|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 35185-35193, December 25, 1998
From the Metabolic Research Unit and Departments of Medicine and
§ Stomatology, University of California,
San Francisco, California 94143
Activation of the atrial natriuretic peptide
(ANP) gene is regarded as one of the earliest and most reliable markers
of hypertrophy in the ventricular cardiac myocyte. We have examined the
role of the nonreceptor tyrosine kinases in the signaling mechanism(s) leading to hypertrophy using human ANP gene promoter activity as a
marker. Endothelin (ET), a well known hypertrophic agonist, increased
activity of c-Src, c-Yes, and Fyn within minutes and promoted a
selective redistribution of each of these kinases within the cell.
Overexpression of c-Src effected a significant increase in activity of
a cotransfected human ANP promoter-driven chloramphenicol acetyl
transferase reporter, while expression of either c-Yes or Fyn was
considerably less effective in this regard. ET-dependent stimulation of the human ANP gene promoter was partially inhibited by
co-transfection with dominant negative Ras or dominant negative Src or
Csk or by treatment with the potent Src family-selective tyrosine
kinase inhibitor PP1, suggesting that the Src family kinases are
involved in signaling ET-dependent activation of this promoter. Both ET- and Src-dependent activation of the ANP
promoter required the presence of a CArG motif in a serum response
element-like structure between Atrial natriuretic peptide
(ANP)1 is a cardiac hormone
involved in the regulation of intravascular volume and blood pressure (1). Under normal conditions, the ANP gene is expressed almost exclusively in the cardiac atria, although modest levels of expression are also detected in the cardiac ventricle, hypothalamus, aortic arch,
and lung (2, 3). Ventricular ANP gene expression is elevated during
embryonic and early neonatal life but remains low throughout adulthood
unless the ventricle is subjected to hemodynamic stress
(e.g. volume or pressure overload). In this context, the
ventricular myocyte undergoes characteristic biochemical and
morphological changes that signal the initiation of hypertrophy. At the
level of gene expression, this includes activation of the immediate
early genes (proto-oncogenes like c-fos, c-jun,
c-myc, and egr-1) followed by reactivation of a
fetal gene program (e.g. ANP, Endothelin-1, a 21-amino acid vasoconstrictor, is one of the most
potent hypertrophic stimuli in the neonatal myocyte system (7, 13).
ET-1 binds to a specific heterotrimeric G protein-coupled receptor that
is linked to a number of well defined intracellular signaling pathways.
Activation of phospholipase C, mobilization of intracellular calcium,
activation of protein kinase C, and stimulation of MAP kinase activity
have each been linked to ET-1 in the neonatal cardiac myocyte (4, 7,
14). The latter is of particular interest in that MAP kinase has
classically been associated with activation of receptors associated
with tyrosine kinase activity. Several recent studies indicate that G
protein-coupled receptors employ a very unique mechanism to effect this
stimulation. This involves a G ET has been shown to stimulate tyrosine kinase activity in a number of
systems (19-21) and, more recently, has been linked directly to
activation of c-Src in rat mesangial cells (22, 23). In cardiac
myocytes, the picture is incomplete. Thorburn et al. (24)
have shown that inhibitors of tyrosine kinase activity (e.g.
genistein) reduce phenylephrine-dependent activation of c-Fos, ANP, and myosin light chain-2 (MLC-2) promoter activity in
cultured myocytes. Sadoshima and Izumo (25) have recently demonstrated
that AII activates Fyn, a tyrosine kinase closely related to Src, in
these cells. They hypothesize that this activation, through
Shc/Grb2/Sos intermediates, leads to stimulation of Ras and MAP kinase,
two biochemical markers that have been linked to the hypertrophic
process (6, 26, 27). Noteworthy, however, are the findings of Zou
et al. (28), which question the dependence of the
hypertrophic response on tyrosine kinase activation, suggesting instead
that stimulation of MAP kinase by AII is strongly linked to activation
of protein kinase C. Thus, at present, there is no consensus as to the
role of the tyrosine kinases in the signaling cascades traditionally
associated with the development of hypertrophy.
Given the controversy surrounding this issue, we have investigated the
role of c-Src and Src-related tyrosine kinases in initiating the
signaling cascade linking the liganded ET receptor to activation of the
ANP gene promoter and, by inference, to the development of hypertrophy
in the neonatal cardiac myocyte. We have determined that ET does
activate c-Src in the myocyte and that this activation is closely tied
to the subsequent activation of ANP gene transcription.
Plasmids--
The hANPCAT constructs contain the 5'-flanking
sequence of the human ANP gene linked to coding sequence for bacterial
chloramphenicol acetyl transferase (CAT); the accompanying numerical
designation defines the 5' limit of the included genomic sequence
relative to its native transcription start site. The Antibodies--
Rabbit polyclonal antibodies directed against
c-Src (SRC2), c-Yes (c-Yes3) and Fyn (FYN3)-G were purchased from Santa
Cruz Biotechnology, Inc. (Santa Cruz, CA). A monoclonal antibody (clone 28) that specifically recognizes the region adjacent to
Tyr530 in the C-terminal regulatory domain of c-Src was
generously provided by Dr. Hisaaki Kawakatsu. This region is recognized
by the antibody only when Tyr530 is in the unphosphorylated
state, i.e. when the kinase is in an activated form (32).
Clone 28 antibody was raised against the peptide sequence
LEDYFTSTPQYQPGENL, which occurs in the C termini of Src, Fyn, and Yes;
consequently, the antibody recognizes all three proteins. Src-specific
monoclonal antibody (mAB327) was a gift from Dr. Joan Brugge, and
monoclonal anti-phosphotyrosine antibody (clone 4G10) was obtained from
Upstate Biotechnology, Inc. (Lake Placid, NY). Monoclonal antibodies
that specifically recognize c-Yes (c-Yes3H9) and Fyn (Fyn301) were
obtained from WAKO Chemicals USA (Richmond, VA). Anti- Cell Culture, Transfection, and CAT Assays--
Primary cultures
of rat ventricular myocytes from 1-day-old rats were prepared as
described (33) and plated on 0.1% gelatin-coated plates in
DME-H21/10% enriched calf serum (Gemini Bioproducts Inc., Calabasas,
CA). After cell attachment (~18 h), the culture medium was changed to
a defined DME-H21/10% serum substitute medium (34). All experiments
were performed after 24-48-h incubation in serum substitute medium.
For the transient transfections, 10 million cells/group were
resuspended in 400 µl of phosphate-buffered saline (PBS), 0.1%
glucose containing 25 µg of reporter plasmid together with varying
concentrations of different expression vectors, as described in the
figure legends. DNA concentration for all samples was adjusted to 40 µg with inert DNA (pUC 18). Cells were electroporated using the
Bio-Rad Gene Pulsar at 280 V/250 microfarads. Independent measurements
of transfection efficiency, using pRSV Isolation of RNA and Northern Blot Analysis--
Total RNA was
isolated from ventricular cardiocytes using the RNeasy kit (QIAGEN,
Inc.). 5 µg of ventricular RNA was size-fractionated on 1% agarose
containing 2.2 M formaldehyde, transferred by capillary action to GeneScreen Plus hybridization Transfer Membrane (NEN Life
Science Products) in 10× standard saline citrate (SSC, 1.5 M sodium chloride, and 0.15 M sodium citrate)
for 8-16 h and fixed to the membrane by UV irradiation (DNA transfer
lamp, Fotodyne Inc., New Berlin, WI). Membranes were then baked at
80 °C for 1 h and probed with a full-length rat ANP cDNA
labeled with [ Immunoprecipitation and Western Blot Analysis--
Incubations
with ET were terminated by aspiration of medium and two rapid washes
with ice-cold PBS. All subsequent steps were carried out at 4 °C
using ice-cold buffers. Cells were lysed in modified radioimmune
precipitation lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 10% glycerol, 1.5 mM
MgCl2, 1 mM EGTA, 0.25 mM sodium
orthovanadate, 10 mM sodium pyrophosphate, 100 mM NaF, 1% Triton X-100, 1% sodium deoxycholate, 0.1%
SDS, 10 µg/ml each of leupeptin and aprotinin, and 1 mM
phenylmethylsulfonyl fluoride) (35). After brief sonification, lysates
were incubated on ice for 15 min. Insoluble material was removed by
centrifugation (15 min at 1500 rpm). Lysates were precleared by 30-min
incubation with 5 µl of agarose conjugated to mouse, goat, and rabbit
IgG, followed by 5-min centrifugation at 7000 × g.
Equal concentrations of cellular lysates (250 µg) were then incubated
with specific antibodies at concentrations of 1-2 µg/250 µg of
protein for 60 min at 4 °C. The immune complexes were collected
after the addition of 25 µl of Dynabeads and incubation for 30 min at
4 °C. The pellets were washed once with lysis buffer and two times
with buffer A (20 mM Tris, pH 7.4, 1 mM EDTA,
0.1% Nonidet P-40, 10% glycerol, and 5 mM
Src Kinase Assay--
To measure c-Src kinase activity,
endogenous c-Src was isolated by immunoprecipitation with monoclonal
antibody mAB327. The immunoprecipitates from ~500 µg of total
ventricular cell protein were washed three times with Src kinase
reaction buffer (100 mM Tris-HCl, pH 7.2, 125 mM
Mg(C2H3O2)2, 25 mM MnCl2, 2 mM EGTA, 0.25 mM sodium orthovanadate, 2 mM dithiothreitol),
and reactions were carried out using components of a commercially
available Src kinase assay kit (Upstate Biotechnology, Inc., Lake
Placid, NY). The assay is based on Src-dependent
phosphorylation of a substrate peptide (KVEKIGEGTYGVVYK) derived from
p34cdc2 (36). For the autophosphorylation assays,
immunoprecipitates were washed twice with kinase buffer (10 mM MnCl2, 10 mM PIPES, pH 7.4) and
incubated with kinase buffer plus 1 µCi of [ Immunofluorescence--
Cells were plated on round 12-mm
coverslips (Esco, Germany) coated with fibronectin (10 µg/ml) at a
density of 104 cells/cm2, treated with ET as
described above, and washed with ice-cold PBS three times. For staining
of Src, Yes, and Fyn, cells were fixed either in acetone at Endothelin Activates Src in Cultured Neonatal Cardiac
Myocytes--
Treatment of neonatal rat ventricular myocytes with 100 nM ET resulted in a time-dependent increment in
whole lysate tyrosine kinase activity, assessed by immunoblotting with
the anti-phosphotyrosine antibody (4G10) (Fig.
1). Accumulation of
phosphotyrosine-containing proteins in the lysates was maximal at 1 min
and began to fall after 5 min of exposure to the peptide.
Phosphotyrosine content of at least 10 cellular proteins, ranging from
~20 to 110 kDa was increased by treatment with ET. Prolonged exposure
of the film revealed fainter signals corresponding to higher molecular mass, phosphotyrosine-containing proteins (~120-200 kDa) (data not
shown).
Western blot analysis of immunoprecipitates of Src in these lysates
revealed no change in the levels of Src protein following treatment
with ET (Fig. 2A). However,
when the same blot was probed with an antibody that selectively
recognizes the activated form of Src (clone 28), an
ET-dependent increase in signal intensity was detected.
Pooled results from three independent experiments indicated a 2.95 ± 1.32-fold induction of activated Src following ET treatment (data
not shown).
The ET-dependent activation of Src implies stimulation of
the intrinsic tyrosine kinase activity associated with this protein. To
confirm this, we carried out an autophosphorylation assay (Fig. 2B) as well as a conventional Src kinase assay using a
synthetic peptide sequence derived from p34cdc2 (36) as the
target substrate (Fig. 2C). In both cases, ET provoked an
almost 7-fold increase in Src kinase activity, which peaked around 1 min and returned to near basal levels after 15 min of incubation. This
induction was largely blocked by inclusion of the nonselective tyrosine
kinase inhibitor genistein during ET stimulation (Fig.
2C).
Endothelin Activates Fyn and Yes in Cardiac Myocytes--
To
explore the possibility that other members of the Src family of
tyrosine kinases might be stimulated by ET, we examined extracts from
ET-treated cells for the presence of activated Fyn and Yes. As shown in
Fig. 3, Western blot analysis of
immunoprecipitates generated with anti-Fyn or anti-Yes antibodies
showed no change in the absolute levels of these two proteins following
ET treatment. However, when the same blots were reprobed with antibody
that selectively recognizes the activated forms of Yes or Fyn, a
time-dependent increase in levels of the individual
activated kinases was observed. These increases were present at 30 s and peaked at 2-15 min of ET exposure.
Endothelin Causes a Redistribution of c-Src, Fyn, and c-Yes in the
Cardiac Myocyte--
Activation of the Src family tyrosine kinases was
accompanied by changes in their topographical distribution within the
cell. Primary cultures of neonatal rat ventriculocytes were analyzed by
indirect immunofluorescence with polyclonal antibodies directed against
c-Src. In quiescent myocytes, two patterns of c-Src distribution were
apparent: a fine punctate staining throughout the cytoplasm and a
concentrated staining adjacent to the membrane (Fig.
4A). Treatment of cells with
ET for 120 s produced a striking redistribution of c-Src into
large nonuniform aggregates in a perinuclear distribution. The
ET-induced redistribution was reversible. After exposure to ET for 15 min, the original diffuse pattern of immunostaining returned (data not
shown). Staining with a monoclonal antibody (mAB 327) directed against
c-Src revealed a similar distribution pattern (data not shown). The
levels of Src immunoreactivity detected in mesenchymal cells
(i.e. primarily cardiac fibroblasts) present in these
cultures were considerably lower than those seen in cardiac myocytes.
A similar approach using antibody directed against Fyn (Fig.
4C) demonstrated an ET-dependent redistribution
of the kinase from a diffuse punctate pattern to spherical cytoplasmic
vesicles clustered in a perinuclear distribution. In the case of Yes
(Fig. 4B), ET promoted a redistribution from the diffuse
pattern seen in the quiescent myocyte to a pattern suggesting a linear
array of Yes molecules along the myofilaments of the cell, a
distribution that may imply an effect on the assembly and/or function
of the contractile apparatus. As in the case of c-Src, Fyn and Yes were detectable in quiescent mesenchymal cells but at much lower levels than
those seen in myocytes.
Src Increases ANP Promoter Activity--
Given the evidence
linking ET, independently, to activation of Src (22) and myocyte
hypertrophy (7), we sought to determine if Src could be linked
mechanistically to downstream markers of hypertrophy in this in
vitro system. To address this issue, we employed a transiently
transfected ANP promoter-driven reporter, a marker that has been shown
to respond to a number of different hypertrophic stimuli in this
in vitro model (7-10, 12). As shown in Fig.
5A, ET treatment effected
approximately a 3-fold increase in reporter activity, which was
suppressed by a dominant negative Ras mutant (N17S), by a dominant
negative Src mutant (K297M) or by Csk, a kinase that negatively
regulates Src activity through phosphorylation of Tyr527
near the carboxyl terminus of the molecule (37).
Forced expression of c-Src alone led to a significant trans-activation
of the hANP promoter (4.2-fold stimulation), and once again, this was
nearly completely reversed by cotransfection with the dominant negative
Ras mutant or, to a lesser extent, by Csk (~50-60% reduction).
Overexpression of v-Src had a significantly stronger effect on promoter
activation relative to c-Src (9.6- versus 4.2-fold). In the
course of several experiments, we noticed significant variation in the
extent of hANP promoter activation with the Src expression vectors, a
finding that could result from differences in endogenous c-Src activity
among the different primary cultures. The average induction by c-Src
was 3.8 ± 1.74-fold (mean ± S.E.), with a range of
2.4-5.3-fold. Trans-activation by v-Src, on the other hand, averaged
9.3 ± 2.54-fold, ranging from 6.9- to 14-fold (data compiled from
six different experiments, p < 0.05 for c-Src
versus v-Src). The v-Src induction was reversed following
cotransfection with the dominant negative Ras mutant; however, Csk, as
expected, was without effect, since Tyr527 is absent in
v-Src. Cotransfected Fyn or Yes expression vectors led to a more modest
increase in ANP-directed reporter activity (1.4- and 2.1-fold
inductions, respectively; neither increment reached statistical
significance), while Lck, a tyrosine kinase selectively expressed in
cells of the lymphoid lineage, was ineffective. The lack of activity
with Fyn and Yes is not likely to reflect variable levels of expression
(relative to Src). Titration of the vectors encoding these proteins
over a broad concentration range (0.5-10 µg of plasmid/transfection)
indicated that the concentrations used in Fig. 5 provided a maximal
level of induction (data not shown). Thus, the relative levels of hANP
CAT induction seen with Src, Yes, and Fyn is more likely to reflect
their intrinsic efficacy in stimulating promoter activity.
Next, we explored the functional link between tyrosine kinase activity
and ANP gene expression. Pretreatment of the cultures with a potent and
Src family-selective tyrosine kinase inhibitor PP1 (38) resulted in a
dose-dependent reduction in the ET-dependent increase in ANP mRNA levels (Fig.
6A), as well as c-Src-induced hANP promoter activity (Fig. 6B). A similar inhibition was
obtained in the presence of the less selective protein tyrosine kinase inhibitor, genistein (data not shown). By inference, the inductive properties of each (i.e. ET and Src) appear to be linked to
their tyrosine kinase activating properties in the cardiac myocyte.
Src Response Localizes to a CArG Motif on hANP Promoter--
We
next attempted to identify the Src-sensitive locus on the hANP
promoter. As shown in Fig. 7, activation
of the promoter was observed with 5' deletion mutants containing 1150 and 466 base pairs of 5'-flanking sequence; however, the induction was largely, although not completely, lost as the deletion was moved to
Finally, to confirm the importance of this locus to the ET-mediated
induction of hANP gene promoter activity, we tested the same constructs
in transiently transfected myocytes after different intervals of
exposure to the peptide. As shown in Fig.
10, ET effected a
time-dependent increase in the activity of wild type The findings presented here demonstrate that an agonist of
hypertrophy in the cardiac myocyte (i.e. endothelin) signals
at least a portion of its activity through Src-like nonreceptor
tyrosine kinases. We show that 1) ET stimulates the activity of c-Src, Fyn, and Yes in primary cultures of neonatal rat cardiac myocytes, 2)
ET-dependent induction of the hANP gene promoter requires
participation of c-Src, and 3) activation of the hANP promoter by
either c-Src or ET requires the presence of a CArG motif positioned
between Until recently, G protein-coupled receptors were thought to signal
selectively through a well defined group of enzymatic effectors (e.g. adenylyl cyclase and phospholipase C) and ion
channels, while activation of tyrosine kinases was largely seen as a
function of the cytokine and growth factor receptors. Recent
investigation has provided convincing support for G
protein-dependent activation of tyrosine kinase activity
(specifically Src family kinase activity) within target cells. Tyrosine
kinase activation by lysophosphatidic acid has been linked to the
By analogy to the growth factor receptors, activation of cellular
tyrosine kinases by norepinephrine, AII, and ET could account for a
significant portion of the growth-promoting properties that these
ligands display in cardiovascular tissues.
Each of the Src family kinases (i.e. c-Src, Fyn, and c-Yes)
that we examined was activated by ET. It is difficult at this stage to
determine the relative contribution of each in promoting the growth
response associated with hypertrophy. AII has been shown to promote
activation of the tyrosine kinase Fyn in ventricular myocytes (25) as
well as assembly of downstream signaling complexes (i.e.
Shc-Grb2-Sos) thought to be involved in hypertrophy. However, as seen
in Fig. 3, Src is considerably more effective than either Yes or Fyn in
stimulating at least one marker of hypertrophy (i.e. hANP
promoter activity), and dominant negative Src (43), which should
selectively antagonize Src activity, partially inhibited ET-dependent stimulation of the hANP gene promoter.
Furthermore, a recent study by Kuppuswamy et al. (44)
demonstrated cytoskeletal association of c-Src and focal adhesion
kinase, but not Fyn, in pressure-overloaded right ventricular
myocardium, lending further support to a specialized role for Src in
the hypertrophic process.
Previous studies carried out with cultured mesangial cells showed that
ET induction of the c-fos promoter requires activation of
c-Src (22, 23), a finding similar to that reported here. In the case of
the c-fos promoter, the activation depends upon the presence
of an intact CArG motif in the SRE, while the upstream Ets motif, which
is required for assembly of the ternary complex (specifically,
association of serum response factor (SRF) accessory protein (SAP) or
Elk-1 with SRF), proved to be dispensable. Subsequent analyses revealed
an additional requirement for a calcium/cAMP response element located
more proximally (23) in the c-fos promoter. In the present
study, the CArG motif in the hANP promoter also proved to be critical
for the response to Src and ET. The level of promoter induction by
v-Src was reduced from 7.2- to 2-fold when point mutations were
introduced into the CArG motif. As seen with the c-fos
promoter, mutation of the Ets binding site or an AP-1 binding site
located downstream from the CArG element had little effect on induction
by Src. The residual 2-fold induction of the CArG mutant by Src could
reflect the involvement of a second element (e.g. a
calcium/cAMP response element or a second, as yet unidentified, CArG
motif) in mediating the Src effect.
The lack of dependence of the ET induction on the Ets motif in the
promoter suggests that formation of a ternary complex is not required.
Although a number of studies have shown that growth factor activation
of the fos promoter (presumably through the MAP kinase
pathway) involves ternary complex formation (36, 45), other studies
have demonstrated that certain trophic stimuli (e.g. serum,
lysophosphatidic acid, and intracellular activators of heterotrimeric G
proteins) traffic through the SRF itself (46). This is believed to
result from activation of the Rho family of small G proteins
(i.e. Rho, Rac, and CDC42hs) and does not correlate with
activation of the MAP kinases (i.e. extracellular
signal-regulated kinase, stress-activated protein kinase/c-Jun
N-terminal kinase, or MPK2/p38) (47). Other studies have suggested that
some growth factors may signal the c-fos SRE through
selective phosphorylation of Ser103 in the SRF molecule
(48), a modification that could alter SRF's signaling capabilities
and/or binding kinetics on the SRE. ET-dependent activation
of the hANP promoter appears to conform to the ternary complex-independent paradigm, relying almost exclusively on the CArG
motif for the inductive effect. Similar conclusions have been drawn
with regard to the regulation of the rat ANP promoter by PHE (49). The
latter induction appears to signal through a CArG motif in the proximal
promoter of the gene without a requirement for ternary complex formation.
A unifying mechanism linking hypertrophic stimuli to enhanced gene
transcription in the cardiac myocyte is lacking. Activation of the
c-fos gene by passive mechanical stretch or AII depends upon
an intact serum response element (including Ets and CArG box binding
sites) in the promoter of that gene (42, 50). PHE- and protein kinase
C-dependent induction of the In summary, we have shown that the hypertrophic properties of ET in
cardiac myocytes traffic, at least in part, through c-Src. We have also
demonstrated that ET and Src activate the hANP gene promoter through a
discrete CArG motif present in the promoter without a requirement for
ternary complex formation. Collectively, these findings suggest a
potentially important role for c-Src as a mediator of cardiac hypertrophy.
We are grateful to Karl Nakamura for
excellent technical assistance. We are also grateful to J. Hanke from
Pfizer Central Research for providing PP1. We also acknowledge the
technical advice and helpful comments and suggestions of Drs. Clifford
Lowell, Eduardo Almeida, Hisaaki Kawakatsu, and Satoshi Kanazawa.
*
This work was supported in part by National Institutes of
Health Grant HL 35753 (to D.G.) and American Heart Association (AHA) Grant-in-Aid 9650083N (to C. D.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Supported by an AHA postdoctoral fellowship.
The abbreviations used are:
ANP, atrial
natriuretic peptide; hANP, human ANP; ET, endothelin; AII, angiotensin
II; PHE, phenylephrine; MAP, mitogen-activated protein; SRE, serum
response element; TK, thymidine kinase; PBS, phosphate-buffered saline; PIPES, 1,4-piperazinediethanesulfonic acid; SRF, serum response factor; Ets, E26 transformation-specific; CArG: CA-rich G, AP-1, activator
protein-1.
c-Src Activation Plays a Role in
Endothelin-dependent Hypertrophy of the Cardiac
Myocyte*
i
,
ko
Ili
§¶,
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
422 and 413 but did not appear to
require assembly of a ternary complex for full activity. These findings support a role for Src in the activation of ANP gene expression and
suggest that this kinase may contribute in an important way to the
signaling mechanisms that activate hypertrophy in the cardiac myocyte.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-myosin heavy chain, and
-skeletal actin) and subsequent up-regulation of sarcomeric
contractile proteins (e.g. myosin light chain-2 and cardiac
actin) (4). The high degree of fidelity with which ANP gene expression
is activated in this process has led to its identification as one of
the earliest and most reliable markers of hypertrophy. While no
in vitro system has been shown to mimic hypertrophy in
vivo with absolute fidelity, the neonatal rat cardiac myocyte
responds to a number of mechanical (e.g. passive stretch)
(5, 6) and biochemical (e.g. endothelin (ET) (7, 8),
angiotensin II (AII) (9), phenylephrine (PHE) (10), or growth factors
(11, 12)) stimuli with phenotypic changes that closely parallel those
seen with hypertrophy in the whole animal.
subunit-mediated increase in
Src-tyrosine kinase activity, which in turn leads to phosphorylation of
the Shc adapter protein, activation of the Shc-Grb2-Sos-Ras pathway, and increased MAP kinase activity (15-18).
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
1150 hANP
promoter fragment was cloned into pSVoLCAT vector, as
described previously (29, 30). 466 hANPCAT was constructed from
1150 hANPCAT by polymerase chain reaction (Perkin-Elmer) using an
upstream sense oligonucleotide
(5'-GGTCTAGAATTTGTCTCGGGCTGCTGG-3'), which incorporated an
XbaI site at its 5' terminus and downstream antisense oligonucleotide (5'-CCAGTACTAGACCAGGCTAGAGTGCAGTGGTGC-3') derived from
CAT coding sequence. Mutants in the serum response element (SRE)-like
element of the hANP gene were generated using the
TransformerTM site-directed mutagenesis kit from
CLONTECH (Palo Alto, CA). Mutagenic primers for the
Ets motif, CArG box, and AP-1 sites were
GGCTGCCTGCCATTTCCGTTGCTCCACCCTTAT,
TCCTCTCCACCCTTATGGTTAGGCCCTGACAGCTGA, and
GGCCCTGACTGAGATCCAAACAAACCAGGGG (reading 5' to 3' on the
sense strand, and where boldface type represent mutated nucleotides), respectively. The TKCAT hybrid gene, containing 109 base pairs of the
herpes simplex virus thymidine kinase (TK) promoter (positions 109 to
+47) fused to CAT, has been described previously (31). The following
restriction enzyme fragments of the hANP gene were subcloned into
pTKCAT and tested for regulatory activity:
BamHI/PvuII (positions 472/400),
PvuII/KpnI (positions 400/332),
KpnI/PvuII (positions 332/208), and
PvuI/HaeI (positions 208/+16). Wild type
472/372 TKCAT and its CArG mutant were generated by polymerase chain reaction using wild type 466 hANPCAT and its homologous CArG
mutant as templates; an upstream sense oligonucleotide
(5'-CTGCAGAAGCTTGGATCCATTTGTCTTCGGGCTGCTGGCT-3'), which incorporates
PstI and HindIII sites at the 5'-end, and a downstream antisense oligonucleotide
(5'-GTCGACAAGCTTCCAGCTCCCCTGGTTTGTTTG-3'), which incorporates
SalI and HindIII sites at the 3'-end, were used
to amplify the relevant fragments, which were then cloned into the
HindIII site of pTKCAT. All mutants and polymerase chain reaction-generated fragments were sequenced. Dominant negative Ras
(N17Ras) was provided by W. J. Fantl. pGK Csk was obtained from
Dr. Shigeyuki Nada. c-Src and v-Src came from Dr. J. A. Cooper, and the Y529F and K297M mutants of c-Src were from Dr. Tony Hunter. pMIK Neo Yes was from Dr. Marius Sudol, and SR Fyn and SR Lck were provided by Dr. Tadashi Yamamoto.
-actinin
(sarcomeric) monoclonal antibody (EA-53) was purchased from Sigma. All
secondary antibodies used for immunofluorescence were from Jackson
Laboratories (West Grove, PA); those used for Western blots were from
Amersham Pharmacia Biotech. Streptavidin conjugates were from Vector
Laboratories, Inc. (Burlingame, CA). Dynabeads M-280 (sheep anti-rabbit
IgG) were from Dynal A.S. (Oslo, Norway).
-galactosidase, typically
show less than 15% variation within a given experiment. After
transfection, each group was plated onto 6-cm dishes (15 × 104 cells/cm2) in DME-H21/10% EC. After the
initial 24 h, medium was changed to DME-H21/10% serum substitute
medium. Endothelin (10
7 M) was added at
different intervals thereafter. The cells were harvested at 66-72 h
post-transfection, and the cell lysates were assayed for CAT activity
and -galactosidase activity as described (33).
-32P]dCTP using the random primer
technique. Hybridizations were performed in Rapid-Hyb buffer (Amersham
Pharmacia Biotech) according to instructions of the manufacturer. Blots
were later stripped and reprobed with radiolabeled glyceraldehyde
phosphate dehydrogenase cDNA to control for differences in loading
and transfer of RNA among samples. To quantitate mRNA levels,
autoradiograms were scanned by laser densitometry.
-mercaptoethanol) and subjected to immunoblotting or the in
vitro kinase reaction. Lysates, normalized for protein content, or
immunoprecipitates were boiled in Laemmli sample buffer, electrophoretically separated on 12% polyacrylamide gel containing 1%
SDS, and transferred to a nitrocellulose membrane. Filters were blocked
in TBST (10 mM Tris-HCl at pH 8.0, 150 mM NaCl,
0.05% Tween 20)/5% skim milk buffer, except on those occasions when anti-phosphotyrosine antibodies were used, when 5% bovine serum albumin was exchanged for skim milk. Following treatment with a
blocking kit (Vector Laboratories), as recommended by the manufacturer, filters were immunoblotted with the appropriate antibody in 0.5-1 × TBST buffer for 60 min. Following a 30-min incubation with
biotinylated donkey anti-mouse (1:1000) and a 15-min incubation with
streptavidin-horseradish peroxidase conjugate (1:1000), immunoreactive
bands were visualized by enhanced chemiluminescence using the ECL
system (Amersham Pharmacia Biotech). When necessary, membranes were
stripped with 2% SDS in 62.5 mM Tris-HCl, pH 6.7, in the
presence of 200 mM -mercaptoethanol (freshly added) for
60 min at 50-60 °C. Following overnight blocking in TBST/1% skim
milk and treatment with a commercial blocking kit (Vector
Laboratories), membranes were reblotted with appropriate antibody, and
the protocol described above was repeated.
-32P]ATP
and 1 µM unlabeled ATP for 15 min. Reactions were
terminated by boiling in sample buffer. Samples were resuspended in
buffer and electrophoresed on 12% polyacrylamide gels containing 1% SDS.
20 °C
for 5 min or in 3.7% paraformaldehyde at room temperature for 20 min
and washed three times with PBS. When fixation was performed in
paraformaldehyde, cells were permeabilized for 2 min in 0.2% Triton
X-100/PBS. Fixed/permeabilized cells were then washed in PBS, blocked
with blocking kit (Vector Laboratories), and incubated in wet chambers
with primary antibody (1:100 dilution in PBS) overnight at 4 °C.
Following three successive 10-min washes in PBS, cells were incubated
for 30 min at room temperature with biotinylated donkey anti-rabbit or
rhodamine-conjugated goat anti-mouse secondary antibody diluted 1:100
in PBS. Cells were then washed three times in PBS for 10 min and
incubated for 15 min at room temperature with a 1:100 dilution of
fluorescein isothiocyanate-streptavidin. After sequential PBS washes
(three times, 10 min each), the cells were mounted with Vectashield
mounting medium (Vector Laboratories). Controls performed with only
secondary antibodies resulted in negligible signals. Conventional
epifluorescence microscopy was carried out using a Zeiss Axiophot
microscope. Photography was performed with Kodak TMAX 400 black and
white film.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (79K):
[in a new window]
Fig. 1.
Endothelin-1-dependent
accumulation of tyrosine-phosphorylated proteins in ventricular
myocytes. Freshly isolated ventricular myocytes (5 × 106) were plated in serum substitute media on 6-cm plates
coated with gelatin. 24 h post-plating, cells were treated with
100 nM ET for the indicated times. Whole cell lysates were
prepared as described under "Experimental Procedures." Samples were
gel-fractionated, transferred to nitrocellulose membranes, and
immunoblotted with anti-phosphotyrosine antibody (4G10). To verify
equal loading, the membrane was stained with Amido Black (data not
shown). Molecular mass markers are presented on the
right.
View larger version (19K):
[in a new window]
Fig. 2.
ET-1 stimulates Src kinase activity in
ventricular myocytes. Freshly prepared ventricular myocytes were
plated as described in the legend to Fig. 1. 24 h post-plating,
cells were stimulated for the indicated times with 100 nM
ET. Cells were washed and lysed, and protein extracts were made.
A, ET activates Src. 250 µg of each sample was
immunoprecipitated (ip) with rabbit polyclonal anti-Src
(N-16) and used for a quantitative immunoblot assay. Immunoprecipitates
were separated on 12% SDS-polyacrylamide gel electrophoresis and
electrotransferred to nitrocellulose membranes. These were probed with
mAB 327, which recognizes both inactive and active c-Src. Following
visualization of immune complexes by ECL, the membrane was washed and
reblotted with clone 28, a c-Src antibody that specifically recognizes
the active form of Src (anti-active Src). Results were quantified by
densitometric analysis, normalized for differences in loading, and
expressed as -fold activation compared with the untreated control.
B, ET stimulates c-Src autophosphorylation. The kinase
reaction was performed as described under "Experimental
Procedures." Approximately 1.5 units of purified recombinant c-Src
was used in a parallel reaction as a positive control (ctl).
Samples were size-fractionated by SDS-polyacrylamide gel
electrophoresis. Autophosphorylation of the Src protein was assessed by
autoradiography and quantitated by densitometry. A representative
autoradiogram is presented at the top. Results were
quantified by densitometric analysis, normalized for differences in
loading, and expressed as-fold activation compared with the untreated
cells. Each analysis was repeated three times with similar results
(A and B). C, ET stimulates Src kinase
activity. Freshly prepared ventricular cardiocytes were plated as
above. 24 h post-plating, one set of plates was pretreated with
360 µM genistein, while the other was left untreated.
Thirty minutes after the addition of genistein, cells were stimulated
with 100 nM ET for the times indicated. c-Src was
immunoprecipitated from cell lysates (0.5 mg) by a Src-specific
monoclonal antibody (mAB 327). In vitro activity was
assessed by using exogenous substrate, a peptide (KVEKIGEGTYGVVYK)
derived from p34cdc2 (Upstate Biotechnology, Inc.), as
described under "Experimental Procedures." Pooled data from three
independent experiments (normalized to the untreated controls in each
case) are presented as the means ± S.E.
View larger version (25K):
[in a new window]
Fig. 3.
Activation of Fyn and Yes in ET-treated
ventricular cardiocytes. Fyn and Yes were immunoprecipitated
(ip) from cell lysates (250 µg) using rabbit polyclonal
anti-Yes (c-Yes3) and anti-Fyn (FYN3) antibodies. Immunoprecipitates
were separated on 12% SDS-polyacrylamide gel electrophoresis and
electrotransferred to nitrocellulose membranes. These were probed with
monoclonal antibodies Fyn301 and Yes3H9, which recognize both inactive
and active forms of Fyn and Yes, respectively (top
panels). Following visualization of immune complexes by ECL,
the membranes were washed and reblotted with antibody (clone 28) that
specifically recognizes only active forms of Fyn and Yes
(bottom panels). Results were quantified by
densitometric analysis, normalized for differences in loading, and
expressed as -fold activation compared with untreated control. Each
analysis was repeated three times with similar results.
View larger version (63K):
[in a new window]
Fig. 4.
ET-induced translocation of Src kinase family
members in ventricular myocytes. Myocytes were treated with 100 nM ET for 120 s and fixed with either cold acetone
(for c-Src and Fyn staining) or with 3.7% paraformaldehyde (c-Yes) and
processed for immunofluorescence microscopy as described under
"Experimental Procedures." Cells were double stained with
monoclonal antibodies directed against sarcomeric -actinin (detected
with rhodamine) and polyclonal antibodies directed against c-Src (SRC2)
(A), c-Yes (c-Yes 3) (B), or Fyn (FYN3)
(C) (each detected with fluorescein isothiocyanate).
Control, no additions; ET-treated, cells treated
with ET (107 M) for 120 s. -Actinin
staining was used to identify myocytes (versus nonmyocytes)
in the population. In A-C, arrowheads identify
Src, Yes, or Fyn signals, respectively, in ventricular cardiocytes;
arrows identify same kinases in cardiac mesenchymal cells
(i.e. fibroblasts). All images are magnified ×1000.
View larger version (18K):
[in a new window]
Fig. 5.
Src- and ET-dependent activation
of the ANP gene requires functional tyrosine kinase activity.
A, effect of dominant negative c-Src (Src K297M), dominant
negative Ras (N17Ras) or Csk on ET- and Src-activated hANP promoter
activity. Neonatal rat ventricular myocytes were transfected with
1150 hANPCAT (25 µg) alone (CTL) or together with 5 µg
of Csk; 5 µg of SrcK297M; 5 µg of N17Ras; 1 µg of c-Src, v-Src,
Fyn, Yes, or Lck; or in combination with 1 µg of c-Src plus 5 µg of
Csk, 1 µg of c-Src plus 5 µg of N17Ras, 1 µg of v-Src plus 5 µg
of Csk, or 1 µg of v-Src plus 5 µg of N17Ras. Cells were incubated
24 h in 10% serum substitute medium in the absence or, where
stated, in the presence of 100 nM ET-1. Twenty-four hours
later, cell lysates were processed for CAT activity as described under
"Experimental Procedures." CAT activity
([3H]acetylchloramphenicol produced) was measured in
equivalent amounts of soluble protein (100 µg) for each reaction.
Results are expressed as -fold activation over basal 1150 hANPCAT
activity and represent the average of three separate experiments done
in triplicate. **, p < 0.05 compared with CTL; ++,
p < 0.01 compared with CTL; *,
p < 0.01 compared with ET-stimulated -1150 hANPCAT; #,
p < 0.05 compared with ET-stimulated 1150 hANPCAT;
+, p < 0.01 compared with c-Src-stimulated 1150
hANPCAT expression; ##, p < 0.01 compared with
v-Src-stimulated 1150 hANPCAT.
View larger version (18K):
[in a new window]
Fig. 6.
Inhibition of tyrosine kinase activity by PP1
prevents ET or Src-induced transactivation of ANP gene expression.
A, Northern blot analysis of ET-dependent ANP
gene expression. Cells were treated for 24 h either with vehicle
or ET (10 7 M), in the presence or absence of
the Src family-selective kinase inhibitor PP1. Total RNA was isolated,
size-fractionated on formaldehyde/agarose gels, transferred to
nitrocellulose, and hybridized to a radiolabeled rat ANP cDNA.
Following autoradiography, the blot was stripped and reprobed with
radiolabeled glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA.
The top part of A depicts a
representative experiment. The bottom part
presents results of quantitative densitometric analyses of three
separate experiments. Values (mean ± S.E.) are normalized for
glyceraldehyde phosphate dehydrogenase signal in each sample and
expressed relative to the control. B, cells were transfected
with 1150 hANPCAT (25 µg) alone (CTL) or in the presence
of 1 µg of c-Src. Twenty-four hours later, the indicated
concentration of PP1 was added to half the cultures, and extracts were
generated after an additional 24-h incubation. Results represent the
means ± S.E. of three individual experiments performed in
duplicate. +, p < 0.01 compared with control; ++,
p < 0.05 compared with control. *,
p < 0.01; **, p < 0.05 compared with
ET-stimulated hANP RNA (A) or Src-stimulated hANPCAT
reporter (B).
222, implying the presence of a Src-sensitive element or elements between 466 and 222 in this promoter. We generated a number of
restriction fragments spanning this region and introduced them upstream
from the core viral thymidine kinase gene promoter linked to CAT. Of
the group of reporters analyzed, only constructs harboring sequence
spanning the region between 472 and 400 proved to be activable by
v-Src (Fig. 8) (v-Src was selected to
provide maximal levels of promoter activity). Examining the sequence of
this fragment, we identified a region structurally homologous to the
serum response element (SRE) of the c-fos promoter, a locus
that has previously been identified as a target of Src in cultured
glomerular mesangial cells (22). Like the c-fos SRE (39),
the SRE-like structure of the hANP gene promoter features a CArG
element at its core with a potential Ets binding motif located in close
proximity, upstream from CArG. There is, in addition, a structure
similar to an AP-1 binding element 3' from CArG that also has a
homologue in the c-fos promoter (Fig.
9B). We examined the role of
each of these three structural elements, alone and in combination, as
potential cis-acting mediators of the Src effect. Site-directed mutations were introduced within the context of 466 hANPCAT and examined for functional response to a cotransfected v-Src expression vector. As shown in Fig. 9A, mutation of the CArG element or
the AP-1 binding site resulted in a decrease in basal promoter activity to approximately 50% of the control level, while mutation of the Ets
binding site, the site responsible for ternary complex assembly on the
c-fos promoter (40), was without effect. Furthermore, while
mutation of the CArG motif resulted in a significant decrease in the
level of induction by v-Src, mutation of the AP-1 or Ets binding site
was almost completely ineffective. Introduction of the same mutation in
the CArG binding site into 100 TKCAT (harboring the region between
472 and 372 in the hANP promoter) significantly decreased v-Src
sensitivity (10.2- versus 2.9-fold induction) (Fig. 8).
These findings suggest that the CArG motif plays a dominant role in
mediating Src-dependent activation of the hANP
promoter.
View larger version (17K):
[in a new window]
Fig. 7.
Mapping the region of hANP promoter that
confers Src sensitivity. Ventricular cardiocytes were transfected
with 25 µg of SV0LCAT or the individual hANPCAT
5'-deletion mutant in the absence (basal) or presence of 1 µg of
v-Src expression vector. The hANP promoter constructs are identified by
the 5'-border of the included hANP gene sequence. Cells were cultured
and assayed for CAT activity as described in the legend of Fig. 5. CAT
activity is expressed in cpm of [3H]acetylchloramphenicol
produced per 100 µg of protein and represents the average of 3-5
separate experiments done in triplicate. *, p < 0.01 versus reporter alone (without v-Src).
View larger version (13K):
[in a new window]
Fig. 8.
Localization of Src-dependent
element in hANP promoter. A schematic representation of hANP
promoter fragments in a heterologous promoter context is shown. The
inclusive sequence for each construct is identified at the termini of
the individual fragments. 472/372 TKCAT MUT contains the CArG box
(positions 423/413) mutation described under "Experimental
Procedures." Ventricular myocytes were transfected with 15 µg of
the indicated constructs in the absence or presence of 1 µg of the
v-Src expression vector. Cells were cultured and processed for CAT
activity as described under "Experimental Procedures." Data
presented are representative of three separate experiments done in
duplicate.
View larger version (14K):
[in a new window]
Fig. 9.
v-Src signals through a CArG box in the hANP
SRE-like element but does not require the Ets or AP-1 binding
sites. A, ventricular cardiocytes were transfected with
the hANP promoter constructs harboring the point mutations indicated
(25 µg each) alone or together with 1 µg of the v-Src expression
vector. CAT activity is expressed in cpm/100 µg of protein; the
numbers to the right of the columns represent the
-fold induction relative to the control without v-Src for each
construct. Ets, CArG, and AP-1 motifs are presented schematically as
ovals, rectangles, or circles,
respectively. Mutated cis-elements are indicated with the
solid symbols; wild type sequence is indicated by
the open symbols. Results are presented as the
means ± S.E. of 3-6 independent experiments performed in
duplicate. *, p < 0.01; **, p < 0.05 versus control (CTL). B, DNA sequence
of the wild type and point mutations in the hANP SRE-like element used
in this experiment. Ets binding site, CArG box, and AP-1 site are
identified with a horizontal arrow or
brackets, respectively. Point mutations are illustrated in
italic letters.
1150
and 466 hANPCAT reporters. The induction was largely suppressed by introduction of a single mutation into the CArG element or by a triple
mutation (i.e. at the CArG, Ets, and AP-1 motifs) into the
466 hANPCAT reporter.
View larger version (16K):
[in a new window]
Fig. 10.
Stimulation of hANP promoter by ET requires
the CArG box. Neonatal rat ventriculocytes were transfected by
electroporation with 25 µg of the indicated hANPCAT expression
vector. Twenty-four hours later, cells were incubated in the absence
(0) or presence of 100 nM ET for the times
indicated. Cell extracts were prepared and analyzed for CAT assay. The
results presented are representative of three experiments, each carried
out in triplicate on different cultures. Results are expressed as -fold
activation over basal activity of hANPCAT reporter indicated. *,
p < 0.01 versus reporter alone.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
422 and 413 in that promoter. This demonstrates, for the
first time, that the hANP gene represents a downstream target for c-Src and suggests a role for c-Src in promoting cardiac hypertrophy.
- rather than -subunits of the associated G protein complex
(15), implying that the activation involves a novel mechanistic
pathway. Liganded - and -adrenergic, AII, and ET receptors have
been shown to stimulate tyrosine kinase activity (19, 23, 41, 42), and
in some cases, tyrosine kinase inhibitors have been shown to block
their effects (6, 24).
-myosin heavy chain gene
requires the presence of an M-CAT site in the proximal promoter (51).
Activation of the skeletal -actin gene by PHE (52), as well as tumor
growth factor- (12), requires intact M-CAT, CArG, and Sp-1 binding
sites. A CArG motif in the same promoter has been linked to activation
by basic fibroblast growth factor (53). The activation of the rat ANP
gene by PHE (49) or electrical depolarization (54) requires an intact CArG motif and a GC-rich phenylephrine response element, a structure resembling an Sp-1 binding site (49, 55), while PHE induction of the
rat brain natriuretic peptide gene is heavily dependent upon an M-CAT
site between 109 and 102 in that promoter (56). Thus, there is
considerable heterogeneity in the molecular circuitry used by
ventricular myocytes to link hypertrophic stimuli to the activation of
gene expression. A second CArG motif positioned further upstream in the
rat ANP promoter has been shown to interact with its proximal homologue
in regulating transcriptional activity (49). It will be of interest to
determine whether a similar motif is present in the proximal human
promoter and, more importantly, whether it subserves the same type of
regulatory function.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Metabolic Research
Unit, Box 0540, UCSF, San Francisco, CA 94143. Tel.: 415-476-2729; Fax:
415-476-1660; E-mail: branka{at}itsa.ucsf.edu.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
i-Milivojevic, B.,
Lapointe, M. C.,
Nakamura, K.,
and Gardner, D. G.
(1991)
Mol. Endocrinol.
5,
1311-1322i-Milivojevic, B.,
and Gardner, D. G.
(1992)
Mol. Cell. Biol.
12,
292-301
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. Ramseger, R. White, and S. Kroger Transmembrane Form Agrin-induced Process Formation Requires Lipid Rafts and the Activation of Fyn and MAPK J. Biol. Chem., March 20, 2009; 284(12): 7697 - 7705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Yogi, G.E. Callera, A.C.I. Montezano, A.B. Aranha, R.C. Tostes, E.L. Schiffrin, and R.M. Touyz Endothelin-1, but not Ang II, Activates MAP Kinases Through c-Src-Independent Ras-Raf-Dependent Pathways in Vascular Smooth Muscle Cells Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): 1960 - 1967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Gardner, S. Chen, D. J. Glenn, and C. L. Grigsby Molecular Biology of the Natriuretic Peptide System: Implications for Physiology and Hypertension Hypertension, March 1, 2007; 49(3): 419 - 426. [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Chen, T.-H. Cheng, H. Lin, N.-L. Shih, Y.-L. Chen, Y.-S. Chen, C.-F. Cheng, W.-S. Lian, T.-C. Meng, W.-T. Chiu, et al. Reactive Oxygen Species Generation Is Involved in Epidermal Growth Factor Receptor Transactivation through the Transient Oxidization of Src Homology 2-Containing Tyrosine Phosphatase in Endothelin-1 Signaling Pathway in Rat Cardiac Fibroblasts Mol. Pharmacol., April 1, 2006; 69(4): 1347 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Brown, M. McGuinness, T. Wright, X. Ren, Y. Wang, G. P. Boivin, H. Hahn, A. M. Feldman, and W. K. Jones Cardiac-specific blockade of NF-{kappa}B in cardiac pathophysiology: differences between acute and chronic stimuli in vivo Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H466 - H476. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Eghbali, R. Deva, A. Alioua, T. Y. Minosyan, H. Ruan, Y. Wang, L. Toro, and E. Stefani Molecular and Functional Signature of Heart Hypertrophy During Pregnancy Circ. Res., June 10, 2005; 96(11): 1208 - 1216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. G Proud Ras, PI3-kinase and mTOR signaling in cardiac hypertrophy Cardiovasc Res, August 15, 2004; 63(3): 403 - 413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. O. Rybin, J. Guo, A. Sabri, H. Elouardighi, E. Schaefer, and S. F. Steinberg Stimulus-specific Differences in Protein Kinase C{delta} Localization and Activation Mechanisms in Cardiomyocytes J. Biol. Chem., April 30, 2004; 279(18): 19350 - 19361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kodama, K. Fukuda, E. Takahashi, S. Tahara, Y. Tomita, M. Ieda, K. Kimura, K. M. Owada, K. Vuori, and S. Ogawa Selective Involvement of p130Cas/Crk/Pyk2/c-Src in Endothelin-1-Induced JNK Activation Hypertension, June 1, 2003; 41(6): 1372 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Ilic, B. Kovacic, S. McDonagh, F. Jin, C. Baumbusch, D. G. Gardner, and C. H. Damsky Focal Adhesion Kinase Is Required for Blood Vessel Morphogenesis Circ. Res., February 21, 2003; 92(3): 300 - 307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. S. Oh, H. Kwon, S. K. Sun, and C.-H. Yang QM, a Putative Tumor Suppressor, Regulates Proto-oncogene c-Yes J. Biol. Chem., September 20, 2002; 277(39): 36489 - 36498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Li, J. Regezi, F. P. Ross, S. Blystone, D. Ilic, S. P. L. Leong, and D. M. Ramos Integrin {alpha}v{beta}3 mediates K1735 murine melanoma cell motility in vivo and in vitro J. Cell Sci., March 9, 2002; 114(14): 2665 - 2672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Gilmore, M. J. Stutts, and S. L. Milgram Src Family Kinases Mediate Epithelial Na+ Channel Inhibition by Endothelin J. Biol. Chem., November 2, 2001; 276(45): 42610 - 42617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Steinberg G protein-coupled receptor kinases: gotta real kure for heart failure? J. Am. Coll. Cardiol., August 1, 2001; 38(2): 541 - 545. [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kovacic-Milivojevic, F. Roediger, E. A.C. Almeida, C. H. Damsky, D. G. Gardner, and D. Ilic Focal Adhesion Kinase and p130Cas Mediate Both Sarcomeric Organization and Activation of Genes Associated with Cardiac Myocyte Hypertrophy Mol. Biol. Cell, August 1, 2001; 12(8): 2290 - 2307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. He and M. C. LaPointe Src and Rac Mediate Endothelin-1 and Lysophosphatidic Acid Stimulation of the Human Brain Natriuretic Peptide Promoter Hypertension, February 1, 2001; 37(2): 478 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chen, J. Cui, K. Nakamura, R. C. J. Ribeiro, B. L. West, and D. G. Gardner Coactivator-Vitamin D Receptor Interactions Mediate Inhibition of the Atrial Natriuretic Peptide Promoter J. Biol. Chem., May 12, 2000; 275(20): 15039 - 15048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-K. Chen, J. Capdevila, and R. C. Harris Overexpression of C-terminal Src Kinase Blocks 14,15-Epoxyeicosatrienoic Acid-induced Tyrosine Phosphorylation and Mitogenesis J. Biol. Chem., April 28, 2000; 275(18): 13789 - 13792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ritchie, F. M. Boyd, J. Wong, and K. Bonham Transcription of the Human c-Src Promoter Is Dependent on Sp1, a Novel Pyrimidine Binding Factor SPy, and Can Be Inhibited by Triplex-forming Oligonucleotides J. Biol. Chem., January 14, 2000; 275(2): 847 - 854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sarnago, A. Elorza, and F. Mayor Jr. Agonist-dependent Phosphorylation of the G Protein-coupled Receptor Kinase 2 (GRK2) by Src Tyrosine Kinase J. Biol. Chem., November 26, 1999; 274(48): 34411 - 34416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. S. Kasi and D. Kuppuswamy Inhibition of Src Family Kinases by a Combinatorial Action of 5'-AMP and Small Heat Shock Proteins, Identified from the Adult Heart Mol. Cell. Biol., October 1, 1999; 19(10): 6858 - 6871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. H. Sugden Signaling in Myocardial Hypertrophy : Life After Calcineurin? Circ. Res., April 2, 1999; 84(6): 633 - 646. [Full Text] [PDF]
|
|
|
|
|
|
M. Haas, A. Askari, and Z. Xie Involvement of Src and Epidermal Growth Factor Receptor in the Signal-transducing Function of Na+/K+-ATPase J. Biol. Chem., September 1, 2000; 275(36): 27832 - 27837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Taylor, J. D. Rovin, and J. T. Parsons A Role for Focal Adhesion Kinase in Phenylephrine-induced Hypertrophy of Rat Ventricular Cardiomyocytes J. Biol. Chem., June 16, 2000; 275(25): 19250 - 19257. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |