| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 35216-35221, December 25, 1998
From the Apolipoprotein (apo) B100 is an
atypical secretory protein in that its translocation across the
endoplasmic reticulum membrane is inefficient, resulting in the partial
translocation and exposure of apoB100 on the cytoplasmic surface of the
endoplasmic reticulum. Cytosolic exposure leads to the association of
nascent apoB with heat shock protein 70 and to its predisposition to
ubiquitination and proteasomal degradation. The basis for the
inefficient translocation of apoB100 remains unclear and controversial.
To test the hypothesis that Apolipoprotein (apo)1
B100 is the major protein of atherogenic very low density and low
density lipoproteins (1). There is a wide range of apoB100 secretion
from the liver in humans, and overproduction of very low density
lipoprotein and low density lipoprotein is a common feature of human
dyslipidemia (2). ApoB100 is a constitutively synthesized protein (3),
and the secretion of apoB is regulated at the posttranslational level, where the availability of newly synthesized core lipids seems to
facilitate the translocation of the nascent polypeptide and targets it
for secretion rather than degradation via the proteasomal pathway
(3-8). The basis for the posttranslational regulation of apoB100 seems
to derive from the fact that it is an atypical secretory protein whose
translocation across the endoplasmic reticulum (ER) membrane is
inefficient, resulting in only a partial translocation of a significant
portion of nascent apoB100 and hence the exposure of apoB100 on the
cytoplasmic surface of the ER (9-14). Cytosolic exposure of apoB100
leads to its association with heat shock protein 70 (7, 15) and a
predisposition to ubiquitination and proteasomal degradation (7, 16).
Indeed, we have recently shown that ubiquitination of apoB can occur
cotranslationally (17).
The basis for the inefficient translocation of apoB100 remains unclear
and controversial (18-21). ApoB100 contains 4536 amino acids and is
predicted to be comprised of three amphipathic Reagents--
N-Acetyl-leucyl-norleucinal (ALLN), OA,
Triton X-100 and protein A-Sepharose CL 4B were purchased from Sigma
Chemical Co. ALLN was used at a concentration of 100 µM,
OA was used at a concentration of 0.4 mM, Triton X-100 was
used at 0.5%, and protein A-Sepharose CL 4B was used at 0.2%.
Synthetic lactacystin and rabbit anti-human apoB polyclonal antibody
were purchased from Calbiochem-Novabiochem International. Lactacystin
was used at a concentration of 10 µM. Sheep anti-human
apoB polyclonal antibody was purchased from Boehringer Mannheim.
Transfectam was purchased from Promega; LipofectAMINE was purchased
from Life Technologies, Inc. MTP inhibitor CP-10447 was provided by
Pfizer Inc. (27). L-[4,5-3H]leucine was
purchased from Amersham with a specific activity of 147 Ci/mmol and
used at a concentration of 150 µCi/ml.
Growth of Cells--
HepG2 cells and CHO cells obtained from the
American Type Culture Collection were grown as described previously
(5). Briefly, cells were maintained at 37 °C, 5% CO2 in
0.1 mM nonessential amino acids, 1 mM sodium
pyruvate, 100 units/ml penicillin, 100 µg/ml streptomycin, and 10%
fetal bovine serum. The medium was changed every 3 days, and
experiments were started after the cells reached 70-90% confluence.
During the experiments, cells were maintained at 37 °C, 5%
CO2 in serum-free minimum Eagle's medium containing 1.5%
bovine serum albumin with the indicated additions or treatments.
In transfection experiments, HepG2 or CHO cells were treated with
Transfectam or LipofectAMINE with or without apoB cDNAs. After
36 h, cells were labeled with
L-[4,5-3H]leucine for 2 h in the
presence or absence of the indicated additions or treatments. Cell
lysates and conditioned medium were analyzed by immunoprecipitation
with either rabbit anti-human apoB polyclonal antibodies or sheep
anti-human apoB polyclonal antibodies. Both antibodies gave similar
immunoprecipitation results.
Construction of ApoB13,16 and ApoB13,13,16 Expression
Plasmids--
The apoB16 expression plasmid pB515 (15) was digested
with EheI and BsrFI and subsequently
SalI to liberate a 2308-base pair
EheI-SalI fragment initiating at nucleotide 211 of the apoB cDNA (residue Insertion of the ApoB34 and ApoB42 Constructs--
ApoB34 and apoB42 are
carboxyl-terminal truncations of apoB100 that have Microsome Isolation and Digestion with Proteinase
K--
Microsomes were prepared according to methods described
previously (12). Briefly, transfected cells from two 100-mm dishes were
combined and disrupted by 20 passes through a ball-bearing homogenizer.
Intact cells and nuclei were removed by centrifugation for 10 min at
9,000 × g, and the microsomes were isolated after centrifugation for 1 h at 105,000 × g. The
microsomes were incubated with or without proteinase K (PK) (50 µg/ml) or Triton X-100 (0.5%) for 30 min on ice. After digestion,
phenylmethylsulfonyl fluoride (3 mM) was added, and the
samples were incubated for another 5 min on ice. The samples were then
recentrifuged, and the microsome pellets were dissolved in lysis buffer
and analyzed by immunoprecipitation.
Immunoprecipitation--
Immunoprecipitation of apoB in medium
and cell lysates was carried out according to the methods of Wu
et al. (29). Briefly, after the samples were incubated on a
shaker for 10 h at 4 °C with an excess amount of anti-apoB
antiserum, the immune complex was precipitated by an additional 3-h
incubation with protein A-Sepharose CL 4B. The samples were analyzed on
either 3-15 or 4% SDS-polyacrylamide gels.
Densitometry--
Immunoprecipitates were subjected to
SDS-polyacrylamide gel electrophoresis and further analyzed by
densitometry using a Molecular Dynamics densitometer. Data were
expressed as relative densitometric units.
Translocation Efficiency of ApoB Across the ER Membrane Is
Determined by the Presence of
Thirty-six h after HepG2 cells were transiently transfected with apoB
cDNAs, cells were labeled for 2 h with
[3H]leucine. Microsomes were then isolated and subjected
to PK digestion in vitro to provide an estimate of
translocation efficiency. After PK digestion, immunoreactive bands of
full-length apoB100 and apoB42, two
Similar experiments were carried out using the chimeric construct
apoB13,16,
Inefficient translocation of Susceptibility to Proteasomal Degradation and Responsiveness to OA
Treatment Are Determined by the Presence of
To directly assess the involvement of the
To further test the sensitivity of
These data suggest that the amphipathic The Sensitivity of ApoB to MTP Inhibition Is Determined by the
Presence of
HepG2 cells were transiently transfected with apoB cDNAs and
labeled with [3H]leucine for 2 h in the presence or
absence of MTP inhibitor. When HepG2 cells were incubated with 100 µM of the MTP inhibitor CP-10447, the cell levels of
apoB42, apoB13,16, Efficient co-translational insertion into the translocon and
translocation across the ER membrane have been a well-accepted model
for the initial processing of secretory proteins (35, 36). Evidence
accumulated during the past 10 years, however, has indicated that the
initial intracellular transport of apoB100 does not fit this paradigm
(5, 37). In particular, it appears that after normal insertion of the
amino-terminal of nascent apoB into the translocon, further
translocation is either relatively slow or actually stops, resulting in
a breakdown of the typical segregation of secretory proteins from the
cytosol. In the present studies, we have attempted to gain insight into
the molecular basis for the inefficient translocation across the ER
membrane of the secretory protein apoB100. The importance of this
"aberrant" processing of apoB100 is that inefficient translocation
is likely to be a major regulatory step that determines how many
apoB100-containing lipoproteins are assembled and secreted by the liver
(5, 37). Our present results strongly indicate that hydrophobic The results from PK digestion experiments in isolated microsomes
indicated that the difference in sensitivity to PK-induced degradation
between apoB42, apoB34, and apoB13,16, Incomplete translocation of apoB100 across the ER membrane results in a
bitopic orientation of apoB100 in which some domains are exposed to the
cytosol, and some are exposed to the ER lumen (9-14, 38). Although the
availability of lipoprotein core lipids is regarded as the most crucial
physiological factor governing the proportion of nascent apoB
polypeptides that are secreted or degraded (3-7), the regulatory roles
of molecular chaperones, such as heat shock protein 70 in the cytosol
and MTP in the lumen of the ER, have also been demonstrated (6, 7, 15).
In a recent report by Chen et al. (39), calnexin was also
shown to be involved in the translocation of apoB100. In the absence of
adequate core lipid availability, apoB associates with heat shock
protein 70 and undergoes rapid intracellular degradation by the
ubiquitin-mediated proteasomal degradation pathway (7, 15, 16). Using
the human apoB chimeric constructs (apoB13,16, apoB13,13,16, and
apoB13,16, MTP is required for efficient apoB translocation (6, 29, 30), and MTP
and apoB100 physically interact (29, 32). We previously showed that
both posttranslational and co-translational ubiquitination and
proteasomal degradation of apoB100 are significantly increased when
apoB translocation is arrested by an inhibition of MTP (7, 17). Our
present studies addressed the question of whether MTP inhibition
affects apoB Although the possibility that the putative topogenic "pause transfer
sequences" (18, 19) may lead to a transmembrane topology is not
excluded by these studies, our results have demonstrated clearly that
the translocation efficiency of apoB100 can be determined by the
presence of hydrophobic In conclusion, our results from experiments with both carboxyl-terminal
truncations of full-length apoB100 and chimeric apoB constructs with or
without a *
This work was supported by National Institutes of Health
Grants HL55638 and T32HL07343.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of Medicine,
P & S 9-510, Columbia University, 630 W. 168th St., New
York, NY 10032. E-mail: ginsbhe{at}cudept.cis.columbia.edu.
The abbreviations used are:
apo, apolipoprotein; ALLN, N-acetyl-leucinyl-leucinyl-norleucinal; CHO, Chinese
hamster ovary; ER, endoplasmic reticulum; MTP, microsomal triglyceride
transfer protein; PK, proteinase K; OA, oleic acid.
2
J. Liang, H. Jiang, L.-S. Huang, S. L. Sturley,
and H. Ginsberg, unpublished data.
3
Mitchell, D. M., Zhou, M., Pariyarath, R., Wang,
H., Aitcheson, J. D., Ginsberg, H. N., and Fisher, E. A., Proc.
Natl. Acad. Sci. U. S. A., in press.
Translocation Efficiency, Susceptibility to Proteasomal
Degradation, and Lipid Responsiveness of Apolipoprotein B Are
Determined by the Presence of 
Sheet Domains*
,,,,,,¶
Department of Medicine and the
§ Institute of Human Nutrition, College of Physicians and
Surgeons of Columbia University, New York, New York 10032
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
sheet domains present in apoB100
contribute to its inefficient translocation, we created human apoB
chimeric constructs apoB13,16 and apoB13,13,16, which contain
amino-terminal 
globular domains but no sheet domains, and
apoB13,16,, which has an amphipathic sheet domain of apoB100
inserted into apoB13,16. These constructs, along with carboxyl-terminal
truncations of apoB100, apoB34 and apoB42, were used to transfect HepG2
and Chinese hamster ovary cells. In contrast to the lack of effect of
proteinase K on apoB13,16 and apoB13,13,16, the levels of apoB34,
apoB42, and apoB13,16, were decreased by 70-85% after proteinase
K-induced proteolysis in both HepG2 and Chinese hamster ovary cells.
Either oleic acid or proteasomal inhibitors
(N-acetyl-leucinyl-leucinyl-norleucinal and lactacystin)
significantly increased the cell levels of apoB13,16,, apoB34,
apoB42, and full-length apoB100 but had no effect on the cell levels of
apoB13,16 and apoB13,13,16. When HepG2 cells were incubated with a
microsomal triglyceride transfer protein inhibitor, the cellular levels
of apoB13,16,, apoB34, and apoB42 were decreased by 70-80%,
whereas the levels of apoB13,16 and apoB13,13,16 were unaffected. The
effects of microsomal triglyceride transfer protein inhibition were
reversed by lactacystin. Our results clearly demonstrate that the
translocation efficiency, susceptibility to proteasomal degradation,
and lipid responsiveness of apoB were determined by the presence
of a lipid binding sheet domain. It is possible that sheet
domains may at least transiently facilitate the interaction of apoB
with the lipid bilayer surrounding the translocation channel.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
helix domains and
two amphipathic sheet domains (22). One of the sheet domains is
located between amino acids at about 18 and 43% of full-length apoB100
and may participate in apoB100 translocation arrest by a hydrophobic
interaction with the ER membrane (23-25). The sheet domain also
seems to be responsible for lipid binding and very low density
lipoprotein assembly (26). To directly test the hypothesis that sheet domains determine apoB100 translocation efficiency, we created
human apoB chimeric constructs containing repeats of the first 13-16%
of full-length apoB100. These constructs, apoB13,16 and apoB13,13,16,
contain the amino-terminal globular domains of apoB100, but no sheet domains. These constructs were equal in length to the first 29 and 42% of apoB100, respectively. We also constructed apoB13,16, in
which the amphipathic sheet domain situated between 28 and 34% of
full-length apoB100 was inserted into apoB13,16 at either 9.5% of the
construct or at 22.5% of the construct. The length of the
apoB13,16, constructs was equal to 35% of full-length apoB100. The
efficiency of translocation, susceptibility to proteasomal degradation,
responsiveness to oleic acid (OA) treatment, and sensitivity to the
inhibition of microsomal triglyceride transfer protein (MTP) activity
of these chimeric proteins were compared with the same properties for
full-length apoB100 and for the carboxyl-terminal truncations apoB34
and apoB42 in HepG2 and Chinese hamster ovary (CHO) cells. Our results
demonstrate that the presence of a sheet domain near the
amino-terminal of apoB100 is necessary and sufficient to cause the
inefficient translocation of at least the first 42% of this atypical
secretory protein.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
5 relative to mature apoB) and
terminating within the plasmid polylinker. The gel-purified fragment
representing the amino-terminal 16% of apoB was ligated back into
pB515 that had been digested with EcoRV (corresponding to
nucleotide 1960 or residue 606 of apoB, which is approximately 13%
from the amino-terminal) and SalI to produce an in-frame
fusion of apoB13 and apoB16. This plasmid, pB13,16, was again digested
with EcoRV and SalI and ligated to the
EheI-SalI fragment of pB515 to produce the
plasmid pB13,13,16, in which apoB13, apoB13, and apoB16 were linked
consecutively. A comparison of these apoB constructs with a schematic
representation of apoB100 is shown in Fig.
1.
View larger version (21K):
[in a new window]
Fig. 1.
Comparison of apoB chimeric constructs and
apoB carboxyl-terminal truncations with apoB100. The figure
depicts the structure of apoB100 as described by Segrest et
al. (22). Human apoB chimeric constructs apoB13,16, apoB13,13,16,
and apoB13,16, and a carboxyl-terminal truncation of apoB100,
apoB34, were constructed as described under "Experimental
Procedures." ApoB13,16 and apoB13,13,16 contain repeated
amino-terminal globular domains of the amino-terminal region of
apoB100 but have no sheet domains. The two chimeric constructs are
equal in length to the first 29% and the first 42% of apoB100,
respectively. ApoB13,16, is a construct in which the amphipathic sheet domain situated between 28 and 34% of full-length apoB100 was
inserted into apoB13,16 at either 9.5% of the construct or 22.5% of
the construct. The length of the apoB13,16, constructs was equal to
35% of full-length apoB100. ApoB34 and apoB42, carboxyl-terminal
truncations of apoB100, contain the amino-terminal globular and
1 sheet domain of apoB100.
Sheet Domain into ApoB13,16--
A 718-base
pair fragment of the apoB cDNA corresponding to the first sheet
domain (apoB28-34; nucleotides 4137-4855; residues 1270-1542) was
synthesized in a polymerase chain reaction with oligonucleotides
B28-34-5' (GAAGATCTTCACTGGAGAGTTCCAAGTCCCTACT) and
B28-34-3' (GAAGATCTTCAGCTCGTAGTTCTCATACTTTAGGGA). This
produced a cDNA corresponding to the sheet domain flanked by
BglII sites (underlined sequences). This PCR fragment was
digested with BglII and ligated to the linear form of
pB13,16 partially digested with BglII. The products of this
reaction comprise in-frame insertions of the sheet domain sequence
at each of the three BglII sites within apoB13,16. Insertion
of the sheet domain at the first BglII site
corresponding to 9.5% of apoB13,16 was confirmed at the nucleotide
level by sequencing. Similarly, insertion of the sheet domain into
the second BglII site corresponding to 22.5% of apoB13,16
was confirmed by sequencing. A comparison of this apoB construct with
apoB100 is shown in Fig. 1.
sheet domains.
An apoB48 cDNA clone with a heterologous promoter derived from
cytomegalovirus was constructed as described previously (28). An
oligonucleotide (CTAGTCTAGACTAG) containing a translation termination
codon and a XbaI site was inserted into the PmlI
site (nucleotide 4663) of the apoB48 cDNA clone that terminates
translation at amino acid 1483 and therefore expresses ApoB34. ApoB42
was kindly provided by Dr. Zemin Yao of the Ottowa Heart Institute (ON, Canada).
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Sheet Domains--
In our initial
experiments, we wished to determine whether the translocation of
nascent apoB was affected by the presence or absence of sheet
domains. We isolated microsomes and used the sensitivity of nascent
apoB to exogenous protease digestion as a measure of translocation
(9-10, 12, 14). Under the conditions of this assay, apoB100 and apoB
constructs that are fully protected from exogenously added PK should be
those that have been completely translocated, whereas any apoB species
that are sensitive to proteolysis should be in a partially
translocated, bitopic orientation. Based on our previous studies (12),
and those of others (9, 10, 13, 14), we expected that the majority of
nascent apoB100 molecules would be partially translocated and
susceptible to PK; endogenous apoB100 could therefore serve as a
positive control against which to compare the sensitivity to
proteolysis of other transfected apoB species in each experiment.
sheet domain-containing
species, were significantly decreased, but there was no detectable
change in the immunoreactive band for apoB13,13,16, which contains globular domains, but no sheet domains (Fig.
2). All of the protein bands disappeared when both Triton X-100, which disrupts microsomes, and PK were in the
incubation media, indicating that the resistance of apoB13,13,16 to PK
digestion was not due to insufficient PK activity or an inherent
resistance to PK. Because apoB13,13,16 is equal in length to apoB42,
the difference in sensitivity to PK digestion between apoB13,13,16 and
apoB42 could not be due to differences in length between these
constructs.
View larger version (21K):
[in a new window]
Fig. 2.
ApoB42 was significantly reduced by PK
digestion of microsomes isolated from HepG2 cells, but apoB13,13,16 was
not affected. HepG2 cells were transiently transfected with apoB42
cDNAs (left three lanes) or apoB13,13,16 cDNA
(right three lanes) as indicated at the bottom of
the figure. Thirty-six h after transfection, the cells were labeled for
2 h with [3H]leucine. Microsomes were isolated as
described under "Experimental Procedures." Microsomes were
incubated with or without PK (50 µg/ml) or Triton X-100 (0.5%) for
30 min on ice. After digestion, phenylmethylsulfonyl fluoride (3 mM) was added, and the samples were incubated for another 5 min on ice. The samples were then recentrifuged, and the microsome
pellets were dissolved in lysis buffer and analyzed by
immunoprecipitation as described under "Experimental
Procedures."
, into which the amphipathic sheet domain situated between apoB28 and B34 had been inserted into the first-third of
apoB13,16. HepG2 cells were transfected with either apoB13,16 or
apoB13,16,, and 36 h later, they were labeled for 2 h with [3H]leucine. Microsomes were then isolated and subjected
to PK digestion in vitro. In contrast to the lack of effect
of PK on apoB13,16 (0.94 ± 0.25 relative densitometric units
compared with undigested control; n = 4), apoB13,16,
was decreased by 75% (0.25 ± 0.09 relative densitometric units;
n = 4) after PK digestion (Fig. 3). Again, apoB100 was significantly
reduced by PK in all transfected cells, and all bands disappeared when
Triton X-100 was present together with PK in the media.
View larger version (45K):
[in a new window]
Fig. 3.
ApoB13,16, was significantly reduced by
the PK digestion of microsomes isolated from HepG2 cells, but apoB13,16
was not affected. HepG2 cells were transiently transfected with
apoB13,16 cDNAs (left three lanes) or apoB13,16,
cDNA (right three lanes) as indicated at the
bottom of the figure. Thirty-six h after transfection, the
cells were labeled for 2 h with [3H]leucine.
Microsomes were isolated as described under "Experimental
Procedures." The digestion conditions for isolated microsomes
were the same as those described in the Fig. 2 legend. Digested samples
were analyzed by immunoprecipitation and densitometry as described
under "Experimental Procedures."
sheet domain-containing constructs was
further examined in CHO cells, which lack MTP activity. When CHO cells
were co-transfected with apoB13,16 and apoB13,16, or with apoB13,16
and apoB34, the sheet domain-containing constructs, apoB13,16,
and apoB34, were reduced by 85% (0.15 ± 0.04 relative densitometric units; n = 3) and 79% (0.21 ± 0.03 relative densitometric units; n = 3), respectively,
after the PK digestion of isolated microsomes, whereas apoB13,16 was
unaffected (0.92 ± 0.23 relative densitometric units;
n = 3) (Fig. 4). The same
results were obtained with the apoB13,16, construct into which the
sheet had been inserted in the second-third of apoB13,16 (data not
shown; see "Experimental Procedures").
View larger version (31K):
[in a new window]
Fig. 4.
ApoB13,16, and apoB34 were significantly
reduced by the PK digestion of microsomes isolated from CHO cells, but
apoB13,16 was not affected. CHO cells were transiently
co-transfected with apoB13,16 and apoB13,16 cDNAs (left
three lanes) or apoB13,16 and apoB34 cDNA (right three
lanes) as indicated at the bottom of the figure.
Thirty-six h after transfection, the cells were labeled for 2 h
with [3H]leucine. Microsomes were isolated as described
under "Experimental Procedures." The digestion conditions for
isolated microsomes were the same as those described in the Fig. 2
legend. Digested samples were analyzed by immunoprecipitation and
densitometry as described under "Experimental Procedures."
Sheet Domains in
ApoB--
The results described above indicated that the addition of a
sheet domain to an apoB construct otherwise containing only globular domains (apoB13,16, versus apoB13,16) was
sufficient to cause translocation to become inefficient. If this is
true, then the simple addition of a sheet domain should convert
apoB constructs with only globular domains to ones that are
dependent on the availability of core lipids and are sensitive to
proteasomal degradation.
sheet domain in
determining the responsiveness to lipid availability and sensitivity to
proteasomal degradation, HepG2 cells were transiently transfected with
apoB cDNAs. Thirty-six h after transfection, the cells were preincubated for 2 h with and without OA (0.4 mM) to
stimulate lipid synthesis or with and without ALLN (100 µM) to inhibit proteasomal degradation. The cells were
then labeled with [3H]leucine for 2 h. OA
significantly increased both the cell and medium levels of full-length
apoB100 and apoB42 but not apoB13,13,16 (Fig.
5). OA and ALLN both increased the cell
levels of full-length apoB100 and apoB13,16, but had no effect on
the cell levels of apoB13,16 (Fig. 6).
apoB100 and apoB13,16, were increased approximately 3× by OA
(apoB100, 2.82 ± 0.23 relative densitometric units compared with
control; apoB13,16,, 3.01 ± 0.65 relative densitometric units,
n = 4) and 2× by ALLN (apoB100, 2.02 ± 0.40 relative densitometric units; apoB13,16,, 2.13 ± 0.32 relative
densitometric units, n = 4) (Fig. 6).
View larger version (22K):
[in a new window]
Fig. 5.
ApoB42 was significantly increased by OA
treatment in HepG2 cells, but apoB13,13,16 was not affected. HepG2
cells were transiently transfected with apoB42 or apoB13,13,16
cDNAs as indicated at the bottom of the figure.
Thirty-six h after transfection, the cells were preincubated with or
without OA (0.4 mM) for 2 h and labeled with
[3H]leucine for 2 h in the absence or presence of
OA. After labeling, cell lysates and medium were analyzed by
immunoprecipitation as described under "Experimental Procedures."
The lowest band in the medium lanes is a nonspecifically
immunoprecipitated protein.
View larger version (49K):
[in a new window]
Fig. 6.
ApoB13,16, was significantly increased by
OA or ALLN treatment, but apoB13,16 was not affected. HepG2 cells
were transiently transfected with apoB13,16 (left three
lanes) or apoB13,16, (right three lanes) cDNAs
as indicated at the bottom of the figure. Thirty-six h after
transfection, the cells were preincubated with or without either OA
(0.4 mM) or ALLN (100 µM) for 2 h and
labeled with [3H]leucine for 2 h in the absence or
presence of OA or ALLN. After labeling, cell lysates were analyzed by
immunoprecipitation and densitometry as described under "Experimental
Procedures."
sheet domain-containing species
to proteasomal degradation, similar experiments were carried out in CHO
cells using another proteasomal inhibitor, lactacystin. Thirty-six h
after CHO cells were transiently transfected with apoB cDNAs, the
cells were preincubated for 2 h and labeled with
[3H]leucine for 2 h in the presence or absence of
lactacystin (10 µM) to inhibit proteasomal degradation.
Cell levels of apoB42 and apoB13,16, were increased approximately
2.5× by lactacystin treatment (apoB42, 2.32 ± 0.32 relative
densitometric units; apoB13,16,, 2.53 ± 0.33 relative
densitometric units, n = 3), whereas apoB13,16 and
apoB13,13,16 levels were unchanged (Fig.
7).
View larger version (28K):
[in a new window]
Fig. 7.
Effect of lactacystin on apoB constructs in
CHO cells. CHO cells were transiently transfected with apoB13,16,
apoB13,16, , apoB42, or apoB13,13,16 cDNAs as indicated the
bottom of the figure. Thirty-six h after transfection, the
cells were preincubated with or without lactacystin (10 µM) for 2 h and labeled with
[3H]leucine for 2 h in the absence or presence of
lactacystin (10 µM). After labeling, cell lysates were
analyzed by immunoprecipitation and densitometry as described under
"Experimental Procedures."
sheet domain plays a
critical role in the response of apoB to OA and to either ALLN or
lactacystin treatment. Furthermore, these results provide compelling evidence to support the hypothesis that sheet domains determine translocation efficiency, lipid binding, and sensitivity to proteasomal degradation of apoB100.
Sheet Domains--
The role of MTP in the
translocation of apoB100 and its assembly with lipids has been
demonstrated in both hepatic cells and in nonhepatic cells expressing
truncated apoB100 fragments (6, 30, 31). MTP and apoB100 form complexes
that can be co-immunoprecipitated (29, 32), and this interaction
requires only the amino-terminal 13% of apoB100 (32). Recent studies
by Bakillah et al. (33) and Hussain et al. (34)
have identified specific binding sites within the first 16% of
apoB100. Despite the fact that the interaction of MTP with apoB100
seems to occur within the globular region of apoB100, the presence
of sheet domains seems to make MTP essential for secretion. We
therefore sought to determine whether the simple addition of a sheet domain would make apoB constructs dependent on MTP.
, and full-length apoB100 decreased more than 80%
(apoB100, 0.19 ± 0.07 relative densitometric units compared with
control; apoB42, 0.18 ± 0.08 relative densitometric units,
n = 4; apoB13,16,, 0.17 ± 0.07 relative
densitometric units, n = 5). Increased apoB degradation associated with MTP inhibition was significantly blocked by the co-incubation of cells with lactacystin (Fig.
8). By contrast, the levels of apoB13,16
and apoB13,13,16 were unaffected by the inhibition of MTP. Secretion of
apoB species containing sheet domains (i.e. full-length
apoB100, apoB42, and apoB13,16,) was also significantly decreased by
the inhibition of MTP (data not shown). These results indicate that the
presence of sheet domains makes MTP activity essential for the
efficient translocation of apoB across the ER membrane, and that the
increased degradation of sheet domain-containing apoB species that
occurs when MTP is inhibited is mediated by the proteasomal degradation
pathway.
View larger version (32K):
[in a new window]
Fig. 8.
MTP inhibition decreased apoB42 and
apoB13,16, , an affect that was blocked by lactacystin.
ApoB13,16 and apoB13,13,16 were not affected by the inhibition of MTP.
HepG2 cells were transiently transfected with apoB13,16, apoB13,13,16,
or apoB13,16, as indicated at the bottom of the figure.
Thirty-six h after transfection, cells were preincubated for 1 h
and labeled with [3H]leucine for 2 h with or without
MTP inhibitor (100 µM) in the absence or presence of
lactacystin (10 µM). After labeling, cell lysates were
analyzed by immunoprecipitation and densitometry as described under
"Experimental Procedures."
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
sheet domains present in apoB100 play a crucial role in determining the
translocation efficiency of this important lipid carrier molecule.
, which contain sheet
domains, and apoB13,16 or apoB13,13,16, which have no sheet
domains, derives directly from the effects of the sheet on
translocation efficiency (Figs. 2-4). Thus, apoB13,16 and apoB13,13,16 were intralumenal and were not accessible to PK, whereas apoB34, apoB42, apoB13,16,, and full-length apoB100 were incompletely translocated and were accessible to exogenously added protease in
isolated microsome preparations. Our demonstration that the simple
addition of a sheet domain to apoB13,16 significantly reduced
translocation efficiency clearly indicates that the sheet domain
between 28 and 34% of full-length apoB is directly involved in the
translocation process.
) and the carboxyl-terminal truncations (apoB34 and
apoB42), we have demonstrated that the amphipathic sheet domain
plays a critical role in the response of apoB to OA and either ALLN or
lactacystin treatment (Figs. 5-7). We did not test whether the sheet domains are important for the interaction of apoB100 with calnexin.
sheet domain-containing constructs and apoB constructs
lacking -sheet domains differently. Treatment of HepG2 cells with a
MTP inhibitor significantly decreased the intracellular levels of newly
synthesized apoB42, apoB34, and apoB13,16,, whereas levels of
apoB13,16 and apoB13,13,16 were unaffected (Fig. 8), indicating that
the presence of sheet domains makes MTP activity essential for the
efficient translocation of apoB100 across the ER membrane. Our
demonstration that lactacystin prevents the degradation of sheet
domain-containing constructs during MTP inhibition is consistent with
prior data indicating that the degradation of inefficiently
translocated apoB100 is mediated by the proteasomal degradation
pathway. Although MTP is required for the translocation of sheet
domain-containing apoB species, recent unpublished data from our
laboratory suggest that the binding of MTP to apoB100 is not dependent
on the presence of sheet domains, and that sheet domains do not
bind to MTP in the absence of the amino terminus of
apoB.2 Our unpublished work
is consistent with recent studies by Bakillah et al. (33)
and Hussain et al. (34) demonstrating binding sites for MTP
in the first 16% of apoB100.
sheet domains. Indeed, because apoB13,16
and apoB13,13,16 contain numerous pause transfer sequences (40, 41), it
seems unlikely that those sequences play independent roles in the
translocation of apoB100 in cultured cells. Our direct comparison of
apoB13,16 and apoB13,16,, which contain similar numbers of disulfide
bonds and glycosylation sites, also indicates that the inefficient
translocation of apoB100 is not linked exclusively to either
amino-terminal disfulfide bond formation or glycosylation. Support for
the importance of sheet domains for the assembly of
triglyceride-enriched lipoproteins comes from the recent studies by
Mcleod et al. (26), who found that the addition of the a sheet domain to apoA-I was associated with the secretion of the
chimeric protein on a triglyceride-enriched lipoprotein. Of note, those
authors found that the addition of the same sheet domain that we
used to the carboxyl-terminal of apoA-I did not cause significant
sensitivity of the chimeric protein to exogenous protease digestion of
isolated microsomes. They concluded, therefore, that the initial
translocation of apoB100 was not determined by sheet domains. It is
likely that because they placed the sheet domain at the very
carboxyl-terminal end of their chimeric construct, the translocation of
their apoA-I/apoB chimera was nearly complete before the sheet
domain could interact with the translocation channel. In our
constructs, the sheet domain was positioned either in the first or
second third of the chimeric protein; therefore, translocation arrest
would have resulted in the exposure of a significant portion of apoB to
the cytosol.
sheet domain demonstrate clearly that the translocation
efficiency, susceptibility to proteasomal degradation, responsiveness
to OA treatment, and sensitivity to MTP inhibition of apoB are mediated
by the presence of hydrophobic, lipid binding sheet domains. We and
others have recently demonstrated that apoB100 is associated with the
translocon proteins, Sec 61 (39) and Sec 61
(39).3 It is possible that
the sheet domain interacts not only with Sec 61 proteins, but also
with TRAM (42). We speculate that such an interaction could result in
the significant slowing or cessation of translocation and the exposure
of more carboxyl-terminal regions of apoB100 to the cytosol. Studies to
test this hypothesis are the focus of our current experiments.
FOOTNOTES
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Yamaguchi, D. M. Conlon, J. J. Liang, E. A. Fisher, and H. N. Ginsberg Translocation Efficiency of Apolipoprotein B Is Determined by the Presence of beta-Sheet Domains, Not Pause Transfer Sequences J. Biol. Chem., September 15, 2006; 281(37): 27063 - 27071. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang and D. M. Small Interfacial properties of amphipathic {beta} strand consensus peptides of apolipoprotein B at oil/water interfaces J. Lipid Res., September 1, 2004; 45(9): 1704 - 1715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. R. Lapierre, D. L. Currie, Z. Yao, J. Wang, and R. S. McLeod Amino acid sequences within the {beta}1 domain of human apolipoprotein B can mediate rapid intracellular degradation J. Lipid Res., February 1, 2004; 45(2): 366 - 377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Chen, R. L. Fitzgerald, G. Li, N. O. Davidson, and G. Schonfeld Hepatic secretion of apoB-100 is impaired in hypobetalipoproteinemic mice with an apoB-38.9-specifying allele J. Lipid Res., January 1, 2004; 45(1): 155 - 163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yamaguchi, M. V. Gamble, D. Conlon, J.-s. Liang, and H. N. Ginsberg The Conversion of ApoB100 Low Density Lipoprotein/High Density Lipoprotein Particles to ApoB100 Very Low Density Lipoproteins in Response to Oleic Acid Occurs in the Endoplasmic Reticulum and Not in the Golgi in McA RH7777 Cells J. Biol. Chem., October 24, 2003; 278(43): 42643 - 42651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kang, N. J. Spann, T. Y. Hui, and R. A. Davis ARP-1/COUP-TF II Determines Hepatoma Phenotype by Acting as Both a Transcriptional Repressor of Microsomal Triglyceride Transfer Protein and an Inducer of CYP7A1 J. Biol. Chem., August 15, 2003; 278(33): 30478 - 30486. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Liao, T. Y. Hui, S. G. Young, and R. A. Davis Blocking microsomal triglyceride transfer protein interferes with apoB secretion without causing retention or stress in the ER J. Lipid Res., May 1, 2003; 44(5): 978 - 985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Fisher and H. N. Ginsberg Complexity in the Secretory Pathway: The Assembly and Secretion of Apolipoprotein B-containing Lipoproteins J. Biol. Chem., May 10, 2002; 277(20): 17377 - 17380. [Full Text] [PDF]
|
|
|
|
 |
|
 </ |
