|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 34775-34783, December 25, 1998
From the Departments of Nuclear factor of activated T cells (NFAT) plays
an important role in expression of many cytokine genes including
interleukin-2 and interleukin-4. However, its role in interferon- Originally described as an essential transcription factor for
IL-21 gene expression in T
cells (1-3), nuclear factor of activated T cells (NFAT) is thought to
play a major role in coordinating transcription of a number of cytokine
genes, which are sensitive to the inhibitory effects of cyclosporin
(4). In addition to binding to the IL-2 promoter, NFAT binds to sites
in the regulatory regions of a number of other cytokine genes,
including TNF- The interferon- YY1 is a multifunctional DNA-binding protein, which can activate,
repress, or initiate transcription depending on the context in which
its binds (29). YY1 is constitutively expressed and is known to
interact with other proteins involved in transcriptional regulation
such as c-Myc (30), Sp-1 (31, 32), ATF/CREB (33), TATA-binding protein,
TFIIB (34, 35), and NF- Cell Lines and Reagents--
A line of Jurkat T cells, which
expresses IFN-
Rabbit polyclonal IgG antibodies to AP-1 proteins, YY1, and Oct-1 were
obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and are as
follows: anti-pan-Jun (c-Jun/AP-1(D)), anti-c-Jun-specific (c-Jun/AP-1(N)), anti-YY1 (C-20), and anti-Oct-1. Rabbit polyclonal antiserum to NFATp was obtained from Upstate Biotechnology, Inc. (Lake
Placid, NY). Rabbit antiserum to members of the NF- Plasmid Constructs--
Plasmids containing the full-length coding regions for each of the
NF-AT genes (NF-ATp, NF-ATc, NF-AT3, and NF-AT4) were subcloned into
the Rous sarcoma virus expression vector pREP4 (Invitrogen, San Diego,
CA) (20).
Transient Transfection Assays--
Jurkat T cells were
transiently transfected with 1 µg/106 cells of an IFN-
In the transfection experiments involving primary lymphoid cells,
murine splenocytes were harvested and treated with 3 µg/ml ConA
21 h prior to transfection to allow uptake of DNA (41). 5 × 106 splenocytes were transiently transfected with 10 µg
of IFN- DNA Binding Assays--
The DNA template for the footprinting
experiments was made by end labeling a human ( Recombinant Nuclear Proteins--
The Rel domain of NF-ATp
(amino acids 185-537) (18) was expressed by the T7 polymerase
expression system and purified as described previously (20). c-Jun
protein was expressed in Escherichia coli and purified from
the insoluble portion of the extract (42). Fra-1 protein was expressed
in E. coli and purified from the soluble fraction to
approximately 80% homogeneity on heparin-Sepharose. ATF-2BR (DNA
binding domain, amino acids 350-505), obtained from boiling lysis
preparations of bacteria without further purification (~90% pure),
was kindly provided by J. Hoeffler (Invitrogen, San Diego, CA)
(43).
Electrophoretic Mobility Shift Assays--
Nuclear extracts were
prepared from Jurkat T cells that were untreated or stimulated for
2 h as described previously (25, 44). Sequences of
oligonucleotides used are as follows (with mutations in lowercase and
consensus sequences underlined): the NFAT/AP-1 Identification of NFAT-binding Sites in the IFN-
To address this possibility, DNase I footprint analysis of the IFN- The IFN-
There were similarities and differences in factors binding to the NFAT
Since the
Although the GG to TT point mutation in the NFAT NFAT Is Required for Maximal Expression of IFN-
To examine whether NFAT plays a similar role in IFN- AP-1 Is Also Required for Maximal Expression of IFN- NFAT Enhances IFN-
Since expression of NFAT proteins can vary in different T cell
populations, and Jurkat T cells express a higher level of endogenous NFAT proteins compared with peripheral T cells (22, 58), murine splenocytes were also cotransfected with the NFAT expression vectors and the IFN- NFAT and YY1 Play a Positive Role in Expression of the IFN-
Although it has been suggested that the two YY1-binding site may play a
role in suppressing basal transcription of the IFN-
When transfected into murine splenocytes, the reporter construct with
the single YY1 point mutation (Y1) showed no significant difference in
expression compared with the pIFN-538 construct in both unstimulated
and stimulated cells (Fig. 5). The reporter construct with the double
YY1 point mutation (Y1Y2) showed a slightly higher level of basal
expression (1.7-fold increase compared with pIFN-538,
p < 0.002) in unstimulated cells but no significant difference in stimulated cells. In contrast to the results seen with
the Jurkat T cells (Fig. 4B), combined mutation of the NFAT and one or both YY1 sites (NY1 and NY1Y2) abolished inducible expression and reduced basal expression in murine splenocytes (Fig. 5).
The slight increase in basal expression seen in the Y1Y2 construct was
also completely abolished in the presence of the NFAT mutations (NY1Y2).
The current studies further elucidate the molecular mechanisms by
which IFN- The current studies demonstrated that NFAT proteins bind to additional
sites in the IFN- As seen in Figs. 4 and 5, the strong NFAT-binding sites at positions
Notably, the IFN- In contrast to the results seen with several other cytokine promoters
(IL-2, IL-4, GM-CSF, and TNF- Previous data suggested that YY1 suppresses IFN- In summary, NFAT plays a positive role in IFN- *
This research was supported in part by funds from the
National Institutes of Health Grant P30 HD28834, through the University of Washington Child Health Research Center, and National Institutes of
Health Grants AI01449 (to M. T. S.) and HD18184 (to C. B. W.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: University of
Washington, Dept. of Pediatrics, Box 356320, 1959 NE Pacific, Seattle, WA 98195. Tel.: 206-543-3207; Fax: 206-543-3184; E-mail:
msweet{at}u.washington.edu.
The abbreviations used are:
IL, interleukin; IFN-
The Roles of Nuclear Factor of Activated T Cells and Ying-Yang
1 in Activation-induced Expression of the Interferon-
Promoter in T Cells*
§,,, and
Pediatrics and
Immunology, University of Washington,
Seattle, Washington 98195, and ¶ Tularik, Inc.,
South San Francisco, California 94080
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(IFN-) expression is not well understood. In the current studies,
two strong NFAT-binding sites in the IFN- promoter were identified
by DNase I footprint analysis at positions 
280 to 270 and 163 to
155. NFATp bound independently to both sites and was required for the
formation of a composite element with AP-1 spanning position 163 to
147. In Jurkat T cells and primary lymphocytes, activation-induced expression of IFN- reporter constructs containing point mutations in
either NFAT site or the AP-1 component of the composite site was
decreased by ~40-65%. Despite elimination of both strong
NFAT-binding sites, the IFN- promoter remained completely sensitive
to inhibition by cyclosporin. This suggests that other elements in the
IFN- promoter, such as the IFN- proximal element, are sufficient
for cyclosporin sensitivity of this gene. Ying-Yang 1 (YY1), a
potential inhibitor of IFN- expression, binds to sites located
between the two NFAT sites. Mutation of the YY1 sites alone had little effect on IFN- promoter activity. However, mutation of both the NFAT
and YY1-binding sites abolished activation-induced expression in
primary murine splenocytes but not in Jurkat T cells. This suggests
that under some conditions, YY1 may play a positive role in
activation-induced transcription of IFN-.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(5, 6), IL-3, IL-4 (7-9), IL-5 (10, 11), and GM-CSF
(12-14). In T cells, NFAT sites commonly bind two components, a
pre-existing cytoplasmic component designated NFATp or NFATc (6) and a
nuclear component comprised of members of the Fos and Jun (AP-1)
protein families (15-17). Recent studies have demonstrated that the
cytoplasmic NFAT components belong to a large family of regulatory
transcription factors comprised of at least four members, NFATp
(NFAT1), NFATc (NFAT2), NFAT3, and NFAT4 (NFATx), which are
differentially expressed in lymphoid and nonlymphoid cells (18-22). In
T cells, NFATp is expressed in both unstimulated and stimulated cells,
whereas NFATc is expressed primarily in activated cells (18, 19, 23,
24).
(IFN-) gene is cyclosporin-sensitive, but the
mechanism for cyclosporin sensitivity of this gene has not been fully
elucidated. Previous studies in our laboratory have demonstrated that
the region between 108 and 40 base pairs (bp) upstream of the
transcription start site in the IFN- promoter is able to confer
activation-specific, cyclosporin-sensitive expression in T cells (25).
Within this region, one target of the inhibitory effect of cyclosporin
is the IFN- proximal element (73 to 48 bp), which binds multiple
transcription factors but not NFAT (26). Further upstream the IFN-
promoter contains several sequences that are homologous to NFAT-binding
sites in the IL-4 gene (27). NFATp has been shown to bind to one of
these sites, and it was proposed that calcineurin-inducible
transcriptional factors act at this site to enhance IFN- expression
(28). The role of NFAT in the function of the IFN- promoter was more
fully explored in the current studies. NFAT bound to additional sites
in the IFN- promoter, and the two strong binding sites were required for maximal expression of an IFN- reporter construct containing 538 bp of the IFN- promoter. However, these two NFAT-binding sites were
not required for cyclosporin sensitivity. In contrast to results seen
with the IL-2 and IL-4 promoters, transient cotransfection studies
suggested that NFAT was not a limiting factor for IFN- gene
expression in Jurkat T cells. In primary murine splenocytes, which have
lower levels of endogenous NFAT protein, overexpression of NFATp or
NFATc enhanced expression of the IFN- promoter.
B (36). Previous studies suggested that YY1
inhibits basal IFN- expression through two mechanisms: binding to an
AP-2-like repressor protein, and competition with AP-1 for DNA binding
(37, 38). In this work, the YY1-binding sites, which are located
between the two strong NFAT-binding sites in the IFN- promoter, did
not mediate inhibition of basal expression of IFN-.
Furthermore, in contrast to its putative role as an inhibitor of
IFN- expression, YY1 appeared to play a positive role in initiating
IFN- gene expression in primary murine splenocytes.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
following activation, was maintained as described
previously (25). Splenocytes obtained from B10.BR or C57Bl/6 mice,
which were originally purchased from The Jackson Laboratories (Bar
Harbor, ME) and bred in our specific pathogen-free facility, were
depleted of erythrocytes with an ammonium chloride lysis solution (0.15 M NH4Cl, 1 mM NaHCO3, 0.1 mM EDTA). The remaining mononuclear cells were cultured
overnight in RPMI 1640 supplemented with 10% fetal calf serum (HyClone
Laboratories, Logan, UT), GlutaMAX, 100 units/ml penicillin, 100 µg/ml streptomycin, and 20 µg/ml gentamicin plus 3 µg/ml
concanavalin A (ConA) prior to electroporation.
B family including p50 (1141, directed against a peptide containing residues 2-16 of human p50), p65 (1226, directed against a peptide containing the carboxyl-terminal 14 residues of human p65), and c-Rel (265) were
provided by Nancy Rice (National Cancer Institute-Frederick Cancer
Research and Development Center, Frederick, MD) (39).
-Galactosidase reporter constructs
containing various amount of 5'-flanking sequence of the IFN-
promoter (basal promoter pIFN-39 and full-length promoter pIFN-538), a
dimer of the IFN- proximal element (71 to 44) placed upstream of
the pIFN-39 basal promoter (Prox dimer), and the IL-2 promoter
(pIL2-568) have been previously described (25, 26). Point mutations in
the NFAT-, AP-1-, and YY1-binding sites were made in the context of the
full-length IFN- promoter (pIFN-538) by polymerase chain
reaction-site directed mutagenesis. The NFAT-binding site mutations
contained a GG to TT substitution, which disrupts NFAT binding. The
AP-1-binding site mutation (a CT to AA substitution at 151, 150)
disrupts AP-1 binding but not NFAT binding to the NFAT 160 site. For
the NFAT 160 mutation (N160) and the AP-1 160 mutation (AP160), a
280-bp BglII/Kpn fragment containing the
substitution was subcloned into pIFN-538
177/109. A 360-bp
Xba/BglII fragment with the NFAT 280
substitution was subcloned into pIFN-538214/178 for the NFAT
280 mutation (N280), and into the N160 construct for the double NFAT
mutation (N160/N280). Point mutations in the Y1 site alone (a T to A
substitution at 201) or in this site and the Y2 site (a GG to CA
substitution at 218, 217) are known to disrupt YY1 binding at these
sites (38). The YY1 mutations were then inserted into the wild-type
pIFN-538 (Y1 or Y1Y2) or double NFAT mutant 538 construct (NY1 or
NY1Y2). The sequence of each construct was confirmed by dye terminator
cycle sequencing (Perkin-Elmer). All of the IFN- promoter constructs
mentioned above were subcloned into a firefly luciferase reporter
plasmid, pGL3, from Promega (Madison, WI).
-galactosidase plasmid and 0.54 µg/106 cells of
control -actin chloramphenicol acetyltransferase plasmid in 0.5 ml
of RPMI 1640 by electroporation (ECM600, BTX Inc., San Diego, CA) as
described previously (25, 26). In cotransfection experiments, the total
amount of plasmid per cuvette was kept constant by addition of control
pREP4 plasmid. After electroporation, the cells were either not
stimulated or stimulated with ionomycin (1.5 µM) and
phorbol myristate acetate (PMA, 25 ng/ml), with or without pretreatment
with cyclosporin A (CSA, 500 ng/ml) for 20 min as described previously
(25, 26). Cell lysates were analyzed for -galactosidase activity
using chlorophenol red as substrate (40) and corrected for
transcription efficacy by normalizing to chloramphenicol
acetyltransferase content as described previously (25, 26).
firefly luciferase reporter plasmid and 1 µg of control
plasmid containing the -actin promoter driving Renilla
luciferase in 0.25 ml of complete media (RPMI 1640, 10% fetal calf
serum, glutamine, penicillin/streptomycin) by electroporation (Bio-Rad,
250 V, 960 microfarads). After electroporation, the cells were rested
for 2 h and then stimulated with 25 ng/ml PMA and 1.5 µM ionomycin or media alone. In certain experiments, some
cells were treated with cyclosporin A (1 µg/ml) for 35-45 min prior
to stimulation. Lysates were harvested at 5 h and assayed for
firefly and Renilla luciferase activity utilizing a Dual
Luciferase Reporter kit (Promega, Madison, WI). Values are reported as
relative light units after correction for transfection efficiency by
normalization to the -actin promoter driving Renilla
luciferase. In the cotransfection experiments, the splenocytes were
transiently transfected with 10 µg of IFN- firefly luciferase
reporter and 10 µg of the appropriate NFAT expression vector without
addition of the -actin promoter Renilla luciferase
plasmid. Values are reported as absolute light units without correction
for transfection efficiency by normalization to the -actin promoter,
since overexpression of NFAT proteins in murine splenocytes increased
-actin promoter expression compared with the control pREP4 vector
(data not shown).
350 to +50) IFN-
promoter fragment at either end. The binding reactions and DNase I
digestions were carried out as described previously (8).
160 site,
5'-GAGTCTAAAGGAAACTCTAACTACAACACCCAAA-3'; the
mutated NFAT 160 site (160m),
5'-GAGTCTAAAttAAACTCTAACTACAACACCCAAA-3'; the NFAT 280 site, 5'-
GGTACAAAAAAATTTCCAGTCCTTGAATG-3'; the mutated NFAT 280
site (280m), 5'-GGTACAAAAAAATTTaaAGTCCTTGAATG-3'; a
consensus YY1 element of the Moloney murine leukemia virus gene, 5'-TGCCTTGCAAAATGGCGTTACTGCAG-3' (45); a consensus
metallothionein IIa AP-1 element,
5'-GAGCCGCAAGTGACTCAGCGCGGG-3' (46); the consensus Dr octamer, 5'-CTGACCATTAAAATGCAAATCAATTACTCTTTGG-3'
(47); and the GATA element of the T cell receptor- enhancer,
5'-GTTAGAGATAGCATCGCCCCA-3' (48). Oligonucleotides were labeled, and
the binding reactions were performed as described previously. (25) In
some experiments, antiserum to specific transcription factors was
preincubated with nuclear extracts for 1 h on ice before the
addition of probe. Bound complexes were resolved on 5% nondenaturing
polyacrylamide gels or 5% nondenaturing Duracryl (Millipore Corp.,
Bedford, MA) polyacrylamide gels in 0.4 or 0.5× Tris borate/EDTA
buffer, dried, and autoradiographed overnight.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Promoter--
Previous studies have identified two elements located
within 108 bp of the 5'-flank of the IFN- gene which are sufficient for T cell and activation-specific expression by the IFN- promoter (25, 26, 49, 50). Although expression mediated by this region of the
promoter and by the proximal element (25, 26, 49) is
cyclosporin-sensitive, neither element appears to contain binding sites
for NFAT proteins. This suggests that unlike other cyclosporin-sensitive promoters of lymphokines expressed in T cells,
cyclosporin sensitivity of the IFN- promoter may not be due to the
inhibitory effects of this drug on NFAT activation. However, it is
possible that NFAT proteins bind at other sites within the full-length
promoter (27, 28) and thereby contribute to the cyclosporin sensitivity
of this gene.
promoter was performed using recombinant NFATp, AP-1 (c-Jun and Fra-1)
and ATF-2 proteins (Figs. 1 and
2). AP-1 and ATF-2 proteins were used
because they are known to bind to the IFN- promoter (26), and AP-1
can form a composite element with NFAT (4, 12, 22). Recombinant NFATp
bound strongly and independently to two regions protecting nucleotides
spanning positions 280 to 265 and 168 to 153 bp relative to the
transcription start site (Figs. 1A, lane 12, and
B, lane 3, and 2B, lane 2). The most
distal NFAT site, which is referred to as the NFAT 280 site, contains
a consensus NFAT-binding sequence at position 280 to 270 and is
identical to the recently described C3-3P site that binds both NFAT
and NF-kB proteins (28). The second NFAT site contains a consensus
NFAT-binding sequence at position 163 to 155 and is referred to as
the NFAT 160 site. The ability of NFATp to bind the NFAT 160 site
is a novel finding. AP-1 (c-Jun plus Fra-1) bound independently to two
previously defined sites (Figs. 1B, lane 4, and 2B,
lane 3) as follows: the distal element at position 98 to 72
(25) and a second site at position 196 to 183 (38, 51). AP-1 also
bound to the NFAT 160 site but did so only in the presence of NFATp
(Fig. 1B, lane 5). NFATp also protected a region spanning
position 106 to 91 just 5' to the distal element but bound weakly
and only in the presence of AP-1 (Fig. 1B, lane 5; Fig.
2B, lane 4). NFATp did not bind to more proximal regions of
the IFN- promoter, such as the proximal element (Fig. 2,
A and B). Consistent with previous data,
recombinant ATF-2 protected a large region spanning position 63 to
43 of the proximal element alone or in combination with c-Jun (Fig. 2A). AP-1 protected a smaller region within the proximal
element (Fig. 2B).
View larger version (109K):
[in a new window]
Fig. 1.
DNase I footprint analysis of the IFN-
promoter. A human IFN- promoter fragment (350 to +50) was
labeled at the distal (350) end, and binding reactions with
recombinant NFATp, c-Jun, and ATF-2 proteins (left panel, A)
or with NFATp and AP-1 (c-Jun plus Fra-1) proteins (right panel,
B) were carried out as described previously (8). NFATp protected
three distinct regions as follows: two strong binding sites spanning
positions 280 to 265 (NFAT 280) and 168 to 153 (NFAT 160)
and a weak binding site centered at 105 adjacent to the distal
element (AP-1+NFAT (DE)). NFATp bound to the weak site only
in the presence of AP-1. AP-1 bound independently to the distal element
(DE) at position 98 to 72 (25) and to a site at 196 to
183 (AP-1 190) (51). In the presence of NFAT, AP-1 bound
cooperatively to the NFAT 160 site (B, NFAT
160+AP-1). The NFAT 160 site coincides with the putative
CD28RE (55). ATF-2 bound to the proximal element (PE) at
positions 63 to 43 (26). Lanes labeled with were reactions
performed with no protein. The lane labeled GA was a
Maxam-Gilbert sequencing reaction showing the purine sequence of the
noncoding strand.
View larger version (66K):
[in a new window]
Fig. 2.
DNase I footprint analysis of the IFN-
promoter. A human IFN- promoter fragment (350 to +50) was
labeled at the proximal (+50) end, and binding reactions were carried
out as in Fig. 1. NFATp protected three distinct regions (NFAT
280, NFAT 160+AP-1, and AP-1+NFAT(DE)) as described
in Fig. 1 but did not protect the region around the proximal element
(PE). AP-1 bound independently to site 196 to 183
(AP-1 190) (51), the distal element (DE) (25),
and the proximal element (PE) (26). As in Fig. 1, AP-1 bound
cooperatively to the site at 160 in the presence of NFATp (NFAT
160+AP-1). ATF-2 bound to the proximal element (ATF
(PE)) as described previously (26). Lanes labeled with were reactions performed with no protein. The lane labeled
GA was a Maxam-Gilbert sequencing reaction showing the
purine sequence of the noncoding strand.
NFAT 280 and NFAT 160 Elements Bind NFAT Proteins
in T Cell Nuclear Extracts--
To determine if NFAT proteins present
in T cell nuclear extracts can bind to the sites identified by the
DNase I footprint analysis using recombinant proteins, the NFAT 280
and NFAT 160 sites were tested in electrophoretic mobility gel shift
assays (EMSAs) with nuclear extracts from Jurkat T cells (Fig.
3). Similar results were obtained using
nuclear extracts from a murine Th1 clone, CD6 (data not shown). As
shown in Fig. 3A, a low basal level of binding to the NFAT
280 site was seen in nuclear extracts from unstimulated Jurkat T
cells (lane 4). Binding to the NFAT 280 site was greatly
induced by treatment of the cells with ionomycin and PMA and was
blocked by cyclosporin A (lanes 5 and 6). When used as competitors, unlabeled NFAT 280 and NFAT 160
oligonucleotides inhibited formation of the NFAT 280 complex (Fig.
3B, lanes 13, 15, and 16). NFAT 280
and NFAT 160 oligonucleotides containing a GG to TT mutation (280m
and 160m), which disrupts the consensus NFAT-binding sequence, did not
block formation of the complex nor did oligonucleotides containing
consensus AP-1, YY1, GATA-1, and Oct-1 elements (Fig. 3B, lanes
14, 17, and 18 and data not shown). In EMSA experiments
using antisera to specific transcription factors, rabbit polyclonal
antiserum against NFATp supershifted the NFAT 280 complex (Fig.
3C, lane 8), whereas antisera directed against Jun, YY1, and
Oct-1 proteins had no effect (Fig. 3C, lane 9, and data not
shown). A supershift was also observed with antisera directed against
p50, p65, and c-Rel (Fig. 3C, lanes 10-12) as has been
described previously (28), indicating that members of the NF-B
family can also bind to the NFAT 280 site.
View larger version (42K):
[in a new window]
Fig. 3.
NFAT proteins in nuclear extracts from Jurkat
T cells bind to the IFN NFAT 160 and NFAT 280 regulatory
elements. A, EMSA showing complexes generated by the
NFAT 160 and NFAT 280 probes incubated with nuclear extracts (3 µg) from Jurkat T cells, which were either not stimulated
(uns), stimulated with ionomycin and PMA (I+P),
or stimulated after pretreatment with cyclosporin A
(I+P/CSA). B, EMSA showing the ability of excess
unlabeled oligonucleotides to compete for binding to the IFN- NFAT
probes: NFAT 160 (lanes 1-7), mutated NFAT 160 (160m,
lanes 8-11), and NFAT 280 (lanes 12-18). Five
(lanes 4 and 15) or 10 ng of the following
unlabeled competitor oligonucleotides (Comp) were added as
indicated: NFAT-160, NFAT-160 mutant (160m), NFAT-280, NFAT-280 mutant
(280m), or AP-1. C, EMSA demonstrating that antiserum
specific for NFATp can supershift the protein-DNA complex binding to
the NFAT 160 and NFAT 280 probes. Antisera used are as follows:
rabbit polyclonal serum control (Cont), anti-NFATp,
anti-pan-Jun (pJun), anti-p50, anti-p65, or
anti-c-Rel.
160 site compared with the NFAT 280 site. As seen in Fig.
3A, no binding to the NFAT 160 probe was seen in
unstimulated Jurkat T cells (lane 1). The NFAT 160 complex
was induced upon stimulation with ionomycin and PMA and blocked by
cyclosporin (Fig. 3A, lanes 2 and 3).
In competition experiments, unlabeled NFAT 160 and NFAT 280
oligonucleotides strongly inhibited formation of the NFAT 160
complex, whereas the mutated NFAT 160 and NFAT 280 oligonucleotides
(160m and 280m) did not (Fig. 3B, lanes 2-6). The NFAT
160 complex appeared to have a somewhat lower affinity than the NFAT
280 site, since the NFAT 160 complex was completely competed by
only 5 ng of the unlabeled NFAT 280 oligonucleotide (Fig. 3B,
lane 4), whereas a higher concentration of unlabeled NFAT 160
oligonucleotide was required to completely compete the NFAT 280
complex (Fig. 3B, lanes 15 and 16). In
some experiments, an AP-1 consensus oligonucleotide partially competed binding of the NFAT 160 complex, but this was not a consistent finding (Fig. 3B, lane 7). Consensus YY1, GATA-1, and Oct-1
oligonucleotides failed to compete for binding to the NFAT 160
complex (data not shown). Antiserum to NFATp supershifted the NFAT-160
complex (Fig. 3C, lane 2), but antisera directed against YY1
and Oct-1 had no effect (data not shown). In contrast to the results
with the NFAT 280 complex, antiserum against Jun proteins (p-Jun)
partially blocked the NFAT 160 complex.
161 to 153 region of the IFN- NFAT 160 site has
sequence homology with the CD28 response element (CD28RE) of the IL-2
promoter, which is a composite NFAT/AP-1 site (52) and binds members of
the NF-B family including c-Rel, p50, and p65 (53), the ability of
antisera to NF-B proteins to interact with the NFAT 160 complex
was tested. In contrast to the results seen with the NFAT 280 element
(Fig. 3C, lanes 10-12), antisera to NF-B
family proteins p50, p65, and c-Rel did not supershift the NFAT 160
complex (Fig. 3C, lanes 4-6). This analysis was performed
with nuclear extracts from Jurkat T cells that were stimulated with
ionomycin and PMA. Previous studies have demonstrated that the CD28RE
complex of the IL-2 promoter is only weakly evident with PMA treatment
and required both a T cell receptor signal (e.g. ionomycin
and PMA or anti-CD3) and an anti-CD28 signal for maximal induction
(54-56). Thus, it remains possible that some members of the NF-B
family may bind to the NFAT 160 site under different conditions of
stimulation. However, recombinant NF-B proteins p50, p65, and p52
did not bind to the NFAT 160 site by DNase I footprint analysis (data
not shown).
160 site disrupts
the NFAT binding consensus sequence, it should be noted that the NFAT
160 oligonucleotide containing this mutation (160m) bound a single
complex which differed from the complex seen with the wild-type NFAT
160 probe (Fig. 3B, lane 8 versus lane 1). This
new complex was only competed by itself (lane 10) and not by
the NFAT 160 or AP-1 oligonucleotides (lanes 9 and
11). The GG to TT mutation of the NFAT 160-binding motif
generated the sequence GTCTAAAttAAA which is homologous to the Octamer
consensus sequence ATG(C/T)AAAT. Binding of Oct-1 to the NFAT 160
mutant and lack of binding of Oct-1 to the wild-type NFAT 160
oligonucleotide was confirmed by EMSA using Oct-1-specific antibody
(data not shown).
Promoter
Constructs but Is Not Necessary for Cyclosporin Sensitivity--
To
determine the influence of NFAT on IFN- gene expression and its role
in the cyclosporin sensitivity of this gene, specific point mutations
(GG to TT) were made in the two strong NFAT-binding sites in the
context of the full-length IFN- promoter reporter construct pIFN-538
by polymerase chain reaction site-directed mutagenesis. These mutations
disrupted NFAT binding determined by DNase I footprint analysis and by
EMSA (Fig. 3B and data not shown). As represented in Fig.
4A, point mutations in the
NFAT 160 site (N160), NFAT 280 site (N280), or both sites
(N160/N280) decreased activation-induced expression by an average of
48, 41, and 49%, respectively, compared with the wild-type pIFN-538
construct tested concomitantly (p < 0.003 by
two-tailed Student's t test, cumulative results of 7 experiments). Inducible expression by these constructs remained
completely sensitive to cyclosporin, as was expression by a reporter
construct containing a dimer of the IFN- proximal element (26),
which does not bind NFATp.
View larger version (28K):
[in a new window]
Fig. 4.
Effects of cyclosporin and NFAT point
mutations on expression of IFN- promoter constructs in Jurkat T
cells. Constructs containing the full-length pIFN-538 promoter
without or with point mutations in the NFAT 160 site (N160), the NFAT
280 site (N280), both NFAT sites (N160/N280), the first YY1-binding
site (Y1), both YY1-binding sites (Y1Y2), combined double NFAT and
YY1-binding site mutations (NY1 and NY1Y2), or a dimer of the proximal
element (71 to 44) placed upstream of the basal IFN-39 promoter
(Prox Dimer) were transiently transfected into Jurkat cells
and assayed for -galactosidase activity with normalization to a
-actin promoter as described previously (26). A, the
Jurkat T cells were either not stimulated (uns, black
bars), stimulated with 25 ng/ml PMA and 1.5 µM
ionomycin (I+P, gray bars), or pretreated with
500 ng/ml cyclosporin A (I+P/CSA, white bars) as
indicated. B, the cells were either not stimulated or
stimulated with PMA and ionomycin. Values are the means ± S.E. of
two experiments in A and three experiments in B,
in which all constructs shown were tested in parallel.
expression in
primary lymphocytes, constructs containing the IFN- promoter driving
a luciferase reporter were transiently transfected into murine
splenocytes (Fig. 5) (41). Results
paralleled those with Jurkat T cells compared with the wild-type
pIFN-538 construct; expression of the N160, N280, and N160/N280
constructs was reduced by 45, 52, and 66% (p < 0.03, n = 3), respectively, in response to ionomycin and PMA
and by 39, 44, and 61% (p < 0.04, n = 2), in response to anti-CD3. The N160/N280 construct with point
mutations in both NFAT sites remained sensitive to cyclosporin.
View larger version (29K):
[in a new window]
Fig. 5.
Expression of IFN- promoter reporter
constructs in fresh splenocytes. The constructs described in Fig.
4 were subcloned into a firefly luciferase reporter plasmid pGL3 and
transiently transfected into murine splenocytes which were treated with
3 µg/ml ConA 21 h prior to transfection to allow for uptake of
DNA. After electroporation, the cells were rested for 2 h and then
either not stimulated or stimulated with 25 ng/ml PMA and 1.5 µM ionomycin (top panel, A) or with an CD3
antibody 145-2C11 (bottom panel, B) in the presence or
absence of cyclosporin A (1 µg/ml). Lysates were harvested at 5 h, assayed for firefly luciferase activity, and corrected for
transfection efficiency by normalization to a -actin promoter
driving Renilla luciferase. Values are the means ± S.E. of three experiments in A and two experiments in
B.
Promoter
Constructs--
To determine whether the interaction of AP-1 at the
composite NFAT/AP-1 160 element influences IFN- gene expression, a
point mutation (CT to AA) was made in the AP-1 site in this composite element. As determined by DNase I footprint analysis, this mutation disrupted the binding of AP-1 to this element in the presence of NFAT
but did not affect NFAT binding (data not shown). Compared with the
wild-type pIFN-538 construct, expression of the construct containing
the AP-1 160 point mutation (AP160) was decreased by 47%
(p < 0.003, n = 6) in Jurkat T cells
and by 68% (p < 0.007, n = 4) in
murine splenocytes in response to ionomycin and PMA (Fig.
6).
View larger version (24K):
[in a new window]
Fig. 6.
Effect of AP-1 point mutation on expression
of IFN- promoter constructs in Jurkat T cells and fresh
splenocytes. A, constructs containing the full-length pIFN-538
promoter without or with point mutations in the AP-1
(AP-160)- or NFAT (N160)-binding sites of the
composite NFAT/AP-1 160 element were transiently transfected into
Jurkat T cells, stimulated and assayed as described in Fig. 4. Values
are the means ± S.E. of six experiments for the AP-1 construct
and three experiments for all other constructs. B, the
corresponding luciferase constructs were transfected into murine
splenocytes as described in Fig. 5. The cells were either not
stimulated (uns) or stimulated with 25 ng/ml PMA
(P) and 1.5 µM ionomycin (I).
Values are the means ± S.E. of four experiments for the AP-1
construct and three experiments for all other constructs.
Expression in Murine Splenocytes but Not
Jurkat T Cells--
Overexpression of NFATp in Jurkat T cells enhances
transcription of reporter genes driven by the IL-2, IL-4, TNF-, and
GM-CSF promoters (57). To determine whether NFATp plays a similar role in IFN- expression, Jurkat T cells were transfected with a NFATp or
NFATc expression vector and reporter plasmids containing various amounts of 5'-flanking sequence of the IFN- promoter. As seen in
Fig. 7A, overexpression of
NFATp enhanced expression of a control IL-2 promoter construct but
failed to enhance expression of the full-length IFN- promoter
construct (pIFN-538). Cotransfection with expression vectors encoding
other members of the NFAT family (NFATc, NFAT3, and NFAT4) also did not
enhance IFN- reporter expression (Fig. 7A and data not
shown).
View larger version (31K):
[in a new window]
Fig. 7.
Cotransfection of Jurkat T cells and murine
splenocytes with IFN- promoter constructs and expression vectors
encoding NFAT proteins. A, Jurkat T cells were
cotransfected with -galactosidase reporter constructs containing
IFN- promoter constructs (promoterless pEQ3, basal promoter pIFN-39,
full-length pIFN-538) or the IL-2 promoter pIL2-568 and an expression
vector encoding NFATp under control of the Rous sarcoma virus promoter.
The total amount of Rous sarcoma virus vector was kept constant by
addition of control pREP4 vector lacking a cDNA insert. The cells
were stimulated with 25 ng/ml PMA and 1.5 µM ionomycin.
Values are the means ± S.E. of five experiments for the pREP4 and
NFATp vectors and two experiments for the NFATc vector. The NFATc
vector was not tested (n.t.) with the pEQ3 and pIFN-39
constructs. B, murine splenocytes were pretreated with ConA
and cotransfected with the firefly luciferase versions of the reporter
constructs described in A and expression vectors encoding
NFATp or NFATc. After 2 h, the splenocytes were not stimulated or
stimulated with 25 ng/ml PMA (P) and 1.5 µM
ionomycin (I). Lysates were harvested at 5 h and
assayed for firefly luciferase activity. Values are the means ± S.E. of three experiments.
reporter plasmids. In contrast to the results seen with
the Jurkat T cells (Fig. 7A), expression of the full-length IFN- promoter construct (pIFN-538) was enhanced 1.5-fold
(p < 0.004 by two-tailed Student's t test,
n = 3) by NFATp overexpression and 1.9-fold
(p < 0.02) by NFATc overexpression (Fig.
7B). In comparison, overexpression of NFATp enhanced
expression of the IL-2 promoter construct (pIL2-568) by 2.0-fold
(p < 0.006). Overexpression of NFATc did not
significantly enhance IL-2 promoter-dependent expression
(p = 0.25).
Promoter--
Based on the results of the transient transfection
experiments in Figs. 4 and 5, NFAT appeared to play a positive role in expression of the IFN- promoter. However, it is possible that the
decreased expression of the constructs containing the NFAT point
mutations is secondary to an overriding or unbalanced effect of a
silencer element within the IFN- promoter located between the NFAT
280 and NFAT 160-binding sites. In this region, several potential
YY1-binding sites have been identified by homology to a consensus
YY1-binding sequence, and YY1 has been shown by gel shift analysis to
bind to two sites named Y1 and Y2 (37, 38). In those studies, when
regions containing the YY1-binding sites (Y1 region 246 to 211; Y2
region 211 to 186) were placed upstream of an IFN- reporter
construct (pIFN-108), point mutations of the YY1-binding sites resulted
in increased expression (Y1) or loss of suppression (Y2) of the
pIFN-108 reporter construct (37, 38). To examine the role of the
NFAT-binding sites on IFN- expression in the absence of the silencer
element, point mutations of the YY1-binding sites (Y1 at position 201
and Y2 at position 218 to 217) were made in the context of the
full-length pIFN-538 promoter, with or without the double NFAT point
mutations (N160/N280), and tested by transient transfection in both
Jurkat T cells and murine splenocytes (Figs. 4B and 5).
gene, the
full-length pIFN-538 reporter constructs with point mutations in one
(Y1) or both YY1 sites (Y1Y2) were not expressed in unstimulated Jurkat
T cells and showed no increase in expression compared with wild-type
pIFN-538 in stimulated cells (Fig. 4B). Mutations in the
YY1-binding sites also did not increase expression of constructs
containing point mutations in the two NFAT-binding sites (Fig.
4B, compare N160/N280 to NY1 and NY1Y2).
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
expression is regulated. A diverse group of both
constitutive and inducible cis-regulatory elements appear to be
involved (Fig. 8). In previous studies,
the most proximal region of the IFN- promoter between 108 and 40
bp relative to the transcription start site was found to be sufficient
for activation-specific, cyclosporin-sensitive expression in T cells (25). Within this region, members of the CREB/ATF, AP-1, octamer, and
GATA families of transcription factors bind to the proximal (70 to
47) and distal (98 to 72) elements (25, 26). These two elements
are necessary for expression of IFN- reporter constructs (25, 26),
and like the endogenous gene, constructs containing multimers of these
elements are expressed on stimulation in memory, but not naïve
T cells in transgenic mice (49). Further upstream, an AP-1 site at
position 196 to 183 contributes to expression induced by mitogens
or by treatment with IL-18 (51, 59). This AP-1 site and a STAT4-binding
site at position 238 (60) play a positive role in
IL-12-dependent activation of IFN- constructs in primary
human CD4+ T cells (59). While the studies described in the current
report were in progress, Sica et al. (28) demonstrated that
NFAT and NF-B proteins could bind to position 278 to 268. Based
on cotransfection of expression constructs encoding a constitutively activated form of calcineurin or p65, they proposed that the activity of this (C3-3P or NFAT-280) site is mediated by calcineurin-inducible factors, whereas enhancement by NF-B is primarily mediated via the
IFN- B-C3-1P tandem elements located further upstream at positions 786 to 776 and 772 to 763. In addition to these positive regulatory elements, two constitutive YY1-binding sites have
been identified at positions Y1 (199 to 203) and Y2 (217 to
221) (37, 38). These sites are postulated to play a role in
inhibiting basal expression of IFN- by competition for DNA binding
with AP-1 at the Y1 position and by activation of an AP-2-like protein
by YY1 binding at the Y2 position.
View larger version (23K):
[in a new window]
Fig. 8.
Summary of the regulatory binding sites in
the IFN- promoter. Regulatory elements binding within the
region 300 bp proximal to the transcription start site (TSS)
of the human IFN- gene are shown. The position and names of the
regulatory elements are shown in the top row, and key
citations are as follows: the NFAT 280 site (this paper and Ref. 28);
STAT 1 and STAT 4-binding site (60); the Y1 and Y2 silencer element
which contains two YY1-binding sites (37, 38); the 196 AP-1-binding
site (51); the NFAT 160/AP-1 site (this paper); CD28RE, the proposed
CD28 response element (55); the weak NFAT 100 site (this paper);
DE, distal element (25); and PE, proximal element
(25, 26). Members of the various transcription factor families known to
bind to these sites in the IFN- promoter are shown.
promoter. In addition to the NFAT 280 site
identified by Sica et al. (28) (Figs. 1-3), a composite NFAT/AP-1 site was found at position 160, to which recombinant proteins or proteins from activated, but not resting T cell nuclear extracts bound (Fig. 3). The NFAT 160 site is similar to composite NFAT/AP-1 elements found in the promoters of other cytokine genes (22)
and is comprised of a relatively strong NFAT consensus sequence (in
bold letters) adjacent to a weak AP-1 site (underlined): 171
GAGTCTAAAGGAAACTCTAACTACAACACCCAAA
138. It has also been suggested that AP-1 might form a composite
element with NFAT at the IFN- NFAT 280 site (22); however, in the current studies, an interaction of AP-1 and NFAT at the NFAT 280 site
was not detected by DNase footprinting or gel shift analysis (Figs.
1-3). In addition to being a composite NFAT/AP-1 site, the NFAT 160
region may serve as a CD28 response element for the IFN- gene (55).
Although the NFAT 160 region has sequence homology with the CD28
response element of the IL-2 promoter which binds members of the
NF-B family (53), binding of NF-B family members to this site was
not detected in our Jurkat nuclear extracts by EMSA (Fig.
3C) or by DNase I footprint analysis using p50, p65, and p52
recombinant proteins (data not shown). This does not formally exclude
other members of the NF-B family, such as c-Rel, from binding to
this site under certain conditions (56). A third weak NFAT-binding site
was identified at position 106 to 99 adjacent to the distal
element. We postulate that this site is not of physiologic importance
based on the following findings: 1) recombinant NFATp protein
bound weakly and only in the presence of AP-1 by in vitro
footprinting, 2) deletion of this site (pIFN-53899-109) did not
affect expression of reporter constructs (25), and 3) this site is not
conserved in the mouse IFN- promoter. However, these results do not
formally exclude the possibility of NFAT being recruited to this site
in vivo.
280 and 160 are required for maximum inducibility of the IFN-
promoter in Jurkat T cells and murine splenocytes, as demonstrated by
decreased levels of expression of full-length IFN- promoter
constructs containing point mutations in one or both of the
NFAT-binding sites. This result is similar to results seen with other
cytokine promoters, including the IL-2 (52) and the IL-4 promoters (8,
9). The mutation of the NFAT 160 site created a site to which Oct-1
bound in vitro (Fig. 3B and data not shown).
Although decreased expression of the IFN- reporter construct
containing this mutation could reflect a suppressive effect of Oct-1 on
promoter activity (61), the more likely possibilities are that the
binding of Oct-1 to the NFAT-160 site had no effect on expression, had
a weak positive effect which was masked by the loss of NFAT binding, or
had an inhibitory effect by blocking NFAT binding as seen in the IL-4
promoter (62). In either case, the results support the notion that NFAT
plays a positive role at this site. As seen in Fig. 6, AP-1 also plays
a positive role at the NFAT/AP-1 160 composite site, as demonstrated
by the reduced level of expression of a full-length IFN- construct
containing a point mutation that blocks AP-1, but not NFAT, binding.
reporter construct containing point mutations in
both NFAT-binding sites (Figs. 4A and 5A,
N160/N280) remained completely sensitive to the inhibitory effects of
cyclosporin. Thus, although NFAT proteins play a positive role in the
IFN- promoter and may contribute to the cyclosporin sensitivity of this gene (Fig. 3A), other regulatory elements in the
IFN- promoter, such as the IFN- proximal element, confer
cyclosporin sensitivity in an NFAT-independent manner. Consistent with
this, cyclosporin also inhibits the calcineurin-dependent
activation of c-Jun amino-terminal/stress-activated protein kinases in
T cells, which are required for phosphorylation and activation of c-Jun
and ATF-2 (63, 64). We have previously shown that c-Jun is essential
for activation-induced transcription of IFN- (26, 50) and binds
preferentially to the IFN- proximal element as a heterodimer with
ATF-2 (26).
) (57), overexpression of NFATp and
other NFAT protein family members did not further enhance expression of
the IFN- promoter construct in Jurkat T cells (Fig. 7A),
suggesting that the abundance of NFAT proteins in these cells is
sufficient for full IFN- gene promoter function. This may reflect
differences in the organization and relative role of NFAT proteins in
the IL-2 (52), IL-4 (8, 9), and TNF- promoters (65), all of which
contain three to five NFAT-binding sites within a total length of
200-300 bp, in comparison to the IFN- promoter, which contains only
two strong NFAT-binding sites. However, in primary murine splenocytes,
which have lower levels of endogenous NFAT activity, the positive role
of NFAT became apparent in that expression of the IFN- promoter
construct was enhanced by overexpression of both NFATp and NFATc,
whereas expression of the IL-2 promoter was enhanced predominantly by
NFATp (Fig. 7B). These results are consistent with recent
data in mice deficient for NFAT proteins, which suggest overlapping but
distinct roles of NFATp and NFATc in the regulation of T lymphocyte
development and cytokine expression (66-69).
promoter function
in Jurkat T cells by interacting at two regions within a silencer
element located between the NFAT-binding sites (38). In contrast to
these results, which were obtained using a shorter IFN- promoter
construct (pIFN-225) or constructs in which portions of the silencer
region were placed out of context upstream of the pIFN-108 promoter
(38), the current studies demonstrated no significant increase in
expression when either or both YY1-binding sites were mutated in the
context of the full-length pIFN-538 construct and transfected into
Jurkat T cells or murine splenocytes (Figs. 4B and 5). It
should be noted that the pIFN-225 construct lacks the NFAT
280-binding site and has greatly decreased expression compared with
the longer pIFN-538 reporter constructs (38). Of interest was the
finding that in primary murine splenocytes but not Jurkat T cells,
expression was abolished in IFN- constructs containing both the NFAT
and YY1 mutations, despite the presence in these constructs of the
distal and proximal elements and the AP-1-binding site at 200. This
difference can not be accounted for by the type of reporter construct,
since the NY1 and NY1Y2 luciferase constructs were expressed in Jurkat
T cells (data not shown). These results suggest that proteins binding
to both the NFAT and YY1 sites may serve to initiate expression of
IFN- in primary splenocytes. Although YY1 has been shown to interact
with many other transcriptional regulators including NF-B (reviewed in Ref. 29), interaction with NFAT proteins has not been demonstrated. Little information is known about the mechanisms by which YY1 induces
transcriptional activation of cellular genes such as c-myc (30) and how cellular proteins modulate the activating and repressive activities of YY1 (29). The basis for the effect of the YY1 mutations
in the IFN- promoter are not known, and the importance of YY1 is
uncertain, since no effect was observed unless the NFAT sites were also
mutated. Nonetheless, the context-dependent effects of the
YY1 mutations are consistent with the notion that YY1 has both
activating and repressing properties that are influenced by the
position of binding sites in a gene promoter and its interactions with
other transcriptional regulators (29).
expression, but
elements besides the NFAT-binding sites contribute to the cyclosporin
sensitivity of the IFN- promoter. In addition, YY1 may play a
complex and context-dependent role in IFN- expression. These factors and their binding sites, along with those previously identified in the essential distal and proximal elements, likely form a
cooperative transcriptional complex, as described for IL-2 and other
promoters (70, 71).
FOOTNOTES
, interferon-; NFAT, nuclear factor of activated T cells; YY1, Ying-Yang 1; bp, base pair(s); EMSA, electrophoretic mobility
shift assay; ConA, concanavalin A; CSA, cyclosporin A; PMA, phorbol
12-myristate 13-acetate; CD28RE, CD28 response element; TNF, tumor
necrosis factor; GM-CSF, granulocyte-macrophage colony-stimulating factor.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. L. Ogilvie, J. R. SternJohn, B. Rattenbacher, I. A. Vlasova, D. A. Williams, H. H. Hau, P. J. Blackshear, and P. R. Bohjanen Tristetraprolin Mediates Interferon-{gamma} mRNA Decay J. Biol. Chem., April 24, 2009; 284(17): 11216 - 11223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Tassi, M. Cella, R. Presti, A. Colucci, S. Gilfillan, D. R. Littman, and M. Colonna NK cell-activating receptors require PKC-{theta} for sustained signaling, transcriptional activation, and IFN-{gamma} secretion Blood, November 15, 2008; 112(10): 4109 - 4116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Cimmino, G. A. Martins, J. Liao, E. Magnusdottir, G. Grunig, R. K. Perez, and K. L. Calame Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression J. Immunol., August 15, 2008; 181(4): 2338 - 2347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Samten, J. C. Townsend, S. E. Weis, A. Bhoumik, P. Klucar, H. Shams, and P. F. Barnes CREB, ATF, and AP-1 Transcription Factors Regulate IFN-{gamma} Secretion by Human T Cells in Response to Mycobacterial Antigen J. Immunol., August 1, 2008; 181(3): 2056 - 2064. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Jacob, R. Hod-Dvorai, S. Schif-Zuck, and O. Avni Unconventional Association of the Polycomb Group Proteins with Cytokine Genes in Differentiated T Helper Cells J. Biol. Chem., May 9, 2008; 283(19): 13471 - 13481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Athie-Morales, G. M. O'Connor, and C. M. Gardiner Activation of Human NK Cells by the Bacterial Pathogen-Associated Molecular Pattern Muramyl Dipeptide J. Immunol., March 15, 2008; 180(6): 4082 - 4089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhou, J. Yin, Z. Dou, J. Tang, C. Zhang, and Y. Cao The Calponin Homology Domain of Vav1 Associates with Calmodulin and Is Prerequisite to T Cell Antigen Receptor-induced Calcium Release in Jurkat T Lymphocytes J. Biol. Chem., August 10, 2007; 282(32): 23737 - 23744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Huang, H. Yang, B. B. Borg, X. Su, S. L. Rhodes, K. Yang, X. Tong, G. Tang, C. D. Howell, H. R. Rosen, et al. A functional SNP of interferon-{gamma} gene is important for interferon-{alpha}-induced and spontaneous recovery from hepatitis C virus infection PNAS, January 16, 2007; 104(3): 985 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Zhang and M. Boothby T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-{gamma} promoter are Stat4 dependent J. Exp. Med., June 12, 2006; 203(6): 1493 - 1505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Solomou, K. Keyvanfar, and N. S. Young T-bet, a Th1 transcription factor, is up-regulated in T cells from patients with aplastic anemia Blood, May 15, 2006; 107(10): 3983 - 3991. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. K. Teixeira, B. P. F. Fonseca, A. Vieira-de-Abreu, B. A. Barboza, B. K. Robbs, P. T. Bozza, and J. P. B. Viola IFN-{gamma} Production by CD8+ T Cells Depends on NFAT1 Transcription Factor and Regulates Th Differentiation J. Immunol., November 1, 2005; 175(9): 5931 - 5939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. F. Kaplan, Y. Ouyang, C. E. Rockwell, G. K. Rao, and N. E. Kaminski 2-Arachidonoyl-glycerol suppresses interferon-{gamma} production in phorbol ester/ionomycin-activated mouse splenocytes independent of CB1 or CB2 J. Leukoc. Biol., June 1, 2005; 77(6): 966 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-Y. Chau, A. M. Keane-Myers, M. Fedele, Y. Ikeda, R. J. Creusot, L. Menozzi, D. J. Cousins, G. Manfioletti, L. Feigenbaum, A. Fusco, et al. IFN-{gamma} gene expression is controlled by the architectural transcription factor HMGA1 Int. Immunol., March 1, 2005; 17(3): 297 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Lappas, J. M. Rieger, and J. Linden A2A Adenosine Receptor Induction Inhibits IFN-{gamma} Production in Murine CD4+ T Cells J. Immunol., January 15, 2005; 174(2): 1073 - 1080. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Winders, R. H. Schwartz, and D. Bruniquel A Distinct Region of the Murine IFN-{gamma} Promoter Is Hypomethylated from Early T Cell Development through Mature Naive and Th1 Cell Differentiation, but Is Hypermethylated in Th2 Cells J. Immunol., December 15, 2004; 173(12): 7377 - 7384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Bream, D. L. Hodge, R. Gonsky, R. Spolski, W. J. Leonard, S. Krebs, S. Targan, A. Morinobu, J. J. O'Shea, and H. A. Young A Distal Region in the Interferon-{gamma} Gene Is a Site of Epigenetic Remodeling and Transcriptional Regulation by Interleukin-2 J. Biol. Chem., September 24, 2004; 279(39): 41249 - 41257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shnyreva, W. M. Weaver, M. Blanchette, S. L. Taylor, M. Tompa, D. R. Fitzpatrick, and C. B. Wilson Evolutionarily conserved sequence elements that positively regulate IFN-{gamma} expression in T cells PNAS, August 24, 2004; 101(34): 12622 - 12627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunard, Y. Eto, J. T. Muljadi, C. K. Glass, C. J. Kelly, and M. Ricote Repression of IFN-{gamma} Expression by Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., June 15, 2004; 172(12): 7530 - 7536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Price, A. M.-L. Wong, D. Williamson, D. Voon, S. Baltic, R. J.N. Allcock, A. Boodhoo, and F. T. Christiansen Polymorphisms at positions -22 and -348 in the promoter of the BAT1 gene affect transcription and the binding of nuclear factors Hum. Mol. Genet., May 1, 2004; 13(9): 967 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, R. A. Barke, R. Charboneau, H. H. Loh, and S. Roy Morphine Negatively Regulates Interferon-{gamma} Promoter Activity in Activated Murine T Cells through Two Distinct Cyclic AMP-dependent Pathways J. Biol. Chem., September 26, 2003; 278(39): 37622 - 37631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Chen, C. Seguin-Devaux, N. A. Burke, T. B. Oriss, S. C. Watkins, N. Clipstone, and A. Ray Transforming Growth Factor {beta} Blocks Tec Kinase Phosphorylation, Ca2+ Influx, and NFATc Translocation Causing Inhibition of T Cell Differentiation J. Exp. Med., June 16, 2003; 197(12): 1689 - 1699. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. H. Schafer, A. K. Gandhi, M. A. Loveland, R. S. Chen, H.-W. Man, P. P. M. Schnetkamp, G. Wolbring, S. Govinda, L. G. Corral, F. Payvandi, et al. Enhancement of Cytokine Production and AP-1 Transcriptional Activity in T Cells by Thalidomide-Related Immunomodulatory Drugs J. Pharmacol. Exp. Ther., June 1, 2003; 305(3): 1222 - 1232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Lang, C. Weigert, S. Braedel, S. Fillon, M. Palmada, E. Schleicher, H.-G. Rammensee, and F. Lang Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes Am J Physiol Cell Physiol, January 1, 2003; 284(1): C200 - C208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Pien, K. B. Nguyen, L. Malmgaard, A. R. Satoskar, and C. A. Biron A Unique Mechanism for Innate Cytokine Promotion of T Cell Responses to Viral Infections J. Immunol., November 15, 2002; 169(10): 5827 - 5837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Soutto, F. Zhang, B. Enerson, Y. Tong, M. Boothby, and T. M. Aune A Minimal IFN-{gamma} Promoter Confers Th1 Selective Expression J. Immunol., October 15, 2002; 169(8): 4205 - 4212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Porter and N. A. Clipstone Sustained NFAT Signaling Promotes a Th1-Like Pattern of Gene Expression in Primary Murine CD4+ T Cells J. Immunol., May 15, 2002; 168(10): 4936 - 4945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. White, P. M. Watt, B. J. Holt, and P. G. Holt Differential Patterns of Methylation of the IFN-{gamma} Promoter at CpG and Non-CpG Sites Underlie Differences in IFN-{gamma} Gene Expression Between Human Neonatal and Adult CD45RO- T Cells J. Immunol., March 15, 2002; 168(6): 2820 - 2827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. B. Riquet, L. Tan, B. K. Choy, M. Osaki, G. Karsenty, T. F. Osborne, P. E. Auron, and M. B. Goldring YY1 Is a Positive Regulator of Transcription of the Col1a1 Gene J. Biol. Chem., October 12, 2001; 276(42): 38665 - 38672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Nakajima, R. Lu, and A. Engelman Human Immunodeficiency Virus Type 1 Replication in the Absence of Integrase-Mediated DNA Recombination: Definition of Permissive and Nonpermissive T-Cell Lines J. Virol., September 1, 2001; 75(17): 7944 - 7955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kiani, F. J. Garcia-Cozar, I. Habermann, S. Laforsch, T. Aebischer, G. Ehninger, and A. Rao Regulation of interferon-{gamma} gene expression by nuclear factor of activated T cells Blood, September 1, 2001; 98(5): 1480 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhu, J. Yang, T. L. Murphy, W. Ouyang, F. Wagner, A. Saparov, C. T. Weaver, and K. M. Murphy Unexpected Characteristics of the IFN-{{gamma}} Reporters in Nontransformed T Cells J. Immunol., July 15, 2001; 167(2): 855 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Kaminuma, M. Deckert, C. Elly, Y.-C. Liu, and A. Altman Vav-Rac1-Mediated Activation of the c-Jun N-Terminal Kinase/c-Jun/AP-1 Pathway Plays a Major Role in Stimulation of the Distal NFAT Site in the Interleukin-2 Gene Promoter Mol. Cell. Biol., May 1, 2001; 21(9): 3126 - 3136. [Abstract] [Full Text]
|
|
|
|
|
|
A. M. Hajjar, D. S. O'Mahony, A. Ozinsky, D. M. Underhill, A. Aderem, S. J. Klebanoff, and C. B. Wilson Cutting Edge: Functional Interactions Between Toll-Like Receptor (TLR) 2 and TLR1 or TLR6 in Response to Phenol-Soluble Modulin J. Immunol., January 1, 2001; 166(1): 15 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zhang and M. H. Kaplan The p38 Mitogen-Activated Protein Kinase Is Required for IL-12-Induced IFN-{gamma} Expression J. Immunol., August 1, 2000; 165(3): 1374 - 1380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Glimcher and K. M. Murphy Lineage commitment in the immune system: the T helper lymphocyte grows up Genes & Dev., July 15, 2000; 14(14): 1693 - 1711. [Full Text]
|
|
|
|
|
|
T.-K. Yu, E. G. Caudell, C. Smid, and E. A. Grimm IL-2 Activation of NK Cells: Involvement of MKK1/2/ERK But Not p38 Kinase Pathway J. Immunol., June 15, 2000; 164(12): 6244 - 6251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Labuda, A. Sundstedt, and M. Dohlsten Selective induction of p38 mitogen-activated protein kinase activity following A6H co-stimulation in primary human CD4+ T cells Int. Immunol., March 1, 2000; 12(3): 253 - 261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Fanger, A. L. Neben, and M. D. Cahalan Differential Ca2+ Influx, KCa Channel Activity, and Ca2+ Clearance Distinguish Th1 and Th2 Lymphocytes J. Immunol., February 1, 2000; 164(3): 1153 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Zhang, T. Nakamura, and T. M. Aune TCR and IL-12 Receptor Signals Cooperate to Activate an Individual Response Element in the IFN-{gamma} Promoter in Effector Th Cells J. Immunol., July 15, 1999; 163(2): 728 - 735. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Guo, V. Casolaro, E. Seto, W.-M. Yang, C. Chang, M.-C. Seminario, J. Keen, and S. N. Georas Yin-Yang 1 Activates Interleukin-4 Gene Expression in T Cells J. Biol. Chem., December 21, 2001; 276(52): 48871 - 48878. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |