|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 35023-35031, December 25, 1998
From the Department of Pharmacology, Baylor College of Medicine,
Houston, Texas 77030
Human signal recognition particle
(SRP) RNA is transcribed by RNA polymerase III and terminates with
-GUCUCUUUUOH on its 3' end. Our previous studies
showed that the three terminal uridylic acid residues of human SRP RNA
are post-transcriptionally removed and a single adenylic acid residue
is added, resulting in a 3' end sequence of -GUCUCUAOH
(Sinha, K. M., Gu, J., Chen, Y., and Reddy, R. (1998)
J. Biol. Chem. 273, 6853-6859). In this study we show
that the Alu RNA, corresponding to the 5' and 3' ends of SRP RNA, is
also accurately processed and adenylated in vitro. Alu
RNAs containing 7 or 11 additional nucleotides on the 3' end were
accurately processed and then adenylated. Deletion analysis showed that
an 87-nucleotide-long motif comprising of the 5' and 3' ends, including
stem IV of the Alu RNA, is sufficient and necessary for the 3' end
processing and adenylation. A 73-nucleotide-long construct with
deletion of stem IV, required for the binding of SRP 9/14-kDa proteins,
was neither processed nor adenylated. The adenylated Alu RNA as well as
adenylated SRP RNA were bound to the SRP 9/14-kDa heterodimer and were
immunoprecipitated by specific antibodies. A significant fraction of
SRP RNA in the nucleoli was found to be processed and adenylated. These
data are consistent with nascent SRP and/or Alu RNAs first binding to
SRP 9/14-kDa protein heterodimer, followed by the removal of extra
sequence on the 3' end and then the addition of one adenylic acid
residue in the nucleus, before transport into the cytoplasm.
Most eukaryotic RNAs are processed after transcription. These
processes include capping, polyadenylation, splicing, CCA turnover on
the 3' end of tRNAs, modification of base, sugar or phosphate moieties,
etc. In the case of human small RNAs like U1, U2, and U4
snRNAs,1 it is known that several nucleotides are removed
from the 3' end of the primary transcript to generate mature RNA
molecules. In all these cases, precursor RNAs bind the snRNP proteins
and the RNP is used as the substrate for processing (1-9). In addition to the removal of several nucleotides from the 3' end of the primary transcript, we recently showed that, in the case of many human small
RNAs, a single adenylic acid residue is added. The human small RNAs
processed and adenylated in this manner include human SRP RNA, 7 SK
RNA, U2 snRNA, and ribosomal 5 S RNA (10).
The signal recognition particle plays an important role in
translocation of membrane proteins and secretory proteins (Refs. 11-16; reviewed in Refs. 13-15). Human SRP is composed of a
300-nucleotide-long RNA component and six proteins (Ref. 17; reviewed
in Refs. 13 and 14). Human SRP RNA is transcribed by RNA polymerase III (18), and the 5' and 3' end portions of SRP RNA are over 80% homologous to the highly repeated Alu sequences in the primate genomes
(19-24). Studies have shown that the Alu sequence of the SRP RNA is
the progenitor of the highly repeated Alu interspersed elements (21,
25). It appears that Alu sequences arose from the removal of the middle
portion (S fragment) of the SRP RNA, reverse transcription, and
integration of the DNA into the genome (22, 25).
The SRP consists of two distinct functional domains. The first one is
the Alu domain consisting of the 5' and the 3' end portions of SRP RNA
associated with two proteins, the 9- and 14-kDa protein heterodimer
(26, 27). The 5' end of the Alu domain has a tRNA-like structure and
plays an important role in arresting the elongation of nascent peptide
in the ribosome (28, 29). The minimal domain necessary for binding with
9/14-kDa protein heterodimer is an 86-nucleotide-long domain including
5' end, 3' end, and stems III and IV (see Fig. 3, A and
B) in the Alu portion of SRP RNA (30). The second functional
domain consists of the SRP RNA-specific S fragment and four SRP
proteins. This domain is responsible for targeting the ribosome-nascent
peptide chain complex to the surface of rough endoplasmic reticulum by
interacting with SRP receptor (reviewed in Refs. 13 and 31). Recently,
Jacobson and Pederson (32) showed that SRP RNA, when injected into the
nucleoplasm, first migrates to the nucleolus and then to the cytoplasm.
Deletion analysis showed that the minimal domain necessary for
migration from the nucleoplasm to the nucleolus is an
86-nucleotide-long domain including 5' end, 3' end, stem III, and stem
IV in the Alu portion of SRP RNA (32). These studies show that the SRP motif involved in binding 9/14-kDa protein heterodimer and migration from nucleoplasm via the nucleolus on its way to cytoplasm is the same
(30, 32).
Maraia and colleagues (33) carried out studies on the biogenesis of Alu
RNA in primates including humans. In humans, the primary transcript of
Alu RNA is dimeric with left and right monomers. In some of the dimeric
Alu RNAs, only the left monomer but not the right monomer can bind the
SRP 9/14-kDa protein heterodimer with high affinity. The loss of Alu
right monomer affinity for SRP9/14 binding is associated with the
accumulation of Alu RNA in the cytoplasm containing only the left
monomer. Export of SRP RNA from the nucleus to the cytoplasm involves
Alu domain and Alu domain competes with SRP RNA in the nucleus for
limiting transport factors (34). These and other studies show that
common proteins bind to SRP and Alu RNAs, and it is likely that there
is a common maturation pathway for both Alu and SRP RNAs.
In this study, we show that the minimal domain necessary for 3' end
processing and adenylation is again an 87-nucleotide long domain
including 5' end, 3' end, stem III, and stem IV in the Alu portion of
SRP RNA. These data show that this tRNA-like domain of SRP RNA has
multiple functions in the biogenesis of SRP RNA, including binding of
9/14-kDa protein heterodimer, 3' end processing, adenylation, and
migration to the nucleolus on its way to the cytoplasm.
Chemicals and Isotopes--
[ In Vitro Synthesis and Purification of Substrate RNAs--
To
prepare the Human SRP RNA, DNA template amplified by PCR was
transcribed by T7 RNA polymerase. The SRP RNA obtained in this manner
contained three uridylic acid residues on the 3' end. Plasmid DNA
containing Alu portion of canine SRP RNA (p7Alu) under T7 promoter was
a gift from Dr. Katharina Strub (27). This Alu sequence was altered by
PCR in order to insert a DraI site on its 3' end and was
cloned into pUC19 vector by insertion into EcoRI and
HindIII sites. The Alu RNA was transcribed by T7 RNA polymerase from the DNA template linearized by DraI, and the
transcribed RNA contained three uridylic acids on the 3' end.
Alu161+7 and Alu161+11 RNAs were transcribed from
the plasmid DNA template linearized by HindIII and DNA
obtained by PCR amplification, respectively. All the deletion mutants
of Alu RNA were constructed by PCR-mediated mutagenesis and cloned into
pUC19 vector (Alu Preparation of HeLa Cell Nuclear Extract and in Vitro
Labeling--
Extracts were prepared from HeLa cells grown in
suspension culture by the procedure of Dignam et al. (35).
The final protein concentration of the extract was 5 mg/ml. For
in vitro labeling of RNAs, 5 µl of 10× in
vitro labeling buffer (6 mM each GTP, UTP, and CTP,
250 µM ATP, 10 mM dithiothreitol, 200 mM KCl, 60 mM creatine phosphate, and 100 mM Tris-HCl, pH 8.0), 40 µl of nuclear extract, and 50 µCi of [ Micrococcal Nuclease Treatment--
The micrococcal nuclease
treatment was done essentially as described by Parker and Steitz (36).
HeLa cell nuclear extract was incubated with micrococcal nuclease at a
concentration of 1 unit/µl in the presence of 0.75 mM
CaCl2 at 30 °C for 30 min. Micrococcal nuclease was
inactivated by the addition of 2.5 mM EGTA, and the extract
was then used for adenylation reactions.
Immunoprecipitations--
Immunoprecipitations were carried out
as described by Steitz (37). Alu RNA was incubated with 15 µl of HeLa
cell nuclear extract in the presence of [ In Vitro Processing--
Approximately 10 fmol of the internally
labeled Alu161, Alu161+7, and
Alu161+11 RNAs were incubated with 20 µl of HeLa cell nuclear extract in a total volume of 50 µl for different time periods. RNAs were purified and fractionated on a 10% polyacrylamide gel. The labeled RNAs were visualized by autoradiography.
Oocyte Injections--
Internally labeled RNAs containing about
10,000 cpm (100 fmol in 20-60 nl) were injected into the vegetal half
of the oocytes. Approximately same amount of radioactivity from each of
the in vitro synthesized RNAs were mixed so as to obtain
similar signal intensities on film during autoradiography. RNAs were
isolated using the procedure described by Fischer et al.
(38). After various periods of incubation, the oocytes were suspended
in homomedium (50 mM Tris-HCl, pH 7.5, 5 mM
EDTA, 1.5% SDS, 300 mM NaCl), and proteinase K was added
to a concentration of 1.5 mg/ml, mixed, and incubated for 15 min. at
37 °C. Labeled RNAs were extracted using phenol-chloroform procedure
and purified by precipitation with ethanol. The purified RNAs were
fractionated on 10% polyacrylamide gel/7 M urea gels,
dried, and subjected to autoradiography.
Determination of 3' End Adenylic Acid of SRP RNA--
An
oligonucleotide (5'-pGATCTGATAGTGTCACCTAAATGAATTCA*-3') with
3'-cordycepin (A*) was ligated to RNAs purified from the HeLa cells or
HeLa cell nucleoli. The nucleoli were prepared as described by Rothblum
et al. (39). A BglII restriction site would be
created if the 3' end nucleotide of the RNA is an adenylic acid. A
human SRP RNA-specific oligonucleotide (SRP RNA220,
5'-ACTCCCGTGCTGATCAGTAG-3') was used for PCR amplification. Internally
labeled PCR products were subjected to BglII digestion and
fractionated on a 10% polyacrylamide gel.
Adenylation of SRP RNA and Alu RNA in Vitro--
We showed
previously that SRP RNA present in the HeLa cell extract gets
adenylated when incubated in the presence of [
Digestion of adenylated SRP RNA or Alu RNAs with T1 RNase yielded a
single 6-nucleotide-long labeled UCUCUAOH fragment (Fig. 1B). Digestion with T2 RNase resulted in labeled Up both in
Alu RNA (Fig. 1C) and SRP RNA (data not shown). If more than
one adenylic acid was added to the 3' end of these RNAs, one would
expect to see radioactivity in both Up and Ap. Therefore, these data
show that a single adenylic acid residue is added to the 3' end of exogenously added SRP and Alu RNAs. This pattern of single adenylic acid residue addition is identical to the adenylation of endogenous SRP
RNA in HeLa cell extracts and adenylation of SRP RNA that occurs
in vivo (10). These data also show that RNAs synthesized in vitro by T7 RNA polymerase are accurately adenylated in
this in vitro adenylation system.
Alu RNAs with Longer 3' Ends Are Accurately Processed in
Vitro--
The Alu RNA synthesized in vitro and used as
substrate for adenylation was 161 nucleotides long with
UCUCUUUOH on its 3' end. We expected this RNA to yield
UCUCUUUAOH after adenylation reaction and subsequent
digestion with T1 RNase. Instead, it was surprising that Alu RNA
yielded UCUCUAOH after adenylation and digestion with T1 RNase (Fig.
1B). These data showed that from the Alu161 RNA
two uridylic acid residues, corresponding to positions 160 and 161, were removed prior to adenylation on the uridylic acid 159 of Alu RNA.
Similarly, SRP RNA added to the adenylation reaction contained three
uridylic acid residues on its 3' end, and two of these uridylic acid
residues were removed before the addition of adenylic acid on the 3'
end of SRP RNA.
To investigate this 3' end processing further, Alu RNAs with longer 3'
end sequences were prepared and incubated with HeLa cell nuclear
extract in the presence of [
The kinetics of the 3' end processing was studied using Alu+11 RNA
which was internally labeled (Fig. 2D). The processing in vitro was rapid, with 50% of the RNA processed within 5 min and was nearly complete in 1 h. These data indicate that Alu
RNA and Alu RNA with longer 3' ends are first processed and then
adenylated in the in vitro system. In addition, it appears
that 3' end processing is rapid in the in vitro system.
Determination of Minimal Cis-elements in Alu RNA Necessary for
Processing and Adenylation--
Since 161-nucleotide-long Alu portion
of SRP RNA was processed and adenylated, this RNA was used to carry out
deletion experiments to determine the domains essential for processing
and adenylation. Fig. 3 (A and
B) shows the schematic representation of SRP RNA, Alu161 RNA, and some of the mutant Alu RNAs tested in this
adenylation system. As expected, treatment of the HeLa cell nuclear
extract with micrococcal nuclease degraded endogenous SRP and other RNA substrates and these RNAs were not labeled in the presence of [ Stem IV of Alu RNA Is Required for 3' End Processing--
As shown
earlier, Alu161 RNA was first processed by removal of two
uridylic acid residues and then adenylated (see Fig. 2). We tested
whether 87-nucleotide-long RNA that gets adenylated and
73-nucleotide-long RNA that does not get adenylated can be processed or
not. The Alu Adenylated RNAs Are Associated with SRP Proteins--
It is
interesting to note that the minimal domain of Alu RNA required for 3'
end processing and adenylation is very similar, if not identical, to
that required for SRP 9/14 protein heterodimer binding (30). Deletion
of stem IV, which is important for binding of SRP 9/14 protein
heterodimer (33), completely abolished processing and adenylation.
Therefore, we tested whether adenylated SRP and Alu RNAs are associated
with SRP 9/14 protein heterodimer or not. After adenylation of SRP and
Alu RNAs in vitro in the presence of
[ Importance of 3' End Sequences for Adenylation--
Since the 3'
end sequence where the adenylation is occurring was found to be
important, several mutant RNAs were made and tested in the in
vitro adenylation system. A schematic representation of mutant Alu
RNAs is shown in Fig. 6A. We
already showed that deletion of 9 nucleotides near the 3' end
(Alu Adenylation Is an Early Event--
In mammalian cells, SRP RNA is
synthesized in the nucleoplasm by RNA polymerase III and is first seen
in the nucleolus before migrating to the cytoplasm (32). We tested
whether SRP RNA found in the nucleolus is adenylated or not. Total RNA
was isolated from HeLa cells and also from nucleoli purified from HeLa
cells. An oligonucleotide was ligated to these RNAs, and after a
quantitative RT-PCR, which selectively amplifies the 3' end portion of
SRP RNA, the resulting DNA was analyzed before and after digestion with
BglII restriction enzyme. The oligonucleotide ligated to the
SRP RNA was designed in such a way that only SRP RNA containing adenylic acid on the 3' end will be digested with BglII.
Data presented in Fig. 7 show that
approximately 35% of the nucleolar SRP RNA contained adenylic acid on
the 3' end (Fig. 7, lane 2) and 50% of the SRP
RNA in HeLa cells contained adenylic acid on the 3' end (Fig. 7,
lane 4). These data show that the 3' end
processing and adenylation of SRP RNA occurs in the nucleus, before SRP
RNA enters the cytoplasm.
The main observation made during this investigation is that an
87-nucleotide-long region, corresponding to the 5' and 3' regions out
of the 300-nucleotide-long mammalian SRP RNA, is necessary and
sufficient for accurate 3' end processing and adenylation. Studies from
other laboratories have shown that this domain of SRP RNA has a
tRNA-like structure and binds to two (9/14-kDa) SRP proteins (30). This
domain was also recently shown to be necessary and sufficient for
transport of SRP RNA from nucleoplasm to the nucleolus and then to the
cytoplasm (32). These data show that this domain of SRP RNA, in
addition to arresting translation of proteins containing the signal
peptide, which are destined for translocation across the endoplasmic
reticulum, has multiple functions. These functions include binding of
9/14-kDa SRP proteins, 3' end processing where extra sequences on the
3' end are removed, adenylation where a single adenylic acid residue is
added, and migration of SRP RNA from nucleoplasm, where SRP RNA is
synthesized, to nucleolus and then to the cytoplasm.
SRP RNA is synthesized by RNA polymerase III and terminates with four
uridylic acid residues on its 3' end. However, SRP RNA characterized
from several mammalian sources including human, rat,
Drosophila, and frog show that several of these uridylic acid residues on the 3' end are not present in most of the mature cytoplasmic SRP RNA molecules. In addition, a single
post-transcriptionally added adenylic acid residue is found in over
50% of the human and rat SRP RNA population (10). Data presented in
this paper describe an accurate in vitro system that removes
the terminal uridylic acid residues from exogenously added SRP/Alu RNAs
and adds one adenylic acid residue. It is interesting to note that Alu
RNAs with longer 3' ends containing 7 or 11 extra nucleotides were
accurately processed and then adenylated. We also used Alu RNAs with
~200 extra nucleotides on the 3' end, and this RNA was also
accurately processed and adenylated, though less efficiently (data not
shown). These data indicate that human cells have the ability to
accurately process and adenylate longer read-through SRP RNA
transcripts that failed to terminate at the first pol III termination
site. It is relevant to note that, in the case of human 5 S RNA genes,
read-through transcription in vivo through the first pol III
termination site is well documented (40). While there is no evidence
that longer read-through SRP RNA transcripts are actually made in
vivo, it is known that Alu RNAs are made as longer transcripts and
processed to yield mature Alu RNAs. Only the Alu RNA sequences capable
of binding SRP 9/14-kDa protein heterodimer were found to be processed
accurately and accumulated in the cytoplasm (33). These data are
consistent and support the results obtained during this investigation.
Although 300-nucleotide-long SRP RNA, 161-nucleotide-long Alu RNA, and
also the 87-nucleotide-long deletion mutant (Alu Fig. 8 shows a proposed pathway for the
biogenesis of SRP RNA. The SRP RNA is made in the nucleoplasm with four
uridylic acid residues on the 3' end. This RNA binds to SRP9/14-kDa
protein heterodimer, followed by removal of three uridylic acid
residues and adenylation. Since SRP RNA in the nucleolus is already
adenylated, it is clear that this processing and adenylation is
occurring in the nucleus. Whether it happens in the nucleoplasm or in
the nucleolus is not known. Purification of nucleoplasmic SRP RNA without nucleolar and/or cytoplasmic SRP RNA contamination is necessary
to answer this question. It is very likely that the processing and
adenylation pathway shown in Fig. 8 is common to SRP RNA and to Alu
RNAs.
The fact that SRP RNA in the nucleolus is already adenylated shows that
3' end processing and adenylation is an early and nuclear event in the
biogenesis of SRP particle. However, Alu RNAs injected into frog oocyte
cytoplasm were accurately processed indicating that machinery for 3'
end processing of SRP RNA can occur both in the nucleus and the
cytoplasm. It is known that the 3' ends of some RNAs, like human U6
snRNA, are constantly trimmed and rebuilt (41). The adenylic acid
residue added on the 3' end of SRP RNA also appears to be turning over
constantly. For example, Alu160A RNA, which has an adenylic
acid on the 3' end, was labeled in the in vitro adenylation
system by removal of unlabeled adenylic acid residue and replacement
with a labeled adenylic acid (Fig. 5B, lane
4). Therefore, it is possible that SRP RNA adenylated in the
nucleus is also adenylated in the cytoplasm during turnover. This
process is reminiscent of CCA turnover on the 3' end of tRNAs where
terminal nucleotides are constantly turning over. Although the
necessity of CCA turnover in tRNAs can be rationalized on the basis of
the need for complete CCA sequence for aminoacylation, the need for A
turnover in SRP is not known.
We investigated whether SRP/Alu RNA itself is the substrate or whether
binding of 9/14-kDa protein is required for Alu/SRP to be recognized as
a substrate for 3' end processing and adenylation. It is known that in
the case of U1, U2, and U4 snRNAs, precursor RNAs first associate with
snRNP proteins to form snRNPs and then get processed (1, 3, 5). It is
clear from the immunoprecipitation data shown in Fig. 4 that adenylated
SRP and Alu RNAs are bound to the 9/14-kDa proteins. The Alu RNA
substrate added to the adenylation reaction is in large excess compared
with the 9/14-kDa protein available in the HeLa cell extract (1 µg of
substrate RNA for 60 µg of total protein in the nuclear extract).
Therefore, if RNA alone is a suitable substrate for processing and
adenylation, only a small fraction of the adenylated RNA would be
immunoprecipitable. The fact that virtually all the adenylated Alu RNA
was precipitable under conditions of excess antibody strongly suggests
that 9/14-kDa protein binding is required for processing and
adenylation. This conclusion is consistent with the observation that
Alu RNA mutant Alu Adenylation in the 3' end is not unique to SRP RNA. Adenylation occurs
on the 3' end of many RNAs including human U2 snRNA, 7 SK RNA, and
ribosomal 5 S RNA (10). The 3' end processing of U1, U2, and U4 snRNAs
has been extensively characterized both in vitro and
in vivo using the frog oocyte system and transfection into
cells (1-9). In the case of U2 snRNA, processing and adenylation appear to be a late event where precursor RNA is first transported to
the cytoplasm for 3' end processing (5). Whether the adenylation of U2
snRNA occurs in the cytoplasm or the nucleus after import is not known.
In our in vitro adenylation system, the U2 snRNA and 7 SK
RNA were not good substrates for adenylation (data not shown). It is
possible that some essential binding proteins were missing in the HeLa
nuclear extract used for the adenylation reactions. It is not known
whether all these small RNAs are adenylated by a common adenylation
machinery or different enzymes are responsible for the adenylation of
other RNAs. Purification and characterization of the SRP RNA
adenylating enzyme will help answer this question.
We thank Rachana Dalia for technical
assistance, Minyone Finley for providing HeLa cells, Dr. Richard Maraia
for anti-SRP antibodies, and Dr. Katharina Strub for Alu plasmid DNA.
*
This work was supported by National Institutes of Health
Grant GM-52901.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
sn, small nuclear; PCR, polymerase chain reaction; SRP, signal recognition particle.
Accurate 3' End Processing and Adenylation of Human Signal
Recognition Particle RNA and Alu RNA in Vitro*
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-32P]ATP and
[-32P]CTP were purchased from Amersham Pharmacia
Biotech. All other chemicals including micrococcal nuclease and T2
RNase were obtained from Sigma. T1 RNase and Taq DNA
polymerase were purchased from Life Technologies, Inc. T7 RNA
polymerase and all other restriction enzymes were obtained from New
England Biolabs. The TA cloning kit was from Invitrogen, and the PCR
DNA product purification kit was from QIAGEN.
1-23, Alu 60-147) or TA cloning vector
PCRTM 2.1 (Invitrogen) (Alu 68-141). Alu 1-23 and
Alu 60-147 RNAs were transcribed by T7 RNA polymerase from the
plasmid DNA template linearized by DraI. Alu 68-141+10
RNA was transcribed from the plasmid DNA template digested by
EcoRI. Alu 151-159, Alu 68-141, and Alu 60-147+9
RNAs were transcribed from DNA prepared by PCR. All the Alu mutants
with 3' end variations were constructed by PCR-mediated mutagenesis,
and the RNAs were transcribed directly from the PCR DNA product.
Alu159 construct was cloned into pUC19 vector, and
Alu159 RNA was made by T7 RNA polymerase transcription of
DNA plasmid linearized by DraI. The in vitro
transcription with T7 RNA polymerase was performed according to
standard protocol (New England Biolabs). All RNA products were purified
by fractionation on a 10% polyacrylamide gel, extracted from the gel,
and purified by precipitation with ethanol. The concentration of the
RNAs was determined by optical density measurements at 260 nm.
-32P]ATP were mixed in a total reaction
volume of 50 µl and incubated at 30 °C for 3 h. The amount of
in vitro synthesized Alu RNA used as substrate for
adenylation assay was ~1 µg (20 pmol). In the case of other RNAs,
correspondingly more or less amount of in vitro synthesized
RNAs were added for adenylation assay to keep the amount of substrate
RNAs at 20 pmol in each reaction. Labeled RNAs were extracted using
phenol-chloroform procedure, purified, and fractionated on 10%
polyacrylamide, 7 M urea gels. Whenever necessary, the
labeled RNAs were excised from the gel, eluted, and purified. These
RNAs were then digested with different enzymes and analyzed by
chromatography and/or size fractionation on 20% polyacrylamide gels
containing 7 M urea.
-32P]ATP in a
total volume of 50 µl. One microliter of the labeled extract was
immunoprecipitated with different amounts (20 and 50 µl) of anti-SRP
9-kDa protein antibodies (kindly provided by Dr. Maraia, National
Institutes of Health, Bethesda, MD) or anti-bovine serum albumin
antibodies as negative control. RNAs from the starting material,
supernatant, and immunoprecipitate were purified and separated on 10%
polyacrylamide gel.
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-32P]ATP
(Ref. 10; also see Fig. 1,
lane 1). In this study, we standardized an
in vitro adenylation system that is dependent on the
addition of exogenous SRP RNA or Alu RNA. First, the HeLa cell extract
was treated with micrococcal nuclease and the nuclease was inactivated
by the addition of EGTA. This HeLa cell extract digested with
micrococcal nuclease was unable to adenylate any endogenous RNAs since
the substrate RNAs were degraded by the nuclease (Fig. 1,
lane 2). There is some residual tRNA resistant to
micrococcal nuclease treatment. This may be due to secondary structure
of tRNAs and/or association with protein(s). Addition of SRP RNA
resulted in labeling of exogenously added SRP RNA (Fig. 1,
lane 3). The 161-nucleotide-long Alu portion of
SRP RNA (designated Alu RNA) also served as a substrate for adenylation
(Fig. 1, lane 4). We also tested other RNAs as
substrates for adenylation in this system. Human U6 snRNA or human U4
snRNA were not adenylated under these conditions. (Fig. 1,
lanes 5 and 6, respectively). These
data show that SRP and Alu RNAs synthesized in vitro serve as substrates for adenylation. In addition, the adenylation is not
random since U4 or U6 snRNAs were not adenylated under the same
conditions. Since micrococcal nuclease-treated HeLa cell extract is
capable of adenylating exogenously added SRP RNA, the adenylating
enzyme(s) do not appear to contain any essential nucleic acid
component.
View larger version (22K):
[in a new window]
Fig. 1.
A, adenylation of SRP RNA and Alu RNA.
HeLa cell nuclear extract treated with micrococcal nuclease was
prepared as described under "Materials and Methods." The SRP and
Alu RNAs were prepared by transcription with T7 RNA polymerase of
appropriate DNA templates. The adenylation in vitro was
carried out in the presence of [ -32P]ATP as described
under "Materials and Methods." The labeled RNAs were purified,
separated on a 10% polyacrylamide gel, dried, and subjected to
autoradiography. B, analysis of 3' end sequences of SRP and
Alu RNAs. Labeled SRP RNA from lane 1 of
panel A and Alu RNA from lane
4 of panel A were purified, digested
with T1 RNase, fractionated on a 20% polyacrylamide gel, dried, and
subjected to autoradiography. Lane M, size
markers. C, analysis of 3' end nucleotide of SRP and Alu
RNAs. Labeled SRP RNA from lane 1 of
panel A and Alu RNA from lane
4 of panel A were purified, digested
with T2 RNase, and subjected to two-dimensional chromatography (42).
The first dimension was isobutyric acid/water/ammonium hydroxide
(66/33/1, v/v/v), and the second dimension was 0.1 M sodium
phosphate buffer, pH 6.8/ammonium sulfate/n-propanol
(100/60/2, v/w/v).
-32P]ATP. Since Alu RNA
migrates differently from the endogenous SRP RNA, the HeLa cell extract
used in this experiment was not treated with micrococcal nuclease.
Three RNAs were used as substrates in this assay including Alu RNA with
UCUCUUUOH on its 3' end and two other RNAs with 7 (designated Alu+7 RNA) or 11 additional nucleotides (designated Alu+11
RNA) on the 3' end of Alu RNA. As expected, these three RNAs migrated
differently on a 10% polyacrylamide gel (Fig.
2A, lanes
1-3). However, when these three RNAs were incubated with
the HeLa cell extract, only labeled RNAs with similar electrophoretic
mobility were obtained (Fig. 2B). T1 RNase digestion of
these RNAs yielded only one labeled fragment corresponding to
UCUCUAOH (Fig. 2C). After 3 h of incubation
with HeLa cell nuclear extract, significant quantities of Alu+7 and
Alu+11 RNAs were still detectable by staining with methylene blue at
the end of adenylation reaction (data not shown). There was no
consistent difference in the efficiency of adenylation between Alu+7
and Alu+11 RNAs. Since longer adenylated products were not detected (see Fig. 2, B and C), it appears that only Alu
RNA molecules that are completely processed on the 3' end are used as
substrates for adenylation.
View larger version (15K):
[in a new window]
Fig. 2.
A, fractionation of Alu RNA and Alu RNAs
with extra nucleotides on the 3' end. Alu RNA and Alu RNAs with extra
nucleotides on the 3' end were fractionated on a 10% polyacrylamide
gel and visualized by staining with methylene blue. B,
adenylation of Alu RNA and Alu RNAs with extra nucleotides on the 3'
end. Different RNAs (shown above each lane) were incubated with HeLa
nuclear extract with [ -32P]ATP for 3 h. Purified
RNAs were separated on a 10% polyacryl amide gel, dried, and subjected to autoradiography.
Black arrowheads refer to the position of the
unlabeled Alu+7 and Alu+11 RNAs visualized by staining with methylene
blue. C, analysis of 3' end sequence of adenylated Alu RNAs.
Labeled SRP RNA from panel B (lane 1)
and Alu RNAs from panel B (lanes
2, 3, and 4) were purified, digested
with T1 RNase, separated on a 20% polyacrylamide gel, dried, and
subjected to autoradiography. D, processing of Alu+11 RNA
in vitro. Uniformly labeled Alu+11 RNA was incubated with
HeLa cell nuclear extract for different time periods, as indicated on
the top of each lane. RNAs were purified, fractionated on a 10%
polyacrylamide gel, dried, and subjected to autoradiography.
Lanes 1 and 2 are uniformly labeled
Alu and Alu+11 RNAs used as size markers.
-32P]ATP (Fig. 3C, lane
2). Addition of Alu161 RNA resulted in adenylated RNA (Fig. 3C, lane 3); however, in the
case of Alu RNA with a 5'-deletion (lane 4) or a
3'-deletion (lane 5), there was no detectable adenylated product. An 87-nucleotide-long Alu RNA (Alu68-141), where nucleotides 68-141 were removed, was adenylated (Fig.
3C, lane 6). Further deletion,
resulting in a 73-nucleotide-long RNA (Alu60-147) where integrity
of stem IV was disrupted, resulted in complete absence of adenylation
(Fig. 3C, lane 7). These data show
that a large central portion of Alu RNA is dispensable and both the 5'
and 3' end sequences are necessary for adenylation. In addition,
integrity of stem IV is also essential for adenylation. It is notable
that 87-nucleotide-long Alu RNA with intact stem IV binds SRP 9/14-kDa
protein heterodimer, whereas 73-nucleotide-long RNA with deletion of
stem IV does not bind SRP 9/14-kDa protein heterodimer (30). These data
show that structural features necessary for the binding of SRP 9/14-kDa
protein heterodimer are also important for adenylation of Alu RNA.
View larger version (31K):
[in a new window]
Fig. 3.
A, secondary structure of SRP RNA. A
schematic representation of mammalian SRP RNA is shown. The region
shown in red represents the Alu portion of SRP RNA, and the
dark green portion represents the S fragment of
SRP RNA. Domains I-IV are regions in SRP RNA that are protected from
hydroxyl radical cleavage from SRP9/14 protein heterodimer (27).
B, primary and secondary structure of Alu RNA and its
deletion mutants. The primary and secondary structure of some Alu RNAs
used for studies on 3' end processing and adenylation. [//] refers to
the site where deletions were made. C, adenylation of Alu
RNA and its deletion mutants. RNAs indicated above each lane were
incubated in micrococcal nuclease-treated HeLa cell nuclear extract
with [ -32P]ATP for 3 h. Lane
1 is control where no RNAs were added and the extract was
not treated with micrococcal nuclease. The RNAs were extracted,
purified, and fractionated on a 10% polyacrylamide gel.
68-141 and Alu60-147 RNAs with 10 and 9 additional
nucleotides, respectively (designated Alu68-141+10 RNA and
Alu60-147+9 RNA), were injected into frog oocytes, and the 3' end
processing was studied (Fig. 4). The
Alu68-141+10 RNA was processed in a time-dependent
manner to yield an RNA that migrates similar to 87-nucleotide-long RNA
(Fig. 4, lanes 1-4). The Alu60-147+9 RNA was
not processed since there was no detectable 73-nucleotide-long RNA even
18 h after injection (Fig. 4, lanes 1-4).
Similar results were obtained when the experiment was performed using
HeLa cell nuclear extract (data not shown). Since the only difference
between these two constructs is the presence of stem IV in
Alu68-141 RNA and absence of intact stem IV in Alu60-147 RNA,
it is concluded that stem IV of Alu RNA is required both for 3' end
processing and adenylation.
View larger version (45K):
[in a new window]
Fig. 4.
The 3' end processing of Alu RNA in
Xenopus oocytes. Labeled RNAs were microinjected into
the cytoplasm of frog oocytes. After different periods of incubation,
the oocytes were lysed and RNAs extracted, purified, and fractionated
on a 10% polyacrylamide gel. Alu RNAs, Alu 68-141 and Alu60-141
RNA, were run as markers in lane 5.
-32P]ATP, immunoprecipitations were carried out with
anti-SRP 9 antibodies. Both endogenous SRP RNA and exogenously added
Alu RNA were adenylated and were found in the immunoprecipitates
obtained with anti-SRP9 protein antibodies. Approximately 20% of the
adenylated SRP and Alu RNAs were immunoprecipitated when 20 µl of the
anti-SRP9 antibodies was used (Fig. 5,
lanes 1 and 2), and this percentage
increased to about 50% when the amount of antibody was increased to 50 µl (Fig. 5, lanes 3 and 4). Under
conditions of antibody excess, virtually all the adenylated SRP and Alu
RNAs were found in the immunoprecipitates obtained with anti-SRP9
protein antibodies (data not shown). Uniformly labeled Alu60-147
RNA, which cannot bind SRP9/14 heterodimer, was also used as a control,
and no detectable radioactivity was found in immunoprecipitates
obtained with anti-SRP9 antibodies (data not shown). These data show
that adenylated SRP and Alu RNAs are associated with SRP 9/14
heterodimer.
View larger version (45K):
[in a new window]
Fig. 5.
Immunoprecipitation of adenylated SRP and Alu
RNAs by anti-SRP9 antibodies. Different amounts of antibodies were
used as indicated at the top of each lane. Anti-bovine serum
albumin antibody was used here as a negative control. The entire sample
found in the supernatants and immunoprecipitates was loaded on the gel.
Lanes 1, 3, and 5 were
samples from supernatants, and lanes 2,
4, and 6 were samples from
immunoprecipitates.
151-159) completely abolished adenylation (Fig. 3C,
lane 5). RNAs terminating with A or C instead of
U at position 160 (Fig. 6B, lanes 4,
5, and 6, respectively), were recognized as
substrates for adenylation, and in every case RNAs adenylated at
position 160 were observed. Disruption of base pairing in stem III of
Alu RNA, where one G:C base pair was disrupted (Fig. 6B,
lane 7) or changed from G:C to G:U (Fig.
6B, lane 3), did not inhibit the adenylation;
however, further disruption of base pairing in stem III (Fig.
6B, lanes 9 and 10),
abolished adenylation completely. In RNAs where adenylation was
observed, the 3' end fragment obtained upon T1 RNase digestion was
UCUCUAOH (Fig. 6C, lanes
1-6). As to be expected, in the case of Alu158C
G RNA, the T1 RNase digestion product was UAOH (Fig. 6C, lane 7). The adenylated mutant Alu
RNAs (Fig. 6B, lanes 3-8) were also
digested with T2 RNase, and, in every case, only labeled Up was
observed (data not shown). These data show that all longer RNAs were
first processed and the adenylation occurred accurately at uridylic
acid 159 of mutant Alu RNAs.
View larger version (33K):
[in a new window]
Fig. 6.
A, diagrammatic representation of Alu
variants with 3' end nucleotide(s) changes. Residue(s) marked with
red are changed nucleotide(s). The `+' symbol represents
the Alu variants that can be adenylated, and ` 
' represents those
RNAs that cannot be adenylated. B, adenylation of Alu RNA
and Alu variants. Alu RNAs with 3' end variations were constructed by
PCR and transcribed by T7 RNA polymerase. RNAs were incubated with
[-32P]ATP in HeLa cell nuclear extract for 3 h,
extracted, and fractionated on a 10% polyacrylamide gel. C,
analysis of 3' end sequence of adenylated Alu RNA and Alu variants.
Adenylated Alu RNA and Alu RNAs with 3' end variation were eluted from
polyacrylamide gel and subjected to T1 RNase digestion. The digestion
products were fractionated on a 20% polyacrylamide gel, dried and
subjected to autoradiography.
View larger version (50K):
[in a new window]
Fig. 7.
Quantitation of adenylated SRP RNA from
nucleoli and whole cells. An oligonucleotide was ligated to RNAs
purified from nucleoli (lanes 1 and 2)
and from whole cells (lanes 3 and 4).
A BglII site would be generated if the 3' end was an A. The
oligonucleotide complementary to the oligonucleotide ligated to the 3'
end if the RNAs, and the oligonucleotide corresponding to SRP RNA
sequence (220-240), were used for PCR amplification. The PCR-amplified
products were digested with restriction enzyme BglII. The
digestion products were fractionated on a 10% non-denaturing
polyacrylamide gel, dried, and subjected to autoradiography.
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
68-141) were all
processed and adenylated, the efficiencies of adenylation were
dramatically different. The SRP RNA was the least efficient and
Alu68-141 was the most efficient. The adenylation efficiency of Alu
RNA was consistently better than SRP RNA (Fig. 1, lanes 3 and 4; Fig. 3C, lanes
3 and 6). The reason for this might be that
smaller RNAs may renature and acquire native conformation much more
readily compared with longer RNAs.
View larger version (14K):
[in a new window]
Fig. 8.
A model for the processing and adenylation of
SRP RNA. The secondary structure of SRP and Alu RNAs has been
studied by several investigators (for review, see Ref. 13). SRP 9/14
protein heterodimer was shown to bind in this region of SRP RNA (30,
43); however, the relative size and actual sites of binding of SRP 9/14
protein heterodimer in this portion is shown only for the purpose of
illustration.
60-147, which cannot bind 9/14-kDa protein
heterodimer, was neither processed nor adenylated (Fig. 3D).
Only Alu RNAs capable of binding SRP 9/14-kDa protein heterodimer
accumulate in the cytoplasm of HeLa cells (33). Together, these data
show that SRP RNA first binds to the 9/14-kDa heterodimer, three
uridylic acid residues are removed, and then a single adenylic acid
residue is added in the nucleus.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Dept. of Pharmacology,
Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Tel.:
713-798-7096; Fax: 713-798-3145; E-mail: rreddy{at}bcm.tmc.edu.
REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  B. J. Krueger, C. Jeronimo, B. B. Roy, A. Bouchard, C. Barrandon, S. A. Byers, C. E. Searcey, J. J. Cooper, O. Bensaude, E. A. Cohen, et al. LARP7 is a stable component of the 7SK snRNP while P-TEFb, HEXIM1 and hnRNP A1 are reversibly associated Nucleic Acids Res., April 1, 2008; 36(7): 2219 - 2229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Roy-Engel, A.-H. Salem, O. O. Oyeniran, L. Deininger, D. J. Hedges, G. E. Kilroy, M. A. Batzer, and P. L. Deininger Active Alu Element "A-Tails": Size Does Matter Genome Res., September 1, 2002; 12(9): 1333 - 1344. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Maraia La Protein and the Trafficking of Nascent RNA Polymerase III Transcripts J. Cell Biol., May 14, 2001; 153(4): F13 - F18. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Grosshans, K. Deinert, E. Hurt, and G. Simos Biogenesis of the Signal Recognition Particle (SRP) Involves Import of SRP Proteins into the Nucleolus, Assembly with the SRP-RNA, and Xpo1p-mediated Export J. Cell Biol., May 7, 2001; 153(4): 745 - 762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Pederson and J. C. Politz The Nucleolus and the Four Ribonucleoproteins of Translation J. Cell Biol., March 20, 2000; 148(6): 1091 - 1096. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Politz, S. Yarovoi, S. M. Kilroy, K. Gowda, C. Zwieb, and T. Pederson Signal recognition particle components in the nucleolus PNAS, January 4, 2000; 97(1): 55 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Sinha, K. Perumal, Y. Chen, and R. Reddy Post-transcriptional Adenylation of Signal Recognition Particle RNA Is Carried Out by an Enzyme Different from mRNA Poly(A) Polymerase J. Biol. Chem., October 22, 1999; 274(43): 30826 - 30831. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Perumal, K. Sinha, D. Henning, and R. Reddy Purification, Characterization, and Cloning of the cDNA of Human Signal Recognition Particle RNA 3'-Adenylating Enzyme J. Biol. Chem., June 8, 2001; 276(24): 21791 - 21796. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |