor did the deletion have a measurable effect on
the distribution of endogenous PS and PE across the plasma membrane. Quantitation of the extent of accumulation by a large population of
cells (~10,000 live cells) indicated that the deletion of the DRS2 gene resulted in a significant decrease in
P-C6-NBD-PS, M-C6-NBD-PE, and
M-C6-NBD-PC accumulation following growth in YPAD at 30 and 23 °C. However, the decrease of P-C6-NBD-PS accumulation
was completely reversed in cells grown in SDC. The mean accumulation of
M-C6-NBD-PE was decreased in
drs2-1::URA3 cells grown in both media. Thus, the
observed decrease in NBD-phospholipid internalization in the drs2 null strain was dependent on the growth media and was
not exclusive to the aminophospholipids.
These data definitively exclude the possibility that Drs2p is the
exclusive or major aminophospholipid translocase in the plasma membrane
of S. cerevisiae. However, these negative results do not
exclude the possibility that Drs2p functions as a phospholipid translocase in intracellular membranes or is one of several plasma membrane aminophospholipid translocases. In the latter case, the partial loss of aminophospholipid internalization in the
drs2 strain would be compensated by additional transporters
under the appropriate growth conditions. Interestingly, DRS2
and four yeast homologs form a distinct subgroup, cluster II, within
the P-type ATPase family (13). These four homologs have no known
function and are potential candidates to code for additional
aminophospholipid transporters. However, because of the complex nature
of the regulation of aminophospholipid transport across the plasma
membrane and its dependence on growth conditions, one cannot exclude
from the data presented that the observed alterations in
P-C6-NBD-PS and M-C6-NBD-PE accumulation in the
drs2-1::URA3 null strain are secondary to other
effects on growth or some other cellular function.
At present, the mechanisms leading to the observed hypersensitivity of
a drs2 null mutant toward some heavy metal cations, in
particular Zn2+, Co2+, Mn2+, and
Ni2+, are not known. In our view, these phenotypes could
either reflect a yet undiscovered role of Drs2p as a transporter of
divalent cations or are indeed a consequence of the proposed function
of Drs2p in aminophospholipid translocation. Two models, not
necessarily exclusive, could provide an explanation for a link between
aminophospholipid translocation and cation sensitivity. (i) An altered
asymmetric distribution of lipids within some cellular membranes,
presumably resulting from the loss of Drs2p, could compromise the
activity of cation transporters embedded in the affected membranes.
Given a prominent localization of Drs2p in the plasma membrane and the numerous exocytic and endocytic pathways leading to and originating from this membrane, it seems possible that Drs2p function might impinge
upon Golgi and vacuolar membranes, which both harbor numerous transport
proteins engaged in the sequestration of divalent cations within these
organelles. (ii) Alternatively, an altered lipid distribution,
i.e. a reduction in the amount of negatively charged PS in
the cytoplasmic leaflets of some intracellular membranes, might
directly result in altered cation binding properties of these
membranes, thereby affecting some cation-dependent steps in
membrane fusion reactions. Noteworthy, in vitro studies have shown that Zn2+ ions are more effective than
Ca2+ to induce fusion of phospholipid vesicles with a low
content of PS (35), and the depletion of Zn2+ blocks
endosome fusion in a cell-free system (36).
It should be noted that the loss of Drs2p function also impairs
ribosome biogenesis. The DRS2 gene was first discovered in a
search for mutants with an altered ratio of free 40 to 60 S ribosomal
subunits or qualitative changes in polyribosome profiles. The
drs2 mutant isolated in this screen processes the 20 S
precursor of the mature 18 S rRNA slowly and is deficient in 40 S
ribosomal subunits (23). It has been demonstrated that a block in the secretory pathway, which can readily be introduced at different stages
of the pathway through the use of conditional alleles in various
SEC genes absolutely required for secretion, leads to the
rapid shut-down of ribosome biogenesis. Thus, the continuous functioning of the secretory pathway appears to be a prerequisite for
the biogenesis of ribosomes (37). Evidently, the proposed role for
Drs2p as a flippase affecting lipid distribution in vesicles of the
late secretory pathway or at the plasma membrane would provide an
intriguing explanation for the ribosome-related defects observed in the
drs2 mutant (23).
Finally, we would like to emphasize that the previous demonstration of
the abolishment of PS internalization in a yeast drs2 mutant
(12) provided the sole functional data for the assignment of
phospholipid translocase activity to the Drs2p subfamily within the
class of P2 ATPases (13). Our inability to confirm a role of Drs2p in
phospholipid translocation underscores the need for future experiments
to carefully reevaluate this functional assignment.
We thank Tracy Ripmaster and John Woolford
for providing DRS2 plasmids and yeast strains and Ralf Egner
and Karl Kuchler for antibodies and advice on subcellular fractionation.
*
This work was supported by the BMFT Zentrales
Schwerpunktprojekt Bioverfahrenstechnik, Universität Stuttgart
(to H. K. R.) and National Institutes of Health Grant GM52410 (to
J. W. N).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of a stipend from the Landesgraduierten-Förderung
(Universität Stuttgart).
The abbreviations used are:
PE, phosphatidylethanolamine; PS, phosphatidylserine; PC, phosphatidylcholine; TNBS, trinitrobenzene sulfonic acid; NBD, 7-nitrobenz-2-oxa-1,3-diazol-4-yl; M-C6-NBD-PC, 1-myristoyl-2[6-NBD-aminocaproyl]phosphatidylcholine; M-C6-NBD-PE, 1-myristoyl-2[6-NBD-aminocaproyl]phosphatidylethanolamine; P-C6-NBD-PS, 1-palmitoyl-2[6-NBD-aminocaproyl]phosphatidylserine; HA, hemagglutinin; kb, kilobase(s); YPAD, yeast
extract/peptone/adenine/glucose; DOPC, dioleoylphosphatidylcholine; N-Rh-DOPE, N-rhodamine-dioleoylphosphatidyl
ethanol amine; SDC, synthetic-complete glucose; YDP, yeast
extract/peptone/glucose.
2
A. Grant and J. Nichols, unpublished data.
3
P. K. Hanson and J. Nichols, unpublished observation.
Loss of Drs2p Does Not Abolish Transfer of Fluorescence-labeled
Phospholipids across the Plasma Membrane of Saccharomyces
cerevisiae*
§,
Institut für Biochemie der
Universität Stuttgart, Pfaffenwaldring 55, D-70569 Stuttgart,
Germany and ¶ Department of Physiology, Emory University School of
Medicine, Atlanta, Georgia 30322
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
ade2 his3-
200 leu2-3, 112 lys2-201 ura3-52)
isogenic with strain AA255 (15). The drs2-1::URA3
strain YR884 was obtained by transformation of YR98 with
drs2-1::URA3 DNA as described below. The
HA::DRS2 strain YR886 carrying an in-frame
insertion of 27 base pairs encoding the HA epitope (16) was constructed
by transforming YR884 with HA::DRS2 DNA as
described below. All media were prepared according to standard
protocols (17).
20 °C, periodically monitored
for purity by thin-layer chromatography, and repurified when necessary.
Phospholipid concentrations were determined by a lipid phosphorus assay
(21). To prepare vesicles, lipids were first mixed in desired
proportions, and the chloroform solvent was removed by evaporation
under nitrogen followed by overnight vacuum desiccation. Desiccated
lipids were solubilized in SDC medium, and the mixture was passed eight
times through a Lipex Extruder (Lipex Biomembranes Inc, Vancouver, BC, Canada) equipped with 0.1-mm filters to produce vesicles. Total lipid
concentration in the stock vesicle preparation was 1 mM. Proportions were 40 mol % NBD-phospholipid, 2 mol % N-Rh-DOPE, 58 mol % DOPC.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (12K):
[in a new window]
Fig. 1.
Restriction maps of the
drs2-1::URA3 and HA::DRS2
alleles. The DRS2 open reading frame present
within a genomic 5.9-kb EcoRI fragment as determined by DNA
sequencing (23) is indicated by an arrow. The positions of
restriction sites used in the construction of
drs2::TRP1 (23) or
drs2-1::URA3 are given. The in-frame insertion of
27 base pairs encoding the nine-amino acid HA epitope (16, 19) in
HA::DRS2 is located between the second and third
codon of the DRS2 coding sequence is indicated by an
asterisk.
View larger version (90K):
[in a new window]
Fig. 2.
Internalization and distribution of
P-C6-NBD-PS and M-C6-NBD-PE in
drs2-1::URA3 and DRS2 strains.
Cells were grown to early log phase in SDC, washed three times in SDC,
and incubated for 30 min at 23 or 30 °C with vesicles containing
either P-C6-NBD-PS or M-C6-NBD-PE and
N-Rh-DOPC and DOPC (40:2:58; molar ratio). Cells were washed
three times in ice-cold SCN3 before imaging by fluorescence
microscopy as described under "Experimental Procedures."
DIC, differentiol interference contrast.
cells with high concentrations of probe solubilized
in Me2SO incubated on ice to inhibit endocytosis (12).
Using our standard protocol to label cells on ice with
P-C6-NBD-PS and M-C6-NBD-PE incorporated into
liposomes resulted in no detectable fluorescence internalization using
the sensitive SIT camera to capture images on the fluorescence microscope. We therefore followed the Tang et al. protocol
for labeling cells on ice using high concentrations of
Me2SO-solubilized NBD-lipids. Following this labeling
protocol, no P-C6-NBD-PS fluorescence could be detected.
However, a very low level of M-C6-NBD-PE fluorescence was
detected, but no differences were observed between the
drs2-1::URA3 and DRS2 strains.
Although detectable with the SIT camera, the fluorescence was too faint
and diffuse to produce publishable images.
Percent NBD-phospholipid accumulation of drs2-1::URA3
strain relative to isogenic parent
drs2 strain relative to its isogenic parent is presented
±S.D. The number of independent experiments (n) is in
parenthesis. For those experiments with an n of 2, the
mean ± the range is presented.
-mannosidase, Ams1 (32), respectively. As demonstrated by the data
shown in Fig. 3, the bulk of HA-Drs2p
co-fractionated with the plasma membrane ATPase, well separated from
endoplasmic reticulum membranes and the bulk of GDPase or
-mannosidase activity. Consistent with this observations, cells
expressing HA-Drs2p from the chromosomal locus exhibited in indirect
immunofluorescence microscopy a ring-shaped rim staining pattern, but
unfortunately the signal was very low (data not shown). Attempts to
increase expression of HA-Drs2p from a multicopy plasmid yielded a more
pronounced rim staining but, in addition, produced a prominent
perinuclear staining pattern, suggesting that the bulk of HA-Drs2p
remained in the endoplasmic reticulum under these conditions (Fig.
4). Taken together, our data strongly
argue for a steady-state localization of Drs2p in the plasma membrane
but indicate that Drs2p could also exert functions in membranes of
secretory organelles along the pathway to the plasma membrane.
View larger version (40K):
[in a new window]
Fig. 3.
Fractionation of HA-Drs2p on sucrose
gradients. Whole cell extracts of the
HA::DRS2 strain YR886 were fractionated by density
centrifugation as described (38). Aliquots of the gradient fractions
were separated by SDS-polyacrylamide gel electrophoresis and analyzed
by Western blotting with anti-HA antibodies, anti-Pma1 antibodies, and
anti-Dpm1 antibodies. The sizes of marker proteins are given in kDa;
the fraction numbers are indicated. Activities for
-mannosidase (Ams1) (32) and guanosine diphosphatase (31)
were determined as described and are given in arbitrary units. Density
(% sucrose, w/w) and protein concentration (arbitrary units) are
plotted against the fraction number.
View larger version (59K):
[in a new window]
Fig. 4.
HA-Drs2p accumulates in the endoplasmic
reticulum upon overexpression. Cells expressing carrying the
HA::DRS2 allele on a 2 µm (µ)-based
multicopy plasmid were analyzed for the presence of HA-Drs2p by
indirect immunofluorescence (top panel) as described (39).
4',6-Diamidino-2-phenylindole dihydrochloride (DAPI)
staining was used to visualize DNA (middle panel). The
bottom panel shows the same field using Nomarski
optics.
View larger version (62K):
[in a new window]
Fig. 5.
Alteration of the HA-Drs2p steady-state level
with growth phase and temperature. Panel A, aliquots were
withdrawn from a HA::DRS2 culture (YR886) in YPD
at various optical densities (A600) as
indicated. Crude membranes were prepared as described (39) and analyzed
for the presence of HA-Drs2p by Western blotting (top). The
blot was then stripped and reprobed for the presence of Pma1
(bottom) as described (39). Each lane corresponds
to 12 absorbance units of cells. Panel B,
HA::DRS2 cultures were grown into stationary phase
in rich (YPD), synthetic complete (SC), and
minimal (MV) media at 30 and 23 °C. The amount of
HA-Drs2p present under these conditions was analyzed as in panel
A. Each lane corresponds to 30 µg of total
protein.
View larger version (71K):
[in a new window]
Fig. 6.
Hypersensitivity of the
drs2-1::URA3 mutant against heavy metals.
Serial 10-fold dilutions of a saturated culture of
drs2-1::URA3 cells (YR884) grown in minimal
medium were spotted onto regular minimal medium (MV) and on
MV plates containing the indicated amounts of divalent cations added as
chlorides. Plates were photographed after 3 days of incubation at
30 °C.
View larger version (63K):
[in a new window]
Fig. 7.
Accumulation of HA-Drs2p upon treatment with
divalent heavy metals. YR886 cells (HA::DRS2)
were grown in regular rich medium (YPD) and in YPD media supplemented
with the indicated amounts of metal chlorides. At an optical density
(A600) of 0.6, 1.1, and 2.0, respectively,
aliquots were withdrawn and analyzed for the presence of HA-Drs2p in
crude membrane preparations as described in Fig. 5. Each
lane corresponds to 30 µg of total protein.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.:
+49 711-685-4389; Fax: (+49 711-685-4392; E-mail:
rudolph{at}po.uni-stuttgart.de.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C. Schuller, Y. M. Mamnun, H. Wolfger, N. Rockwell, J. Thorner, and K. Kuchler Membrane-active Compounds Activate the Transcription Factors Pdr1 and Pdr3 Connecting Pleiotropic Drug Resistance and Membrane Lipid Homeostasis in Saccharomyces cerevisiae Mol. Biol. Cell, December 1, 2007; 18(12): 4932 - 4944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Alder-Baerens, Q. Lisman, L. Luong, T. Pomorski, and J. C.M. Holthuis Loss of P4 ATPases Drs2p and Dnf3p Disrupts Aminophospholipid Transport and Asymmetry in Yeast Post-Golgi Secretory Vesicles Mol. Biol. Cell, April 1, 2006; 17(4): 1632 - 1642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S W C van Mil, R H J Houwen, and L W J Klomp Genetics of familial intrahepatic cholestasis syndromes J. Med. Genet., June 1, 2005; 42(6): 449 - 463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kihara and Y. Igarashi Cross Talk between Sphingolipids and Glycerophospholipids in the Establishment of Plasma Membrane Asymmetry Mol. Biol. Cell, November 1, 2004; 15(11): 4949 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Natarajan, J. Wang, Z. Hua, and T. R. Graham Drs2p-coupled aminophospholipid translocase activity in yeast Golgi membranes and relationship to in vivo function PNAS, July 20, 2004; 101(29): 10614 - 10619. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Saito, K. Fujimura-Kamada, N. Furuta, U. Kato, M. Umeda, and K. Tanaka Cdc50p, a Protein Required for Polarized Growth, Associates with the Drs2p P-Type ATPase Implicated in Phospholipid Translocation in Saccharomyces cerevisiae Mol. Biol. Cell, July 1, 2004; 15(7): 3418 - 3432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Pomorski, J. C. M. Holthuis, A. Herrmann, and G. van Meer Tracking down lipid flippases and their biological functions J. Cell Sci., February 22, 2004; 117(6): 805 - 813. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Hua and T. R. Graham Requirement for Neo1p in Retrograde Transport from the Golgi Complex to the Endoplasmic Reticulum Mol. Biol. Cell, December 1, 2003; 14(12): 4971 - 4983. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
