![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 7, 4089-4095, February 13, 1998
§¶,
§,
, and
From the
Laboratory of Molecular and Cellular
Neuroscience, The Rockefeller University, New York,
New York 10021 and the
Institute of Environmental and Life
Science, The Hallym Academy of Science, Hallym University, 1 Okcheon-dong, Chuncheon, Kangwon-do 200-703, Korea
| |
ABSTRACT |
|---|
|
|
|---|
Protein phosphatase 1 (PP1) is found in the cell nucleus and has been implicated in several aspects of nuclear function. We report here the cloning and initial characterization of a novel protein ~ named phosphatase 1 nuclear targeting subunit (PNUTS). This protein interacts with PP1 in a yeast two-hybrid assay, is found in a stable complex with PP1 in mammalian cell lysates, and exhibits a potent modulation of PP1 catalytic activity toward exogenous substrate in vitro. PNUTS is a ubiquitously expressed protein that exhibits a discreet nuclear compartmentalization and is colocalized with chromatin at distinct phases during mitosis. The subcellular localization of PP1 and the activity toward substrates involved in many aspects of cell physiology have previously been shown to be regulated by association with noncatalytic targeting subunits. The properties of PNUTS are consistent with its role as a targeting subunit for the regulation of nuclear PP1 function.
| |
INTRODUCTION |
|---|
|
|
|---|
Protein phosphatase 1 (PP1)1 is a serine/threonine phosphatase that exerts control over many aspects of cellular physiology by reversing the actions of protein kinases, which include protein kinase A and protein kinase C. As a consequence, PP1 is critical to the regulation of diverse processes, such as cell division, muscle contraction, gene expression, glycogen metabolism, and neurotransmission (1, 2). PP1 is expressed ubiquitously and is distributed into multiple subcellular compartments. Although in vitro the catalytic subunit of PP1 exhibits a broad substrate specificity, the concerted action of the enzyme in the cell is thought to be directed by interaction of the catalytic subunit with a family of regulatory proteins. This family includes proteins, such as inhibitor-1, its neuronal homologue DARPP-32, inhibitor-2, and NIPP-1, which respond to distinct extracellular stimuli to regulate PP1 activity. A separate subfamily of PP1 regulatory proteins, referred to as targeting subunits, are thought to direct PP1 to specific subcellular locations and, in some cases, to modulate the activity of the enzyme toward specific substrates at these sites. For example, the glycogen binding targeting subunits in skeletal muscle and liver mediate the regulation of PP1 in response to insulin and epinephrine. In addition, PP1 associated with distinct targeting subunits bound to the myofibrils of smooth and striated muscle displays an enhanced rate of myosin dephosphorylation and reduced activity toward the enzymes of glycogen metabolism (3). Recent biochemical evidence suggests that a number of additional targeting proteins remain to be identified (4, 5).
There is evidence that PP1 plays a critical role in regulating nuclear processes. For example, PP1 has been shown to be important for exit from mitosis in yeast, fungi, and mammalian cells (6-11). Furthermore, RNA splicing appears to be regulated by type 1 phosphatase (12, 13), and PP1 has been shown to interact with a splicing factor (14). PP1 has also been shown to exist in high molecular weight complexes in nuclear extracts, and this can be accounted for in part by association of PP1 with the inhibitory polypeptide NIPP-1 (5). However, it seems clear that there are additional nuclear binding partners that are likely to play a role in directing nuclear PP1 function. We have focused our attention on potential PP1 regulatory proteins that are expressed in the nervous system and have used a yeast two-hybrid screen to identify a novel protein that exhibits properties expected of a nuclear PP1 targeting subunit.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Library Construction and Yeast Two-hybrid
Screening--
cDNA for library construction was synthesized from
5 µg of oligo(dT)-purified total rat brain mRNA using the adapter
5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15 to prime first
strand synthesis with SuperScript II reverse transcriptase (Life
Technologies, Inc.). Second strand synthesis was achieved using nick
translational mRNA replacement. The SalI adapter
5'-TCGACCCACGCGTCCG/5'-pCGGACGCGTGGG was ligated to double stranded DNA
followed by digestion with NotI. cDNAs (~3.5 × 106) were directionally subcloned into the
NotI/SalI-digested GAL4 activation domain
expression vector pPC86 (15). The cDNA for PP1
was expressed as
a GAL4 fusion in the expression vector pPC62 (15).
cDNA Expression and Immunoprecipitation--
The expression
vector pcDNA1 Neo (Invitrogen) was modified using a synthetic
double stranded oligonucleotide (5'-pAG CTT CCA GCA GCC ATG GAC TAC AAG
GAC GAC GAT GAC AAA GGT GGG TCG ACG C; 5'-pGG CCG CGT CGA CCC ACC TTT
GTC ATC GTC GTC CTT GTA GTC CAT GGC TGC TGG A) that was ligated into
the HindIII/NotI-digested plasmid. This
oligonucleotide provided a ribosomal RNA binding site, an initiation
codon, and sequences encoding the FLAG epitope followed by a
SalI site in frame with SalI/NotI
library inserts. Clone 14 plasmid DNA was digested with
SalI/NotI, and the released cDNA was
subcloned into this expression vector. An EcoRI fragment containing 4155 nucleotides of cDNA encompassing the entire coding sequence was subcloned into the mammalian expression vector pcDNA3 (Invitrogen). Constructs were transfected into 293T cells by calcium phosphate transfection; 5 µg of DNA was resuspended in 0.5 ml of 0.25 M CaCl2 and added dropwise to an equal volume
of HEPES-buffered saline: 280 mM NaCl, 10 mM
KCl, 1.5 mM Na2HPO4, 12 mM dextrose, 50 mM HEPES, pH 7.05. The
precipitate was added directly to tissue culture medium (Dulbecco's
modified Eagle's medium/10% fetal calf serum, 5% gassed
CO2) and incubated overnight, after which it was aspirated
and replaced with fresh medium. Samples were lysed in 0.5% Nonidet
P-40, 1 mM EDTA, 50 mM Tris-HCl, pH 8.0, 120 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 20 µg/ml leupeptin/antipain, and 5 µg/ml pepstatin/chymostatin on ice
for 30 min. The 100,000 × g supernatant protein
concentrations were determined using BCA assay (Pierce). 2 mg of total
protein was used for immunoprecipitation with anti-FLAG monoclonal
antibody M2 coupled to agarose (IBI). PP1 immunoprecipitations were
performed with 1 µg of either PP1
or
isoform specific antibody
(17) and 10 µl of protein A-Sepharose (Pharmacia). Following several
washes in lysis buffer and one in 50 mM Tris-HCl, pH 7.0, complexes were solubilized by boiling in SDS-PAGE sample buffer.
Proteins were separated by SDS-PAGE and immunoblotted as described
below. Coimmunoprecipitation from PC12 cells followed the same
procedure except that tissue was dispersed using a probe sonicator and
lysates were precleared with protein A-Sepharose prior to incubation
with a protein A-Sepharose-primary antibody complex with or without
preabsorption of the synthetic immunization peptide.
cDNA Cloning, Characterization and Expression
Pattern--
The 5' end of the cDNA was characterized using four
clones isolated from a rat hippocampal
ZAP cDNA library that was
kindly provided by Dr. Markus Stoffel. Sequencing of both cDNA
strands was performed by dye terminator cycling and resolution on an
ABI 373 Stretch Sequencer. Sequence analysis was performed using
Geneworks (Intelligenetics) and the BLAST algorithm (18).
Antibody Production-- The synthetic peptide GDPNQLTRKGRKRKTVTWPEEGKLC (residues 384-407) was provided by Dr. Janet Crawford (W. M. Keck Foundation, Yale University). For immunization, 5 mg of peptide was conjugated to 33 mg of thyroglobulin (Sigma) using 2.5 ml of 0.2% glutaraldehyde added dropwise over 20 min at 4 °C followed by further incubation at 4 °C with mixing for 2 h. The reaction was quenched with 1.8 mg of sodium borohydride in 150 µl of water. The preparation was dialyzed extensively against PBS and used for immunization of two rabbits: RU154 and RU155 (Cocalico Biologicals). Crude sera were affinity-purified on a column of immunizing peptide coupled to SulfoLink (Pierce), which was prepared according to the manufacturer's recommendation. A second round of affinity purification was against purified GST-110 fusion protein. This protein was first dialyzed extensively against coupling buffer and then immobilized on cyanogen bromide activated Sepharose 4B according to the manufacturer's recommendation.
Indirect Immunofluorescence-- PC12 cells were grown overnight on 30-mm Nunclon tissue culture dishes coated with 0.1 mg/ml poly-D-lysine and fixed for 15 min in 4% paraformaldehyde-PBS. Cells were permeabilized and blocked in PBS containing 1% bovine serum albumin, 5% fetal calf serum, and 0.1% saponin for 1 h. Cells were then incubated with primary antibody RU154 (1:200) for 2 h at room temperature, washed with PBS, and incubated for 45 min with Texas red-conjugated goat anti-rabbit immunoglobulin (Rockland). After being washed three times with PBS, cells were stained for DNA with DAPI for 10 min, and the coverslips were mounted with Fluoromount (Fisher).
Preparation of Bacterial GST Fusion Protein--
A 1118-base
pair PflM I blunt-ended/SalI fragment was
purified from clone 14. This was ligated into NotI
blunt-ended/SalI-digested pGEX-4T-2 (Pharmacia) to direct
expression of GST fused to residues 309-691 of the PP1-binding
protein. The protein was expressed in BL21 DE3 E. coli by
induction of log phase cells with 0.1 mM isopropyl-1-thio-
-D-galactopyranoside at 30 °C for
3 h. Cells were resuspended in ice-cold PBS followed by cell lysis
using a French press. Triton X-100 was added to 1%, and the lysate was centrifuged for 5 min at 10,000 × g at 4 °C. The
supernatant was loaded onto a glutathione-agarose affinity column
(Pharmacia) and washed extensively with PBS. The fusion protein was
eluted with 5 mM glutathione, 50 mM Tris-HCl,
pH 8.0.
Protein Phosphatase Activity Assay-- [32P]phosphorylase and purified rabbit muscle PP1 and PP2A were provided by Dr. Hsien-bin Huang. Preparation and activity assays were performed essentially as described (19). The phosphatase assay was carried out with PP1 or PP2A (~150 pM) in 50 mM Tris-HCl, pH 7.0, 0.1% 2-mercaptoethanol, 0.3 mg/ml bovine serum albumin, 0.01% Brij 35, 1 mg/ml [32P]phosphorylase, 5 mM caffeine, 0.1 mM EGTA with or without varied concentrations of GST and GST-14. PP1 and the bacterial GST proteins were pre-incubated at 30 °C for 10 min. The reaction was initiated by addition of substrate, carried out for 10 min at 30 °C, and stopped by trichloroacetic acid precipitation. Radioactivity present in the supernatant was determined by Cherenkov counting.
| |
RESULTS |
|---|
|
|
|---|
Identification of a Novel Gene Product Interacting with
PP1--
To identify proteins capable of interacting with the
isoform of PP1, we performed a yeast two-hybrid screen (20). We used a
rat brain cDNA-GAL4 expression plasmid library and a "bait" hybrid protein consisting of PP1
fused to the GAL 4 DNA binding domain. Out of 60 clones analyzed, clone 14 was one of two cDNAs isolated that appeared to be derived from the same gene based on
restriction fragment size analysis (data not shown). Clone 14 appeared
to interact specifically with PP-1
because it would not activate
transcription of yeast reporter genes either independently or in
combination with irrelevant baits. This clone contained an ~ 3-kilobase cDNA insert and partial nucleotide sequencing followed
by data base searches revealed that it represented a novel protein.
in 293T
cell extracts. Clone 14 was subcloned into a mammalian expression
vector designed to include an amino-terminal FLAG tag. The tagged
protein was expressed transiently to a high level in 293T cells and
immunoprecipitation carried out using an anti-FLAG antibody. Proteins
present in the immune complex, as well as SDS extracts from the soluble
and particulate fractions, were separated by SDS-PAGE and immunoblotted
sequentially using anti-FLAG and anti-PP1
antibodies (Fig.
1A). A proportion of the
overexpressed clone 14 recombinant protein was present in the
particulate fraction, whereas the majority appeared in the soluble
fraction migrating at ~85 and ~60 kDa. The lower ~60 kDa species
was scarce in the particulate fraction, whereas in the soluble fraction
it became relatively more abundant during the immunoprecipitation
assay. This suggested that the amino-terminal FLAG tagged ~60 kDa
protein is generated by proteolysis and that removal of the carboxyl
terminus of the recombinant protein largely prevents partition to the
particulate fraction. The strong signal seen for PP1 in
coimmunoprecipitations performed with cells expressing clone 14 indicated that in 293T cell lysates, the two proteins exist in a
complex.
|
and PP1
isoforms form a complex with the
~110-kDa protein (Fig. 1B). Preabsorption of the
anti-clone 14 and anti-PP1
antibodies with their respective peptide
immunogens abolished the signals seen in subsequent immunoblots,
demonstrating the specificity of the coimmunoprecipitation assay. PP1
is known to undergo a cell cycle-dependent inhibitory phosphorylation
of the carboxyl terminus (21). Using synchronized cell cultures and
phosphorylation state-specific antibodies, we observed no selective
coimmunoprecipitation of the PP1-binding protein with the phospho-or
dephospho-form of PP1 (not shown).
Clone 14 Expression Pattern-- Northern blotting analysis revealed the presence of an ~4.2-kilobase mRNA transcript in all tissues examined, with the highest levels being found in testis (Fig. 2A). The cDNA probe employed did not reveal alternatively spliced transcripts.
|
Sequence Analysis of the PP1-binding Protein--
Four overlapping
cDNA clones were isolated from a rat hippocampal
ZAP cDNA
library to characterize the full-length cDNA for clone 14. The
predicted amino acid sequence is shown in Fig.
3. The putative initiating methionine was
identified as the first residue in a long open reading frame of 2616 nucleotides, lying in the context of a sequence possessing 80%
compliance with the consensus eukaryotic ribosome binding sequence
(22). The predicted molecular mass of this protein is 92.8 kDa, which
differs from the apparent molecular mass of ~110 kDa seen in SDS-PAGE
for both the expressed cDNA and for the endogenous rat protein.
This may be due to an extended conformation and/or low SDS binding
capacity. In addition, the glycine residue following the initiating
methionine might be subject to myristylation. The protein is
predicted to be basic, with a theoretical pI of 9.2.
|
Subcellular Localization of the PP1-binding Protein-- We examined the cellular distribution of the PP1-binding protein by indirect immunofluorescence. Freely dividing PC12 cells were fixed, permeabilized, and stained first with the anti-PP1-binding protein antibody plus a Texas red-conjugated secondary antibody, and secondly for DNA using DAPI stain. Fig. 4 shows that staining for the PP1-binding protein is restricted to the nuclear compartment in PC12 cells. This finding is consistent with the partition of the PP1-binding protein to the low speed centrifugation pellet in 293T cell fractionation studies (Fig. 2C). During interphase (Fig. 4, A and D), the staining appeared somewhat punctate, suggesting that the protein is subcompartmentalized within the nucleus. During anaphase (Fig. 4, B and E) the condensed chromatin was readily visible with the DAPI stain. Antibody staining at this stage appeared to be excluded from the region staining for chromatin. In marked contrast, at a later stage of the mitotic cycle, during telophase (Fig. 4, C and F), the antibody staining appeared to overlap precisely with the DAPI stain. This suggests that there is a cell cycle-dependent shift in the colocalization of the PP1-binding protein with chromatin. Fig. 4G indicates the specificity of the antibody used for immunofluorescence in a Western blot of total PC12 cell lysate.
|
The PP1-binding Protein Modulates PP1 Catalytic Activity-- The functional consequence of the interaction between the binding protein and PP1 was examined in vitro by measuring the effect on PP1 catalytic activity of increasing concentrations of recombinant protein. For this we prepared a bacterial protein (GST-14) consisting of GST fused to residues 309-691 of the PP1-binding protein; notably, larger bacterial proteins were found to be unstable. This protein was purified by affinity chromatography on glutathione beads and found to migrate with an apparent molecular mass of 85 kDa in SDS-PAGE (data not shown). The activity of purified PP1 catalytic subunit was measured using radiolabeled phosphorylase a as substrate. The GST-14 fusion protein inhibited PP1 enzymatic activity with an IC50 of ~50 pM. In contrast, GST alone had no effect on the activity of PP1 at high concentrations, and neither GST nor GST-14 affected the activity of the purified catalytic subunit of a closely related phosphatase, PP2A (Fig. 5A). Together, these results indicate that GST-14 is a potent and specific inhibitor of PP1 activity in vitro.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present results provide evidence for a stable complex between PP1 and a novel interacting protein. This protein exhibits a discreet nuclear localization and is a potent modulator of PP1 catalytic activity. We therefore propose to name the protein PNUTS. This acronym reflects its putative role as a phosphatase 1 nuclear targeting subunit. The affinity between PP1 and PNUTS appears to be relatively high. This is suggested both by the strong signals seen in coimmunoprecipitation experiments and by the inhibitory potency in enzyme assays. Preliminary studies suggest that the mode of PP1 binding and inhibition may be complex, possibly involving more than one site, as has been shown for other PP1 regulatory subunits (28-30)
Certain high molecular weight forms of PP1 have previously been characterized biochemically. In particular, Jagiello et al. (5) identified a protein of 111 kDa present in rat liver nuclear extracts that binds to PP1 and inhibits activity toward phosphorylase a. This protein may correspond to PNUTS. In addition, Nelson et al. (35) described unknown proteins of 125 and 110 kDa that are present in mitotic extracts and that bind to PP1. These proteins, one of which may also correspond to PNUTS, are present in cell fractions containing high molecular weight PP1 species that display significant activity toward phosphorylase a and toward phospho-Rb. This raises the possibility that PNUTS may be present in a protein complex containing PP1 activity toward Rb. We performed coimmunoprecipitation experiments to examine the Rb content in PP1 complexes and found a small fraction of hypophosphorylated Rb to be complexed with PP1, as previously reported (31). However, no Rb protein could be detected in an immune complex of PNUTS and vice versa, suggesting that the binding of these two proteins to PP1 is mutually exclusive.2
PNUTS possesses structural signatures that might be expected of an RNA-binding protein. In particular, the RGG boxes present in the carboxyl terminus have been shown to be associated with RNA-binding proteins (25). Previous studies have suggested a role for PP1 in the regulation of RNA splicing (12, 13, 32), and a recent two-hybrid screen identified a splicing factor that can form a complex with PP1 (14). PNUTS therefore represents a potential targeting protein for coupling PP1 to the nuclear RNA processing machinery. In addition to these RGG boxes, there is an atypical Zn2+ finger and an unusual histidine-rich repeat region. It will be of interest to determine the nucleic acid binding potential of these various regions and their contribution to the targeting of PNUTS to the nucleus. During the incubation of 293T cell lysates for immunoprecipitation experiments (Fig. 1A), the carboxyl terminus of a proportion of the recombinant PNUTS appeared to be lost due to proteolysis. This was accompanied by a shift in the partition of the truncated protein from the particulate to the soluble fraction, implying that the carboxyl terminus is at least partially responsible for the localization of the protein to the particulate fraction. It therefore seems possible that this region could help to target the protein to the nucleus, perhaps in addition to the more amino-terminal putative nuclear localization motifs. Curiously, two of the three consensus motifs for SH3 domain binding are found within the region rich in RGG boxes. The presence of both sets of motifs within the same domain of the protein suggests the possibility of a mutually exclusive binding for an SH3 domain-containing protein or nucleic acid. Alternatively, PNUTS may serve to cross-link an SH3 domain-containing protein to nucleic acid.
PP1 has been shown to be important for exit from mitosis both by genetic analyses (7-10) and in microinjection studies (6, 11). However the relevant substrates for PP1 at the exit from mitosis have not been defined. Recent work in both yeast and mammalian cells has indicated that phosphorylation of the carboxyl terminus of PP1 by cdc2 inhibits enzyme activity (33, 34) and that this phosphorylation shows a distinct peak during early to mid-mitosis, with subsequent dephosphorylation presumably reactivating PP1 and allowing exit from mitosis (21, 36). Immunofluorescence microscopy further showed that the phosphorylated form of the enzyme was localized to nonchromosomal regions during anaphase (21). That staining is very similar to that of PNUTS during anaphase, after which phospho-PP1 staining decreases and PNUTS appears to translocate to chromosomal regions. Coimmunoprecipitation studies from synchronized PC12 cell cultures show that although phospho-PP1 was complexed with PNUTS, there was no significant cell cycle-dependent shift in total PP1 complexed.2 PP1 has been reported to accumulate in the nucleus and to colocalize with chromatin at mitosis (6). Thus, only a proportion of mitotic PP1 is presumably complexed with PNUTS, although the phospho form is preferentially colocalized. It seems likely that a comprehensive description of the role of PP1 during mitosis may require characterization of additional PP1 targeting proteins.
The sequence of what appears to be the human homologue of PNUTS has recently been submitted to the GenBank data base (accession no. Y13247). The human gene for this protein lies in the HLA class 1 region on the short arm of chromosome 6 within a region implicated in hereditary hemochromatosis (37). The only region of extensive diversity between human and rat appears in the carboxyl-terminal histidine-rich region, with the human protein possessing several additional histidine-rich repeat motifs. This divergence presumably explains the slower migration of human PNUTS in SDS-PAGE. In addition, significant sequence divergence occurs within the consensus motif for nucleotide phosphate binding; the serine residue in the consensus GxxGxGKS is converted to a glycine in the human sequence. Although this casts some doubt on a potential nucleotide binding function for PNUTS, it should be noted that in proteins of the adenylate kinase family the P-loop contains a glycine following the invariant lysine (24), indicating that this residue might be tolerated in a human PNUTS P-loop.
The classical PP1 targeting subunits are thought to function in part by bringing enzyme and substrate into close proximity (3). A major goal underlying the identification of novel targeting subunits for PP1 is to provide insight into the substrates that are responsible for mediating the diverse functions of this enzyme. Future efforts to describe the role of nuclear PP1 will focus on the nucleic acids, potential PP1 substrates, and other proteins that are predicted to interact with PNUTS.
| |
Note Added in Proof |
|---|
Work decribing the interaction of PP1 with what appears to be the human homolog of PNUTS has recently been reported (38).
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant MH 40899.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF040954.
§ These authors contributed equally to this work.
¶ To whom correspondence should be addressed: Laboratory of Molecular and Cellular Neuroscience, The Rockefeller University, 1230 York Ave., New York, NY 10021. E-mail: allenp{at}rockvax.rockefeller.edu.
1 The abbreviations used are: PP1, protein phosphatase 1; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; GST, glutathione S-transferase; PNUTS, phosphatase 1 nuclear targeting subunit.; DAPI, 41,6-diamidino-2-phenylindole.
2 P. B. Allen, Y.-G. Kwon, A. C. Nairn, and P. Greengard, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models Physiol Rev, April 1, 2008; 88(2): 421 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Gunawardena, B. L. Ruis, J. A. Meyer, M. Kapoor, and K. F. Conklin NOM1 Targets Protein Phosphatase I to the Nucleolus J. Biol. Chem., January 4, 2008; 283(1): 398 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Trinkle-Mulcahy, J. Andersen, Y. W. Lam, G. Moorhead, M. Mann, and A. I. Lamond Repo-Man recruits PP1{gamma} to chromatin and is essential for cell viability J. Cell Biol., February 27, 2006; 172(5): 679 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ling, A. J. Smith, and G. T. Morgan A sequence motif conserved in diverse nuclear proteins identifies a protein interaction domain utilised for nuclear targeting by human TFIIS. Nucleic Acids Res., January 1, 2006; 34(8): 2219 - 2229. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lesage, M. Beullens, M. Nuytten, A. Van Eynde, S. Keppens, B. Himpens, and M. Bollen Interactor-mediated Nuclear Translocation and Retention of Protein Phosphatase-1 J. Biol. Chem., December 31, 2004; 279(53): 55978 - 55984. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Colbran Protein Phosphatases and Calcium/Calmodulin-Dependent Protein Kinase II-Dependent Synaptic Plasticity J. Neurosci., September 29, 2004; 24(39): 8404 - 8409. [Full Text] [PDF] |
||||
![]() |
P. B. Allen, A. T. Greenfield, P. Svenningsson, D. C. Haspeslagh, and P. Greengard Phactrs 1-4: A family of protein phosphatase 1 and actin regulatory proteins PNAS, May 4, 2004; 101(18): 7187 - 7192. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. T. Tran, A. Ulke, N. Morrice, C. J. Johannes, and G. B. G. Moorhead Proteomic Characterization of Protein Phosphatase Complexes of the Mammalian Nucleus Mol. Cell. Proteomics, March 1, 2004; 3(3): 257 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. CEULEMANS and M. BOLLEN Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button Physiol Rev, January 1, 2004; 84(1): 1 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Kim, T. Watanabe, P. B. Allen, Y.-M. Kim, S.-J. Lee, P. Greengard, A. C. Nairn, and Y.-G. Kwon PNUTS, a Protein Phosphatase 1 (PP1) Nuclear Targeting Subunit. CHARACTERIZATION OF ITS PP1- AND RNA-BINDING DOMAINS AND REGULATION BY PHOSPHORYLATION J. Biol. Chem., April 11, 2003; 278(16): 13819 - 13828. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mao and K. S. Rosenthal Strain-Dependent Structural Variants of Herpes Simplex Virus Type 1 ICP34.5 Determine Viral Plaque Size, Efficiency of Glycoprotein Processing, and Viral Release and Neuroinvasive Disease Potential J. Virol., March 15, 2003; 77(6): 3409 - 3417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Dell'Acqua, K. L. Dodge, S. J. Tavalin, and J. D. Scott Mapping the Protein Phosphatase-2B Anchoring Site on AKAP79. BINDING AND INHIBITION OF PHOSPHATASE ACTIVITY ARE MEDIATED BY RESIDUES 315-360 J. Biol. Chem., December 6, 2002; 277(50): 48796 - 48802. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mao and K. S. Rosenthal An N-terminal Arginine-rich Cluster and a Proline-Alanine-Threonine Repeat Region Determine the Cellular Localization of the Herpes Simplex Virus Type 1 ICP34.5 Protein and Its Ligand, Protein Phosphatase 1 J. Biol. Chem., March 22, 2002; 277(13): 11423 - 11431. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Peggie, S. H. MacKelvie, A. Bloecher, E. V. Knatko, K. Tatchell, and M. J. R. Stark Essential functions of Sds22p in chromosome stability and nuclear localization of PP1 J. Cell Sci., January 1, 2002; 115(1): 195 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, Y. Ma, S. S. Taylor, and R. Y. Tsien Genetically encoded reporters of protein kinase A activity reveal impact of substrate tethering PNAS, December 18, 2001; 98(26): 14997 - 15002. [Abstract] [Full Text] [PDF] |
||||