|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 273, Issue 52, 35339-35346, December 25, 1998
From the Department of Pharmacology, The University of Texas
Southwestern Medical Center, Dallas, Texas 75235-9041
SV40 small tumor antigen (small-t) was used as a
model to identify structural elements involved in the interactions
between regulatory proteins and protein phosphatase 2A (PP2A). Using
mutant proteins and synthetic peptides, we identified a small domain within small-t that is a major site for interaction with the dimeric form of PP2A. A series of small-t truncation mutants identified a
region surrounding the first of two conserved cysteine clusters that
was critical for interaction with PP2A. These mutants also identified
additional regions of small-t that contribute to high affinity
interaction. Deletion of residues 110-119, which encompass the first
cysteine cluster, resulted in a protein that failed to bind to PP2A.
Synthetic peptides that contained residues 105-122 of small-t blocked
binding of small-t to PP2A. These peptides also inhibited the
phosphatase activity of PP2A in a manner analogous to full-length
small-t. The active small-t peptides adopt a A significant fraction of the serine/threonine phosphatase
activity in most tissue and cell types is attributable to protein phosphatase 2A (1). The diverse functions of
PP2A1 in cellular signaling
are due to the presence of an assortment of holoenzymes. Each
holoenzyme is made up of one of a diverse array of regulatory subunits
associated with a conserved dimeric core (AC). The core complex is
composed of a catalytic subunit (C) and a structural subunit (A). There
are at least three unrelated families of PP2A regulatory subunits that
have multiple isoforms and splice variants (2-5). A major function of
the regulatory subunits is to differentially modulate the activity and
specificity of the AC core enzyme (6-8). The small and middle tumor
antigens of the polyomaviruses are a fourth set of proteins that can
bind and regulate the activity of PP2A (9). Efficient transformation of
quiescent cells requires the expression of small-t as well as large
tumor antigen, the major transforming protein of SV40. Small-t appears
to have a mitogenic role during transformation by SV40 (10, 11).
Consistent with this idea is the observation that overexpression of
SV40 small-t in mammalian cells activates growth factor-stimulated
signaling pathways. These include the mitogen-activated protein kinase
(12) and stress-activated protein kinase (13) pathways, as well as
pathways that utilize nuclear factor- Relatively little is known about the molecular basis for the
interaction of regulatory subunits and tumor antigens with the dimeric
core of PP2A. None of the regulatory proteins form a stable complex
directly with the catalytic subunit. A model for PP2A architecture
suggests that the A subunit acts as an adapter protein that allows
association of the C subunit with regulatory proteins (2, 4, 15). The
regulatory subunits and tumor antigens bind in a mutually exclusive
manner to a region of the A subunit that is distinct from the region
that binds the C subunit (16). The diverse array of regulatory proteins
that interact with PP2A bind to a common site within the A subunit
despite a lack of any significant amino acid sequence similarity.
SV40 small-t is a 174-amino acid protein that contains an
amino-terminal 82-amino acid common region that is shared with large tumor antigen and a 92-amino acid carboxyl-terminal domain that is
unique to small-t (17). The small-t unique region contains the PP2A
binding domain. Amino acid sequence comparisons have identified two
cysteine cluster motifs (CXCXXC) that are
absolutely conserved in the small-t proteins of the polyomavirus family
(17). A region of the unique domain encompassing the first cysteine cluster is necessary for the binding of small-t to PP2A (12). Small-t
associates with PP2A by displacing the cellular regulatory subunits,
resulting in inhibition of phosphatase activity (18).
Because the regulatory subunits and tumor antigens bind to the same
region of the A subunit of PP2A but share no significant sequence
identity, we speculated that the different regulatory proteins share a
common structural element. In this study, we have used SV40 small-t as
a model regulatory protein to identify and define structural elements
involved in interaction with PP2A. Using small-t mutants and synthetic
peptides, we identified a small domain within SV40 small-t that is
responsible for interaction with the A subunit, and we show that this
domain can regulate phosphatase activity in a manner analogous to
full-length small-t.
Purification of Proteins--
Recombinant small-t was expressed
in insect cells and purified as described previously (19). The dimeric
AC form of PP2A (20) and the free catalytic form of PP2A (21) were
purified from bovine cardiac muscle as described. The purification of
glutathione S-transferase (GST) and the fusion between GST
and the A subunit of PP2A (GST-A) were described previously (12). After
purification, glutathione-agarose complexed to either GST or GST-A was
washed three times with 3 bed volumes of PP2A storage buffer (25 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1 mM DTT, and 50% glycerol) aliquoted and stored at
-80 °C for later use. Recombinant baculoviruses expressing wild
type small-t and mutant small-t proteins were generated from inserts
excised from pBluescript plasmids (12) and the BacPAK 6 system
(CLONTECH) according the manufacturer's protocols.
Virus stocks were produced and plaque-purified using standard
procedures (22). The expression of the mutant small-t proteins was
verified by SDS-PAGE followed by Western blotting. Wild type small-t
and mutants 1-110, 1-131, 1-150, 52-174, and 88-174 were expressed in Sf9 cells. Cells expressing the various proteins were
harvested by centrifugation, washed with TBS (20 mM
Tris-HCl, pH 7.0; 150 mM NaCl), and resuspended in 1:3
(w/v) lysis buffer (20 mM HEPES, pH 7.2, 500 mM
NaCl, 10 mM DTT, 2 mM phenylmethylsulfonyl
fluoride, 10% glycerol, and 1% Triton X-100). The suspension was
incubated on ice for at least 30 min and then microcentrifuged for 15 min. The cleared supernatant was then applied onto a Superose-6 gel filtration column (Amersham Pharmacia Biotech) equilibrated with 20 mM HEPES, pH 7.2, 80 mM NaCl, 0.2 mM DTT, and 10% glycerol. Fractions were monitored by
SDS-PAGE followed by Western blotting using either PAb419 (23) or a
small-t polyclonal antibody provided by G. Walter (University of
California, San Diego, CA) (12). Fractions containing monomeric
proteins were pooled and concentrated using a Centricon-3 concentrator
(Amicon). The concentration of the resulting material was determined
using purified recombinant small-t protein to generate a standard curve
and the immunodetection slot blot technique (24).
Mutagenesis of SV40 Small-t--
The generation of small-t
fragments containing amino acids 1-110, 1-131, 1-150, 52-174, and
88-174 was described previously (12). The unique site elimination
technique described by Deng and Nickoloff (25) was used to generate
additional small-t truncation mutants. pBluescript KS containing
full-length SV40 small-t was used as the template with a selection
oligonucleotide primer that converted an AflIII site to a
BglII site. Mutagenic PCR primers used to generate the
mutants were as follows: In Vitro Transcription/Translation--
Wild type small-t,
small-t mutants, and the PP2A catalytic subunit were produced using the
TNT-coupled in vitro transcription/translation system
(Promega) as described previously (12). The translated material was
analyzed by SDS-PAGE in a 12% polyacrylamide gel followed by
fluorography either directly or after immunoprecipitation with the
monoclonal antibody PAb419 (23).
GST-A Subunit Binding Assays--
The binding of small-t
proteins produced by in vitro transcription/translation to a
GST-A subunit fusion protein has been described previously (12).
Briefly, equal amounts of trichloroacetic acid-precipitatable
35S radioactivity (0.5-1.0 × 106 cpm)
from each in vitro transcription/translation reaction were combined with 20 µl of a 1:1 slurry of glutathione agarose,
containing bound GST or GST-A, in low salt buffer (50 mM
Tris-HCl, pH 7.4, 10 mM EDTA, 20 mM NaCl, 5 mM benzamidine, 2 mM phenylmethylsulfonyl fluoride, 2 mM DTT). The mixtures were incubated at ambient
temperature for 2 h. The resin was washed with low salt buffer and
then with high salt buffer (50 mM Tris-HCl, pH 7.4, 10 mM EDTA, 500 mM NaCl, 5 mM
benzamidine, 2 mM phenylmethylsulfonyl fluoride, 2 mM DTT) followed by elution with 10 mM
glutathione in high salt buffer. The eluates were analyzed by SDS-PAGE
followed by autoradiography and fluorography.
Circular Dichroism Measurements--
The spectral analysis of
small-t peptides was performed on an AVIV circular dichroism
spectrometer (model 62DS) between the wavelengths of 200 and 260 nm at
25 °C using a 0.1-cm cuvette. Each sample contained the indicated
peptide at 30 µM in CD buffer (10 mM sodium
phosphate, pH 6.4, 5 mM 2-mercaptoethanol). The peptide
spectra were normalized against the buffer.
Secondary Structure Predictions--
The amino acid sequences of
small-t proteins from different polyomaviruses were aligned with the
Clustal method using the DNAstar program and then submitted to the
PredictProtein mail server (phd{at}embl-heidelberg.de) for secondary
structure prediction (26-28).
Preparation of 32P-Labeled Substrates and Protein
Phosphatase Assays--
Myosin light chain phosphorylation and
phosphatase activity assays were determined as described previously
(18). Briefly, the AC dimeric form of PP2A (final concentration, 0.5 nM) was combined with various proteins or peptide fragments
in phosphatase assay buffer (20 mM MOPS, pH 7.0, 0.5 mg/ml
bovine serum albumin, 10 mM DTT, and 1 mM
MnCl2). The reaction was initiated by the addition of
32P-labeled myosin light chains (2 µM) and
incubated for 5 min at 30 °C. The reaction was terminated by the
addition of 25% trichloroacetic acid (final concentration, 10%) and 6 mg/ml bovine serum albumin (final concentration, 2.5 mg/ml). The
samples were incubated on ice for 5 min, precipitated protein was
pelleted in a microcentrifuge, and the 32P in the
supernatant was measured using a Beckman LS 1801 liquid scintillation
counter. The IC50 values for peptides 97-122, 105-122, and 105-122 (C-S) were calculated using the logistic equation for the
determination of IC50 values described by Bliss (29).
Synthesis of Small-t Peptides--
Synthetic peptides spanning
amino acids 91-128 of SV40 small-t were synthesized in the Howard
Hughes Medical Institute Biopolymer Core Facility at the University of
Texas Southwestern Medical Center and solubilized in either peptide
solubilization buffer A (50 mM Tris-HCl, pH 7.0, 10 mM DTT) or in peptide solubilization buffer B (40 mM MES, pH 6.4, 10 mM DTT) for use in
phosphatase assays and blocking experiments. For CD experiments, the
peptides were solubilized in peptide solubilization buffer C (40 mM MES, pH 6.4, 20 mM 2-mercaptoethanol).
Inhibition of PP2A by Small-t Fragments--
Wild type SV40
small-t antigen interacts with the AC dimeric core of PP2A and inhibits
activity toward several phosphoprotein substrates (18). The binding of
small-t is mediated primarily by interaction with the A subunit. To
determine the contributions of different regions of small-t to
interaction with the dimeric form of PP2A, we used recombinant
fragments of small-t, the binding of which to the A subunit had been
characterized (12). The recombinant fragments were expressed in
Sf9 cells, partially purified, and quantitated. Their effects on
phosphatase activity were determined by incubating varying amounts of
the recombinant proteins with the AC dimeric form of PP2A. The
activities of the resulting complexes were then determined using
phosphorylated myosin light chain as substrate.
Fragments 52-174 and 88-174 (Fig. 1), containing truncations of the
amino-terminal common region, and fragments 1-131 and 1-150,
containing truncations of the carboxyl-terminal unique region, all
inhibited the activity of the AC dimer (Fig.
2). The IC50 values for
fragments 52-174 and 88-174 were 0.7 and 1.5 µM, whereas the IC50 values for 1-131 and 1-150 were 35 and
90 nM, respectively. In contrast, fragment 1-110, which
cannot bind to the A subunit (12), had no effect on phosphatase
activity. Although they inhibited activity to the same extent as wild
type small-t, the recombinant fragments with truncations of the amino
terminus had lower apparent affinity for the AC dimer than the wild
type protein (IC50 = 5 nM). Sequences within
the amino-terminal 88 amino acids were not required for inhibition of
PP2A activity, but they were important for high affinity interaction of
small-t with PP2A. Notably, removal of the first 51 amino-terminal
residues of small-t (fragment 52-174) resulted in a 140-fold increase
in the IC50.
Identification of the Minimal Region of Small-t That Binds to the A
Subunit--
Based on the results described above and those reported
previously (12), the region of small-t containing amino acids 111-130 appeared to contain a major PP2A binding site. To further define the
regions necessary for interaction, small-t fragments containing residues 95-135 and 95-165 (Fig. 1)
were generated and assayed for their ability to bind to the A subunit.
35S-Labeled small-t fragments were generated by in
vitro transcription/translation and incubated with a
glutathione-agarose resin complex of either GST-A or with GST alone.
The agarose beads were washed and eluted with glutathione, and the
eluted material analyzed by SDS-PAGE. Fig.
3A shows that both small-t
fragments bound specifically to GST-A and not to GST. These results
indicate that the region containing amino acids 95-135, which includes
the putative binding domain, is able to bind to the A subunit. This 41 amino acid fragment of small-t therefore contains the residues that are
sufficient for binding to the A subunit.
An amino acid sequence alignment of the putative PP2A binding domain
from the small-t proteins of various polyomaviruses is shown in Fig.
4A. The alignment reveals
several residues around the first cysteine cluster that are highly
conserved. To investigate the importance of these residues, we employed
a set of sequential carboxyl-terminal truncation mutants to identify
the carboxyl-terminal boundary of the PP2A binding domain (Fig. 1).
Various 35S-labeled small-t fragments were generated by
in vitro transcription/translation and assayed for their
ability to associate with GST-A. Truncations at or amino-terminal to
residue 118 resulted in a complete loss of binding (Fig.
3B). However, fragments that were truncated at or
carboxyl-terminal to position 119 still bound to GST-A (Fig. 3B). These results indicate that amino acid 119 is the
carboxyl-terminal boundary of the PP2A binding domain. They also show
that residues in addition to the conserved cysteines are required for
binding to PP2A.
Because residue 119 of small-t is highly conserved (either Lys or Arg),
we postulated that the positive charge at position 119 might be
important for binding to PP2A. To test this hypothesis, the
carboxyl-terminal arginine at position 119 of the 1-119 fragment was
mutated to alanine, lysine, or glutamic acid, and the mutant fragments
were assayed for binding to the A subunit. Surprisingly, mutation of
Arg119 had no apparent effect. An equivalent amount of each
truncation mutant bound to GST-A (data not shown). Therefore, the
positive charge at amino acid 119 is not critical for interaction with GST-A. These results suggest that the amino acid at position 119, at
least in the context of the 119-truncation fragment, makes important
peptide backbone interactions that can be contributed by several
different amino acids.
To test the idea that the conserved cysteine cluster is an integral
component of the A subunit binding domain, a small-t deletion mutant
lacking residues 110-119 was constructed and assayed for binding to
PP2A. 35S-Labeled wild type small-t or small-t deletion
mutant Peptide Analogs Block Binding of Small-t to the A Subunit--
The
effects of small-t truncations and deletions are consistent with the
idea that the region surrounding the first cysteine cluster is a domain
that interacts with the A subunit. However, an equally compelling
argument is that deletion of residues 110-119 has a global effect on
small-t structure that disrupts A subunit binding. Consequently, a
second approach utilizing small-t peptide analogs was used to
corroborate the results from the mutagenesis studies. Synthetic
peptides (Fig. 4B) spanning the putative PP2A binding domain
of SV40 small-t (amino acids 91-128) were synthesized and assayed for
their ability to block the association of 35S-labeled wild
type small-t with GST-A. To ensure that the peptides had specific
effects on small-t, the experiments were done in the presence of
35S-labeled C subunit. This strategy takes advantage of the
nonoverlapping binding sites for small-t and the catalytic subunit on
the A subunit of PP2A (16).
In a control experiment, an excess of recombinant small-t inhibited the
association of 35S-labeled small-t with GST-A while having
no effect on catalytic subunit binding (Fig.
5). The ability of different peptides to inhibit the association of labeled small-t with GST-A was tested in a
similar manner. Two peptides, 97-122 and 105-122, which include the
first cysteine cluster, blocked the association of wild type small-t
with GST-A but had little or no effect on the binding of the catalytic
subunit. Two other peptides, 91-110 and 117-128, corresponding to
regions adjacent to the conserved cysteine cluster, had no effect on
the binding of either small-t or the catalytic subunit. This experiment
identifies residues 105-122 as a minimal region required to block the
interaction of small-t with GST-A (summarized in Fig. 4B).
These residues encompass the conserved cysteine motif (amino acids
111-116) and amino acids 117-119, which, when deleted, resulted in
the loss of binding activity (Fig. 3C). The ability of the
peptides to block binding supports the idea that the region around the
first cysteine cluster of small-t is a domain that is critical for
interaction with the A subunit of PP2A.
Peptide Analogs Inhibit PP2A Activity--
Small-t mutants that
were capable of binding to GST-A also inhibited the activity of the AC
dimeric form of PP2A. To determine whether the small-t peptides could
also affect activity, they were assayed for their ability to inhibit
the phosphatase activity of the AC complex. The small-t peptides were
incubated with either AC or the free C subunit and their effects on
phosphatase activity determined. None of the peptides had any affect on
the phosphatase activity of the free catalytic subunit (Fig.
6A, open bars).
However, the two peptides that blocked the association of small-t with GST-A caused a significant decrease in the activity of the AC complex
(Fig. 6A, hatched bars). Because there was no effect on the
free catalytic subunit, the results show that, like inhibition by wild
type small-t, inhibition of PP2A by the peptides required the presence
of the A subunit (18).
The apparent affinities of peptides 97-122 and 105-122 were
characterized by determining the IC50 for inhibition of the
AC complex. Increasing concentrations of peptides were combined
with AC, and the phosphatase activity was determined using
32P-labeled myosin light chains as a substrate. Fig.
6B shows the dose-response curves for the various peptides.
Peptides 91-110 and 117-128 showed no inhibition at any concentration
tested, whereas peptides 97-122 and 105-122 inhibited AC activity
with an IC50 of 193 ± 19 and 223 ± 31 nM, respectively. Although these values are higher than the
IC50 of wild type small-t (5 nM), the peptides
still interacted with relatively high apparent affinity.
In order to determine the role of the conserved cysteines in the
activity of peptide 105-122, each of the cysteines was changed to a
serine, and the mutant peptide was assayed for its ability to inhibit
AC. When assayed over the concentration range in which wild type
105-122 peptide inhibited AC, peptide 105-122 (C-S) had no affect on
activity (Fig. 6B). However, at higher concentrations, peptide 105-122 (C-S) was able to inhibit the core AC enzyme
(IC50 = 27 ± 3.6 µM). As observed with
the other peptides, 105-122 (C-S) had no effect on catalytic subunit
(data not shown). These results indicate that the cysteines are not
required for inhibitory activity but are important for high affinity
binding to AC.
The Association of Zinc with Small-t Peptides Requires the
Conserved Cysteines--
Mutation of the conserved cysteines,
especially cysteine 116, results in small-t proteins that have reduced
stability in vivo (30) but are still able to bind to the A
subunit (31). These observations suggest that mutation of the cysteines
alters the structure of the protein while still permitting association
with the A subunit. Our results with peptides 105-122 and 105-122
(C-S) are consistent with these observations. Both the wild type
peptide and the mutant peptide were able to associate with AC, but the mutant peptide had significantly lower affinity.
Circular dichroism was used to determine whether mutating the conserved
cysteines in peptide 105-122 altered its structure. The CD spectra for
peptides 97-122, 105-122, 105-122 (C-S), and 117-128 are shown in
Fig. 7A. Peptide 117-128
exhibited a minimum peak at 200 nM indicating that this
peptide had an unordered structure in solution (32). Both peptides
97-122 and 105-122 exhibited minimum peaks between 213 and 218 nm,
which is consistent with the presence of
SV40 small-t has been shown to bind to 2 mol of zinc (19), and the
conserved cysteines are likely to be involved in coordination of the
associated zinc atoms (33). To determine whether the cysteines in the
synthetic peptides were able to coordinate zinc, the CD spectra for
peptides 117-128, 97-122, 105-122, and 105-122 (C-S) were
determined in the presence and absence of zinc (Fig. 8). The addition of zinc to peptides
97-122 and 105-122 caused the minima to shift to the right and also
caused a decrease in the their intensity (Fig. 8, B and
C). These spectral changes indicate that zinc associates
with these peptides resulting in a change in their structure.
Subsequent treatment with EDTA caused the CD spectra of peptides
97-122 and 105-122 to return to the zinc free state (data not shown).
Conversely, addition of zinc to peptides 117-128 or 105-122 (C-S) did
not cause a change in structure (Fig. 8, A and
D). The lack of effect of zinc on the structure of peptide
105-122 (C-S) indicates that the cysteines in the conserved cluster
are involved in the coordination of zinc.
Previous work detailing the interaction of small and middle tumor
antigens with PP2A has shown that there are multiple sites of
interaction between the two proteins. The A subunit of PP2A is composed
of 15 repeats of a loosely conserved 40-45-amino acid sequence that
has been defined as an armadillo (arm) repeat. Arm repeats are present
in a variety of proteins and are thought to be involved in
protein-protein interactions (34). A model for the A subunit has been
proposed (15) that is consistent with the three-dimensional structure
of the arm repeat region of Consistent with the involvement of multiple sites on the A subunit,
multiple regions of small-t are also involved in the association with
PP2A. In addition to the region encompassing the first cysteine cluster
(12), a conserved region encompassing residues 97-103 also plays an
important role in interaction (31). Mutational analysis has shown that
the equivalent region is also important for interaction of polyoma
small and middle tumor antigens with PP2A (36, 37). Although it is
clear that the 97-103 region is important for high affinity binding to
PP2A, it is not crucial. Mutations in this region reduce the apparent
affinity of interaction but do not completely inhibit the interaction
with PP2A in vitro (31).
Mutation of additional regions of polyoma small and middle tumor
antigens affects interaction with PP2A. Mutations within residues
142-145, which lie between the first and second cysteine clusters,
inhibited co-immunoprecipitation of polyoma small-t with PP2A (37).
Although the sequence of SV40 small-t in this region is not highly
related to polyoma small-t, it may also play a role. The amino-terminal
common domain of SV40 small-t is not required for interaction with PP2A
(12, 31) but it may play an accessory role. Deletions and point
mutations of polyoma middle-t antigen showed that the first 25 residues
are important for interaction with PP2A in co-immunoprecipitation
assays (36). Our data are consistent with a role for the amino-terminal
region of SV40 small-t also being involved in association with PP2A.
Removal of the first 51 amino acids caused a 140-fold reduction in
apparent affinity for the AC complex (Fig. 2). The amino-terminal
domain of small-t shares sequence similarity with the J-domains of DnaJ
proteins (38). The amino-terminal common domain of small-t can
functionally replace the J-domain of the Escherichia coli
DnaJ molecular chaperone (39, 40). Results from mutational analysis of
polyoma and SV40 small-t suggest that the J-domain of small-t could be
involved in interactions with PP2A.
Our data define amino acids 105-122 of SV40 small-t as a site that
interacts with PP2A. Deletion of residues 110-119 resulted in a
protein that was unable to bind to the A subunit of PP2A. Additionally,
peptides, which contained residues 105-122, blocked the association of
wild type small-t with GST-A and inhibited PP2A activity. These results
suggest that this region contains a primary interaction site, whereas
other regions of small-t contribute to high affinity binding to PP2A.
Although this region encompasses the first cysteine cluster of small-t,
the conserved cysteines are not required for interaction with PP2A. A
peptide in which each of the cysteines was mutated to serine still
interacted with the AC dimer, although with lower affinity (Fig. 6).
These results are consistent with previous studies showing that
mutation of one or two cysteines within the first cluster had no
dramatic effect on interaction with PP2A (31).
Mutation of the highly conserved cysteines at amino acids 111, 113, and
116 affected the structure of the 105-122 peptide. Mutating the
cysteines to serines caused the structure of the peptide to change from
a Small-t is a metalloprotein that binds to 2 mol of zinc (19), and
association of zinc is important for the stability and solubility of
the protein (30, 33). Mutation of conserved cysteines in the first
cluster also causes a reduction in zinc binding (33). The reduced
stability of the cysteine mutants suggests that binding of zinc is
important for the structural stability of small-t. Although it has been
proposed that the conserved cysteines are involved in the coordination
of zinc, the actual metal binding ligands in small-t have not been
identified. The fact that mutation of the cysteines within peptide
105-122 to serines abolished its zinc-induced conformational change
strongly supports the proposal that the cysteines are involved in the
direct coordination of zinc.
It has been suggested that coordination of zinc by small-t involves an
arrangement of the cysteine clusters that is similar to the binuclear
thiolate zinc cluster of the GAL4 transcription factor (19). However,
the cysteine at position 103 and the histidine at position 122 (Fig.
4A) are also conserved throughout the polyomavirus family
(17). Furthermore, mutation of cysteine 103 and histidine 122 decrease
the stability of small-t, indicating that these residues could also be
involved in the coordination of zinc (31, 33). The combination of
cysteine 103, histidine 122, and the conserved cysteine clusters of
small-t generates a putative zinc binding domain with the sequence
(CX7,8CXCX2CX5HX15,
16CXCX2C), which could serve
as a zinc binding center. This sequence does not readily conform to any
of the known zinc binding domains (42) and may represent a novel motif.
It has been pointed out previously that small-t, as well as the
cellular regulatory subunits, binds to overlapping regions of the A
subunit of PP2A. A puzzling aspect has been the fact that none of these
regulatory subunit families share significant amino acid similarity
with each other or with small-t. This lack of significant sequence
homology is also seen in the proteins that associate with the arm
region of We thank Dr. Jose Rizo-Rey for assistance with
circular dichroism measurements.
*
This work was supported by National Institute of Health
Grant GM49505.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Pharmacology,
University of Texas-Southwestern Medical Center, 5323 Harry Hines
Blvd., Dallas, TX 75235-9041. Tel.: 214-648-2571; Fax: 214-648-8626; E-mail: marc.mumby{at}email.swmed.edu.
The abbreviations used are:
PP2A, protein
phosphatase 2A; GST, glutathione S-transferase; GST-A, fusion between GST and the A subunit of PP2A; CD, circular dichroism; small-t, SV40 small tumor antigen; DTT, dithiothreitol; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; MOPS, 4-morpholinepropanesulfonic acid.
Identification of Structural Elements Involved in the Interaction
of Simian Virus 40 Small Tumor Antigen with Protein Phosphatase 2A*
,
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-strand structure that
was essential for high affinity interaction with the PP2A dimer. Based
on circular dichroism measurements, the same cysteine
cluster-containing peptides that bind to PP2A also interact with zinc.
Interaction with zinc required the conserved cysteines but was not
required for interaction with PP2A.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B, protein kinase C
, and
phosphatidylinositol-3 kinase (14). Activation of these pathways by
small-t requires interaction with PP2A, indicating that this
phosphatase plays an important and multifunctional role in cell signaling.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
110-119,
AAGAAAATCTCTGCTAACATGAAGCATGAAAATAGA; 1-116,
CATATGCTTGCTGTGCTAAGCTTGGATGAAGCATGAAAATAG; 1-118
GCTTGCTGTGCTTACTGTAAGCTTAGCATGAAAATAGAAAATAA, 1-119,
TTGCTGTGCTTACTGAGGTAAGCTTATGAAAATAGAAAATTATACAG; 1-120, TGCTTACTGAGGATGTAAGGTCTGCAGGAA; and 1-125,
GAAGCATGAAAATAGATAAGCTTACAGGAAAGATCCA. Each mutant construct was
verified by DNA sequencing. Small-t fragments 95-135 and 95-165 were
generated by PCR and ligated into the pBluescript II KS plasmid
(Stratagene). Point mutants generated within the 1-119
truncation mutant were constructed by PCR using a common
5'-oligonucleotide (AAAAAGCTTATGGATAAATTAAACAG) and different
3'-oligonucleotides with sequences TTTTTACTCCAGTAAGCACAGCAAGCATATG for
the 1-119R/E mutant, TTTTTATTTCAGTAAGCACAGCAAGCATATG for the 1-119R/K
mutant, and TTTTTAAGCCAGTAAGCACAGCAAGCATATG for the 1-119R/A mutant.
The PCR fragments were subcloned into the pCR3.1 TA vector (Promega), and the point mutations were verified by DNA sequencing.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (22K):
[in a new window]
Fig. 1.
Schematic summary of the binding properties
of small-t mutants. Graphical representations of full-length and
mutant small-t proteins are depicted. Small-t is divided into a common
region (open bars) and a unique region (black
bar). The unique region contains two conserved cysteine clusters
(hatched areas). The length of the bars shows the sizes of
the mutant small-t proteins. In the case of the 110-119 mutant the
deleted region is delineated by two lines. The right-hand portion of
the figure summarizes the ability of the different mutants to bind to
the A subunit of PP2A.
View larger version (25K):
[in a new window]
Fig. 2.
Inhibition of PP2A by small-t fragments.
Dose inhibition curves were generated by incubating increasing
concentrations of wild type small-t (open circles), mutant
1-131 (filled squares), mutant 1-150 (open
squares), mutant 88-174 (open triangles), mutant
52-174 (filled triangles), and mutant 1-110 (filled
circles) recombinant proteins with the AC dimeric form of PP2A.
Phosphatase activity was determined as described under "Experimental
Procedures." Each point represents the mean ± S.E. of the mean
of at least three separate experiments.
View larger version (34K):
[in a new window]
Fig. 3.
Binding of small-t mutants to the A subunit
of PP2A. 35S-Labeled wild type and mutant small-t
proteins were translated in vitro, and combined with GST
( 
) or GST-A (+) complexed to glutathione agarose. The bound material
was eluted with glutathione and analyzed by SDS-PAGE followed by
fluorography. The binding of full-length small-t and small-t fragments
95-135 and 95-165 is shown in panel A. The binding of
fragments 1-110, 1-116, 1-118, 1-119, 1-120, 1-125, and 1-131 is
shown in panel B. In panel C, wild type small-t
or the 110-119 mutant protein was combined with in vitro
translated C subunit and assayed for binding to GST-A as described
above.
View larger version (37K):
[in a new window]
Fig. 4.
Summary of the activities of synthetic
peptide. A, an alignment of the amino acid sequences of
the putative PP2A binding domains of various polyomaviruses (residues
91-131 in SV40 small-t). The symbols above the sequence indicate
absolutely conserved (*), highly conserved (#), and nonconserved ( )
residues. B, the sequence of the synthetic peptides and
their effects on PP2A. A summary of the GST-A binding and phosphatase
assay results is shown at the right. ND, not
determined.
110-119 (Fig. 1) were combined with 35S-labeled
PP2A catalytic subunit and incubated with GST-A. Analysis of the bound
material showed that removal of the first cysteine cluster resulted in
a dramatic decrease in the ability of small-t to bind to the A subunit.
The binding of the C subunit, added as a control for nonspecific
effects, was not altered (Fig. 3C). In control experiments,
neither wild type small-t, 110-119, nor the C subunit bound to GST
alone (data not shown).
View larger version (59K):
[in a new window]
Fig. 5.
Synthetic peptides specifically inhibit the
binding of small-t to PP2A. 35S-Labeled catalytic
subunit and wild type small-t were combined with GST-A in the absence
or the presence of 2.5 µM recombinant small-t
(ST) or with peptides 91-110, 105-122, 97-122, or
117-128 as indicated (all at a final concentration of 25 µM). The bound material was analyzed by 12% SDS-PAGE
followed by fluorography.
View larger version (36K):
[in a new window]
Fig. 6.
Small-t peptides inhibit PP2A activity.
A, the indicated small-t peptides were combined with either
the catalytic subunit (open bars) or the AC dimeric form of
PP2A (hatched bars) and their effects on phosphatase
activity determined. The data are plotted as the percent of the
activity of the catalytic subunit or AC form assayed in the absence of
peptide. Values shown are the mean ± S.E. of three separate
experiments. B, increasing concentrations of peptide 97-122
(filled circles), 105-122 (filled diamonds),
91-110 (open diamonds), 117-128 (open circles),
and peptide 105-122 (C-S) (filled squares) were combined
with the AC form of PP2A, and phosphatase activity was determined. The
data are plotted as percentage of inhibition (± S.E.) of the activity
of the AC form assayed in the absence of peptide.
-strand structure. The
-strand structure of these peptides agrees with the secondary
structure predictions for this region of small-t (Fig. 7B).
In contrast, peptide 105-122 (C-S) displayed an unordered structure in
solution indicating that the cysteines are important for the intrinsic
structure of the peptide (Fig. 7A). This result suggests
that the reduced affinity of peptide 105-122 (C-S) for the AC complex
may be due to the loss of secondary structure.
View larger version (21K):
[in a new window]
Fig. 7.
Structural analysis of the PP2A binding
domain. A, CD spectra of peptide 97-122 (open
triangles), 105-122 (filled circles), 105-122 (C-S)
(open circles), and 117-128 (filled triangles)
were determined. B, the secondary structure of small-t was
analyzed as described under "Experimental Procedures." The
probability that a particular residue will be in an 
-helix
(filled circles), -strand (open circles), or
an extended loop (filled diamonds) is plotted relative to
position in the small-t sequence for the region around the putative
PP2A binding domain.
View larger version (27K):
[in a new window]
Fig. 8.
Effects of zinc on small-t peptides. CD
spectra of peptides 117-128 (A), 97-122 (B),
105-122 (C), and 105-122 (C-S) (D) were
determined in the presence (open circles) or absence
(filled circles) of 100 µM
ZnSO4.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-catenin, the ortholog of the
Drosophila armadillo protein (35). Tumor antigens and
cellular regulatory subunits interact with multiple regions within
repeats 1-10, whereas the catalytic subunit binds to carboxyl-terminal
repeats 11-15 of the A subunit (16). A requirement for multiple arm
repeats has also been demonstrated for the interaction of -catenin
with its accessory proteins (35).
-strand to a random conformation and decreased apparent affinity
for the AC dimer by 2 orders of magnitude. These results indicate that
the cysteines contribute directly to the structural integrity of the
peptide and presumably play a similar role in full-length small-t.
Accordingly, mutation of these residues in full-length small-t causes
decreases in stability that are consistent with alteration in protein
structure (30, 31, 33). Collectively, these results argue that the
conserved cysteines play an important role in forming the structure of
this region of small-t and that the presence of a -strand secondary structure is critical for high affinity binding to PP2A.
-catenin (35). This lack of a shared sequence motif
contrasts with the presence of conserved sequence motif in proteins
that interact with protein phosphatase 1 (43). The lack of a conserved
sequence suggests that a conserved structural element is responsible
for interaction with PP2A. The CD data provided here represent the
initial information regarding the nature of such a structural element
within a PP2A regulatory protein. The secondary structure of the region
of small-t encompassed by residues 105-122 is predicted to be a
-strand. The CD spectra of peptides that inhibit the phosphatase
activity of the AC dimer and block small-t binding to GST-A indicate
that they have the predicted -strand structure. There are several
examples in protein structure data bases in which proteins lacking any
amino acid identity contain structurally related domains. Structural
stabilization, induced by coordination of metals, could be duplicated
by appropriate side-chain interactions. It has been postulated that the
structure of metal binding motifs may not be unique to metalloproteins, but may represent more general folding motifs (41). Therefore, despite
the lack of amino acid sequence similarity and the absence of cysteine
clusters, the PP2A regulatory subunits may share a common structural
element with small-t antigen. Our data suggest that this common element
may be a region of -strand secondary structure.
ACKNOWLEDGEMENT
FOOTNOTES
This work is submitted in partial fulfillment for the degree of
Doctor of Philosophy in the Cell Regulation Graduate Program at the
University of Texas Southwestern Medical Center at Dallas.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C. Csortos, I. Kolosova, and A. D. Verin Regulation of vascular endothelial cell barrier function and cytoskeleton structure by protein phosphatases of the PPP family Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L843 - L854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Guergnon, F. Dessauge, V. Dominguez, J. Viallet, S. Bonnefoy, V. J. Yuste, O. Mercereau-Puijalon, X. Cayla, A. Rebollo, S. A. Susin, et al. Use of Penetrating Peptides Interacting with PP1/PP2A Proteins As a General Approach for a Drug Phosphatase Technology Mol. Pharmacol., April 1, 2006; 69(4): 1115 - 1124. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Uren, S. Fallen, H. Yuan, A. Usubutun, T. Kucukali, R. Schlegel, and J. A. Toretsky Activation of the Canonical Wnt Pathway during Genital Keratinocyte Transformation: A Model for Cervical Cancer Progression Cancer Res., July 15, 2005; 65(14): 6199 - 6206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Hupfeld, J. L. Resnik, S. Ugi, and J. M. Olefsky Insulin-induced {beta}-Arrestin1 Ser-412 Phosphorylation Is a Mechanism for Desensitization of ERK Activation by G{alpha}i-coupled Receptors J. Biol. Chem., January 14, 2005; 280(2): 1016 - 1023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ugi, T. Imamura, H. Maegawa, K. Egawa, T. Yoshizaki, K. Shi, T. Obata, Y. Ebina, A. Kashiwagi, and J. M. Olefsky Protein Phosphatase 2A Negatively Regulates Insulin's Metabolic Signaling Pathway by Inhibiting Akt (Protein Kinase B) Activity in 3T3-L1 Adipocytes Mol. Cell. Biol., October 1, 2004; 24(19): 8778 - 8789. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Y. Lin and J. A. DeCaprio SV40 Large T Antigen Promotes Dephosphorylation of p130 J. Biol. Chem., November 21, 2003; 278(47): 46482 - 46487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. C. Hahn, S. K. Dessain, M. W. Brooks, J. E. King, B. Elenbaas, D. M. Sabatini, J. A. DeCaprio, and R. A. Weinberg Enumeration of the Simian Virus 40 Early Region Elements Necessary for Human Cell Transformation Mol. Cell. Biol., April 1, 2002; 22(7): 2111 - 2123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ugi, T. Imamura, W. Ricketts, and J. M. Olefsky Protein Phosphatase 2A Forms a Molecular Complex with Shc and Regulates Shc Tyrosine Phosphorylation and Downstream Mitogenic Signaling Mol. Cell. Biol., April 1, 2002; 22(7): 2375 - 2387. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Gjoerup, D. Zaveri, and T. M. Roberts Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen J. Virol., October 1, 2001; 75(19): 9142 - 9155. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |