JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Natochin, M.
Right arrow Articles by Artemyev, N. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Natochin, M.
Right arrow Articles by Artemyev, N. O.

J Biol Chem, Vol. 273, Issue 8, 4300-4303, February 20, 1998

COMMUNICATION
Substitution of Transducin Ser202 by Asp Abolishes G-protein/RGS Interaction*

Michael Natochin and Nikolai O. ArtemyevDagger

From the Department of Physiology and Biophysics, University of Iowa College of Medicine, Iowa City, Iowa 52242

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Known RGS proteins stimulate GTPase activity of Gi and Gq family members, but do not interact with Gsalpha and G12alpha . To determine the role of specific Galpha residues for RGS protein recognition, six RGS contact residues of chimeric transducin alpha -subunit (Gtalpha ) corresponding to the residues that differ between Gialpha and Gsalpha have been replaced by Gsalpha residues. The ability of human retinal RGS (hRGSr) to bind mutant Gtalpha subunits and accelerate their GTPase activity was investigated. Substitutions Thr178 right-arrow Ser, Ile181 right-arrow Phe, and Lys205 right-arrow Arg of Gtalpha did not alter its interaction with hRGSr. The Lys176 right-arrow Leu mutant had the same affinity for hRGSr as Gtalpha , but the maximal GTPase stimulation by hRGSr was reduced by ~2.5-fold. The substitution His209 right-arrow Gln led to a 3-fold decrease in the affinity of hRGSr for the Gtalpha mutant without significantly affecting the maximal GTPase enhancement. The Ser202 right-arrow Asp mutation abolished Gtalpha recognition by hRGSr. A counteracting replacement of Glu129 by Ala in hRGSr did not restore the interaction of hRGSr with the Gtalpha Ser202 right-arrow Asp mutant. Our data suggest that the Ser residue at position 202 of Gtalpha is critical for the specificity of RGS proteins toward Gi and Gq families of G-proteins. Consequently, the corresponding residue, Asp229 of Gsalpha , is likely responsible for the inability of RGS proteins to interact with Gsalpha .

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Heterotrimeric GTP-binding proteins (G-proteins) are components of many major signaling systems that are used by cells to transduce a variety of signals from specific cell surface receptors to intracellular effector proteins. Regulation of G-protein GTPase activity represents an important mechanism for establishing proper signal duration. A novel class of proteins called RGS1 for regulators of G-protein signaling has been identified (1-5). Evidence has been accumulated that members of this family negatively regulate signaling via Gi and Gq-like G-proteins by stimulating their GTPase activity (6-10). Identification of RGS proteins has helped to solve a long standing discrepancy between the fast signal termination in vivo and relatively slow intrinsic GTPase rates typically observed under in vitro conditions (6, 11). However, no RGS protein or other GTPase-activating protein (GAP) specific toward Gsalpha has been described to date (9, 10). The recently solved crystal structure of RGS4 bound to Gialpha 1·AlF4- provides the first structural insights into the mechanism of RGS protein GAP function and offers a starting point for studying the structural basis of the specificity of known RGS proteins (12). RGS4 interacts with the switch regions of Gialpha 1 that are likely to have a similar general conformation with the corresponding regions of Gsalpha (12). The incompetence of RGS proteins to bind and stimulate the GTPase activity of Gsalpha therefore originates from the differences between amino acid residues of Gialpha 1 contacting RGS4 and corresponding residues of Gsalpha .

In this study we investigate molecular determinants of the specificity of RGS/G-protein interaction using transducin alpha -subunit (Gtalpha ) as a prototypical member of the Gi family and a human homologue (hRGSr) of mouse retinal mRGSr (13, 14). We have carried out mutational analysis of specific amino acid residues of chimeric Gtalpha corresponding to the RGS contact residues that are different between Gialpha and Gsalpha to determine their specific role for RGS protein recognition.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- GTP was a product of Boehringer Mannheim. [gamma -32P]GTP (>5000 Ci/mmol) was purchased from Amersham Corp. All other chemicals were acquired from Sigma.

Preparation of Rod Outer Segment (ROS) Membranes, Gtbeta gamma and hRGSr-- Bovine ROS membranes were prepared as described previously (15). Urea-washed ROS membranes (uROS) were prepared according to protocol in Ref. 16. Gtbeta gamma was prepared by the procedure described in Ref. 17. GST-hRGSr and hRGSr were prepared and purified as described previously (14). The purified proteins were stored in 40% glycerol at -20 °C or without glycerol at -80 °C.

Site-directed Mutagenesis of Chimeric Gtalpha -- Mutagenesis of Gtalpha residues was performed using the vector for expression of His6-tagged Gtalpha /Gialpha 1 chimera 8 (Chi8) as a template for PCR amplifications (18). The Gtalpha Lys176 right-arrow Leu and Thr178 right-arrow Ser substitutions were introduced using 5'-primer 1 and 3'-primers 2 and 3, respectively, for PCR amplification (see below). The PCR products were digested with BsmBI and subcloned into the BsmBI-digested pHis6Chi8. Primer 3 also contained silent mutations creating the unique XbaI site that was used to make the Ile181 right-arrow Phe mutant. The 5'-primer 4 and 3'-primer 5 were used to obtain the PCR product carrying the Ile181 right-arrow Phe mutation. The product was cut with XbaI and HindIII and subcloned into the XbaI/HindIII-digested pHis6Chi8 Thr178 right-arrow Ser. The Ser202 right-arrow Asp and Lys205 right-arrow Arg substitutions were introduced by PCR-directed mutagenesis using 5'-primer 6 and 3'-primers 7 and 8, respectively, followed by insertion of the NcoI/BamHI-digested PCR products into pHis6Chi8. Mutation His209 right-arrow Gln was generated using 5'-primer 9 and 3'-primer 5 and subcloning of the PCR product into the BamHI and HindIII sites of pHis6Chi8. The sequences of all mutants were verified by automated DNA sequencing at the University of Iowa DNA Core Facility. Chi8 and all mutants were expressed and purified as described previously (18). The purified proteins were tested in the trypsin protection assay as described (19). The following primers were used to generate mutant Chi8 (the restriction sites are underlined and mutated codons are in bold): Primer 1, TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGG; Primer 2, GAACTG CGTCTC AAT GAT ACC CGT GGT CAG GAC ACG GG; Primer 3, GAACTG CGTCTC AAT GAT ACC CGA GGT CTT GAC TCT AGA GCG C; Primer 4, GCGC TCT AGA GTC AAG ACC ACG GGT ATC TTT GAG; Primer 5, TCGTCTTCAAGAATCGATAAGCTT; Primer 6, ATC ACG CC ATG GGG GCT GGG GCC AGC; Primer 7, A GCA GTG GAT CCA CTT CTT GCG CTC ATC GCG CTG CC; Primer 8, A GCA GTG GAT CCA CTT GCG GCG CTC TGA GC; Primer 9, AAG TGG ATC CAG TGC TTT GAA GGC.

Site-directed Mutagenesis of hRGSr-- A substitution Glu129 right-arrow Ala of hRGSr was performed using PCR amplifications from the pGEX-KG-hRGSr template (14) similarly as described (20). GST-hRGSr and the mutant were expressed in DH5alpha Escherichia coli cells, and the GST portion was removed as described earlier (14).

Binding of Chimeric Gtalpha and Its Mutants to GST-hRGSr-- Chi8 or its mutants (1 µM final concentration) were mixed with glutathione-agarose retaining ~10 µg of GST-hRGSr in 200 µl of 20 mM HEPES buffer (pH 7.6) containing 100 mM NaCl, 2 mM MgCl2, 30 µM AlCl3, and 10 mM NaF (buffer A). After incubation for 20 min at 25 °C, the agarose beads were spun down, washed three times with 1 ml of buffer A, and the bound proteins were eluted with a sample buffer for SDS-polyacrylamide gel electrophoresis.

Single Turnover GTPase Assay-- Single turnover GTPase activity measurements were carried out in suspensions of uROS membranes (5 µM rhodopsin) reconstituted with chimeric Gtalpha or its mutants (2 µM) and Gtbeta gamma (1 µM) essentially as described in Refs. 14 and 21. Bleached uROS membranes were mixed with different concentrations of hRGSr or hRGSrGlu129 right-arrow Ala and preincubated for 5 min at 25 °C. The GTPase reaction was initiated by addition of 100 nM [gamma -32P]GTP (~4 × 105 dpm/pmol). The GTPase rate constants were calculated by fitting the experimental data to an exponential function: % GTP hydrolyzed = 100(1 - e-kt), where k is a rate constant for GTP hydrolysis.

Miscellaneous-- Protein concentrations were determined by the method of Bradford (22) using IgG as a standard or using calculated extinction coefficients at 280 nm. SDS-polyacrylamide gel electrophoresis was performed by the method of Laemmli (23) in 12% acrylamide gels. Rhodopsin concentrations were measured using the difference in absorbance at 500 nm between "dark" and bleached ROS preparations. Fitting of the experimental data was performed with nonlinear least squares criteria using GraphPad Prizm (version 2) software. The results are expressed as the mean ± S.E. of triplicate measurements.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Effects of hRGSr on GTPase Activity of Gtalpha Mutants-- Six residues directly interacting with RGS4 are different in Gialpha 1 and Gsalpha (12). These residues correspond to Lys176, Thr178, Ile181, Ser202, Lys205, and His209 of Gtalpha . Except for a conservative substitution, Gtalpha Ile181/Gialpha 1 Val185, these residues are identical in Gtalpha and Gialpha 1. To analyze functional consequences of the replacement of these Gtalpha residues by corresponding Gsalpha residues we took advantage of the efficient expression of functional Gtalpha /Gialpha 1 chimeras in E. coli (18). All the Gtalpha mutants were made based on Chi8 that contains 80% of Gtalpha amino acid sequence, including all three Gtalpha switch regions (18). Analysis of Chi8 GTPase activity showed properties similar to native Gtalpha . The GTP hydrolysis by Chi8 alone or in the presence of uROS was negligible (not shown). In the presence of both, uROS and Gtbeta gamma , the basal GTPase activity of Chi8 was 0.016 ± 0.002 s-1 (Fig. 1). A similar rate of GTP hydrolysis (0.019 s-1) was observed earlier for holotransducin, Gtalpha beta gamma , reconstituted with uROS under similar conditions (14). This suggests that despite a lack of myristoylation and the His6-tag attached to the N terminus, Chi8 was competent to interact with Gtbeta gamma and light-activated rhodopsin. The GTPase activity of Chi8 was substantially enhanced in the presence of hRGSr. Addition of 1 µM hRGSr led to acceleration of the GTPase activity by almost 8-fold (k = 0.126 ± 0.018 s-1) (Fig. 1). Stimulation of GTPase activity of transducin by hRGSr under similar conditions was ~10-fold (14). Furthermore, the dose dependence of the stimulation of Chi8 GTPase activity by hRGSr yielded an EC50 value of 109 ± 15 nM (Fig. 2A), which correlates well with the EC50 value of 85 nM for the effect of hRGSr on transducin (24). Effects of hRGSr on the GTPase activity of Chi8 suggest that this chimeric G-protein was an appropriate target for the site-directed mutagenesis.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1.   Stimulation of GTPase activity of Gtalpha mutants by hRGSr. The time course of GTP hydrolysis in suspensions of bleached urea-washed ROS membranes was determined as described under "Experimental Procedures." The reaction mixtures contained 5 µM rhodopsin, 2 µM Chi8 or mutant, and 1 µM Gtbeta gamma in the absence (squares) or in the presence (triangles) of 1 µM hRGSr.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   Dose dependence of GTPase activity stimulation of Gtalpha mutants by hRGSr. The GTPase rate constants for Gtalpha mutants in suspensions of urea-washed ROS membranes (5 µM rhodopsin, 2 µM Gtalpha mutant, 1 µM Gtbeta gamma ) were determined in the presence of increasing concentrations of hRGSr. Symbols indicate EC50 values as follows: square , 109 ± 15 nM (Chi8); diamond , 103 ± 17 nM (T178S); down-triangle, 186 ± 24 nM (I181F); triangle , 147 ± 13 nM (K205R); black-square, 337 ± 25 nM (H209Q); black-triangle, 129 ± 21 nM (K176L); black-diamond , S202D.

Expression of Chi8 and all six Gtalpha mutants, Lys176 right-arrow Leu, Thr178 right-arrow Ser, Ile181 right-arrow Phe, Ser202 right-arrow Asp, Lys205 right-arrow Arg, and His209 right-arrow Gln produced comparable amounts of fully soluble proteins (~5-7 mg/liter of culture). Mutants Lys176 right-arrow Leu, Ile181 right-arrow Phe, Lys205 right-arrow Arg, and His209 right-arrow Gln, similarly to Chi8 and transducin, had basal GTPase activities in the range of 0.014-0.023 s-1 (Fig. 1). The Ser202 right-arrow Asp mutation led to a small reduction in the basal GTPase rate (k = 0.012 ± 0.001 s-1). Interestingly, Gtalpha Thr178 right-arrow Ser had an elevated basal GTPase activity (k = 0.032 ± 0.003 s-1) (Fig. 1). The maximal stimulation of GTPase activity of Thr178 right-arrow Ser, Ile181 right-arrow Phe, Lys205 right-arrow Arg and His209 right-arrow Gln mutants by hRGSr was 5.0-7.5-fold, comparable with the effects of hRGSr on Chi8 (Fig. 2A). A lower, only ~3-fold, maximal GTPase rate enhancement resulted from addition of hRGSr to Gtalpha Lys176 right-arrow Leu (Fig. 2B). hRGSr failed to elicit any notable stimulation of GTPase activity of Gtalpha Ser202 right-arrow Asp (Fig. 2B). The concentration dependence curves for stimulation of GTPase activity of different mutants by hRGSr revealed modest variations in the EC50 values. Mutants Lys176 right-arrow Leu, Thr178 right-arrow Ser, Ile181 right-arrow Phe, and Lys205 right-arrow Arg had the EC50 values comparable with the EC50 value for Chi8 and transducin, suggesting that these mutations did not alter affinity of the G-protein-RGS interaction (Fig. 2, A and B). A 3-fold increase in the EC50 value was observed for the His209 right-arrow Gln mutant (EC50 337 ± 25 nM) (Fig. 2A).

Binding of Gtalpha Mutants to GST-hRGSr-- Binding between the Gtalpha mutants and hRGSr was examined using precipitation of mutants by glutathione-agarose beads containing immobilized GST-hRGSr. hRGSr, as many other RGS proteins, binds with high affinity to the AlF4- conformation of G-protein alpha -subunits (7, 9, 14). The binding assay demonstrated that GST-hRGSr in the presence of AlF4- was able to precipitate nearly stoichiometric amounts of Chi8, and all of the Gtalpha mutants, except Gtalpha Ser202 right-arrow Asp (Fig. 3A). The competence of hRGSr to efficiently precipitate the mutant Lys176 right-arrow Leu is consistent with the EC50 value of 129 nM for the stimulation of its GTPase activity, even though the maximal GTPase enhancement by hRGSr for this mutant was substantially decreased. Gtalpha Ser202 right-arrow Asp failed to bind GST-hRGSr using this assay (Fig. 3A). The failure of Gtalpha Ser202 right-arrow Asp to bind GST-hRGSr is not caused by its inability to bind AlF4- and assume an active conformation. Chi8 and the Ser202 right-arrow Asp mutant demonstrated equivalent degrees of protection of their switch II region from tryptic cleavage upon binding of AlF4- (Fig. 3B). The binding data indicate correlation between the stimulatory effects of hRGSr on the Gtalpha mutants in the GTPase assay and ability of hRGRr to bind these mutants. The deficiency of hRGSr to stimulate GTPase activity of Gtalpha Ser202 right-arrow Asp has resulted from the loss of the affinity of this interaction. However, the Lys176 right-arrow Leu substitution appeared to produce a different result. The reduction in the maximal GTPase acceleration of Gtalpha Lys176 right-arrow Leu occurred without a concurrent decrease in affinity of the G-protein/RGS interaction.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   Binding of Gtalpha mutants to GST-hRGSr. SDS-polycrylamide gel (12%) stained with Coomassie Blue. Binding of Gtalpha mutants complexed with GDP·AlF4- to GST-hRGSr (A) or to GST-hRGSr Glu129 right-arrow Ala mutant (C) immobilized on glutathione-agarose was performed as described under "Experimental Procedures." B, the trypsin protection test for Chi8 and the Ser202 right-arrow Asp mutant. Chi8 and the Ser202 right-arrow Asp mutant were treated with trypsin (25 µg/ml) at a 20:1 protein/trypsin molar ratio for 15 min at 25 °C in the absence or presence of AlF4-.

Effects of the hRGSr Mutant Glu129 right-arrow Ala on GTPase Activity of Chimeric Gtalpha and Its Ser202 right-arrow Asp Mutant-- Based on the crystal structure of RGS4 bound to Gialpha 1·AlF4- (12), a residue Ser202 makes a contact with hRGSr residue Glu129. We have tested the possibility that a complementary replacement of hRGSr residue Glu129 by Ala would restore the ability of hRGSr to interact and stimulate GTPase activity of Gtalpha Ser202 right-arrow Asp. hRGSr Glu129 right-arrow Ala was fully active toward Chi8 and five of its mutants, but deficient of any GAP activity toward Gtalpha Ser202 right-arrow Asp (not shown). Similarly, to the wild type hRGSr, the Glu129 right-arrow Ala mutant failed to bind Gtalpha Ser202 right-arrow Asp, whereas its binding to Chi8 was intact (Fig. 3C).

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Since its recent discovery, the family of RGS proteins has been rapidly growing. Those RGS proteins that have already been extensively characterized share a common specificity pattern. These RGS proteins interact with G-protein alpha -subunits from Gi and Gq families but have no activity toward Gs (6-8, 10) and G12 (9). Both possibilities remain open: a member(s) of the RGS family capable of interaction with Gsalpha (G12alpha ) has not been yet identified or characterized, or none of the RGS proteins would be a GAP for Gsalpha (G12alpha ). The answer to this question lies in understanding the structural details and requirements for RGS/G-protein interaction.

The crystal structure of the complex of RGS4 with Gialpha 1·AlF4- has revealed a structural basis for the inability of RGS4 to interact with Gsalpha . Six amino acid residues from the RGS/G-protein interface are different between Gialpha and Gsalpha (12). Three of these residues, corresponding to Thr178, Ser202, and His209 in Gtalpha are conserved among the Gialpha , Gtalpha , Gqalpha , and Gzalpha subunits that are known to interact with RGS. Another two Gtalpha residues, Ile181 and Lys205, have homologous substitutions. Ile181 is substituted by Val in Gialpha and Gzalpha , and Lys205 is replaced by Arg in Gqalpha . To identify the residue(s) critical for the failure of Gsalpha to interact with RGS proteins, we replaced the RGS contact residues in Gtalpha by corresponding residues in Gsalpha and examined the ability (EC50 and Vmax) of hRGSr to stimulate GTPase activity of these mutants. hRGSr is a human homologue (hRGSr) of mouse retinal mRGS, which was originally thought to be a retina-specific RGS protein, but later it was found in other tissues as well (13, 25). Like other characterized RGS proteins, hRGSr interacts with Gi- and Gq-like alpha -subunits, but does not bind Gsalpha (24). Substitutions Thr178 right-arrow Ser, Ile181 right-arrow Phe, and Lys205 right-arrow Arg did not significantly alter the activity of hRGSr toward these mutants. While this was not unexpected for the conservative replacement Lys205 right-arrow Arg, it was rather surprising for the Thr178 right-arrow Ser mutant. The corresponding Gialpha 1 Thr182 residue interacts with seven invariant or highly conserved residues of RGS4 and, thus, even homologous substitution by Ser could have had a major impact on the Galpha /RGS interaction (12). It appears that Ser may substitute Thr178 suitably in most of the RGS contacts. Another substitution that did not interfere with the affinity of Gtalpha binding to hRGSr is Lys176 right-arrow Leu. This is consistent with the lack of conservation at this position between Gtalpha , Gqalpha , and Gzalpha . Interestingly, however, this mutation led to a substantial reduction in the GTPase Vmax value elicited by hRGSr. Perhaps the lower stimulated GTPase activity of the Lys176 right-arrow Leu mutant reflects an intrinsic partial impairment of the catalytic site not evident from the basal GTPase activity. The adjacent Gtalpha Thr177 residue is intimately involved in the GTP hydrolysis (26) and may not be fully stabilized in the RGS/Gtalpha Lys176 right-arrow Leu complex. The Lys176 right-arrow Leu mutation highlights the possibility that Gsalpha may have a limited ability for stimulation by RGS proteins assuming there is one that binds Gsalpha . A modest decrease in the affinity for hRGSr without significantly affecting the maximal degree of the GTPase rate acceleration was observed for Gtalpha His209 right-arrow Gln. The most severe outcome for the Gtalpha /hRGSr interaction was caused by the Ser202 right-arrow Asp mutation. This mutation resulted in the loss of hRGSr binding. The crystal structure of Gialpha 1 with RGS4 provides a rationale for such an outcome (12). A negative charge introduced by the Asp residue might be repelled by the negative charge of the counteracting Glu129 residue of hRGSr, which corresponds to the Glu126 residue of RGS4. However, the Glu residue is not absolutely conserved in RGS proteins. A number of RGS proteins, RGS1, RGS6, and RGS7, have residues other than Glu at this position. Small uncharged residues such as the Ala residue in RGS7 might be the most accommodating residue for Asp. We found that the Glu129 right-arrow Ala substitution in hRGSr cannot rescue the ability of hRGSr to interact with Gtalpha Ser202 right-arrow Asp. Perhaps, additional residue(s) such as Asn131 of hRGSr (Asn128 of RGS4) also interferes with the Asp side chain. RGS4 Asn128 makes a contact with Gialpha 1 Ser206 (Ser202 of Gtalpha ). The RGS Asn residue is critical for the RGS/Galpha interaction (12), and may only be substituted by Ser, though with a notable loss of the RGS affinity for Gtalpha (20). Quite possibly, an interference of the Galpha Asp residue with the network of interactions involving the hRGSr Asn131 residue is also responsible for the lack of interaction between hRGSr and Gtalpha Ser202 right-arrow Asp.

The degree of impairment of the RGS/Galpha interaction in the Ser202 right-arrow Asp mutant allows us to speculate that the corresponding Asp229 of Gsalpha is mainly responsible for the inability of Gsalpha to interact with characterized RGS proteins. Other differences in RGS contact residues between Gsalpha and the Gi-like alpha -subunits could be more easily accommodated by limited variability of different RGS domains. Our results do not support a likelihood that one of the currently identified RGS proteins may serve as a GAP for Gsalpha . Nevertheless, they provide a direction toward identification of potential candidates for interaction with Gsalpha among yet undiscovered RGS proteins.

    ACKNOWLEDGEMENTS

We thank R. McEntaffer for technical assistance and Drs. H. Hamm and N. Skiba for providing us with the Gtalpha /Gialpha expression vector.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant EY-10843. The services provided by the Diabetes and Endocrinology Research Center of the University of Iowa were supported by National Institutes of Health Grant DK-25295.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence and reprint requests should be addressed: Dept. of Physiology and Biophysics, University of Iowa College of Medicine, 5-660 Bowen Science Bldg., Iowa City, IA 52242. Tel.: 319-335-7864; Fax: 319-335-7330; E-mail: nikolai-artemyev{at}uiowa.edu.

1 The abbreviations used are: RGS proteins, regulators of G-protein signaling; hRGSr, human retinal RGS protein; ROS, rod outer segment(s); uROS, urea-washed ROS membranes; GAP, GTPase-activating protein; Gtalpha , rod G-protein (transducin) alpha -subunit; Gialpha , Gsalpha , Gqalpha , and Gzalpha , alpha -subunits of G-proteins; GST, glutathione S-transferase; Chi8, chimera 8; PCR, polymerase chain reaction.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Koelle, M. R., and Horvitz, H. R. (1996) Cell 84, 115-125[CrossRef][Medline] [Order article via Infotrieve]
  2. De Vries, L., Mousli, M., Wurmser, A., and Farquhar, M. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 11916-11920[Abstract/Free Full Text]
  3. Druey, K. M., Blumer, K. J., Kang, V. H., Kehrl, J. H. (1996) Nature 379, 742-746[CrossRef][Medline] [Order article via Infotrieve]
  4. Dohlman, H. G., and Thorner, J. (1997) J. Biol. Chem. 272, 3871-3874[Free Full Text]
  5. Koelle, M. R. (1997) Curr. Opin. Cell Biol. 9, 143-147[CrossRef][Medline] [Order article via Infotrieve]
  6. Berman, D. M., Wilkie, T. M., and Gilman, A. G. (1996) Cell 86, 445-452[CrossRef][Medline] [Order article via Infotrieve]
  7. Watson, N., Linder, M. E., Druey, K. M., Kehrl, J. H., Blumer, K. J. (1996) Nature 383, 172-175[CrossRef][Medline] [Order article via Infotrieve]
  8. Hunt, T. W., Fields, T. A., Casey, P. J., Peralta, E. G. (1996) Nature 383, 175-177[CrossRef][Medline] [Order article via Infotrieve]
  9. Berman, D. M., Kozasa, T., and Gilman, A. G. (1996) J. Biol. Chem. 271, 27209-27212[Abstract/Free Full Text]
  10. Huang, C., Hepler, J. R., Gilman, A. G., Mumby, S. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6159-6163[Abstract/Free Full Text]
  11. Gilman, A. G. (1987) Annu. Rev. Biochem. 56, 615-649[CrossRef][Medline] [Order article via Infotrieve]
  12. Tesmer, J. J. G., Berman, D. M., Gilman, A. G., Sprang, S. R. (1997) Cell 89, 251-261[CrossRef][Medline] [Order article via Infotrieve]
  13. Chen, C. K., Wieland, T., and Simon, M. I. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12885-12889[Abstract/Free Full Text]
  14. Natochin, M., Granovsky, A. E., and Artemyev, N. O. (1997) J. Biol. Chem. 272, 17444-17449[Abstract/Free Full Text]
  15. Papermaster, D. S., and Dreyer, W. J. (1974) Biochemistry 13, 2438-2444[CrossRef][Medline] [Order article via Infotrieve]
  16. Yamanaka, G., Eckstein, F., and Stryer, L. (1985) Biochemistry 24, 8094-8101[CrossRef][Medline] [Order article via Infotrieve]
  17. Kleuss, C., Pallast, M., Brendel, S., Rosenthal, W., and Scultz, G. (1987) J. Chromatogr. 407, 281-289[CrossRef][Medline] [Order article via Infotrieve]
  18. Skiba, N. P., Bae, H., and Hamm, H. E. (1996) J. Biol. Chem. 271, 413-424[Abstract/Free Full Text]
  19. Kleuss, C., Raw, A. S., Lee, E., Sprang, S. R., Gilman, A. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9828-9831[Abstract/Free Full Text]
  20. Natochin, M., McEntaffer, R. L., and Artemyev, N. O. (1998) J. Biol. Chem. 273, in press
  21. Arshavsky, V. Y., Gray-Keller, M. P., Bownds, M. D. (1991) J. Biol. Chem. 266, 18530-18537[Abstract/Free Full Text]
  22. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
  23. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  24. Natochin, M., Lipkin, V. M., and Artemyev, N. O. (1997) FEBS Lett. 411, 179-182[CrossRef][Medline] [Order article via Infotrieve]
  25. Buckbinder, L., Velasco-Miguel, S., Chen, Y., Xu, N., Talbott, R., Gelbert, L., Gao, J., Seizinger, B. R., Gutkind, J. S., Kley, N. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7868-7872[Abstract/Free Full Text]
  26. Sondek, J., Lambright, D. G., Noel, J. P., Hamm, H. E., Sigler, P. B. (1994) Nature 372, 276-279[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
M. A. Clark and N. A. Lambert
Endogenous Regulator of G-Protein Signaling Proteins Regulate the Kinetics of G{alpha}q/11-Mediated Modulation of Ion Channels in Central Nervous System Neurons
Mol. Pharmacol., April 1, 2006; 69(4): 1280 - 1287.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
A. M. Preininger and H. E. Hamm
G Protein Signaling: Insights from New Structures
Sci. Signal., February 3, 2004; 2004(218): re3 - re3.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. S. Weinstein, S. Yu, D. R. Warner, and J. Liu
Endocrine Manifestations of Stimulatory G Protein {alpha}-Subunit Mutations and the Role of Genomic Imprinting
Endocr. Rev., October 1, 2001; 22(5): 675 - 705.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-W. Jeong and S. R. Ikeda
Endogenous Regulator of G-Protein Signaling Proteins Modify N-Type Calcium Channel Modulation in Rat Sympathetic Neurons
J. Neurosci., June 15, 2000; 20(12): 4489 - 4496.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Woulfe and J. M. Stadel
Structural Basis for the Selectivity of the RGS Protein, GAIP, for Galpha i Family Members. IDENTIFICATION OF A SINGLE AMINO ACID DETERMINANT FOR SELECTIVE INTERACTION OF Galpha i SUBUNITS WITH GAIP
J. Biol. Chem., June 18, 1999; 274(25): 17718 - 17724.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Natochin, A. E. Granovsky, and N. O. Artemyev
Identification of Effector Residues on Photoreceptor G Protein, Transducin
J. Biol. Chem., August 21, 1998; 273(34): 21808 - 21815.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-L. Lan, N. A. Sarvazyan, R. Taussig, R. G. Mackenzie, P. R. DiBello, H. G. Dohlman, and R. R. Neubig
A Point Mutation in Galpha o and Galpha i1 Blocks Interaction with Regulator of G Protein Signaling Proteins
J. Biol. Chem., May 22, 1998; 273(21): 12794 - 12797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-L. Lan, H. Zhong, M. Nanamori, and R. R. Neubig
Rapid Kinetics of Regulator of G-protein Signaling (RGS)-mediated Galpha i and Galpha o Deactivation. Galpha SPECIFICITY OF RGS4 AND RGS7
J. Biol. Chem., October 20, 2000; 275(43): 33497 - 33503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I.-K. Park, C. A. Klug, K. Li, L. Jerabek, L. Li, M. Nanamori, R. R. Neubig, L. Hood, I. L. Weissman, and M. F. Clarke
Molecular Cloning and Characterization of a Novel Regulator of G-protein Signaling from Mouse Hematopoietic Stem Cells
J. Biol. Chem., January 5, 2001; 276(2): 915 - 923.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Natochin, M.
Right arrow Articles by Artemyev, N. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Natochin, M.
Right arrow Articles by Artemyev, N. O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.