Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chow, J. C.
Right arrow Articles by Smith, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chow, J. C.
Right arrow Articles by Smith, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 8, 4672-4680, February 20, 1998

Insulin-like Growth Factor-I Receptor Internalization Regulates Signaling via the Shc/Mitogen-activated Protein Kinase Pathway, but Not the Insulin Receptor Substrate-1 Pathway*

Jesse C. ChowDagger , Gerolama Condorelli§, and Robert J. Smith

From the Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts 02215

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Insulin-like growth factor-I (IGF-I) receptors activate divergent signaling pathways by phosphorylating multiple cellular proteins, including insulin receptor substrate-1 (IRS-1) and the Shc proteins. Following hormone binding, IGF-I receptors cluster into clathrin-coated pits and are internalized via an endocytotic mechanism. This study investigates the relationship between IGF-I receptor internalization and signaling via IRS-1 and Shc. A mutation in the C terminus of the IGF-I receptor decreased both the rate of receptor internalization and IGF-I-stimulated Shc phosphorylation by more than 50%, but did not affect IRS-1 phosphorylation. Low temperature (15 °C) decreased IGF-I receptor internalization and completely inhibited Shc phosphorylation. Although receptor and IRS-1 phosphorylation were decreased in accordance with delayed binding kinetics at 15 °C, the ratio of IRS-1 to receptor phosphorylation was increased more than 2-fold. Dansylcadaverine decreased receptor internalization and Shc phosphorylation, but did not change receptor or IRS-1 phosphorylation. Consistent with these findings, dansylcadaverine inhibited IGF-I-stimulated Shc-Grb2 association, mitogen-activated protein kinase phosphorylation, and p90 ribosomal S6 kinase activation, but did not affect the association of phosphatidylinositide 3-kinase with IRS-1 or activation of p70 S6 kinase. These data support the concept that Shc/mitogen-activated protein kinase pathway activation requires IGF-I receptor internalization, whereas the IRS-1 pathway is activated by both cell surface and endosomal receptors.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Insulin-like growth factor-I (IGF-I)1 initiates pleiotropic cellular growth and metabolic responses by binding to the type I insulin-like growth factor receptor (1). The activated intrinsic tyrosine kinase of the IGF-I receptor catalyzes receptor autophosphorylation and the tyrosine phosphorylation of early signaling intermediates, including insulin receptor substrate-1 (IRS-1) and the Shc proteins (2-4). IRS-1 contains multiple phosphotyrosine residues that serve as docking sites and activators of a number of signaling molecules, including phosphatidylinositide (PI) 3-kinase (5, 6). Stimulation of PI 3-kinase leads to the activation of downstream mediators of IGF-I action, including p70 S6 kinase, a serine/threonine kinase that phosphorylates 40 S ribosomal protein S6 (7). The Shc proteins, which include several isoforms (46, 52, and 66 kDa), contain specific tyrosine phosphorylation sites necessary for their association with Grb2 and the consequent activation of the GTP-binding protein Ras (8, 9). Activation of Ras initiates a series of phosphorylation events that results in the dual phosphorylation of the mitogen-activated protein (MAP) kinases, ERK1 and ERK2 (10). These MAP kinases can phosphorylate a number of substrates, including p90 ribosomal S6 kinase (11), a protein kinase that can activate several transcription factors in the nucleus (12, 13). Thus, tyrosine phosphorylation of IRS-1 and Shc activates divergent pathways that are ultimately important for cell metabolism, growth, and differentiation (14). However, little is known about cellular mechanisms that may regulate the relative intensity of signaling via these intermediates in response to IGF-I.

Previous studies have suggested a role for ligand-induced receptor trafficking in modulating the activation of intracellular signaling molecules (15, 16). Based in part on direct evidence and on homologies with the insulin signaling pathway (17, 18), it is believed that IGF-I binding initiates the migration of IGF-I receptors to clathrin-coated pits and the subsequent formation of early endosomes containing internalized but still active receptors. The ligand-receptor complex ultimately becomes dissociated and inactivated in the acidic environment of late endosomes, where ligands and receptors are sorted for degradation in lysosomes or recycling to the cell surface (17, 18). Activated IGF-I receptors at the cell surface, in coated pits, and in early endosomes have the potential to initiate specific cellular responses. For other hormone-receptor complexes, endosomal compartments have been shown to participate in the initiation and/or continuation of intracellular signaling reactions (15). Hormone-stimulated tyrosine phosphorylation of the epidermal growth factor receptor begins at the cell surface but persists within the endosome compartment, such that there is a greater level of receptor phosphorylation in the endosome than in the plasma membrane (19). Generation of ceramide by tumor necrosis factor receptors in endosomes initiates the activation of NF-kappa B, while ceramide synthesis at the plasma membrane directs the activation of serine/threonine protein kinases and phospholipase A2 (20). Thus, hormone signaling can occur at multiple steps in receptor internalization pathways, and this may provide a mechanism for regulating the intensity and pattern of signals generated by activated receptors.

The relationship between ligand-induced IGF-I receptor internalization and the activation of specific cellular substrates that lead to signaling responses has not been studied. We and others have observed that the time courses of IGF-I stimulated IRS-1 and Shc phosphorylation are different (21, 22). IRS-1 is maximally phosphorylated within 1 to 2 min of IGF-I stimulation, whereas Shc phosphorylation has been shown to reach a maximum only after 5 to 10 min (21, 22). The time course of Shc but not IRS-1 phosphorylation correlates with the time required for ligand-induced receptor internalization (23). The objective of the current study was to determine whether IRS-1 and Shc phosphorylation results from their interaction with IGF-I receptors at distinct sites in the ligand-induced internalization pathway.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- Recombinant human IGF-I was provided by Eli Lilly Inc. (Indianapolis, IN). Shc, Grb2, and pan-ERK antibodies were purchased from Transduction Laboratories (Lexington, KY). Phosphospecific MAP kinase antibody was from Promega Corp. (Madison, WI). The 3R S6 RSK substrate peptide and antibodies to the RSK-2 isoform of p90 ribosomal S6 kinase and the p85 regulatory subunit of PI 3-kinase were from Upstate Biotechnology, Inc. (Lake Placid, NY). Polyclonal phosphotyrosine and IGF-I receptor (C-terminal) antibodies were prepared as described previously (24). The glutathione S-transferase-S6 substrate peptide and antibodies to p70 ribosomal S6 kinase, IRS-1, and IRS-2 were provided by Dr. Morris White. The monoclonal IGF-I receptor antibody (alpha IR-3) was provided by Dr. Steve Jacobs. Protein A-Sepharose was purchased from Pharmacia Inc. (Piscataway, NJ). [gamma -32P]ATP was purchased from NEN Life Science Products Inc. (Boston, MA). 125I-Protein A and 125I-IGF-I were from ICN Biomedical (Costa Mesa, CA) and Amersham Life Science, Inc. (Arlington Heights, IL), respectively. All other reagents were purchased from Sigma.

CHO Cell Lines-- Unless otherwise indicated, all studies were conducted with multiple clones of CHO cells stably transfected with the CAG+ isoform of the human IGF-I receptor. These cells, which have been described previously (25), express approximately 6 × 105 receptors/cell as assessed by ligand binding and Scatchard analysis. For studies on cells expressing mutated IGF-I receptors, a 961-base pair HindIII-BamHI fragment of the wild-type IGF-I receptor cDNA (base pairs 3195-4156) was subcloned into Bluescript (Stratagene, La Jolla, CA) and used as a template for site-directed mutagenesis as described by Kunkel (26). The oligonucleotide TCCGCGCCAGCTACGACGAGAGACA (mutant nucleotide underlined) was used to generate a cDNA fragment encoding a Phe to Tyr substitution at position 1310 in the C-terminal portion of the IGF-I receptor beta -subunit. The mutated IGF-I receptor fragment was fully sequenced to exclude the possibility of additional unwanted mutations and used to replace the analogous fragment in the previously described APrM8 expression vector containing the full-length cDNA of the wild-type CAG+ IGF-I receptor (25). Multiple stably transfected clones of CHO cells expressing approximately 6 × 105 mutant receptors/cell were obtained by a co-transfection protocol using a neomycin resistance selection method as described previously (25). The isolation of CHO cells expressing similar numbers of kinase-inactive IGF-I receptors (Lys to Ala substitution at position 1003) has been described (25).

Ligand-induced Internalization-- For comparative studies on wild-type and mutant IGF-I receptors, the rate of receptor internalization was determined as described previously (20). Cells were replica plated in 24-well dishes in Ham's F-12 medium supplemented with 10% fetal bovine serum. Subconfluent cell monolayers were washed twice with phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin (BSA), preincubated for 20 min at 37 °C in assay buffer containing Ham's F-12 medium supplemented with 0.5% BSA and 50 mM Hepes (pH 7.4), and rinsed twice more with wash buffer. Subsequently, 40,000 cpm of 125I-IGF-I (final IGF-I concentration 5 × 10-11 M) in assay buffer was added to each well, and individual plates were incubated at 37 °C for timed periods of 2, 4, 6, 8, or 10 min. Following incubation, the medium was removed, and the plates were immersed in ice-cold PBS plus 0.1% BSA (pH 7.5) and further washed by immersing twice in ice-cold PBS plus 0.1% BSA at pH 2.75 (determination of internalized IGF-I) or pH 7.5 (determination of total cell-associated IGF-I). The washed cells were solubilized with 0.1 N NaOH in 0.1% SDS, and 125I was quantified by gamma -counting. The internalization rate constant (Ke), representing the slope of the line relating internalized to surface-bound hormone at each time point, was determined as described previously (27). An integrated measure of surface-bound hormone was approximated by the trapezoidal rule using intervals of 2 min, and the slope of the line defining Ke was determined by linear regression.

For the low temperature and inhibitor studies, the amount of IGF-I internalized was determined as described by Hsu and Olefsky (28). Cells were grown to subconfluency in 35-mm wells, serum depleted for 16-18 h, washed twice with PBS and once with Krebs-Ringer phosphate-Hepes binding buffer (pH 7.5) at room temperature, and incubated in binding buffer containing 125I-IGF-I (10-8 M) for 10 min. The monolayer was then washed 3 times with ice-cold PBS, the surface-bound ligand was extracted with acidic binding buffer (pH 2.75) for 5 min at 4 °C, and the cell-associated (internalized) radioactivity was determined by lysing the cells with 0.4 N NaOH. The percentage of ligand internalized was calculated by dividing the internalized counts/min by surface-bound plus internalized counts/min.

IGF-I Stimulated Protein Tyrosine Phosphorylation-- To determine IGF-I stimulation of protein tyrosine phosphorylation in intact cells, subconfluent monolayers were incubated for 16-18 h in serum-free Ham's F-12 medium containing 0.5% BSA and 25 mM Hepes (pH 7.4). IGF-I was subsequently added to the medium at a dose of 10-8 M for the indicated period of time, the medium was removed, and the cells were washed twice with ice-cold buffer (137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 0.1 mM Na3VO4 in 20 mM Tris-HCl, pH 7.6) and lysed in the same buffer supplemented with 1% Nonidet P-40, 10% glycerol, 2 mM EDTA, 10 mM sodium pyrophosphate, 10 mM sodium fluoride, 2 mM Na3VO4, 2 mM phenylmethylsulfonyl fluoride, and 8 µg/ml leupeptin). Cell lysates were centrifuged at 12,000 × g for 5 min at 4 °C, the supernatants were collected, and protein concentrations determined using a Bradford dye binding assay kit with BSA as standard (Bio-Rad). For studies on the effects of low temperature, cell monolayers were incubated overnight with serum-free medium, and this was replaced with fresh medium preadjusted to 15 or 37 °C. After incubation for 30 min at the appropriate temperature, IGF-I was added, and cell lysates prepared as described above. For inhibitor studies, dansylcadaverine (500 µM), chloroquine (200 µM), or an appropriate diluent were added for 30 min prior to IGF-I stimulation.

To detect tyrosine-phosphorylated proteins, equal amounts of solubilized protein (1 mg) from cells treated under various conditions were incubated in lysis buffer with either alpha IR3 (1:200 dilution), IRS-1 (1:100 dilution), or Shc (1 µg/ml) antibody at 4 °C overnight. The antibody was then adsorbed to protein-A Sepharose beads for 2 h at 4 °C, and the resulting immunocomplexes were washed three times by centrifugation and resuspension in buffer containing 10 mM Tris-HCl (pH 7.8), 150 mM NaCl, 1% Nonidet P-40, 1 mM Na3VO4, and 1 mM phenylmethylsulfonyl fluoride. Specific protein immunoprecipitates, plus additional cell extracts not treated with antibodies (200 µg), were heated in Laemmli buffer with 100 mM DTT at 100 °C for 5 min.

Proteins were separated by SDS-PAGE and electroblotted onto nitrocellulose membranes (Schleicher & Schuell, Inc., Keene, NH). The blots were blocked in 5% BSA, probed with phosphotyrosine antibody (2 µg/ml), washed as described previously, and then incubated with 125I-Protein A for 1 h at 25 °C (29). Labeled protein bands were detected and quantitated using a PhosphorImaging system (Molecular Dynamics, Sunnyvale, CA). The identities of the phosphorylated bands on anti-phosphotyrosine immunoblots corresponding to the beta -subunit of the IGF-I receptor (105 kDa), IRS-1 (170 kDa), and Shc proteins (66, 52, and 46 kDa) were confirmed with antibodies specific for each of these proteins.

MAP Kinase Activation and Co-precipitation Studies-- IGF-I-stimulated MAP kinase activation was measured by immunoblotting CHO cell lysates (prepared above) with a phosphospecific MAP kinase antibody (1:2000 dilution). After detection with 125I-Protein A, these blots were stripped and re-probed with a monoclonal pan-ERK antibody (1:5000 dilution) as described by the manufacturer (Transduction Laboratories). Protein bands corresponding to ERK 1 and 2 were visualized by the enhanced chemiluminescence (ECL) method (Amersham).

For co-precipitation experiments, cell lysates were incubated with IRS-1, IRS-2 (1:100 dilution), or Shc antibody followed by SDS-PAGE and electroblotting as described above. Blots of IRS-1 and -2 immunoprecipitates were subsequently probed with either an antibody that recognizes the p85 regulatory subunit of PI-3 kinase (1:1000 dilution), or the respective immunoprecipitating antibody. To measure IGF-I-stimulated Shc-Grb2 association, Shc immunoprecipitates were immunoblotted with a monoclonal Grb2 antibody (1:1000) as described by the manufacturer (Transduction Laboratories). The protein band corresponding to Grb2 was detected by the ECL method.

Kinase Assays-- RSK-2 activity was measured by an immune complex kinase assay as described previously (30). For each treatment, 500 µg of cell extract was incubated with polyclonal RSK-2 antibody for 2 h at 4 °C and subsequently complexed to protein A-Sepharose beads for an additional 2 h. Immunocomplexes were washed 3 times with lysis buffer, 3 times with LiCl buffer, 3 times with RSK kinase buffer (30), and resuspended in kinase buffer containing 30 mM Tris (pH 7.4), 10 mM MgCl2, 0.1 mM EGTA, 1 mM DTT, 3R S6 peptide (RRLSSLRA), 40 µM ATP, and 10 µCi of [gamma -32P]ATP. Reactions were performed at 30 °C for 15 min with agitation, terminated, and spotted onto P81 phosphocellulose papers. The papers were washed several times with 1% phosphoric acid and measured for radioactivity by the Cerenkov method.

To determine the activity of p70 S6 kinase, 300 µg of cell lysate was incubated with p70 S6 kinase antibody for 2 h at 4 °C. Following this incubation period, protein A-Sepharose beads were added to the mixture and incubated at 4 °C for an additional 2 h. The immune complexes were washed 2 times with ice-cold buffer A (1% Nonidet P-40, 0.5% deoxycholate, 100 mM NaCl, 10 mM Tris, pH 7.2, 1 mM EDTA, 1 mM Na3VO4, 2 mM DTT, 40 µg/ml phenylmethylsulfonyl fluoride), 2 times with buffer B (1 M NaCl, 0.1% Nonidet P-40, 10 mM Tris, pH 7.2, 1 mM Na3VO4, 2 mM DTT, 40 µg/ml phenylmethylsulfonyl fluoride), and once with 150 mM NaCl in 50 mM Tris (pH 7.2). Kinase assays were performed in buffer containing 20 mM HEPES (pH 7.2), 10 mM MgCl2, 0.1 mg/ml BSA, 3 mM beta -mercaptoethanol, 50 µM ATP, 20 µCi of [gamma -32P]ATP, and 5 µg of glutathione S-transferase-S6 peptide (the final 30 amino acids of rat S6 sequence) for 10 min at 30 °C with agitation. Reactions were terminated by heating with Laemmli buffer with 100 mM DTT at 100 °C for 5 min and analyzed by SDS-PAGE. Gels were vacuum dried and exposed in a PhosphorImager cassette.

Statistical Analysis-- Quantitative data are presented as mean ± S.E. and analyzed using a statistical model based on a one-way or two-way classification analysis of variance. Tests of significance for all possible comparisons were determined by Bonferroni's t test (SYSTAT, version 5.0, Evanston, IL).

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Time Course of IGF-I Stimulated IRS-1 and Shc Phosphorylation-- To determine the time course of IGF-I stimulated IRS-1 and Shc tyrosine phosphorylation, multiple clones of stably transfected CHO cells expressing approximately 6 × 105 human wild-type IGF-I receptors/cell were stimulated with 10-8 M IGF-I for 1, 2, 5, 10, or 20 min at 37 °C. Cell lysates were prepared, resolved by SDS-PAGE, and the IGF-I receptor and IRS-1 were identified by immunoblotting with phosphotyrosine antibody. For quantitation of phosphorylation of the Shc proteins, the cell extracts were first subjected to immunoprecipitation with Shc antibody, and the resulting precipitates were analyzed by phosphotyrosine antibody immunoblotting. As shown in Fig. 1A, phosphorylation of the IGF-I receptor was rapid, reaching a maximum within 2 min. Insulin receptor tyrosine phosphorylation was unmeasurable in these cell extracts (data not shown), reflecting the specificity of IGF-I binding and the relatively low number of insulin receptors in the CHO cells. The tyrosine phosphorylation of IRS-1 also was very rapid, reaching maximal levels within 1 to 2 min after the addition of IGF-I (Fig. 1, A and B). At 10 min, there was a 20% decrease in IRS-1 phosphorylation and no further change through 20 min of incubation. In comparison to IRS-1, Shc tyrosine phosphorylation was more gradual, reaching a maximal and sustained level after 5 to 10 min of incubation with IGF-I (Fig. 1A). Quantitative data are shown for the 52-kDa Shc isoform in Fig. 1B, and a similar time course of IGF-I stimulated phosphorylation was also observed for the 46- and 66-kDa Shc isoforms.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of IGF-I-stimulated tyrosine phosphorylation of the IGF-I receptor, IRS-1, and Shc in CHO cells expressing human IGF-I receptors. Cells were serum-starved for 16-18 h and stimulated with IGF-I (10-8 M) for the indicated times. Whole cell detergent extracts were immunoprecipitated with Shc antibody or directly analyzed by SDS-PAGE, and then immunoblotted with phosphotyrosine antibody as described under "Experimental Procedures." A, representative immunoblots for the IGF-I receptor (IGFR), IRS-1, and Shc. B, bands corresponding to IRS-1 (open circle ) or the 52-kDa Shc isoform (bullet ) were quantitated by a PhosphorImager and expressed as % of maximum phosphorylation. Data represent mean ± S.E. from 10 independent experiments.

Protein Tyrosine Phosphorylation in CHO Cells Transfected with Internalization-defective Mutant IGF-I Receptors-- Previous studies in our laboratory have shown that mutation of the Phe residue to Tyr at position 1310 in the C terminus of the IGF-I receptor leads to a decreased rate of ligand-induced receptor internalization in transfected CHO cells (31). As shown in Fig. 2, the rate of ligand-induced internalization of Tyr-1310 mutant receptors is decreased by 50% in comparison with wild-type IGF-I receptors. The internalization rate of the Tyr-1310 mutant is only slightly greater than the rate of ligand-induced internalization of receptors that have absent kinase activity as a consequence of a Lys to Ala mutation at position 1003 in the ATP-binding site.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   125I-IGF-I internalization in CHO cells expressing human wild-type, Tyr-1310 mutant, or kinase-defective Ala-1003 IGF-I receptors. Cells were incubated for 0-10 min at 37 °C with 125I-IGF-I. Internalized radioactivity was determined by washing at pH 2.75, and total cell associated radioactivity by washing at pH 7.5. The rate constant for IGF-I receptor internalization (Ke) was calculated as described under "Experimental Procedures." Data represent the mean ± S.E. from multiple experiments with at least two independent cell clones expressing each receptor type. *, p < 0.05 wild-type (n = 13) versus Tyr-1310 (n = 14) or Ala-1003 (n = 8).

Although internalization of the Tyr-1310 mutant receptor was markedly inhibited, IGF-I-induced autophosphorylation of this receptor construct was preserved and, in fact, modestly increased in comparison with wild-type receptors (Fig. 3A, top and bottom panels). Thus, the mutant receptor has an effective IGF-I activated tyrosine kinase. The increased receptor autophosphorylation cannot be explained by a difference in receptor content, which was similar to that in cells transfected with the wild-type receptor as assessed by immunoblotting (middle panel in Fig. 3A) or by Scatchard analysis of IGF-I binding data (not shown). The higher level of phosphorylation in the Tyr-1310 mutant may reflect, at least in part, phosphorylation of the additional C-terminal tyrosine residue. IRS-1 tyrosine phosphorylation was markedly stimulated by IGF-I in cells transfected with wild-type or Tyr-1310 receptors. There was no difference in IRS-1 content or in the level of IRS-1 phosphorylation catalyzed by these two receptor constructs (Fig. 3B). Thus, the marked decrease in ligand-induced internalization of the Tyr-1310 receptor does not interfere with its capacity to interact with IRS-1 in intact cells. This contrasts with the effects of IGF-I on Shc phosphorylation (Fig. 3C). Phosphorylation of all three Shc isoforms was stimulated by IGF-I in cells transfected with either receptor construct, but Shc phosphorylation was markedly decreased in cells expressing the internalization-defective Tyr-1310 receptor mutant. Quantitation of the extent of tyrosine phosphorylation of the dominant 52-kDa Shc isoform from multiple experiments (Fig. 3C, bottom panel) demonstrated a 65% decrease in the level of Shc phosphorylation 10 min after IGF-I stimulation of cells expressing the Tyr-1310 receptor as compared with the wild-type receptor. A similar or greater decrease in Shc phosphorylation was evident at multiple time points extending to 60 min after IGF-I stimulation (data not shown).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of the Tyr-1310 mutation on IGF-I-stimulated receptor, IRS-1, and Shc tyrosine phosphorylation. CHO cells expressing human wild-type or Tyr-1310 mutant IGF-I receptors were serum starved for 16-18 h and incubated in the absence or presence of IGF-I (10-8 M) for 2 or 10 min at 37 °C to detect IRS-1 or Shc phosphorylation, respectively. Cell lysates were immunoprecipitated with: A, IGF-I receptor; B, IRS-1; or C, Shc antibody, resolved by SDS-PAGE, and then immunoblotted with phosphotyrosine antibody (top panel) or the same immunoprecipitating antibody (middle panel) as described under "Experimental Procedures." Bands corresponding to the beta -subunit of the IGF-I receptor (105 kDa), IRS-1 (170 kDa), or the 52-kDa Shc isoform were quantitated by a PhosphorImager system (lower panel). Data are expressed as % of wild-type (IGF-I stimulated) and represent mean ± S.E. from six independent experiments with two independent cell clones for each receptor type. *, p < 0.05 versus basal; **, p < 0.05 versus basal or stimulated wild-type cells.

The protein level of the 52-kDa Shc isoform, as determined by direct immunoblotting, was also decreased in the Tyr-1310 cells (35% lower than in cells expressing wild-type receptors, p < 0.05), but the decrease in Shc protein content was less than the decrease in Shc phosphorylation in these cells. IGF-I stimulation of 52-kDa Shc phosphorylation was significantly decreased in the Tyr-1310 cells after correction for the change in Shc protein content (100 ± 8.6% for wild-type versus 70 ± 4.3% for Tyr-1310, p < 0.05). This observation was consistent for two different clones of wild-type Tyr-1310 cells that were studied. Therefore, the IGF-I-stimulated phosphorylation of Shc, but not IRS-1, was decreased in cells transfected with the internalization-defective mutant IGF-I receptor.

Effects of Low Temperature on Internalization and Protein Tyrosine Phosphorylation-- To further investigate the relationship between receptor-mediated endocytosis and protein tyrosine phosphorylation, IGF-I receptor internalization in CHO cells expressing the wild-type receptor was inhibited by reducing the cell incubation temperature from 37 to 15 °C. Ligand-induced IGF-I receptor internalization after 10 min was decreased by 64% at 15 °C compared with cells at 37 °C (Fig. 4A). Low temperature also decreased IGF-I stimulated receptor autophosphorylation at early time points (0-20 min) (Fig. 4B). This is consistent with delayed ligand binding kinetics at 15 °C, which have previously been described (32). The time course of IGF-I stimulated IRS-1 tyrosine phosphorylation was delayed, and the level of IRS-1 phosphorylation observed at all time points between 0 and 20 min was reduced at 15 °C versus 37 °C (Fig. 5A). Since diminished IRS-1 phosphorylation might be explained by delayed IGF-I binding and receptor activation, the level of IRS-1 phosphorylation was expressed per unit of receptor autophosphorylation. When data from cells stimulated with IGF-I for periods ranging from 2 to 20 min were analyzed, a significant increase in the amount of phosphorylated IRS-1 per phosphorylated receptor was evident at 15 °C compared with 37 °C (p < 0.05 by ANOVA). As shown for the 20-min time point in Fig. 5B, the amount of phosphorylated IRS-1 per phosphorylated receptor was increased by more than 2-fold at 15 °C. Thus, the inhibition of ligand-induced receptor internalization at 15 °C is associated with an augmentation of IRS-1 phosphorylation relative to the number of autophosphorylated (active) IGF-I receptors.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of low temperature on IGF-I receptor internalization and tyrosine phosphorylation in CHO cells. Cells expressing the human IGF-I receptor were serum-starved for 16-18 h followed by a 30-min incubation period at 37 °C or 15 °C. A, cells were subsequently incubated in the presence of 125I-IGF-I for 10 min. Surface-bound ligand was extracted with acidic binding buffer and cell-associated (internalized) radioactivity was determined by alkaline lysis as described under "Experimental Procedures." Data are expressed as the % of total cell associated radioactivity internalized after 10 min and represent mean ± S.E. from four independent experiments. *, p < 0.05. B, cells were stimulated with IGF-I (10-8 M) for the indicated period of time at 37 °C (bullet ) or 15 °C (open circle ). Cell lysates were directly analyzed by SDS-PAGE and immunoblotted with phosphotyrosine antibody as described under "Experimental Procedures." Bands corresponding to the beta -subunit of the IGF-I receptor were quantitated by a PhosphorImager system and expressed as % of maximal phosphorylation. Data represent mean ± S.E. from 10 independent experiments.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of low temperature on IGF-I-stimulated IRS-1 tyrosine phosphorylation in CHO cells. A, cells expressing the human IGF-I receptor were serum-starved for 16-18 h followed by a 30-min incubation period at 37 °C (bullet ) or 15 °C (open circle ) and subsequently stimulated with IGF-I (10-8 M) for the indicated period of time. Cell lysates were immunoprecipitated with IRS-1 antibody, resolved by SDS-PAGE, and immunoblotted with phosphotyrosine antibody as described under "Experimental Procedures." Bands corresponding to IRS-1 were quantified by a PhosphorImager system and expressed as % maximal phosphorylation. The ratios in Panel B were calculated by dividing the amount of phosphorylated IRS-1 by the amount of phosphorylated receptor at the 20-min time point. These data represent mean ± S.E. from 10 independent experiments. *, p < 0.05.

In contrast with IRS-1, IGF-I stimulation of Shc phosphorylation was completely inhibited at 15 °C (Fig. 6A). This inhibition of Shc phosphorylation at 15 °C was evident at time points extending at least 60 min after the addition of IGF-I (data not shown). When Shc phosphorylation was expressed per unit of autophosphorylated IGF-I receptor, a marked decrease was apparent at 15 °C (Fig. 6B). Thus, the inhibition of ligand-induced IGF-I receptor internalization by reduced temperature is associated with increased IRS-1 phosphorylation per autophosphorylated receptor and inhibited Shc phosphorylation.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of low temperature on IGF-I-stimulated Shc tyrosine phosphorylation in CHO cells. A, cells expressing the human IGF-I receptor were serum-starved for 16-18 h followed by a 30-min incubation period at 37 °C (bullet ) or 15 °C (open circle ) and subsequently stimulated with IGF-I (10-8 M) for the indicated period of time. Cell lysates were immunoprecipitated with Shc antibody, resolved by SDS-PAGE, and immunoblotted with phosphotyrosine antibody as described under "Experimental Procedures." Bands corresponding to the 52-kDa Shc isoform were quantified by a PhosphorImager system. The ratios in Panel B were calculated by dividing the amount of phosphorylated Shc by the amount of phosphorylated receptor at the 20-min time point. These data represent mean ± S.E. from 10 independent experiments. *, p < 0.05.

Effects of Dansylcadaverine and Chloroquine on IGF-I Receptor Internalization and Protein Tyrosine Phosphorylation-- As an additional method of investigating the relationship between receptor endocytosis and signaling, IGF-I-stimulated protein tyrosine phosphorylation in CHO cells was determined after treatment with two chemical inhibitors of receptor trafficking, dansylcadaverine and chloroquine. Although the mechanism of action of dansylcadaverine has not been precisely defined, extensive evidence indicates that it inhibits receptor trafficking at a step proximal to the formation of endocytotic vesicles (33, 34). Chloroquine interferes with receptor trafficking by blocking a later step in the acidification of endosomes, thereby preventing recycling of receptors to the cell surface (35). Consistent with these early and late sites of action in the receptor internalization/trafficking pathway, pretreatment of CHO cells expressing the wild-type IGF-I receptor with dansylcadaverine resulted in a 65% decrease in ligand-induced receptor internalization, whereas chloroquine did not significantly alter receptor internalization (Fig. 7).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of dansylcadaverine or chloroquine on IGF-I receptor internalization. Cells expressing the human IGF-I receptor were serum-starved for 16-18 h followed by a 30-min incubation with dansylcadaverine (500 µM) or chloroquine (200 µM). Cells were subsequently incubated in the presence of 125I-IGF-I for 10 min. Surface-bound ligand was extracted with acidic binding buffer and cell-associated (internalized) radioactivity was determined by alkaline lysis as described under "Experimental Procedures." Data are expressed as the % of total cell associated radioactivity internalized after 10 min and represent mean ± S.E. from four independent experiments. *, p < 0.05.

Despite its marked inhibition of receptor internalization, dansylcadaverine did not significantly alter IGF-I-stimulated receptor autophosphorylation (Fig. 8A) or tyrosine phosphorylation of IRS-1 (Fig. 8B). However, IGF-I-stimulated phosphorylation of the 52-kDa Shc isoform was inhibited by approximately 50% following dansylcadaverine treatment (Fig. 8C). Although not as effectively visualized in Fig. 8C, inhibition of phosphorylation of the 66- and 46-kDa isoforms of Shc by dansylcadaverine was also evident on blots exposed for a longer period of time. Consistent with its lack of effect on receptor internalization, chloroquine did not alter receptor, IRS-1, or Shc phosphorylation (data not shown).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8.   Effects of dansylcadaverine on IGF-I-stimulated receptor, IRS-1 and Shc tyrosine phosphorylation in CHO cells. Cells expressing human IGF-I receptors were serum-starved for 16-18 h followed by a 30-min incubation period in the absence or presence of dansylcadaverine (DC) (500 µM) and subsequently stimulated with IGF-I (10-8 M) for 5 min at 37 °C. Cell lysates were immunoprecipitated with IGF-I receptor (A), IRS-1 (B), or Shc antibody (C), resolved by SDS-PAGE, and then immunoblotted with phosphotyrosine (PY) antibody (top panel) or the same immunoprecipitating antibody (middle panel) as described under "Experimental Procedures." Bands corresponding to the beta -subunit of the IGF-I receptor (105 kDa), IRS-1 (170 kDa), or the 52-kDa Shc isoform were quantitated by a PhosphorImager system (lower panel). Data are expressed as % of control (IGF-I stimulated without dansylcadaverine) and represent mean ± S.E. from six independent experiments. *, p < 0.05 versus basal; **, p < 0.05 versus basal or stimulated wild-type cells.

Effects of Dansylcadaverine on the IRS-1 and Shc/MAP Kinase Signaling Pathways-- To determine whether ligand-induced receptor internalization influences signaling events that are downstream from IRS-1, CHO cells expressing IGF-I receptors were incubated with the internalization inhibitor, dansylcadaverine. Following stimulation with IGF-I for 5 min, cell lysates were immunoprecipitated with IRS-1 antibody and immunoblotted with an antibody specific for the p85 regulatory subunit of PI3-kinase to measure p85 association with IRS-1. Fig. 9A demonstrates that dansylcadaverine has no effect on IGF-I-stimulated p85 association with IRS-1, consistent with the previous observation of unaltered IRS-1 tyrosine phosphorylation in dansylcadaverine-treated cells. Under these same conditions, IRS-2 tyrosine phosphorylation and p85 association with IRS-2 was not affected by dansylcadaverine (data not shown) indicating that the activation of this alternate IRS pathway also is not affected by changes in receptor internalization. As a signaling response downstream from IRS activation of PI 3-kinase, p70 S6 kinase was shown to be markedly stimulated by IGF-I, and this activation was not altered by pretreatment with dansylcadaverine (Fig. 9B).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9.   Effects of dansylcadaverine (DC) on IGF-I-stimulated association of the p85 regulatory subunit of PI 3-kinase with IRS-1 and activation of p70 S6 kinase in CHO cells expressing human IGF-I receptors. Cells were serum-starved for 16-18 h followed by a 30-min incubation period in the absence or presence of dansylcadaverine (500 µM) and subsequently stimulated with IGF-I (10-8 M) for 5 min at 37 °C. A, cell lysates were immunoprecipitated with IRS-1 antibody followed by SDS-PAGE, and then immunoblotted with p85 or IRS-1 antibody as described under "Experimental Procedures." The p85 immunoblot of anti-IRS-1 precipitates in panel A is representative of six independent experiments, which are quantified in the bar graph (mean ± S.E.). B, p70 S6 kinase was immunoprecipitated from cell lysates, and kinase activity was measured based on phosphorylation of S6 peptide as described under "Experimental Procedures." Data are expressed as % of control (IGF-I stimulated without dansylcadaverine) and represent the mean ± S.E. from six independent experiments. *, p < 0.05 versus basal.

In contrast to the lack of effects on IRS pathway signaling, inhibition of receptor internalization by dansylcadaverine decreased IGF-I activation of multiple signaling responses downstream from Shc. As shown in Fig. 10A, the IGF-I-stimulated association of Grb2 with Shc was decreased by approximately 35% in dansylcadaverine-treated cells (p < 0.05), which is similar in magnitude to the inhibition of IGF-I-stimulated Shc tyrosine phosphorylation by dansylcadaverine (Fig. 8C). This was associated with a decrease in IGF-I-stimulated phosphorylation of the 44-kDa ERK 1 isoform of MAP kinase (Fig. 10), a less marked decrease in the 42-kDa ERK 2 isoform, and a significant decrease in IGF-I-stimulated p90 S6 kinase activity (Fig. 10C).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 10.   Effects of dansylcadaverine (DC) on IGF-I-stimulated association of Grb2 with Shc, phosphorylation of MAP kinase, and activation of p90 S6 kinase in CHO cells. Cells expressing human IGF-I receptors were serum-starved for 16-18 h, incubated for 30 min in the absence or presence of dansylcadaverine (500 µM), and then stimulated with IGF-I (10-8 M) for 5 min at 37 °C. A, cell lysates were immunoprecipitated with Shc antibody, resolved by SDS-PAGE, and then immunoblotted with Grb2 or Shc antibody as described under "Experimental Procedures." The top panel shows a representative immunoblot of Shc-Grb2 co-precipitation, and the middle panel shows Shc protein content determined by immunoprecipitation and blotting. The bar graph at the bottom represents the quantitation of Shc-Grb2 co-precipitation from six independent experiments (mean ± S.E.). B, cell lysates were directly resolved by SDS-PAGE and immunoblotted with MAP kinase antibodies. The top panel shows a representative immunoblot with phosphospecific MAP kinase antibody, and the middle panel is the same blot stripped and re-probed with antibody that recognizes MAP kinase independent of its phosphorylation state. The bar graph at the bottom was derived from the quantitation of the 44-kDa bands in six independent experiments with the phosphospecific antibody. C, p90 S6 kinase was immunoprecipitated from cell lysates, and kinase activity was measured based on phosphorylation of S6 peptide as described under "Experimental Procedures." The data were derived from six independent experiments. The results in all bar graphs are expressed as % of control (IGF-I stimulated without dansylcadaverine). *, p < 0.05 versus basal; **, p < 0.05 versus basal or stimulated control cells.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The comparison of the time courses of IGF-I-stimulated tyrosine phosphorylation of IRS-1 and Shc proteins in CHO fibroblasts expressing human IGF-I receptors confirms, in this cell system, the previously reported observation that Shc phosphorylation is delayed in comparison with IRS-1 phosphorylation. A similar slower time course of Shc compared with IRS-1 phosphorylation has also been observed in Rat1 fibroblasts stimulated with IGF-I (22) or insulin (9). The temporal pattern of Shc phosphorylation corresponds to the time course of IGF-I receptor internalization previously described in CHO cells (23), suggesting that receptor endocytosis may play a role in cell signaling via Shc phosphorylation. Therefore, we investigated the relationships between IRS-1 and Shc-dependent signaling and ligand-induced IGF-I receptor internalization.

IGF-I-induced receptor internalization was inhibited by mutation of the C-terminal region of the IGF-I receptor (Phe to Tyr substitution at amino acid position 1310), incubation of cells at low temperature (15 °C), or treatment with the endocytosis inhibitor dansylcadaverine. With each of these different experimental approaches, there was a significant decrease in ligand-induced receptor internalization and a corresponding decrease in IGF-I stimulation of Shc tyrosine phosphorylation. Cells expressing the Tyr-1310 mutant receptor exhibited maximum phosphorylation of Shc 10 min after IGF-I stimulation and decreased Shc phosphorylation at multiple time points extending for at least 60 min after IGF-I treatment. Thus, decreased Shc tyrosine phosphorylation in cells expressing the Tyr-1310 receptor cannot be explained by delayed kinetics of Shc phosphorylation. Two independent Tyr-1310 cell clones had a similar 35% decrease in Shc protein content in comparison with two clones expressing the wild-type receptor. This suggests a possible relationship between the activation state and expression of the Shc proteins, which we have not yet investigated. The decrease in Shc phosphorylation was greater than the decrease in Shc content, however, and IGF-I-stimulated Shc phosphorylation was significantly diminished in the Tyr-1310 cells even after correction for the lower level of Shc protein. The cellular content of the Shc proteins did not change in cells incubated at low temperature or with the inhibitor dansylcadaverine, further confirming a consistent relationship between decreased IGF-I receptor internalization and decreased IGF-I stimulation of Shc phosphorylation.

The step in the endocytotic pathway inhibited by the Tyr-1310 mutation is not known. However, there is evidence that low temperature and dansylcadaverine delay receptor internalization at steps proximal to the formation of early endosomes. It has been shown that incubating cells at a 16 °C results in a marked decrease in the fraction of bound insulin that cannot dissociate from intact cells by low pH washing, indicative of a delay in early endosome formation via clathrin-coated pits (36). In the CHO cells investigated in this study, we have demonstrated a similar marked inhibition of ligand-induced IGF-I receptor internalization at 15 °C. Previous studies have shown that dansylcadaverine appears to inhibit a step in endocytotic vesicle formation that involves the pinching off of vesicles from the plasma membrane (33, 37). Based on these sites of inhibition, our findings are consistent with a model in which the tyrosine phosphorylation of Shc occurs predominantly by activated IGF-I receptors in endosomes, or at least by receptors in vesicles that have moved past the point in the endocytotic pathway inhibited by dansylcadaverine. Our findings further demonstrate that changes in Shc phosphorylation as a consequence of altered receptor internalization correlate with the intensity of IGF-I induced signaling via the MAP kinase pathway.

The endosome has previously been implicated as a major site of Shc tyrosine phosphorylation in response to epidermal growth factor stimulation in liver parenchyma (38), but the relative activity of receptors at different points in the ligand-induced internalization pathway in phosphorylating Shc or other substrates was not investigated in this earlier study. In a report published subsequent to the completion of our study, the inhibition of ligand-induced insulin receptor internalization in receptor overexpressing CHO cells by mutation or incubation at 4 °C was shown to be associated with decreased insulin-stimulated tyrosine phosphorylation of annexin II (39). It was hypothesized that annexin II is selectively phosphorylated by receptors that have moved from the microvillous to nonvillous regions of the plasma membrane (40), but not yet entered coated pits and endosomes. In accordance with our findings, it was briefly noted in this study that insulin-stimulated phosphorylation of the 64-kDa isoform of Shc was also inhibited at 4 °C (39). Thus, the internalization of insulin receptors as well as IGF-I receptors appears to be required for phosphorylation and activation of the Shc proteins.

In contrast to Shc phosphorylation, we did not observe a decrease in IGF-I-stimulated IRS-1 tyrosine phosphorylation when receptor internalization was inhibited by mutation, low temperature, or dansylcadaverine, indicating that IRS-1 phosphorylation is not dependent on IGF-I receptor internalization. Furthermore, data from dansylcadaverine-treated cells demonstrate that IGF-I receptor internalization does not regulate the intensity of signaling via the IRS pathway, as measured by association of the p85 regulatory subunit of PI 3-kinase with IRS proteins or p70 S6 kinase activation. The observation that IGF-I receptor internalization is not required for IRS-1 phosphorylation is consistent with a previous study on insulin receptors demonstrating that insulin-stimulated IRS-1 tyrosine phosphorylation can be observed at 4 °C in CHO fibroblasts and 3T3-L1 adipocytes (41). Thus, it appears that IRS-1 phosphorylation can be catalyzed by activated IGF-I or insulin receptors at the cell surface and/or in coated pits closely associated with the plasma membrane. When receptor internalization is inhibited by low temperature, the amount of tyrosine-phosphorylated IRS-1 per activated (phosphorylated) IGF-I receptor in these structures increases, whereas Shc phosphorylation is completely inhibited. It is important to note that these findings of effective IRS-1 tyrosine phosphorylation despite decreased receptor internalization do not exclude an important role for activated endosomal or intracellular membrane-associated receptors in the phosphorylation of IRS-1. In vivo administration of colchicine and a peroxovanadium compound has been shown to exclusively activate endosomal insulin receptors in the liver, and this leads to tyrosine phosphorylation of IRS-1, demonstrating the signaling capacity of endosomal insulin receptors in signaling (42). Another study has provided evidence that IRS-1 can be phosphorylated by activated insulin receptors in intracellular membrane compartments in rat adipocytes after insulin stimulation (43).

In a recently published report (44), the Shc proteins were shown to be localized on rough endoplasmic reticulum membranes and redistributed to several regions in the cell, including clathrin-coated pits and endosomes, after tyrosine kinase receptor activation. Furthermore, the presence of distinct subcellular compartmentalized pools of Shc was demonstrated in PC-12 cells (45). Based on these data, plus the findings in the current study, it will be important to explore in future investigations the possibility that activation of receptors and their subsequent endocytosis may lead to the recruitment and tyrosine phosphorylation of the Shc proteins. Rapidly emerging evidence supports a role for compartmentation in targeting the actions of multiple cellular signaling intermediates, including PI 3-kinase (46), protein phosphatases (47), protein kinase C (48), cAMP-dependent protein kinase (49), and the MAP kinase cascade (47). The observation that different substrates or combinations of substrates are phosphorylated by IGF-I receptors at distinct cellular sites defined by the internalization pathway suggests an important role for the ligand-induced internalization mechanism in establishing the subcellular compartmentation of receptors. Factors that modify receptor internalization, either by altering the membrane microenvironment or directly interacting with receptors, could change the distribution of receptors in different cellular compartments and, thus, change the specific pattern of post-receptor responses initiated by receptor activation.

In conclusion, the present study demonstrates that IGF-I receptor internalization is required for cell signaling via the Shc/MAP kinase pathway, but not the IRS-1 pathway. Using three different approaches to modify receptor internalization in intact CHO fibroblasts, our data provide strong evidence for the role of IGF-I receptor endocytosis in modulating post-receptor signaling events. Cellular compartmentation established by ligand-induced receptor internalization may provide a mechanism for independently modulating the stimulation of specific signaling molecules and, thus, the activation of divergent pathways that lead to distinct biological responses.

    ACKNOWLEDGEMENTS

We thank Karen TenDyke and Velta Ramolins for excellent technical assistance, Dr. Francesco Giorgino for helpful suggestions concerning this study, and Drs. Steve Jacobs and Morris White for the antibodies and reagents.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grant DK43038 and Diabetes and Endocrinology Research Center Grant DK36836.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by National Institutes of Health Training Grant DK07260 and a Mary K. Iacocca Foundation postdoctoral fellowship.

§ Present address: Dipartimento di Biologia e Patalogia Cellulare e Molecolare L. Califano, Federico II Naples Medical School, 80131 Naples, Italy.

To whom correspondence should be addressed: Joslin Diabetes Center, One Joslin Place, Boston, MA 02215. Tel.: 617-732-2474; Fax: 617-732-2650.

1 The abbreviations used are: IGF-I, insulin-like growth factor-I; BSA, bovine serum albumin; ERK, extracellular signal regulated kinase; IRS-1, insulin receptor substrate-1; IRS-2, insulin receptor substrate-2; MAP kinase, mitogen-activated protein kinase; PI, phosphatidylinositide; PBS, phosphate-buffered saline; DTT, dithiothreitol; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Stewart, C. E. H., and Rotwein, P. (1996) Physiol. Rev. 76, 1005-1026[Abstract/Free Full Text]
  2. Chuang, L. M., Myers, M. G., Jr., Seidner, G. A., Birnbaum, M. J., White, M. F., Kahn, C. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5172-5175[Abstract/Free Full Text]
  3. Myers, M. G., Jr., Sun, X. J., Cheatham, B., Jachna, B. R., Glasheen, E. M., Backer, J. M., White, M. F. (1993) Endocrinolology 132, 1421-1430[Abstract/Free Full Text]
  4. Giorgetti, S., Pelicci, P. G., Pelicci, G., and Van Obberghen, E. (1994) Eur. J. Biochem. 223, 195-202[Medline] [Order article via Infotrieve]
  5. Myers, M. G., Jr., and White, M. F. (1995) Trends Endocrinol. Metab. 6, 209-215
  6. Myers, M. G., Jr., Backer, J. M., Sun, X. J., Shoelson, S. E., Hu, P., Schlessinger, J., Yoakim, M., Schaffhausen, B., White, M. F. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10350-10354[Abstract/Free Full Text]
  7. Dardevet, D., Sornet, C., Vary, T., and Grizard, J. (1996) Endocrinology 137, 4087-4094[Abstract]
  8. Pelicci, G., Lanfrancone, L., Grignani, F., McGlade, J., Cavallo, F., Forni, G., Nicoletti, I., Pawson, T., and Pelicci, P. G. (1992) Cell 70, 93-104[CrossRef][Medline] [Order article via Infotrieve]
  9. Sasaoka, T., Rose, D. W., Jhun, B. H., Saltiel, A. R., Draznin, B., Olefsky, J. M. (1994) J. Biol. Chem. 269, 13689-13694[Abstract/Free Full Text]
  10. Lamphere, L., and Lienhard, G. E. (1992) Endocrinology 131, 2196-2202[Abstract/Free Full Text]
  11. Sturgill, T. W., Fay, L. B., Erickson, E., and Maller, J. L. (1988) Nature 334, 715-718[CrossRef][Medline] [Order article via Infotrieve]
  12. Blenis, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5889-5892[Abstract/Free Full Text]
  13. Xing, J., Ginty, D. D., and Greenberg, M. E. (1996) Science 273, 959-963[Abstract]
  14. Jones, J. I., and Clemmons, D. R. (1995) Endocr. Rev. 16, 3-34[Abstract/Free Full Text]
  15. Bevan, A. P., Drake, P. G., Bergeron, J. J. M., Posner, B. I. (1996) Trends Endocrinol. Metab. 7, 13-21
  16. Vieira, A. V., Lamaze, C., and Schmid, S. L. (1996) Science 274, 2086-2089[Abstract/Free Full Text]
  17. Furlanetto, R. W. (1988) Endocrinology 122, 2044-2053[Abstract/Free Full Text]
  18. Carpentier, J.-L. (1994) Diabetologia 37, S117-S124
  19. Wada, I., Lai, W. H., Posner, B. I., Bergeron, J. J. (1992) J. Cell Biol. 116, 321-330[Abstract/Free Full Text]
  20. Wiegmann, K., Schutze, S., Machleidt, T., Witte, D., and Kronke, M. (1994) Cell 78, 1005-1015[CrossRef][Medline] [Order article via Infotrieve]
  21. Smith, R. J., Chow, J. C., and Condorelli, G. (1996) Exp. Clin. Endocrinol. Diabetes 104, Suppl. 2, 42 (abstr.)
  22. Sasaoka, T., Ishiki, M., Sawa, T., Ishihara, H., Takata, Y., Imamura, T., Usui, I., Olefsky, J. M., Kobayashi, M. (1996) Endocrinology 137, 4427-4434[Abstract]
  23. Hsu, D., Knudson, P. E., Zapf, A., Rolband, G. C., Olefsky, J. M. (1994) Endocrinology 134, 744-750[Abstract/Free Full Text]
  24. Kamps, M. P., and Sefton, B. M. (1988) Oncogene 2, 305-315[Medline] [Order article via Infotrieve]
  25. Condorelli, G., Bueno, R., and Smith, R. J. (1994) J. Biol. Chem. 269, 8510-8516[Abstract/Free Full Text]
  26. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492[Abstract/Free Full Text]
  27. Lund, K. A., Opresko, L. K., Starbuck, C., Walsh, B. J., Wiley, H. S. (1990) J. Biol. Chem. 265, 15713-15723[Abstract/Free Full Text]
  28. Hsu, D., and Olefsky, J. M. (1993) Endocrinology 133, 1247-1251[Abstract/Free Full Text]
  29. Giorgino, F., Chen, J. H., and Smith, R. J. (1992) Endocrinology 130, 1433-1444[Abstract/Free Full Text]
  30. Aronson, D., Violan, M. A., Dufresne, S. D., Zangen, D., Fielding, R. A., Goodyear, L. J. (1997) J. Clin. Invest. 99, 1251-1257[Medline] [Order article via Infotrieve]
  31. Condorelli, G., Tocchetti, G. C., Andreozzi, F., Caiola, A., Crescenzi, E., Beguinot, F., and Smith, R. J. (1994) Front. Endocrinol. 9, 373-376
  32. Adashi, E. Y., Resnick, C. E., Hernandez, E. R., Svoboda, M. E., Van Wyk, J. J. (1988) Endocrinology 122, 194-201[Abstract/Free Full Text]
  33. Davies, P. J. A., Davies, D. R., Levitzki, A., Maxfield, F. R., Milhaud, P., Willingham, M. C., Pastan, I. H. (1980) Nature 283, 162-167[CrossRef][Medline] [Order article via Infotrieve]
  34. Davies, P. J. A., Cornwell, M. M., Johnson, J. D., Reggianni, A., Myers, M., Murtaugh, M. P. (1984) Diabetes Care 7, 35-41
  35. Gonzalez Noriega, A., Grubb, J. H., Talkad, V., Sly, W. S. (1980) J. Cell Biol. 85, 839-852[Abstract/Free Full Text]
  36. Olefsky, J. M., and Kao, M. (1982) J. Biol. Chem. 257, 8667-8673[Free Full Text]
  37. Peavy, D. E., Edmondson, J. W., and Duckworth, W. C. (1984) Endocrinology 114, 753-760[Abstract/Free Full Text]
  38. Di Guglielmo, G. M., Baass, P. C., Ou, W. J., Posner, B. I., Bergeron, J. J. (1994) EMBO J. 13, 4269-4277[Medline] [Order article via Infotrieve]
  39. Biener, Y., Feinstein, R., Mayak, M., Kaburagi, Y., Kadowaki, T., and Zick, Y. (1996) J. Biol. Chem. 271, 29489-29496[Abstract/Free Full Text]
  40. Carpentier, J. L., and Paccaud, J. P. (1994) Ann. N. Y. Acad. Sci. 733, 266-278[CrossRef][Medline] [Order article via Infotrieve]
  41. Heller-Harrison, R. A., Morin, M., and Czech, M. P. (1995) J. Biol. Chem. 270, 24442-24450[Abstract/Free Full Text]
  42. Bevan, A. P., Burgess, J. W., Drake, P. G., Shaver, A., Bergeron, J. J. M., Posner, B. I. (1995) J. Biol. Chem. 270, 10784-10791[Abstract/Free Full Text]
  43. Kublaoui, B., Lee, J., and Pilch, P. F. (1995) J. Biol. Chem. 270, 59-65[Abstract/Free Full Text]
  44. Lotti, L. V., Lanfrancone, L., Migliaccio, E., Zompetta, C., Pelicci, G., Salcini, A. E., Falini, B., Pelicci, P. G., Torrisi, M. R. (1996) Mol. Cell. Biol. 16, 1946-1954[Abstract]
  45. Thomas, D., Patterson, S. D., and Bradshaw, R. A. (1995) J. Biol. Chem. 270, 28924-28931[Abstract/Free Full Text]
  46. Heller-Harrison, R. A., Morin, M., Guilherme, A., and Czech, M. P. (1996) J. Biol. Chem. 271, 10200-10204[Abstract/Free Full Text]
  47. Scott, J. D. (1997) Trends. Biochem. Sci. 21, 312-315
  48. Mochly-Rosen, D. (1995) Science 268, 247-251[Abstract/Free Full Text]
  49. Scott, J. D., and McCartney, S. (1994) Mol. Endocrinol. 8, 5-11[Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
C. S. M. Ferreira, M. C. Cheung, S. Missailidis, S. Bisland, and J. Gariepy
Phototoxic aptamers selectively enter and kill epithelial cancer cells
Nucleic Acids Res., February 1, 2009; 37(3): 866 - 876.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Xi, X. Shen, and D. R. Clemmons
p66shc Negatively Regulates Insulin-Like Growth Factor I Signal Transduction via Inhibition of p52shc Binding to Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Substrate-1 Leading to Impaired Growth Factor Receptor-Bound Protein-2 Membrane Recruitment
Mol. Endocrinol., September 1, 2008; 22(9): 2162 - 2175.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Ginty, S. Adak, A. Can, M. Gerdes, M. Larsen, H. Cline, R. Filkins, Z. Pang, Q. Li, and M. C. Montalto
The Relative Distribution of Membranous and Cytoplasmic Met Is a Prognostic Indicator in Stage I and II Colon Cancer
Clin. Cancer Res., June 15, 2008; 14(12): 3814 - 3822.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Chamberlain, T. Chan, J. C. Oberg, A. D. Hawrysh, K. M. James, A. Saxena, J. Xiang, and D. H. Anderson
Disrupted RabGAP Function of the p85 Subunit of Phosphatidylinositol 3-Kinase Results in Cell Transformation
J. Biol. Chem., June 6, 2008; 283(23): 15861 - 15868.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. Vasilcanu, D. Vasilcanu, B. Sehat, S. Yin, A. Girnita, M. Axelson, and L. Girnita
Insulin-Like Growth Factor Type-I Receptor-Dependent Phosphorylation of Extracellular Signal-Regulated Kinase 1/2 but not Akt (Protein Kinase B) Can Be Induced by Picropodophyllin
Mol. Pharmacol., March 1, 2008; 73(3): 930 - 939.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Jensen, B. Hansen, P. De Meyts, L. Schaffer, and B. Urso
Activation of the Insulin Receptor by Insulin and a Synthetic Peptide Leads to Divergent Metabolic and Mitogenic Signaling and Responses
J. Biol. Chem., November 30, 2007; 282(48): 35179 - 35186.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Romanelli, A. P. LeBeau, C. G. Fulmer, D. A. Lazzarino, A. Hochberg, and T. L. Wood
Insulin-like Growth Factor Type-I Receptor Internalization and Recycling Mediate the Sustained Phosphorylation of Akt
J. Biol. Chem., August 3, 2007; 282(31): 22513 - 22524.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Mukherjee, M. Tessema, and A. Wandinger-Ness
Vesicular Trafficking of Tyrosine Kinase Receptors and Associated Proteins in the Regulation of Signaling and Vascular Function
Circ. Res., March 31, 2006; 98(6): 743 - 756.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. Luo, S. J. Field, J. Y. Lee, J. A. Engelman, and L. C. Cantley
The p85 regulatory subunit of phosphoinositide 3-kinase down-regulates IRS-1 signaling via the formation of a sequestration complex
J. Cell Biol., August 1, 2005; 170(3): 455 - 464.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. Vallesi, P. Ballarini, B. Di Pretoro, C. Alimenti, C. Miceli, and P. Luporini
Autocrine, Mitogenic Pheromone Receptor Loop of the Ciliate Euplotes raikovi: Pheromone-Induced Receptor Internalization
Eukaryot. Cell, July 1, 2005; 4(7): 1221 - 1227.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Ling, L. A. Maile, J. Lieskovska, J. Badley-Clarke, and D. R. Clemmons
Role of SHPS-1 in the Regulation of Insulin-like Growth Factor I-stimulated Shc and Mitogen-activated Protein Kinase Activation in Vascular Smooth Muscle Cells
Mol. Biol. Cell, July 1, 2005; 16(7): 3353 - 3364.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Ronacher, N. Matsiliza, N. Nkwanyana, A. J. Pawson, T. Adam, C. A. Flanagan, R. P. Millar, and A. A. Katz
Serine Residues 338 and 339 in the Carboxyl-Terminal Tail of the Type II Gonadotropin-Releasing Hormone Receptor Are Critical for {beta}-Arrestin-Independent Internalization
Endocrinology, October 1, 2004; 145(10): 4480 - 4488.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
T. B. Patel
Single Transmembrane Spanning Heterotrimeric G Protein-Coupled Receptors and Their Signaling Cascades
Pharmacol. Rev., September 1, 2004; 56(3): 371 - 385.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Shi, K. Egawa, H. Maegawa, T. Nakamura, S. Ugi, Y. Nishio, and A. Kashiwagi
Protein-Tyrosine Phosphatase 1B Associates with Insulin Receptor and Negatively Regulates Insulin Signaling without Receptor Internalization
J. Biochem., July 1, 2004; 136(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Dalle, C. Longuet, S. Costes, C. Broca, O. Faruque, G. Fontes, E. H. Hani, and D. Bataille
Glucagon Promotes cAMP-response Element-binding Protein Phosphorylation via Activation of ERK1/2 in MIN6 Cell Line and Isolated Islets of Langerhans
J. Biol. Chem., May 7, 2004; 279(19): 20345 - 20355.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. J. Abuzzahab, A. Schneider, A. Goddard, F. Grigorescu, C. Lautier, E. Keller, W. Kiess, J. Klammt, J. Kratzsch, D. Osgood, et al.
IGF-I Receptor Mutations Resulting in Intrauterine and Postnatal Growth Retardation
N. Engl. J. Med., December 4, 2003; 349(23): 2211 - 2222.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Biedi, D. Panetta, D. Segat, R. Cordera, and D. Maggi
Specificity of Insulin-Like Growth Factor I and Insulin on Shc Phosphorylation and Grb2 Recruitment in Caveolae
Endocrinology, December 1, 2003; 144(12): 5497 - 5503.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. M. Rahman, A. Dobrzyn, P. Dobrzyn, S.-H. Lee, M. Miyazaki, and J. M. Ntambi
Stearoyl-CoA desaturase 1 deficiency elevates insulin-signaling components and down-regulates protein-tyrosine phosphatase 1B in muscle
PNAS, September 16, 2003; 100(19): 11110 - 11115.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
I. Rakatzi, S. Ramrath, D. Ledwig, O. Dransfeld, T. Bartels, G. Seipke, and J. Eckel
A Novel Insulin Analog With Unique Properties: LysB3,GluB29 Insulin Induces Prominent Activation of Insulin Receptor Substrate 2, but Marginal Phosphorylation of Insulin Receptor Substrate 1
Diabetes, September 1, 2003; 52(9): 2227 - 2238.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Pawson, S. R. Maudsley, J. Lopes, A. A. Katz, Y.-M. Sun, J. S. Davidson, and R. P. Millar
Multiple Determinants for Rapid Agonist-Induced Internalization of a Nonmammalian Gonadotropin-Releasing Hormone Receptor: A Putative Palmitoylation Site and Threonine Doublet within the Carboxyl-Terminal Tail Are Critical
Endocrinology, September 1, 2003; 144(9): 3860 - 3871.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Giovannone, E. Lee, L. Laviola, F. Giorgino, K. A. Cleveland, and R. J. Smith
Two Novel Proteins That Are Linked to Insulin-like Growth Factor (IGF-I) Receptors by the Grb10 Adapter and Modulate IGF-I Signaling
J. Biol. Chem., August 22, 2003; 278(34): 31564 - 31573.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Cai, S. Dhe-Paganon, P. A. Melendez, J. Lee, and S. E. Shoelson
Two New Substrates in Insulin Signaling, IRS5/DOK4 and IRS6/DOK5
J. Biol. Chem., July 3, 2003; 278(28): 25323 - 25330.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Vecchione, A. Marchese, P. Henry, D. Rotin, and A. Morrione
The Grb10/Nedd4 Complex Regulates Ligand-Induced Ubiquitination and Stability of the Insulin-Like Growth Factor I Receptor
Mol. Cell. Biol., May 1, 2003; 23(9): 3363 - 3372.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Hailey, E. Maxwell, K. Koukouras, W. R. Bishop, J. A. Pachter, and Y. Wang
Neutralizing Anti-Insulin-like Growth Factor Receptor 1 Antibodies Inhibit Receptor Function and Induce Receptor Degradation in Tumor Cells
Mol. Cancer Ther., December 1, 2002; 1(14): 1349 - 1353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Chiarugi, P. Cirri, M. L. Taddei, E. Giannoni, T. Fiaschi, F. Buricchi, G. Camici, G. Raugei, and G. Ramponi
Insight into the Role of Low Molecular Weight Phosphotyrosine Phosphatase (LMW-PTP) on Platelet-derived Growth Factor Receptor (PDGF-r) Signaling. LMW-PTP CONTROLS PDGF-r KINASE ACTIVITY THROUGH TYR-857 DEPHOSPHORYLATION
J. Biol. Chem., September 27, 2002; 277(40): 37331 - 37338.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. K. Misra, G. Akabani, and S. V. Pizzo
The Role of cAMP-dependent Signaling in Receptor-recognized Forms of alpha 2-Macroglobulin-induced Cellular Proliferation
J. Biol. Chem., September 20, 2002; 277(39): 36509 - 36520.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Dalle, T. Imamura, D. W. Rose, D. S. Worrall, S. Ugi, C. J. Hupfeld, and J. M. Olefsky
Insulin Induces Heterologous Desensitization of G Protein-Coupled Receptor and Insulin-Like Growth Factor I Signaling by Downregulating {beta}-Arrestin-1
Mol. Cell. Biol., September 1, 2002; 22(17): 6272 - 6285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Lu, J. T. Murray, W. Luo, H. Li, X. Wu, H. Xu, J. M. Backer, and Y.-G. Chen
Transforming Growth Factor beta Activates Smad2 in the Absence of Receptor Endocytosis
J. Biol. Chem., August 9, 2002; 277(33): 29363 - 29368.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. G. Penheiter, H. Mitchell, N. Garamszegi, M. Edens, J. J. E. Dore Jr., and E. B. Leof
Internalization-Dependent and -Independent Requirements for Transforming Growth Factor {beta} Receptor Signaling via the Smad Pathway
Mol. Cell. Biol., July 1, 2002; 22(13): 4750 - 4759.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Chiarugi, P. Cirri, M. L. Taddei, D. Talini, L. Doria, T. Fiaschi, F. Buricchi, E. Giannoni, G. Camici, G. Raugei, et al.
New perspectives in PDGF receptor downregulation: the main role of phosphotyrosine phosphatases
J. Cell Sci., May 15, 2002; 115(10): 2219 - 2232.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. H. Shah, J. Alberto Olivares-Reyes, A. Yesilkaya, and K. J. Catt
Independence of Angiotensin II-Induced MAP Kinase Activation from Angiotensin Type 1 Receptor Internalization in Clone 9 Hepatocytes
Mol. Endocrinol., March 1, 2002; 16(3): 610 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. G. Brocardo, R. Schillaci, A. Galeano, M. Radrizzani, V. White, A. G. Guerrico, T. A. Santa-Coloma, and A. Roldan
Early effects of insulin-like growth factor-1 in activated human T lymphocytes
J. Leukoc. Biol., August 1, 2001; 70(2): 297 - 305.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. P. Coller and D. M. Paulnock
Signaling pathways initiated in macrophages after engagement of type A scavenger receptors
J. Leukoc. Biol., July 1, 2001; 70(1): 142 - 148.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
C. M. Boney, H. Sekimoto, P. A. Gruppuso, and A. R. Frackelton Jr.
Src Family Tyrosine Kinases Participate in Insulin-like Growth Factor I Mitogenic Signaling in 3T3-L1 Cells
Cell Growth Differ., July 1, 2001; 12(7): 379 - 386.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. Braiman, A. Alt, T. Kuroki, M. Ohba, A. Bak, T. Tennenbaum, and S. R. Sampson
Insulin Induces Specific Interaction between Insulin Receptor and Protein Kinase C{{delta}} in Primary Cultured Skeletal Muscle
Mol. Endocrinol., April 1, 2001; 15(4): 565 - 574.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
R. D. York, D. C. Molliver, S. S. Grewal, P. E. Stenberg, E. W. McCleskey, and P. J. S. Stork
Role of Phosphoinositide 3-Kinase and Endocytosis in Nerve Growth Factor-Induced Extracellular Signal-Regulated Kinase Activation via Ras and Rap1
Mol. Cell. Biol., November 1, 2000; 20(21): 8069 - 8083.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. K. Studer, E. Levicoff, H. Georgescu, L. Miller, D. Jaffurs, and C. H. Evans
Nitric oxide inhibits chondrocyte response to IGF-I: inhibition of IGF-IRbeta tyrosine phosphorylation
Am J Physiol Cell Physiol, October 1, 2000; 279(4): C961 - C969.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. M. Boney, P. A. Gruppuso, R. A. Faris, and A. R. Frackelton Jr.
The Critical Role of Shc in Insulin-Like Growth Factor-I-Mediated Mitogenesis and Differentiation in 3T3-L1 Preadipocytes
Mol. Endocrinol., June 1, 2000; 14(6): 805 - 813.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
R.-S. Schmid, W. M. Pruitt, and P. F. Maness
A MAP Kinase-Signaling Pathway Mediates Neurite Outgrowth on L1 and Requires Src-Dependent Endocytosis
J. Neurosci., June 1, 2000; 20(11): 4177 - 4188.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Dews, M. Prisco, F. Peruzzi, G. Romano, A. Morrione, and R. Baserga
Domains of the Insulin-Like Growth Factor I Receptor Required for the Activation of Extracellular Signal-Regulated Kinases
Endocrinology, April 1, 2000; 141(4): 1289 - 1300.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Maudsley, K. L. Pierce, A. M. Zamah, W. E. Miller, S. Ahn, Y. Daaka, R. J. Lefkowitz, and L. M. Luttrell
The beta 2-Adrenergic Receptor Mediates Extracellular Signal-regulated Kinase Activation via Assembly of a Multi-receptor Complex with the Epidermal Growth Factor Receptor
J. Biol. Chem., March 24, 2000; 275(13): 9572 - 9580.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. L. Pierce, S. Maudsley, Y. Daaka, L. M. Luttrell, and R. J. Lefkowitz
Role of endocytosis in the activation of the extracellular signal-regulated kinase cascade by sequestering and nonsequestering G protein-coupled receptors
PNAS, February 15, 2000; 97(4): 1489 - 1494.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. B. Knight, K. T. Cao, G. V. Gibson, and A. L. Olson
Expression of a Prenylation-Deficient Rab4 Interferes with Propagation of Insulin Signaling through Insulin Receptor Substrate-1
Endocrinology, January 1, 2000; 141(1): 208 - 218.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. W. Schaefer, H. Kamiguchi, E. V. Wong, C. M. Beach, G. Landreth, and V. Lemmon
Activation of the MAPK Signal Cascade by the Neural Cell Adhesion Molecule L1 Requires L1 Internalization
J. Biol. Chem., December 31, 1999; 274(53): 37965 - 37973.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Kranenburg, I. Verlaan, and W. H. Moolenaar
Dynamin Is Required for the Activation of Mitogen-activated Protein (MAP) Kinase by MAP Kinase Kinase
J. Biol. Chem., December 10, 1999; 274(50): 35301 - 35304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Urso, D. L. Cope, H. E. Kalloo-Hosein, A. C. Hayward, J. P. Whitehead, S. O'Rahilly, and K. Siddle
Differences in Signaling Properties of the Cytoplasmic Domains of the Insulin Receptor and Insulin-like Growth Factor Receptor in 3T3-L1 Adipocytes
J. Biol. Chem., October 22, 1999; 274(43): 30864 - 30873.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. F. di Mari, R. Davis, and R. L. Safirstein
MAPK activation determines renal epithelial cell survival during oxidative injury
Am J Physiol Renal Physiol, August 1, 1999; 277(2): F195 - F203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F.-T. Lin, W. E. Miller, L. M. Luttrell, and R. J. Lefkowitz
Feedback Regulation of beta -Arrestin1 Function by Extracellular Signal-regulated Kinases
J. Biol. Chem., June 4, 1999; 274(23): 15971 - 15974.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. C. Budd, A. Rae, and A. B. Tobin
Activation of the Mitogen-activated Protein Kinase Pathway by a Gq/11-coupled Muscarinic Receptor Is Independent of Receptor Internalization
J. Biol. Chem., April 30, 1999; 274(18): 12355 - 12360.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Valentinis, G. Romano, F. Peruzzi, A. Morrione, M. Prisco, S. Soddu, B. Cristofanelli, A. Sacchi, and R. Baserga
Growth and Differentiation Signals by the Insulin-like Growth Factor 1 Receptor in Hemopoietic Cells Are Mediated through Different Pathways
J. Biol. Chem., April 30, 1999; 274(18): 12423 - 12430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Schutze, T. Machleidt, D. Adam, R. Schwandner, K. Wiegmann, M.-L. Kruse, M. Heinrich, M. Wickel, and M. Kronke
Inhibition of Receptor Internalization by Monodansylcadaverine Selectively Blocks p55 Tumor Necrosis Factor Receptor Death Domain Signaling
J. Biol. Chem., April 9, 1999; 274(15): 10203 - 10212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. J. Della Rocca, Y. V. Mukhin, M. N. Garnovskaya, Y. Daaka, G. J. Clark, L. M. Luttrell, R. J. Lefkowitz, and J. R. Raymond
Serotonin 5-HT1A Receptor-mediated Erk Activation Requires Calcium/Calmodulin-dependent Receptor Endocytosis
J. Biol. Chem., February 19, 1999; 274(8): 4749 - 4753.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Miele, M. Caruso, V. Calleja, R. Auricchio, F. Oriente, P. Formisano, G. Condorelli, A. Cafieri, D. Sawka-Verhelle, E. Van Obberghen, et al.
Differential Role of Insulin Receptor Substrate (IRS)-1 and IRS-2 in L6 Skeletal Muscle Cells Expressing the Arg1152 right-arrow Gln Insulin Receptor
J. Biol. Chem., January 29, 1999; 274(5): 3094 - 3102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ahn, S. Maudsley, L. M. Luttrell, R. J. Lefkowitz, and Y. Daaka
Src-mediated Tyrosine Phosphorylation of Dynamin Is Required for beta 2-Adrenergic Receptor Internalization and Mitogen-activated Protein Kinase Signaling
J. Biol. Chem., January 15, 1999; 274(3): 1185 - 1188.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F.-T. Lin, Y. Daaka, and R. J. Lefkowitz
beta -Arrestins Regulate Mitogenic Signaling and Clathrin-mediated Endocytosis of the Insulin-like Growth Factor I Receptor
J. Biol. Chem., November 27, 1998; 273(48): 31640 - 31643.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, H. Hoff, and C. Sell
Insulin-like Growth Factor I-mediated Degradation of Insulin Receptor Substrate-1 Is Inhibited by Epidermal Growth Factor in Prostate Epithelial Cells
J. Biol. Chem., July 14, 2000; 275(29): 22558 - 22562.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. L. Roudabush, K. L. Pierce, S. Maudsley, K. D. Khan, and L. M. Luttrell
Transactivation of the EGF Receptor Mediates IGF-1-stimulated Shc Phosphorylation and ERK1/2 Activation in COS-7 Cells
J. Biol. Chem., July 14, 2000; 275(29): 22583 - 22589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-K. Tong, N. K. Hussain, A. G. Adams, J. P. O'Bryan, and P. S. McPherson
Intersectin Can Regulate the Ras/MAP Kinase Pathway Independent of Its Role in Endocytosis
J. Biol. Chem., September 15, 2000; 275(38): 29894 - 29899.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Sato, M. Takahashi, Y. Shibukawa, S. K. Jain, R. Hamaoka, J.-i. Miyagawa, Y. Yaginuma, K. Honke, M. Ishikawa, and N. Taniguchi
Overexpression of N-Acetylglucosaminyltransferase III Enhances the Epidermal Growth Factor-induced Phosphorylation of ERK in HeLaS3 Cells by Up-regulation of the Internalization Rate of the Receptors
J. Biol. Chem., April 6, 2001; 276(15): 11956 - 11962.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Dalle, W. Ricketts, T. Imamura, P. Vollenweider, and J. M. Olefsky
Insulin and Insulin-like Growth Factor I Receptors Utilize Different G Protein Signaling Components
J. Biol. Chem., May 4, 2001; 276(19): 15688 - 15695.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Navab, E. Chevet, F. Authier, G. M. Di Guglielmo, J. J. M. Bergeron, and P. Brodt
Inhibition of Endosomal Insulin-like Growth Factor-I Processing by Cysteine Proteinase Inhibitors Blocks Receptor-mediated Functions
J. Biol. Chem., April 20, 2001; 276(17): 13644 - 13649.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Zwaagstra, M. El-Alfy, and M. D. O'Connor-McCourt
Transforming Growth Factor (TGF)-beta 1 Internalization. MODULATION BY LIGAND INTERACTION WITH TGF-beta RECEPTORS TYPES I AND II AND A MECHANISM THAT IS DISTINCT FROM CLATHRIN-MEDIATED ENDOCYTOSIS
J. Biol. Chem., July 13, 2001; 276(29): 27237 - 27245.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chow, J. C.
Right arrow Articles by Smith, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chow, J. C.
Right arrow Articles by Smith, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement