|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 35161-35169, December 25, 1998
From the § Department of Medicine (Rheumatology),
Medical College of Wisconsin and the Blood Research Institute,
Milwaukee, Wisconsin 53226, the ¶ Lineberger Comprehensive
Cancer Institute, University of North Carolina,
Chapel Hill, North Carolina 27599, the Synovial fluid basic calcium phosphate (BCP)
crystals are markers of severe joint degeneration in osteoarthritis.
BCP crystals cause mitogenesis of articular cells and stimulate matrix
metalloprotease production, thus promoting degradation of articular
tissues. Previous work suggested that BCP crystal-induced cell
activation required intracellular crystal dissolution, induction of
proto-oncogene expression, and activation of signal transduction
pathways involving protein kinase C and mitogen-activated protein
kinases. Here we further elucidate the mechanisms of BCP
crystal-induced cell activation as BCP crystals activate transcription
factors nuclear factor Synovial fluid basic calcium phosphate
(BCP)1 (hydroxyapatite,
octacalcium phosphate, and tricalcium phosphate) crystals are common in
osteoarthritis (OA) and are associated with severe degenerative arthropathies (1). The prevalence of BCP crystals in synovial fluid
from patients with knee OA is between 30 and 60%, and their presence
correlates strongly with radiographic evidence of cartilage degeneration (2). Larger joint effusions are seen in affected joints
when compared with joint fluid from OA knees without BCP crystals
(3).
Clinical and pathological studies have demonstrated that synovial
lining proliferation of varying degrees is associated with BCP crystals
in osteoarthritis (4). BCP crystals themselves are at least partly
responsible for such proliferation since they stimulate cell
replication in vitro (5). Increased cellularity in the
synovial lining enhances the capacity for secretion of cytokines, which
may promote chondrolysis. Non-inflammatory destruction of matrix-rich
articular structures including cartilage, ligament, and tendon is also
characteristic of BCP crystal deposition (1). BCP crystals promote
tissue damage by induction of matrix metalloprotease (MMP) synthesis
and secretion. Since there are no available drugs to inhibit deposition
or affect reabsorption of these crystals, prevention of the biological
consequences of the destructive processes initiated by BCP crystals is
an attractive therapeutic strategy.
The in vitro effects of BCP crystals emphasize their
pathogenic potential. BCP crystals induce mitogenesis in cultured
fibroblasts (5, 6). However, mechanisms by which BCP crystals induce mitogenesis have been incompletely studied. Endocytosis and
intracellular dissolution of the crystals, producing an elevated
cytoplasmic calcium concentration, are important (7). BCP crystals
activate a protein kinase signal transduction pathway involving p42 and p44 mitogen-activated protein (MAP) kinases (8). Current data suggest
that BCP crystals enhance phospholipase C activity in synovial
fibroblasts (9). If BCP crystals increase phospholipase C activity,
resultant diacylglycerol accumulation followed by increased protein
kinase C (PKC) activity should ensue. This postulate is supported in a
study by Mitchell et al. (6) who found that BCP
crystal-induced mitogenesis in Balb/c/3T3 fibroblasts was inhibited
when PKC was down-regulated using the tumor-promoting phorbol ester,
12-O-tetradecanoyl-phorbol 13-acetate (TPA), an analogue of
diacylglycerol. Another index of PKC activation is translocation of the
enzyme from the cytosolic compartment to the membrane compartment of
the cell, and we have shown increased membrane-associated PKC activity
in porcine chondrocytes treated with BCP crystals (10). These data
suggest that the mitogenic response to BCP crystals involves activation
of PKC. However, BCP crystal-induced activation of PKC in human
cultures has not been reported.
A potentially important pathway of crystal-induced cell activation
involves transcription factor, nuclear factor Alternatively, crystal-induced mitogenesis may derive from other
pathways. The cellular effects of many growth-promoting agents are
mediated by high affinity receptor protein tyrosine kinases (PTK) (14).
In mammalian cells, the binding of ligand to the extracellular domain
induces tyrosine phosphorylation of the cytoplasmic domain. This leads
to recruitment and downstream activation of a number of common
signaling molecules including PTK and phosphatidylinositol 3-kinase
(PI3 kinase) (15). Phosphoinositides play a key role in signal
transduction, and the 3-phosphoinositide pathway has been implicated in
growth factor-dependent mitogenesis (16). Production of
3-phosphoinositides requires PTK-mediated recruitment and activation of
PI3 kinase (15). Calcium pyrophosphate dihydrate (CPPD) and monosodium
urate crystals induce protein tyrosine phosphorylation in human
neutrophils (17). PI3 kinase is also involved in CPPD and monosodium
urate crystal-induced neutrophil activation (18), but the role of
either in BCP crystal-induced activation of neutrophils, fibroblasts,
or chondrocytes has not been reported.
Transduction pathways resulting in protease synthesis and secretion are
likely active in BCP crystal-induced arthritis. Probable effectors of
tissue damage from BCP crystals are MMPs, including collagenase-1
(MMP-1), stromelysin (MMP-3), 92-kDa gelatinase (gelatinase B/MMP-9),
and collagenase-3 (MMP-13) (19-21). The collagenase promotor contains
a cis element termed the TPA response element (TRE), which
is involved in increased transcription in response to agonists
including tumor necrosis factor In the present study, we demonstrate that the mitogenic response to BCP
crystals is associated with PKC activation in HF and NF- Materials
The monoclonal anti-PKC antibody MC-5, which recognizes Cell Culture
A model system of human foreskin fibroblast (HF) cultures was
used for these experiments since HF responses to BCP crystals have been
shown to be similar to those of synovial fibroblasts (5). HF cultures
were established from explants and transferred as described previously
(28). They were grown and maintained in DMEM supplemented with 10% FBS
containing 1% penicillin, streptomycin, and Fungizone (PSF). All
experiments were performed on confluent cell monolayers that had been
rendered quiescent by removing the media, washing with DMEM alone, and
subsequently incubating in DMEM containing 0.5% FBS and 1% PSF for
24 h. All cultures used were 3rd or 4th passage cells.
Balb/c/3T3 (American Type Culture Collection, Rockville, MD) cultures
were grown and maintained in DMEM with 10% Colorado calf serum and 1%
penicillin/streptomycin. When approximately 70% confluent, cultures
were rendered quiescent by incubating in DMEM containing 0.5% Colorado
calf serum for 24 h prior to experiments.
NIH 3T3 cells (American Type Culture Collection) were cultured in DMEM
supplemented with 10% bovine calf serum and 1%
penicillin/streptomycin.
Determination of Mitogenesis by Uptake of
[3H]Thymidine
Cells were grown to confluence in 24-well plates and rendered
quiescent by incubation in 0.5% FBS for 24 h.
[3H]Thymidine (1 µCi/ml) was added to the wells 23 h after the addition of 10% FBS, TPA (200 nM), or BCP
crystals (18 µg/cm2) in the presence or absence of
varying concentrations of staurosporine and pulse-labeled for 1 h.
Control cultures were in 0.5% FBS with or without varying
concentrations of staurosporine. The cells were then washed 3 times
with phosphate-buffered saline (PBS), and macromolecules were
precipitated with 5% trichloroacetic acid solution. The precipitate
was washed again with PBS and dissolved in 1 ml 0.1 N NaOH,
1% SDS. Levels of trichloroacetic acid-precipitable 3H
were determined in triplicate, using a liquid scintillation counter
(Packard Instruments, Downers Grove, IL).
Crystal Synthesis and Preparation
BCP crystals were synthesized by a modification of published
methods (29). Mineral prepared by this method has a calcium/phosphate molar ratio of 1.59 and contains partially carbonate-substituted hydroxyapatite with admixed octacalcium phosphate shown by Fourier transform infrared spectroscopy. The crystals were crushed and sieved
to yield 10-20-µm aggregates, which were sterilized and rendered
pyrogen-free by heating at 200 °C for 90 min. Heating to 200 °C
did not alter the crystal character or the relationship of
hydroxyapatite and octacalcium phosphate, as confirmed by x-ray diffraction and Fourier transform infrared spectroscopy. Crystals were
weighed and suspended by sonication in Dulbecco's modified Eagle's
medium (DMEM). The crystal suspension was sonicated again just prior to
use. The amounts of crystals used were determined based on our previous
studies of dose-response relationships between BCP crystals and the
mitogenic response (5). In those studies, maximal mitogenic responses
were achieved with BCP levels of 50-100 µg/ml. These levels are
equivalent to concentrations of BCP crystals found in pathologic joint fluids.
Extract Preparation
Cells were washed in PBS and lysed in E buffer (0.3% Nonidet
P-40, 10 mM Tris, pH 8.0, 60 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride (PMSF)) by 5 min of incubation on ice.
Nuclei were pelleted by spinning for 5 min at 2,500 rpm at 4 °C in
an Eppendorf microcentrifuge, and the supernatant was saved as the
cytoplasmic extract prior to SDS-PAGE through 10% polyacrylamide gels
(30). Glycerol was added to cytoplasmic extracts to a final
concentration of 20%, after which the extracts were stored at
DNA Binding Reactions and Electrophoretic Mobility Shift Analysis
(EMSA)
EMSA was performed using a radiolabeled probe, UV 21, designed
for cross-linking studies. This probe is derived from a template oligonucleotide UV1 (CAGGGCTGGGGATTCCCCATCTCCACAGTTTCACTTC)
corresponding to bases Northern Blot Analysis
Northern blot analysis of total cellular RNA was used to study
the expression of c-fos and c-jun mRNA in HF
after stimulation with BCP crystals in the presence or absence of the
PKC inhibitor staurosporine. Confluent, quiescent monolayer cultures of
HF in 100-mm plates were washed twice with cold PBS 24 h after
treatment. Total RNA was recovered by precipitation with 4 M LiCl as described by Cathala et al. (33). Five
micrograms of total cellular RNA was fractionated on a 1.2%
agarose-formaldehyde gel; ribosomal RNA was visualized with ethidium
bromide, and the fractionated RNA was transferred to nitrocellulose
filters (34). Hybridization of the filters with DNA probes was
performed overnight at 42 °C. Probes were labeled using the random
primer method, and [ PKC Translocation
Confluent cultures of HF grown in 100-mm plates were washed
twice in cold PBS and then harvested in 1.5 ml of translocation buffer
(20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 0.5 mM EGTA, 0.2 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 0.33 M sucrose) (36). Cells were
sonicated on ice for 15 s and then centrifuged at 100,000 × g for 45 min. The supernatant was used as the cytosolic fraction. The pellet was then dissolved in 0.5 ml of translocation buffer containing Triton X-100 (0.1% w/v), shaken at 4 °C
overnight, and then centrifuged at 100,000 × g for 45 min. The supernatant was used as the membrane fraction. Samples (20 µl) of cytosolic and membrane fractions were subjected to SDS-PAGE in
10% polyacrylamide gels.
PKC Activity Assay
Plates were washed 2 times in cold PBS and then scraped into 1 ml of buffer A (0.3 M sucrose, 50 mM Tris-HCl,
pH 7.5, 5 mM EDTA, 10 mM EGTA, 0.3%
Western Blotting
After electrophoresis, proteins were electrophoretically
transferred to nitrocellulose membranes overnight at 4 °C. After transfer, the membranes were blocked in 2.5% non-fat dry milk in
Tris-buffered saline (TBS) (20 mM Tris, 500 mM
NaCl, pH 7.5). The membranes were washed twice with Tween 20 wash
solution (20 mM Tris, 500 mM NaCl, 0.05% Tween
20) (TTBS). The membranes were then incubated for 1 h with
antibody buffer (0.1% non-fat dry milk-TTBS) containing a 1:500 or
1:1000 dilution of primary antibodies. The blots were then washed with
TTBS and incubated with a 1:1000 dilution of biotin-conjugated goat
anti-mouse or anti-rabbit IgG for 1 h. The blots were washed with
TTBS and incubated with a 1:1000 dilution of alkaline
phosphatase/streptavidin for 1 h. Membranes were washed twice with
TTBS and once with TBS. Immunoreactive bands were detected using
enhanced chemiluminescence reagents (ECL) (Amersham Pharmacia Biotech).
Protein Tyrosine Kinase and PI3 Kinase Analysis
Lysis and Immunoprecipitation--
Adherent fibroblasts in
100-mm plates were solubilized in 1 ml of lysis buffer (50 mM HEPES, pH 7.4), 150 mM NaCl, 10 mM NaCl, 10 mM EDTA, 200 mM NaF, 20 mM NaP2O7, 10% glycerol, 1%
Triton X-100) supplemented with 20 µg/ml aprotinin, 20 µg/ml
leupeptin, 1 mM benzamidine, 1 mM
Na3VO4, and 1 mM PMSF. The
Triton-insoluble fraction was pelleted by centrifugation at 15,000 × g for 4 min at 4 °C. The supernatants were incubated
with equal amounts of the appropriate antibodies for 2 h at
4 °C, and the antibody immunoprecipitates were collected on protein
G-agarose for an additional hour. Immune complexes were washed twice
with lysis buffer, twice with 100 mM Tris, pH 7.6, 500 mM LiCl, and twice with TNE buffer (10 mM Tris,
pH 7.4, 100 mM NaCl, 1 mM EDTA). All washes
were supplemented with 20 µg/ml aprotinin, 20 µg/ml leupeptin, 1 mM Na3VO4, and 1 mM
PMSF. For PI3 kinase assay, immune complexes were analyzed as described
below. For gel electrophoresis and immunoblotting, immune complexes
were solubilized in 2× concentrated SDS-containing sample buffer,
separated by SDS-PAGE, and electrophoretically transferred to
Immobilon-P membrane (Millipore Corp., Bedford, MA). Immunoreactive
proteins were detected by ECL as above.
Phosphatidylinositol 3-Kinase Assay--
Washed anti-PI3K
immunoprecipitates were incubated on ice for 10 min in 20 µl of a
sonicated substrate mixture containing PtdIns(4,5)P2 and
phosphatidylserine (1:1) at a concentration of 0.5 mg/ml in 20 mM HEPES, pH 7.4. Reactions were initiated by addition of
20 µl of kinase buffer containing 20 mM HEPES, pH 7.4, 50 mM MgCl2, 50 µM ATP, 20 µCi of
[ Statistics
Statistical analysis was performed using the Wilcoxon Rank Sum
test (40).
BCP Crystals Cause PKC Translocation--
PKC activation is
associated with translocation of the enzyme from the cytosolic to the
membrane fraction of the cell. The addition of BCP crystals (18 µg/cm2) or TPA (200 nM) to HF cultures in
0.5% FBS/DMEM caused translocation of an upper band, immunoreactive
with the monoclonal anti-PKC antibody (clone MC5), from the cytosolic
compartment to the membrane compartment of HF harvested 15 min after
treatment (Fig. 1). Treatment of HF with
IL-1 (50 ng/ml) showed no such effect. Translocation of the
immunoreactive band was maximal when cells were harvested 10 min after
treatment with BCP crystals and returned to control levels within 30 min after stimulation (Fig. 2).
Inhibition of BCP Crystal-induced HF Mitogenesis by the PKC
Inhibitor Staurosporine--
By using [3H]thymidine
incorporation as an index of mitogenesis, we demonstrated a 5-fold
increase in [3H]thymidine incorporation in HF cultures
treated with BCP crystals (25 µg/cm2) compared with that
of control HF cultures incubated with 0.5% FBS alone after 24 h
(Fig. 3). Staurosporine, which inhibits
PKC by interacting with the catalytic domain, attenuated the mitogenic response of HF to BCP crystals in a concentration-dependent
fashion. Similarly, the phorbol ester TPA (200 nM), a known
activator of PKC, caused a 21/2-fold increase in
[3H]thymidine incorporation in HF cultures. Staurosporine
inhibited the mitogenic response to TPA in a
concentration-dependent manner. When HF were incubated with
staurosporine alone, there was a modest increase in
[3H]thymidine incorporation at 0.5 and 0.1 nM
concentrations.
BCP Crystals Cause Increased PKC Activity--
The addition of BCP
crystals (25 µg/cm2) to HF cultures in 0.5% FBS/DMEM
produced an approximately 3-fold increase in PKC activity after 30 min
(Table I). TPA (200 nM)
caused an approximately 5-fold increase in PKC activity after 30 min.
The increases in PKC activity induced by both BCP crystals and TPA were
attenuated by the PKC inhibitors staurosporine, bisindolylmaleimide-1
(a competitive inhibitor for the ATP-binding site of PKC), and H7. To
preclude inhibition of a cAMP-dependent kinase, we also
investigated the effects of HA1004, a compound structurally similar to
H7 but with a higher Ki for PKC
(Ki PKC, 40 µM; Ki, cAMP-dependent kinase 2.3 µM) (37). HA1004
had no inhibitory effect on BCP- or TPA-induced increases in PKC
activity.
BCP Crystals Induce NF- BCP Crystals Cause NF-
When BCP crystal-treated HF cultures were co-incubated with the PKC
inhibitor staurosporine, there was a
concentration-dependent inhibition of BCP crystal-induced
NF- BCP Crystals Induce c-fos and c-jun mRNA and AP-1 in
HF--
BCP crystals caused maximal expression of c-fos
mRNA in HF 30 min after treatment which returned to base line
within 2 h (Fig. 8, A and
B). When cultures were treated with staurosporine prior to
stimulation with BCP crystals, c-fos mRNA expression was
greatly attenuated. BCP crystals induced maximal expression of
c-jun mRNA within 2 h after treatment which
continued through 3 h, the longest time point tested (Fig. 8,
C and D). In contrast with c-fos,
there was minimal inhibition of c-jun mRNA when cultures
were treated with staurosporine. Complementing these findings, BCP
crystals induced nuclear translocation of the transcription factor AP-1 which continued for at least 2 h after treatment, the longest time
point tested (Fig. 9, A and
B). Nuclear binding was specific as none resulted from
incubation with a mutant AP-1 probe. Control HF cultures were in 0.5%
FBS, 10% FBS, or treated with TPA (200 nM). Co-incubation
of the nuclear extracts with an anti-Fos antibody resulted in a
supershifted complex.
BCP Crystals Do Not Induce Protein Tyrosine Phosphorylation or
Activation of PI3 Kinase--
Base-line levels of four
tyrosine-phosphorylated proteins were observed in lysates from control
and, unstimulated cultures. Bands at 50 and 27 kDa correspond to heavy
and light chain antibody, respectively, reacting with secondary
HRP-conjugated goat anti-mouse IgG. When cultures were treated with
PDGF (50 ng/ml), there was enhanced tyrosine phosphorylation of a
number of proteins with molecular masses of 185, 170, 145, 116, 80, 72, 62, 60, 40, and 33 kDa. In contrast, cells treated with either BCP
crystals or the non-mitogenic particulate controls, latex beads or
diamond dust, resulted in no increase in tyrosine phosphorylation
relative to unstimulated cultures (Fig.
10A). Similarly, when HF
cultures were treated with PDGF and lysates immunoprecipitated with
anti-phosphotyrosine antibody, as expected, PI3 kinase activity on the
immune complexes was dramatically increased over unstimulated cells
(Fig. 10B, lane 3 versus 4). However,
PI3 kinase activity on anti-phosphotyrosine immune complexes from
BCP-treated cells was no different from untreated cells (lane
3 versus 5). NIH 3T3 cells treated with PDGF
and immunoprecipitated with either phosphotyrosine or anti-PI3 kinase
antibodies served as positive controls (lanes 1 and
2). Untreated, PDGF-treated, or BCP-treated HF cells
immunoprecipitated with PI3 kinase antibody also served as positive
controls for PI3 kinase activity (lanes 6-8).
The results of this investigation show that BCP crystal-induced
cell activation is associated with NF- BCP crystals cause mitogenesis in Balb/c/3T3 murine fibroblasts, and
NF- BCP crystals possess many of the characteristics typical of a growth
factor. Most water-soluble hormones or growth factors bind to specific
receptors on the cell surface which induce the intracellular activation
of signaling cascades. The mediator of the earliest events induced by
contact of insoluble BCP crystals with the cell surface, or with an as
yet unknown surface "receptor," has not yet been identified. We
have used PDGF as a control in our work because the PDGF receptor has
been characterized, and the signal transduction pathways induced by the
PDGF receptor have been analyzed in detail (41). In contrast to that of
BCP crystals, PTK and PI3 kinase are required for PDGF-induced DNA synthesis (16). Furthermore, PDGF-induced DNA synthesis occurs through
a protein kinase C (PKC)-independent pathway, whereas BCP crystals
require at least basal levels of PKC to induce mitogenesis (6).
PTK and PI3K are involved in CPPD crystal-induced neutrophil activation
(17, 18). Although both are calcium-containing, CPPD and BCP crystals
differ in their clinical manifestations. CPPD is commonly associated
with attacks of acute arthritis, "pseudogout," characterized by
joint effusions packed with neutrophils. BCP crystals in synovial
fluid, in contrast, are usually associated with few neutrophils. It is
not known whether BCP crystals induce PTK or PI3K in neutrophils. BCP
crystals did not induce PTK or PI3K in human fibroblasts, in contrast
with PDGF (6). These results emphasize the specificity of cell
activation by BCP crystals and suggest that BCP crystals, unlike PDGF,
directly or indirectly activate G-protein-linked surface receptor(s)
(42).
Many stimuli other than BCP crystals activate NF- BCP crystals induce MMP synthesis and secretion in fibroblasts and
chondrocytes, but the mechanism by which this occurs remains poorly
understood. We have shown that while intracellular dissolution of BCP
crystals augments the mitogenic response, it does not play a role in
BCP induction of MMPs (50). The mechanism of stimulation of the
synthesis and secretion of MMPs in response to stimuli other than BCP
crystals is partly understood. For example, PKC activation is required
for MMP induction in fibroblasts treated with epidermal growth factor
(51) or interleukin-1 (52). Although PKC activation occurs with BCP
crystal-induced mitogenesis, its role in the associated MMP production
has not been established. Staurosporine does not inhibit BCP
crystal-induced collagenase mRNA accumulation in
HF2 at concentrations which
inhibit mitogenesis. We have shown here that staurosporine inhibited
BCP crystal-induced c-fos but not c-jun mRNA
accumulation in HF. This suggests that BCP crystal-induction of
c-fos requires PKC activity, whereas induction of
c-jun does not. Members of the AP-1 family of transcription
factors include Fos/Jun or Jun/Jun dimers that bind preferentially to
the TRE of the collagenase promotor (53). It is possible that the lack of inhibition of BCP crystal-induced c-jun or collagenase
mRNA accumulation in the presence of staurosporine reflects binding of Jun/Jun dimers to the TRE during BCP crystal induction of MMP1 and
other MMPs. Alternatively, since MAP kinases also modulate AP-1
activity (53), BCP crystal-induced activation of MAP kinases could
facilitate MMP production in the presence of staurosporine (8).
The AP-1 sequence or TRE is necessary but not sufficient for phorbol
ester induction of collagenase in fibroblasts (54). Furthermore, in
some cells MMP expression is dependent on activation of and DNA binding
to NF- Glucocorticoids are potent inhibitors of NF- The association of BCP crystals with osteoarthritis and joint
destruction is well established. Synovial hypertrophy is likely a
response to the mitogenic effects of the crystals, and degradation of
cartilage likely results from MMP activity induced by the crystals in
synoviocytes and chondrocytes. However, no known drug prevents or
treats the consequences of BCP crystal deposition. An improved understanding of the molecular mechanisms leading to BCP
crystal-induced mitogenesis and MMP induction is essential to the
development of a rational approach to ultimate prevention or reversal
of the consequences of BCP crystal deposition.
*
This work was supported by grants from the National
Arthritis Foundation, American Federation for Aging Research, National Institutes of Health Grants AR-01953 (to G. M. C.) and AR-38421 (to
H. S. C.), the Lupus Foundation of America, the Cancer League of
Colorado, and the American Association of Colleges of Pharmacy (to
R. I. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
BCP, basic calcium
phosphate; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal
bovine serum; HF, human fibroblasts; PKC, protein kinase C; TPA, 12-O-tetradecanoylphorbol-13-acetate; EMSA, electrophoretic
mobility shift analysis; PAGE, polyacrylamide gel electrophoresis; PDGF, platelet-derived growth factor; PtdIns, phosphatidylinositol; PI3K, phosphatidylinositol 3-kinase; PI3 kinase, phosphatidylinositol
3-kinase; NF- 2
G. M. McCarthy, unpublished observations.
Molecular Mechanism of Basic Calcium Phosphate Crystal-induced
Activation of Human Fibroblasts
ROLE OF NUCLEAR FACTOR 
B, ACTIVATOR PROTEIN 1, AND PROTEIN
KINASE C*
,
, Department of
Medicine (Arthritis), University of Miami School of Medicine and
Geriatric Research, Education and Clinical Center, Veterans
Administration Medical Center, Miami, Florida 33125, and the ** School
of Pharmacy, University of Colorado Health Sciences Center,
Denver, Colorado 80262
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B and activator protein 1 in human
fibroblasts. We confirm the role of protein kinase C in BCP
crystal-induced mitogenesis in human fibroblasts. In contrast, we
demonstrate that BCP crystals do not activate signal transduction
pathways involving protein tyrosine kinases or phosphatidylinositol
3-kinase. These data further define the mechanism of cell activation by
BCP crystals and confirm its selectivity, an observation that may have
therapeutic implications.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B (NF-B). Present
in the cytoplasm of most cell types, NF-B is critical to many signal
transduction pathways, including those leading to cell replication and
oncogenesis, and is induced during the G0 to G1
transition of mitogenesis in murine fibroblasts (11). The best
characterized form of NF-B consists of a heterodimer composed of a
50-kDa (p50) and a 65-kDa (p65) (also called RelA) subunit (12). In
unstimulated cells, NF-B is found in the cytoplasm bound to IB
(inhibitor B), a member of a family of inhibitor proteins that
prevents it from entering the nucleus. When cells are exposed to
inducers of NF-B, two serine residues of IB are phosphorylated by
specific IB kinases causing its rapid degradation by the 26 S
proteasome and loss of NF-B inhibitory activity (13). NF-B is
thus released to translocate to the nucleus and activate transcription
of target genes. BCP crystals induce mitogenesis, but their ability to
activate NF-B has not previously been studied.
and phorbol esters (22, 23).
Increased transcription through the TRE depends on the transcription
factor activator protein-1 (AP-1), a heterodimer composed of the
protein products of c-fos and c-jun, both primary response genes, which interact to stimulate transcription of
AP-1-responsive genes. BCP crystals induce c-fos and
c-jun mRNA accumulation in human fibroblasts (HF) and
inhibitors of protein synthesis such as cycloheximide block BCP crystal
induction of MMP mRNA (19, 24). This suggests that synthesis of a
transactivating complex containing Fos and Jun proteins, such as AP-1,
is necessary for BCP crystal induction of MMPs.
B induction
in Balb/c/3T3 and HF. We confirm that BCP crystals induce the
transcription factor AP-1, and we show that the PKC inhibitor,
staurosporine, inhibits BCP crystal induction of c-fos, but
not c-jun, mRNA in HF. In contrast, we show that BCP
crystals do not activate PI3 kinase or tyrosine kinases confirming that cell activation by BCP crystals is selective in mechanism.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
and
forms of PKC, was from Amersham Pharmacia Biotech. The polyclonal antibody raised in rabbits against IB, was from Rockland, Inc. (Gilbertsville, PA). The polyclonal anti-peptide antibody against c-Fos
(c-Fos(K-25)XTransCruzTM) was from Santa Cruz Biotechnology
(Santa Cruz, CA). The murine monoclonal anti-PI3K antibody against
human p85 and the anti-phosphotyrosine antibody, 4G10, were from
Upstate Biotechnology, Inc. (Lake Placid, NY). Biotin-labeled goat
anti-rabbit IgG and peroxidase-labeled streptavidin were from
Kirkegaard & Perry Laboratories, Inc. (Gaithersburg, MD). Enhanced
chemiluminescence was performed using a kit from Amersham Corp.
(Buckinghamshire, UK). Tritiated thymidine (50 Ci/mmol) was from
Amersham Pharmacia Biotech, and [-32P]dCTP and
[-32P]dATP were from ICN Pharmaceuticals, Inc.
(Irvine, CA). The AP-1 probe was the AP-1 consensus oligonucleotide
(5'-CGCTTGATGACTCAGCCGGAA-3') from Santa Cruz Biotechnology (Santa
Cruz, CA). The mutant AP-1 probe was also from Santa Cruz
Biotechnology. The c-fos probe was a 1.3-kilobase pair
PstI v-fos fragment from the pfos-1/plasmid supplied by I. Verma (Salk Institute, San Diego, CA) (25). The c-jun probe was a 0.9-kilobase pair
BamHI/PstI insert from the RSV-cJ plasmid,
supplied by Dr. Michael Karin (University of California, San Diego)
(26). The pHcGAP plasmid containing glyceraldehyde-3-phosphate dehydrogenase cDNA (27) was from the American Type Culture
Collection (27). Staurosporine was from Kamiya Biomedical Co. (Thousand Oaks, CA). H7 (1-(5-isoquinolinesulfonyl)-2-methylpiperazine
dihydrochloride) and HA1004
(N-(2-guanidinoethyl)-5-isoquinolinesulfonamide
hydrochloride) were from Seikagaku America, Inc. (St. Petersburg, FL)
Bisindoylmaleimide-1 was from Calbiochem. Human recombinant
platelet-derived growth factor (PDGF)-BB was from Austral Biologics
(San Ramon, CA). Recombinant human interleukin-1 (IL-1) was from
R & D Systems (Minneapolis, MN). Phosphatidylinositol (PtdIns) and
phosphatidylserine were from Avanti Polar Lipids (Alabaster, AL).
PtdIns, PtdIns(4)P, and PtdIns(4,5)P2 were from Calbiochem.
12-O-Tetradecanoylphorbol 13-acetate (TPA) and latex beads
(particles 0.46 µm in diameter) were from Sigma. Diamond dust
(particles 1-5 µm long) was obtained from A. Landau Co.
(Philadelphia, PA). Colorado calf serum was from the Colorado Serum Co
(Denver, CO). Bovine calf serum, fetal bovine serum (FBS), Hanks'
buffered saline solution, and DMEM were from Life Technologies, Inc.
80 °C until use. Nuclear extracts were washed in buffer E without
Nonidet P-40 and resuspended in 40 µl of C buffer (20 mM
HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM
spermine, 0.2 mM EDTA, 2 mM EGTA, 2 mM dithiothreitol, 20% glycerol, 1 mM PMSF).
NaCl was added to a concentration of 0.4 M, and the nuclei were gently shaken for 10 min at 4 °C. The nuclei were then pelleted by spinning for 10 min at 14,000 rpm at 4 °C in an Eppendorf
microcentrifuge, and the nuclear extract supernatant was stored at
70 °C until use. The protein content of cell extracts was
determined using the method of Bradford (Bio-Rad) (31).
178 to 141 of the region 1 enhancer of
the H-2Kb gene which contains a
strong B motif. UV1 was annealed to primer UV2 (GAAGTGAAAC-TGTGG)
and extended with Klenow fragment in the presence of
[-32P]dCTP as described previously (32). The AP-1
probe is described under "Materials." Binding reactions were
performed by first incubating 2 µg of nuclear extract with 1 µg of
poly(dI-dC) in binding buffer (10 mM Tris, pH 7.7, 50 mM NaCl, 20% glycerol, 1 mM dithiothreitol, 0.5 mM EDTA) for 10 min at room temperature. Approximately
10,000 cpm of probe was then added and allowed to bind for
approximately 30 min. Some nuclear extracts were treated with IB
(recombinant IB expressed in Escherichia
coli and purified using histidine tags) prior to addition of
the UV 21 probe. The reaction mix was then loaded onto native 5%
acrylamide gels, prepared with 0.25× TBE (22.3 mM Tris,
22.3 mM borate, 0.5 mM EDTA). Supershift
experiments were performed by incubating binding reaction mixes with 1 µl of antiserum for 15 min at room temperature. The polyclonal
antibody against p50 (Ab1141) is generated in rabbits and is raised
against a peptide fragment made from amino acids 2-15 of human p105.
The anti-p65 antibody (Ab5192) is polyclonal antisera against the C
terminus of human p65. Gels were analyzed either by autoradiography or
with a PhosphorImager (Molecular Dynamics).
-32P]dATP, to a specific activity
of >5 × 108 cpm/µg (35). The filters were washed
at a maximal stringency of 0.25× standard saline citrate (SSC, 1×
SSC = 0.15 M sodium chloride, 0.015 M
sodium citrate, pH 7.0) at 60 °C for 30 min. Autoradiography was
performed with Kodak XAR-5 film (Eastman Kodak Co.), and signal
intensity was quantified by scanning laser densitometry (LKB
Instruments, Stockholm, Sweden).
-mercaptoethanol, 0.1 mM PMSF, 10 mg/ml pepstatin, 10 mg/ml soybean trypsin inhibitor) and sonicated for 30 s. The cell
lysate was then centrifuged at 100,000 × g for 45 min,
and the supernatant was removed. The pellet was resuspended in 1 ml of
buffer A containing 1% Triton X-100 and then applied to 200 ml of
DEAE-Sepharose minicolumns equilibrated in buffer B (buffer A without
sucrose). The columns were then washed with 1 ml of buffer B and eluted
with 1 ml of buffer C (buffer B + 0.15 M NaCl). Prior
experiments determined that 0.15 M NaCl eluted the majority
of the PKC activity. 25 ml samples were then assayed for PKC activity
using a PKC assay kit (Amersham Pharmacia Biotech). This assay is a
modification of the mixed micelle assay and utilizes a peptide that is
specifically phosphorylated on threonine by PKC (37, 38). Assay
conditions and separation of the phosphorylated peptide were as
described in the instructions supplied with the kit.
-32P]ATP (specific activity, 6000 Ci/mmol; NEN Life
Science Products). After 10 min at 37 °C, the reactions were
terminated with 200 µl of 1 N HCl. Next,
CHCl3/CH3OH (1:1) (400 µl) was added, and the
phospholipids were extracted. The aqueous layer was aspirated, and the
CHCl3 layer was washed once with 160 µl of
CH3OH/1 N HCl (1:1). The resulting
CHCl3 layer was dried with nitrogen gas, and the
phospholipid residues were solubilized in
CHCl3/CH3OH (2:1). Radiolabeled
PtdIns(3,4,5)P3 was separated from
PtdIns(4,5)P2 and PtdIns(4)P standards by thin layer
chromatography (TLC) as described previously (39).
32P-Radiolabeled phosphoinositides were visualized by
autoradiography. 32Pi incorporated into
PtdIns(3,4,5)P3 was quantified directly on the TLC plates
with an AMBIS computerized imaging/radioscanning system. Authentic
PtdIns(4)P and PtdIns(4,5)P2 standards were chromatographed
in parallel lanes and visualized by spraying with 10%
H2SO4 and heating to 100 °C.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (68K):
[in a new window]
Fig. 1.
BCP crystal induction of PKC
translocation. Confluent, quiescent HF cultures in DMEM and 0.5%
FBS were treated with BCP crystals (18 µg/cm2). Control
cultures were treated with IL-1 (50 ng/ml), TPA (200 nM),
or left untreated. After 20 min, cultures were harvested, and cytosolic
and membrane fractions were prepared as described under "Experimental
Procedures." Western blot of cytosolic and membrane fractions of HF
using a monoclonal anti-PKC antibody (MC-5) was performed.
B, BCP crystals; C, control, unstimulated
cultures. The positions of molecular mass markers in kDa are
shown.
View larger version (42K):
[in a new window]
Fig. 2.
BCP crystal induction of PKC translocation,
time course. Confluent, quiescent HF cultures in DMEM and 0.5%
FBS were treated with BCP crystal (18 µg/cm2). Control
cultures were in DMEM and 0.5% FBS. At the indicated time points in
minutes, cultures were harvested, and cytosolic and membrane fractions
were prepared as described under "Experimental Procedures." Western
blot of cytosolic and membrane fractions of HF using a monoclonal
anti-PKC antibody (MC-5) was performed. C, control,
unstimulated cultures; B, BCP crystals. The positions of
molecular mass markers in kDa are shown.
View larger version (22K):
[in a new window]
Fig. 3.
Effect of the PKC inhibitor, staurosporine,
on BCP crystal-induced mitogenesis. Confluent, quiescent HF
cultures in DMEM and 0.5% FBS were treated with BCP crystals (25 µg/cm2) with or without staurosporine at varying doses.
Staurosporine was added 30 min prior to other stimulants. Control
cultures were treated with the phorbol ester, TPA (200 nM),
or 10% serum, or were unstimulated. After 23 h, all plates were
pulse-labeled with [3H]thymidine (1 µCi/ml) for 1 h. The plates were then processed, and thymidine incorporation was
determined. All values ± S.E.; n = 6. Staur, staurosporine. Significant inhibition of BCP crystal-
and TPA-induced mitogenesis by staurosporine (1 nM),
p < 0.01.
BCP crystal induction of PKC activity in human fibroblasts, effect of
PKC inhibitors
B in Balb/c/3T3 Fibroblasts--
By
using the UV21 probe, BCP crystal-induced NF-B was demonstrated in
Balb/c/3T3 fibroblasts by formation of an NF-B·DNA complex within 30 min of treatment which was maximal within 60 min of
treatment and which had returned to base line by 24 h after treatment (Fig. 4). When nuclear extracts
were treated with recombinant IB prior to addition of the UV21
probe, DNA binding of the protein complex was completely inhibited.
Co-incubation of the nuclear extracts with an anti-p65 antibody caused
a supershift of the NF-B·DNA complex, confirming the specificity
of binding. The addition of an anti-p50 antibody did not result in a
supershifted NF-B·DNA complex, likely due to inability of the
human antibody to recognize murine protein.
View larger version (101K):
[in a new window]
Fig. 4.
BCP crystal induction of NF- B in
Balb/c/3T3 fibroblasts. EMSA of equal amounts of protein from
nuclear extracts of untreated or BCP crystal-stimulated Balb/c/3T3
fibroblasts was performed using the probe described under
"Experimental Procedures." Lane 1, unstimulated cell
extracts; lanes 2-5, time course of induction of NF-B.
Lane 2, 30 min; lane 3, 60 min; lane
4, 90 min; lane 5, 24 h after treatment with BCP
crystals. Lane 6, BCP crystal-stimulated cell extracts
co-incubated with IB. Lane 7, BCP crystal-stimulated cell
extracts co-incubated with antibody 1141 against p50. Lane
8, BCP crystal-stimulated cell extracts co-incubated with antibody
1141 and its corresponding peptide. Lane 9, BCP
crystal-stimulated cell extracts co-incubated with antibody 5192 against p65. Lane 10, BCP crystal-stimulated cell extracts
co-incubated with antibody 5192 and its corresponding peptide. The
thin arrow indicates the major complex induced and the
thick arrow indicates the supershifted complex.
B Induction in HF--
BCP
crystal-induced NF-B was demonstrated in HF by formation of an
NF-B·DNA complex within 4 h of treatment which continued through 24 h after treatment, the longest time point tested (Fig. 5). Co-incubation of the nuclear extracts
with either an anti-p65 or anti-p50 antibody resulted in a supershifted
complex. The induction of NF-B by BCP crystals was delayed relative
to the induction of NF-B in response to 10% FBS as treatment of
cultures with 10% FBS resulted in formation of an NF-B·DNA
complex within 1 h which had returned to base line within 24 h after treatment. Control cultures were in 0.5% FBS.
View larger version (98K):
[in a new window]
Fig. 5.
BCP crystal induction of NF- B in HF, time
course. EMSA of equal amounts of protein from nuclear extracts of
untreated, BCP crystal-stimulated, or 10% FBS-treated HF was performed
using the probe described under "Experimental Procedures." Cells
were harvested at the indicated times in hours after stimulation.
C, unstimulated control cultures; B, BCP (18 µg/cm2) crystal-stimulated cultures; F, 10%
FBS-treated cultures; numbers refer to time in hours after treatment.
p50, polyclonal anti-peptide antibody to p50 (antibody
1141); p65, polyclonal anti-peptide antibody against p65;
pep, corresponding peptide. Unlabeled arrows show
the position of the supershifted complexes.
B. Such inhibition was not specific as NF-B induction in
response to 10% FBS was also inhibited (Fig.
6). Concurrent with BCP crystal induction
of NF-B, there was transient disappearance of immunoreactive I-Ba
noted both 1 and 4 h after treatment with BCP crystals. There was
reappearance of I-B by 24 h after treatment (Fig.
7).
View larger version (60K):
[in a new window]
Fig. 6.
BCP crystal induction of NF- B in HF.
Effect of the PKC inhibitor, staurosporine. EMSA of equal amounts of
protein from nuclear extracts of untreated, BCP crystal-stimulated or
10% FBS-treated HF was performed using the probe described under
"Experimental Procedures." C, unstimulated control
cultures; ST, staurosporine (1 nM);
B, BCP (18 µg/cm2) crystal-stimulated
cultures; F, 10% FBS-treated cultures.
View larger version (22K):
[in a new window]
Fig. 7.
BCP crystal induction of transient
disappearance of I B in HF. Cytoplasmic extracts (50 µg) were
subjected to PAGE followed by Western blot using a polyclonal antibody
to IkB (1:1000). C, untreated control cultures;
B, BCP crystals; F, 0% FBS. Numbers
refer to time in hours after treatment when cultures were
harvested.
View larger version (74K):
[in a new window]
Fig. 8.
BCP crystal induction of c-fos
(A and B) and c-jun (C
and D) mRNA accumulation, effect of
staurosporine. Confluent cultures of HF in 100-mm plates were
incubated in DMEM and 0.5% FBS for 24 h before being treated with
BCP crystals (18 µg/cm2). Some cultures were treated with
staurosporine (1 nM) 30 min prior to stimulation with BCP
crystals. Unstimulated control cultures were in 0.5% FBS. At varying
time points, cultures were harvested, and total RNA was isolated.
Northern blot analysis was performed using radiolabeled
c-fos cDNA, followed by autoradiography. The blot was
then stripped of the c-fos probe and re-probed with
radiolabeled c-jun cDNA, and autoradiography repeated.
The blot was stripped one more time and re-probed with radiolabeled
glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA as
a control. Autoradiographs were scanned using a laser densitometer with
results presented as bar graphs and expressed as the percent
of maximal expression, using glyceraldehyde-3-phosphate dehydrogenase
to correct for small variations in total RNA analyzed. B,
BCP crystals; St, staurosporine. The positions of the 18 S
and 28 S ribosomes are shown.
View larger version (45K):
[in a new window]
Fig. 9.
BCP crystal induction of AP-1.
A, EMSA of equal amounts of protein from nuclear extracts of
HF treated with BCP crystals (18 µg/cm2) was performed
using the radiolabeled AP-1 probe, as described under "Experimental
Procedures." Control cultures were treated with TPA (200 nM) or left untreated. Cultures were harvested 2 h
after treatment. Some extracts were co-incubated with a polyclonal
anti-Fos antibody with or without its corresponding peptide. The
positions of AP-1 and the supershifted complexes are shown.
C, unstimulated cultures; B, BCP crystal-treated
cultures; T, TPA-treated cultures. B, time
course. EMSA was performed as above, but some extracts were incubated
with the mutant AP-1 probe described under "Experimental
Procedures." Control cultures were untreated or treated with TPA (200 nM) or 10% FBS. C, unstimulated cultures;
T, TPA; F, 10% FBS. Numbers refer to
time in min (') after treatment when cultures were harvested.
NS, nonspecific.
View larger version (43K):
[in a new window]
Fig. 10.
PDGF- or BCP crystal-induced protein
tyrosine phosphorylation and phosphatidylinositol 3-kinase activation
in fibroblasts. A, confluent HF in 100-mm plates were
incubated overnight in 0.5% FBS and either left untreated
(C) or treated with latex beads (18 µg/cm2),
diamond dust (18 µg/cm2), BCP crystals (18 µg/cm2), or PDGF (50 ng/ml) for the times (', min)
indicated. Cell lysates were immunoprecipitated with
anti-phosphotyrosine antibody 4G10 as described under "Experimental
Procedures." Immune complexes were solubilized in SDS sample buffer,
separated by 8.75% SDS-PAGE, and immunoblotted with 4G10 antibody as
described under "Experimental Procedures." Tyrosine-phosphorylated
proteins were detected by chemiluminescence. Molecular mass markers in
kDa are indicated at the left. B, NIH 3T3 or
human fibroblasts were either untreated (C) or treated as in
A with either BCP crystals (18 µg/cm2) or PDGF
(50 ng/ml) for 15 min. Cell lysates were immunoprecipitated
(PPT) with either anti-phosphotyrosine antibody 4G10 or
anti-PI3K antibody as described under "Experimental Procedures."
The PI3K assay, as described under "Experimental Procedures," was
used to assess PI3K activity on the washed immune complexes using
PtdIns(4,5)P2 as substrate. Lipids were separated by thin
layer chromatography and radiolabeled PtdIns(3,4,5)P3 was
detected by autoradiography. Net counts incorporated into
PtdIns(3,4,5)P3 are as follows: lane 1, 9,120;
lane 2, 41,741; lane 3, 108; lane 4,
4,581; lane 5, 22; lane 6, 13,092; lane
7, 30,214; and lane 8, 10,038. Circles
represent migration of authentic PtdIns(4)P and
PtdIns(4,5)P2 standards.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B induction in Balb/c/3T3 and
human fibroblasts (HF) and PKC activation and AP-1 induction in HF.
Moreover, we have demonstrated that inhibition of BCP crystal-induced mitogenesis by the PKC inhibitor staurosporine is accompanied by
inhibition of BCP crystal induction of NF-B and c-fos,
but not c-jun, mRNA. Although the cellular effects of
many other growth-promoting agents are mediated by high affinity
receptor protein tyrosine kinases (PTK) (14) with resultant recruitment
and activation of PI3K (15), out data show that neither tyrosine
phosphorylation nor PI3K activity appears to be required for BCP
crystal-induced cell activation. Thus, these observations further
define the biological effects of BCP crystals.
B is induced when quiescent Balb/c/3T3 fibroblasts are stimulated
with serum growth factors (6, 11). Therefore, we initiated our
investigation by studying the ability of BCP crystals to induce NF-B
in this cell type. We were unable to demonstrate the presence of the
p50 subunit in the NF-B·DNA complex by supershift in Balb/c/3T3
cells treated with BCP crystals. However, the antibody was raised
against a peptide fragment from human, and not murine, p105, the
cytoplasmic precursor of p50 and therefore may not recognize murine protein.
B. These include
cytokines and activators of protein kinase C such as the phorbol ester
TPA (43). Several signal transduction pathways may be involved, but all
of these stimuli act by means of protein kinases that phosphorylate
(and thus degrade) IB. It was originally proposed that IB might
serve as a substrate for kinases such as PKC and protein kinase A,
based on in vitro studies (44, 45). Recently, however, a
high molecular mass IB kinase complex containing at least two
cytokine-responsive IkB kinases has been identified (46). These kinases
specifically phosphorylate critical serine residues of IB.
Activation of NF-B by tumor necrosis factor- and IL-1 requires
the successive action of NF-B-inducing kinase and IB kinase (47).
The molecular mechanisms by which NF-B-inducing kinase becomes
activated are not yet understood. Although BCP crystals activate both
PKC and NF-B, it is not known to what extent these two events are
linked. Since the critical modification for IkB kinases activation
appears to be phosphorylation, it is possible that PKC plays a role in
BCP crystal induction of NF-B by inducing phosphorylation and
activation of IkB kinases (48). In support of this concept, the PKC
inhibitor staurosporine inhibited both BCP crystal-induced mitogenesis
and NF-B. Alternatively, it is possible that staurosporine inhibits
IkB kinases since, although it is a potent inhibitor of PKC, it also
inhibits PKA and other protein kinases (49).
B but not AP-1 (55). Conversely, the functional and physical
interplay of the NF-B and AP-1 families of transcription factors
have recently been reported to result in enhanced DNA binding and
biological function of each (56). Finally, the potential role of the
transcription factor PEA3 in the transcriptional regulation of BCP
crystal-induced MMP expression needs to be considered as the
collagenase promotor contains a PEA3-binding site that acts
synergistically with AP-1 to achieve maximal levels of transcriptional
activation in response to TPA (57). BCP crystals induce both NF-B
and AP-1, and our data suggest that NF-B plays a role in BCP
crystal-induced mitogenesis and that AP-1 is involved in BCP crystal
induction of MMPs. Further study will be necessary to show whether
NF-B and/or PEA3 activation is necessary for BCP crystal induction
of MMPs.
B activation in mice and
cultured cells. Such inhibition appears to be mediated by induction of
IB inhibitory protein (58). Glucocorticoids also inhibit MMP-1
induction by interfering with AP-1 (59-61). Intra-articular
glucocorticoids are effective for at least short-term relief of pain in
OA, but no clinical predictors of response have been found (62). The
presence or absence of synovial fluid BCP crystals was not evaluated,
however, and based on the current data, glucocorticoids likely inhibit
the major biological effects of BCP crystals in vivo. In
addition, aspirin and sodium salicylate, both of which have been used
to treat the symptoms of joint degeneration, also inhibit the
activation of NF-B so that the anti-inflammatory effects of these
drugs may be partly attributable to the inhibition of NF-B (63).
Finally, a number of PKC modulators are currently undergoing clinical
evaluation as anticancer drugs, and tamoxifen, already in clinical use,
is a moderately potent inhibitor of PKC (64). PKC inhibition could be
an effective target for attenuation of BCP crystal-induced mitogenesis.
FOOTNOTES
To whom correspondence should be addressed: Dept. of Clinical
Pharmacology, The Royal College of Surgeons in Ireland, 123, St.
Stephens Green, Dublin 2, Ireland. Tel.: 353-1-4782165; Fax: 353-1-4022453.
B, nuclear factor B; PTK, protein tyrosine kinases; OA, osteoarthritis; PDGF, platelet-derived growth factor; CPPD, calcium
pyrophosphate dihydrate; TRE, TPA response element; IL-1, interleukin-1; MMP, matrix metalloprotease; TBS, Tris-buffered
saline; AP-1, activator protein 1; MAP, mitogen-activated protein; PBS, phosphate-buffered saline; HA1004, N-(2-guanidinoethyl)-5-isoquinolinesulfonamide
hydrochloride; H7, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine dihydrochloride.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  E. S. Molloy, M. P. Morgan, G. A. Doherty, B. McDonnell, M. Hilliard, J. O'Byrne, D. J. Fitzgerald, and G. M. McCarthy Mechanism of basic calcium phosphate crystal-stimulated cyclo-oxygenase-1 up-regulation in osteoarthritic synovial fibroblasts Rheumatology, July 1, 2008; 47(7): 965 - 971. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Nadra, J. C. Mason, P. Philippidis, O. Florey, C. D.W. Smythe, G. M. McCarthy, R. C. Landis, and D. O. Haskard Proinflammatory Activation of Macrophages by Basic Calcium Phosphate Crystals via Protein Kinase C and MAP Kinase Pathways: A Vicious Cycle of Inflammation and Arterial Calcification? Circ. Res., June 24, 2005; 96(12): 1248 - 1256. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ohana, D. Segal, R. Palty, D. Ton-That, A. Moran, S. L. Sensi, J. H. Weiss, M. Hershfinkel, and I. Sekler A Sodium Zinc Exchange Mechanism Is Mediating Extrusion of Zinc in Mammalian Cells J. Biol. Chem., February 6, 2004; 279(6): 4278 - 4284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Reuben, M. A. Brogley, Y. Sun, and H. S. Cheung Molecular Mechanism of the Induction of Metalloproteinases 1 and 3 in Human Fibroblasts by Basic Calcium Phosphate Crystals. ROLE OF CALCIUM-DEPENDENT PROTEIN KINASE Calpha J. Biol. Chem., April 19, 2002; 277(17): 15190 - 15198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G M McCarthy, P R Westfall, I Masuda, P A Christopherson, H S Cheung, and P G Mitchell Basic calcium phosphate crystals activate human osteoarthritic synovial fibroblasts and induce matrix metalloproteinase-13 (collagenase-3) in adult porcine articular chondrocytes Ann Rheum Dis, April 1, 2001; 60(4): 399 - 406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M MCCARTHY; and P. DIEPPE Mortality in rheumatoid arthritis patients. Ann Rheum Dis, November 1, 1999; 58(11): 723 - 724. [Full Text]
|
|
|
|
|
|
Y. Sun, L. Wenger, C. E. Brinckerhoff, R. R. Misra, and H. S. Cheung Basic Calcium Phosphate Crystals Induce Matrix Metalloproteinase-1 through the Ras/Mitogen-activated Protein Kinase/c-Fos/AP-1/Metalloproteinase 1 Pathway. INVOLVEMENT OF TRANSCRIPTION FACTOR BINDING SITES AP-1 AND PEA-3 J. Biol. Chem., January 4, 2002; 277(2): 1544 - 1552. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |