![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 8, 4672-4680, February 20, 1998
,From the Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts 02215
| |
ABSTRACT |
|---|
|
|
|---|
Insulin-like growth factor-I (IGF-I) receptors activate divergent signaling pathways by phosphorylating multiple cellular proteins, including insulin receptor substrate-1 (IRS-1) and the Shc proteins. Following hormone binding, IGF-I receptors cluster into clathrin-coated pits and are internalized via an endocytotic mechanism. This study investigates the relationship between IGF-I receptor internalization and signaling via IRS-1 and Shc. A mutation in the C terminus of the IGF-I receptor decreased both the rate of receptor internalization and IGF-I-stimulated Shc phosphorylation by more than 50%, but did not affect IRS-1 phosphorylation. Low temperature (15 °C) decreased IGF-I receptor internalization and completely inhibited Shc phosphorylation. Although receptor and IRS-1 phosphorylation were decreased in accordance with delayed binding kinetics at 15 °C, the ratio of IRS-1 to receptor phosphorylation was increased more than 2-fold. Dansylcadaverine decreased receptor internalization and Shc phosphorylation, but did not change receptor or IRS-1 phosphorylation. Consistent with these findings, dansylcadaverine inhibited IGF-I-stimulated Shc-Grb2 association, mitogen-activated protein kinase phosphorylation, and p90 ribosomal S6 kinase activation, but did not affect the association of phosphatidylinositide 3-kinase with IRS-1 or activation of p70 S6 kinase. These data support the concept that Shc/mitogen-activated protein kinase pathway activation requires IGF-I receptor internalization, whereas the IRS-1 pathway is activated by both cell surface and endosomal receptors.
| |
INTRODUCTION |
|---|
|
|
|---|
Insulin-like growth factor-I (IGF-I)1 initiates pleiotropic cellular growth and metabolic responses by binding to the type I insulin-like growth factor receptor (1). The activated intrinsic tyrosine kinase of the IGF-I receptor catalyzes receptor autophosphorylation and the tyrosine phosphorylation of early signaling intermediates, including insulin receptor substrate-1 (IRS-1) and the Shc proteins (2-4). IRS-1 contains multiple phosphotyrosine residues that serve as docking sites and activators of a number of signaling molecules, including phosphatidylinositide (PI) 3-kinase (5, 6). Stimulation of PI 3-kinase leads to the activation of downstream mediators of IGF-I action, including p70 S6 kinase, a serine/threonine kinase that phosphorylates 40 S ribosomal protein S6 (7). The Shc proteins, which include several isoforms (46, 52, and 66 kDa), contain specific tyrosine phosphorylation sites necessary for their association with Grb2 and the consequent activation of the GTP-binding protein Ras (8, 9). Activation of Ras initiates a series of phosphorylation events that results in the dual phosphorylation of the mitogen-activated protein (MAP) kinases, ERK1 and ERK2 (10). These MAP kinases can phosphorylate a number of substrates, including p90 ribosomal S6 kinase (11), a protein kinase that can activate several transcription factors in the nucleus (12, 13). Thus, tyrosine phosphorylation of IRS-1 and Shc activates divergent pathways that are ultimately important for cell metabolism, growth, and differentiation (14). However, little is known about cellular mechanisms that may regulate the relative intensity of signaling via these intermediates in response to IGF-I.
Previous studies have suggested a role for ligand-induced receptor
trafficking in modulating the activation of intracellular signaling
molecules (15, 16). Based in part on direct evidence and on homologies
with the insulin signaling pathway (17, 18), it is believed that IGF-I
binding initiates the migration of IGF-I receptors to clathrin-coated
pits and the subsequent formation of early endosomes containing
internalized but still active receptors. The ligand-receptor complex
ultimately becomes dissociated and inactivated in the acidic
environment of late endosomes, where ligands and receptors are sorted
for degradation in lysosomes or recycling to the cell surface (17, 18).
Activated IGF-I receptors at the cell surface, in coated pits, and in
early endosomes have the potential to initiate specific cellular
responses. For other hormone-receptor complexes, endosomal compartments
have been shown to participate in the initiation and/or continuation of
intracellular signaling reactions (15). Hormone-stimulated tyrosine
phosphorylation of the epidermal growth factor receptor begins at the
cell surface but persists within the endosome compartment, such that
there is a greater level of receptor phosphorylation in the endosome
than in the plasma membrane (19). Generation of ceramide by tumor
necrosis factor receptors in endosomes initiates the activation of
NF-
B, while ceramide synthesis at the plasma membrane directs the
activation of serine/threonine protein kinases and phospholipase
A2 (20). Thus, hormone signaling can occur at multiple
steps in receptor internalization pathways, and this may provide a
mechanism for regulating the intensity and pattern of signals generated
by activated receptors.
The relationship between ligand-induced IGF-I receptor internalization and the activation of specific cellular substrates that lead to signaling responses has not been studied. We and others have observed that the time courses of IGF-I stimulated IRS-1 and Shc phosphorylation are different (21, 22). IRS-1 is maximally phosphorylated within 1 to 2 min of IGF-I stimulation, whereas Shc phosphorylation has been shown to reach a maximum only after 5 to 10 min (21, 22). The time course of Shc but not IRS-1 phosphorylation correlates with the time required for ligand-induced receptor internalization (23). The objective of the current study was to determine whether IRS-1 and Shc phosphorylation results from their interaction with IGF-I receptors at distinct sites in the ligand-induced internalization pathway.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
Recombinant human IGF-I was provided by Eli Lilly
Inc. (Indianapolis, IN). Shc, Grb2, and pan-ERK antibodies were
purchased from Transduction Laboratories (Lexington, KY).
Phosphospecific MAP kinase antibody was from Promega Corp. (Madison,
WI). The 3R S6 RSK substrate peptide and antibodies to the RSK-2
isoform of p90 ribosomal S6 kinase and the p85 regulatory subunit of PI 3-kinase were from Upstate Biotechnology, Inc. (Lake Placid, NY). Polyclonal phosphotyrosine and IGF-I receptor (C-terminal) antibodies were prepared as described previously (24). The glutathione S-transferase-S6 substrate peptide and antibodies to p70
ribosomal S6 kinase, IRS-1, and IRS-2 were provided by Dr. Morris
White. The monoclonal IGF-I receptor antibody (
IR-3) was provided by Dr. Steve Jacobs. Protein A-Sepharose was purchased from Pharmacia Inc.
(Piscataway, NJ). [
-32P]ATP was purchased from NEN
Life Science Products Inc. (Boston, MA). 125I-Protein A and
125I-IGF-I were from ICN Biomedical (Costa Mesa, CA) and
Amersham Life Science, Inc. (Arlington Heights, IL), respectively. All other reagents were purchased from Sigma.
CHO Cell Lines--
Unless otherwise indicated, all studies were
conducted with multiple clones of CHO cells stably transfected with the
CAG+ isoform of the human IGF-I receptor. These cells, which have been described previously (25), express approximately 6 × 105 receptors/cell as assessed by ligand binding and
Scatchard analysis. For studies on cells expressing mutated IGF-I
receptors, a 961-base pair HindIII-BamHI fragment
of the wild-type IGF-I receptor cDNA (base pairs 3195-4156) was
subcloned into Bluescript (Stratagene, La Jolla, CA) and used as a
template for site-directed mutagenesis as described by Kunkel (26). The
oligonucleotide TCCGCGCCAGCTACGACGAGAGACA (mutant
nucleotide underlined) was used to generate a cDNA fragment encoding a Phe to Tyr substitution at position 1310 in the C-terminal portion of the IGF-I receptor
-subunit. The mutated IGF-I receptor fragment was fully sequenced to exclude the possibility of additional unwanted mutations and used to replace the analogous fragment in the
previously described APrM8 expression vector containing the
full-length cDNA of the wild-type CAG+ IGF-I receptor (25).
Multiple stably transfected clones of CHO cells expressing
approximately 6 × 105 mutant receptors/cell were
obtained by a co-transfection protocol using a neomycin resistance
selection method as described previously (25). The isolation of CHO
cells expressing similar numbers of kinase-inactive IGF-I receptors
(Lys to Ala substitution at position 1003) has been described (25).
Ligand-induced Internalization--
For comparative studies on
wild-type and mutant IGF-I receptors, the rate of receptor
internalization was determined as described previously (20). Cells were
replica plated in 24-well dishes in Ham's F-12 medium supplemented
with 10% fetal bovine serum. Subconfluent cell monolayers were washed
twice with phosphate-buffered saline (PBS) containing 0.1% bovine
serum albumin (BSA), preincubated for 20 min at 37 °C in assay
buffer containing Ham's F-12 medium supplemented with 0.5% BSA and 50 mM Hepes (pH 7.4), and rinsed twice more with wash buffer.
Subsequently, 40,000 cpm of 125I-IGF-I (final IGF-I
concentration 5 × 10
11 M) in assay
buffer was added to each well, and individual plates were incubated at
37 °C for timed periods of 2, 4, 6, 8, or 10 min. Following
incubation, the medium was removed, and the plates were immersed in
ice-cold PBS plus 0.1% BSA (pH 7.5) and further washed by immersing
twice in ice-cold PBS plus 0.1% BSA at pH 2.75 (determination of
internalized IGF-I) or pH 7.5 (determination of total cell-associated
IGF-I). The washed cells were solubilized with 0.1 N NaOH
in 0.1% SDS, and 125I was quantified by
-counting. The
internalization rate constant (Ke), representing the
slope of the line relating internalized to surface-bound hormone at
each time point, was determined as described previously (27). An
integrated measure of surface-bound hormone was approximated by the
trapezoidal rule using intervals of 2 min, and the slope of the line
defining Ke was determined by linear regression.
8
M) for 10 min. The monolayer was then washed 3 times with
ice-cold PBS, the surface-bound ligand was extracted with acidic
binding buffer (pH 2.75) for 5 min at 4 °C, and the cell-associated
(internalized) radioactivity was determined by lysing the cells with
0.4 N NaOH. The percentage of ligand internalized was
calculated by dividing the internalized counts/min by surface-bound
plus internalized counts/min.
IGF-I Stimulated Protein Tyrosine Phosphorylation--
To
determine IGF-I stimulation of protein tyrosine phosphorylation in
intact cells, subconfluent monolayers were incubated for 16-18 h in
serum-free Ham's F-12 medium containing 0.5% BSA and 25 mM Hepes (pH 7.4). IGF-I was subsequently added to the medium at a dose of 10
8 M for the indicated
period of time, the medium was removed, and the cells were washed twice
with ice-cold buffer (137 mM NaCl, 1 mM
MgCl2, 1 mM CaCl2, and 0.1 mM Na3VO4 in 20 mM
Tris-HCl, pH 7.6) and lysed in the same buffer supplemented with 1%
Nonidet P-40, 10% glycerol, 2 mM EDTA, 10 mM
sodium pyrophosphate, 10 mM sodium fluoride, 2 mM Na3VO4, 2 mM
phenylmethylsulfonyl fluoride, and 8 µg/ml leupeptin). Cell lysates
were centrifuged at 12,000 × g for 5 min at 4 °C,
the supernatants were collected, and protein concentrations determined
using a Bradford dye binding assay kit with BSA as standard (Bio-Rad).
For studies on the effects of low temperature, cell monolayers were
incubated overnight with serum-free medium, and this was replaced with
fresh medium preadjusted to 15 or 37 °C. After incubation for 30 min
at the appropriate temperature, IGF-I was added, and cell lysates
prepared as described above. For inhibitor studies, dansylcadaverine
(500 µM), chloroquine (200 µM), or an
appropriate diluent were added for 30 min prior to IGF-I
stimulation.
IR3 (1:200 dilution), IRS-1 (1:100 dilution), or Shc (1 µg/ml) antibody at 4 °C
overnight. The antibody was then adsorbed to protein-A Sepharose beads
for 2 h at 4 °C, and the resulting immunocomplexes were washed
three times by centrifugation and resuspension in buffer containing 10 mM Tris-HCl (pH 7.8), 150 mM NaCl, 1% Nonidet
P-40, 1 mM Na3VO4, and 1 mM phenylmethylsulfonyl fluoride. Specific protein
immunoprecipitates, plus additional cell extracts not treated with
antibodies (200 µg), were heated in Laemmli buffer with 100 mM DTT at 100 °C for 5 min.
Proteins were separated by SDS-PAGE and electroblotted onto
nitrocellulose membranes (Schleicher & Schuell, Inc., Keene, NH). The
blots were blocked in 5% BSA, probed with phosphotyrosine antibody (2 µg/ml), washed as described previously, and then incubated with
125I-Protein A for 1 h at 25 °C (29). Labeled
protein bands were detected and quantitated using a PhosphorImaging
system (Molecular Dynamics, Sunnyvale, CA). The identities of the
phosphorylated bands on anti-phosphotyrosine immunoblots corresponding
to the
-subunit of the IGF-I receptor (105 kDa), IRS-1 (170 kDa),
and Shc proteins (66, 52, and 46 kDa) were confirmed with antibodies specific for each of these proteins.
MAP Kinase Activation and Co-precipitation Studies-- IGF-I-stimulated MAP kinase activation was measured by immunoblotting CHO cell lysates (prepared above) with a phosphospecific MAP kinase antibody (1:2000 dilution). After detection with 125I-Protein A, these blots were stripped and re-probed with a monoclonal pan-ERK antibody (1:5000 dilution) as described by the manufacturer (Transduction Laboratories). Protein bands corresponding to ERK 1 and 2 were visualized by the enhanced chemiluminescence (ECL) method (Amersham).
For co-precipitation experiments, cell lysates were incubated with IRS-1, IRS-2 (1:100 dilution), or Shc antibody followed by SDS-PAGE and electroblotting as described above. Blots of IRS-1 and -2 immunoprecipitates were subsequently probed with either an antibody that recognizes the p85 regulatory subunit of PI-3 kinase (1:1000 dilution), or the respective immunoprecipitating antibody. To measure IGF-I-stimulated Shc-Grb2 association, Shc immunoprecipitates were immunoblotted with a monoclonal Grb2 antibody (1:1000) as described by the manufacturer (Transduction Laboratories). The protein band corresponding to Grb2 was detected by the ECL method.Kinase Assays--
RSK-2 activity was measured by an immune
complex kinase assay as described previously (30). For each treatment,
500 µg of cell extract was incubated with polyclonal RSK-2 antibody
for 2 h at 4 °C and subsequently complexed to protein
A-Sepharose beads for an additional 2 h. Immunocomplexes were
washed 3 times with lysis buffer, 3 times with LiCl buffer, 3 times
with RSK kinase buffer (30), and resuspended in kinase buffer
containing 30 mM Tris (pH 7.4), 10 mM
MgCl2, 0.1 mM EGTA, 1 mM DTT, 3R S6 peptide (RRLSSLRA), 40 µM ATP, and 10 µCi of
[
-32P]ATP. Reactions were performed at 30 °C for 15 min with agitation, terminated, and spotted onto P81 phosphocellulose
papers. The papers were washed several times with 1% phosphoric acid
and measured for radioactivity by the Cerenkov method.
-mercaptoethanol, 50 µM ATP, 20 µCi of
[
-32P]ATP, and 5 µg of glutathione
S-transferase-S6 peptide (the final 30 amino acids of rat S6
sequence) for 10 min at 30 °C with agitation. Reactions were
terminated by heating with Laemmli buffer with 100 mM DTT
at 100 °C for 5 min and analyzed by SDS-PAGE. Gels were vacuum dried
and exposed in a PhosphorImager cassette.
Statistical Analysis-- Quantitative data are presented as mean ± S.E. and analyzed using a statistical model based on a one-way or two-way classification analysis of variance. Tests of significance for all possible comparisons were determined by Bonferroni's t test (SYSTAT, version 5.0, Evanston, IL).
| |
RESULTS |
|---|
|
|
|---|
Time Course of IGF-I Stimulated IRS-1 and Shc
Phosphorylation--
To determine the time course of IGF-I stimulated
IRS-1 and Shc tyrosine phosphorylation, multiple clones of stably
transfected CHO cells expressing approximately 6 × 105 human wild-type IGF-I receptors/cell were stimulated
with 10
8 M IGF-I for 1, 2, 5, 10, or 20 min
at 37 °C. Cell lysates were prepared, resolved by SDS-PAGE, and the
IGF-I receptor and IRS-1 were identified by immunoblotting with
phosphotyrosine antibody. For quantitation of phosphorylation of the
Shc proteins, the cell extracts were first subjected to
immunoprecipitation with Shc antibody, and the resulting precipitates
were analyzed by phosphotyrosine antibody immunoblotting. As shown in
Fig. 1A, phosphorylation of
the IGF-I receptor was rapid, reaching a maximum within 2 min. Insulin
receptor tyrosine phosphorylation was unmeasurable in these cell
extracts (data not shown), reflecting the specificity of IGF-I binding
and the relatively low number of insulin receptors in the CHO cells.
The tyrosine phosphorylation of IRS-1 also was very rapid, reaching
maximal levels within 1 to 2 min after the addition of IGF-I (Fig. 1,
A and B). At 10 min, there was a 20% decrease in
IRS-1 phosphorylation and no further change through 20 min of
incubation. In comparison to IRS-1, Shc tyrosine phosphorylation was
more gradual, reaching a maximal and sustained level after 5 to 10 min
of incubation with IGF-I (Fig. 1A). Quantitative data are
shown for the 52-kDa Shc isoform in Fig. 1B, and a similar time course of IGF-I stimulated phosphorylation was also observed for
the 46- and 66-kDa Shc isoforms.
|
Protein Tyrosine Phosphorylation in CHO Cells Transfected with Internalization-defective Mutant IGF-I Receptors-- Previous studies in our laboratory have shown that mutation of the Phe residue to Tyr at position 1310 in the C terminus of the IGF-I receptor leads to a decreased rate of ligand-induced receptor internalization in transfected CHO cells (31). As shown in Fig. 2, the rate of ligand-induced internalization of Tyr-1310 mutant receptors is decreased by 50% in comparison with wild-type IGF-I receptors. The internalization rate of the Tyr-1310 mutant is only slightly greater than the rate of ligand-induced internalization of receptors that have absent kinase activity as a consequence of a Lys to Ala mutation at position 1003 in the ATP-binding site.
|
|
Effects of Low Temperature on Internalization and Protein Tyrosine Phosphorylation-- To further investigate the relationship between receptor-mediated endocytosis and protein tyrosine phosphorylation, IGF-I receptor internalization in CHO cells expressing the wild-type receptor was inhibited by reducing the cell incubation temperature from 37 to 15 °C. Ligand-induced IGF-I receptor internalization after 10 min was decreased by 64% at 15 °C compared with cells at 37 °C (Fig. 4A). Low temperature also decreased IGF-I stimulated receptor autophosphorylation at early time points (0-20 min) (Fig. 4B). This is consistent with delayed ligand binding kinetics at 15 °C, which have previously been described (32). The time course of IGF-I stimulated IRS-1 tyrosine phosphorylation was delayed, and the level of IRS-1 phosphorylation observed at all time points between 0 and 20 min was reduced at 15 °C versus 37 °C (Fig. 5A). Since diminished IRS-1 phosphorylation might be explained by delayed IGF-I binding and receptor activation, the level of IRS-1 phosphorylation was expressed per unit of receptor autophosphorylation. When data from cells stimulated with IGF-I for periods ranging from 2 to 20 min were analyzed, a significant increase in the amount of phosphorylated IRS-1 per phosphorylated receptor was evident at 15 °C compared with 37 °C (p < 0.05 by ANOVA). As shown for the 20-min time point in Fig. 5B, the amount of phosphorylated IRS-1 per phosphorylated receptor was increased by more than 2-fold at 15 °C. Thus, the inhibition of ligand-induced receptor internalization at 15 °C is associated with an augmentation of IRS-1 phosphorylation relative to the number of autophosphorylated (active) IGF-I receptors.
|
|
|
Effects of Dansylcadaverine and Chloroquine on IGF-I Receptor Internalization and Protein Tyrosine Phosphorylation-- As an additional method of investigating the relationship between receptor endocytosis and signaling, IGF-I-stimulated protein tyrosine phosphorylation in CHO cells was determined after treatment with two chemical inhibitors of receptor trafficking, dansylcadaverine and chloroquine. Although the mechanism of action of dansylcadaverine has not been precisely defined, extensive evidence indicates that it inhibits receptor trafficking at a step proximal to the formation of endocytotic vesicles (33, 34). Chloroquine interferes with receptor trafficking by blocking a later step in the acidification of endosomes, thereby preventing recycling of receptors to the cell surface (35). Consistent with these early and late sites of action in the receptor internalization/trafficking pathway, pretreatment of CHO cells expressing the wild-type IGF-I receptor with dansylcadaverine resulted in a 65% decrease in ligand-induced receptor internalization, whereas chloroquine did not significantly alter receptor internalization (Fig. 7).
|
|
Effects of Dansylcadaverine on the IRS-1 and Shc/MAP Kinase Signaling Pathways-- To determine whether ligand-induced receptor internalization influences signaling events that are downstream from IRS-1, CHO cells expressing IGF-I receptors were incubated with the internalization inhibitor, dansylcadaverine. Following stimulation with IGF-I for 5 min, cell lysates were immunoprecipitated with IRS-1 antibody and immunoblotted with an antibody specific for the p85 regulatory subunit of PI3-kinase to measure p85 association with IRS-1. Fig. 9A demonstrates that dansylcadaverine has no effect on IGF-I-stimulated p85 association with IRS-1, consistent with the previous observation of unaltered IRS-1 tyrosine phosphorylation in dansylcadaverine-treated cells. Under these same conditions, IRS-2 tyrosine phosphorylation and p85 association with IRS-2 was not affected by dansylcadaverine (data not shown) indicating that the activation of this alternate IRS pathway also is not affected by changes in receptor internalization. As a signaling response downstream from IRS activation of PI 3-kinase, p70 S6 kinase was shown to be markedly stimulated by IGF-I, and this activation was not altered by pretreatment with dansylcadaverine (Fig. 9B).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The comparison of the time courses of IGF-I-stimulated tyrosine phosphorylation of IRS-1 and Shc proteins in CHO fibroblasts expressing human IGF-I receptors confirms, in this cell system, the previously reported observation that Shc phosphorylation is delayed in comparison with IRS-1 phosphorylation. A similar slower time course of Shc compared with IRS-1 phosphorylation has also been observed in Rat1 fibroblasts stimulated with IGF-I (22) or insulin (9). The temporal pattern of Shc phosphorylation corresponds to the time course of IGF-I receptor internalization previously described in CHO cells (23), suggesting that receptor endocytosis may play a role in cell signaling via Shc phosphorylation. Therefore, we investigated the relationships between IRS-1 and Shc-dependent signaling and ligand-induced IGF-I receptor internalization.
IGF-I-induced receptor internalization was inhibited by mutation of the C-terminal region of the IGF-I receptor (Phe to Tyr substitution at amino acid position 1310), incubation of cells at low temperature (15 °C), or treatment with the endocytosis inhibitor dansylcadaverine. With each of these different experimental approaches, there was a significant decrease in ligand-induced receptor internalization and a corresponding decrease in IGF-I stimulation of Shc tyrosine phosphorylation. Cells expressing the Tyr-1310 mutant receptor exhibited maximum phosphorylation of Shc 10 min after IGF-I stimulation and decreased Shc phosphorylation at multiple time points extending for at least 60 min after IGF-I treatment. Thus, decreased Shc tyrosine phosphorylation in cells expressing the Tyr-1310 receptor cannot be explained by delayed kinetics of Shc phosphorylation. Two independent Tyr-1310 cell clones had a similar 35% decrease in Shc protein content in comparison with two clones expressing the wild-type receptor. This suggests a possible relationship between the activation state and expression of the Shc proteins, which we have not yet investigated. The decrease in Shc phosphorylation was greater than the decrease in Shc content, however, and IGF-I-stimulated Shc phosphorylation was significantly diminished in the Tyr-1310 cells even after correction for the lower level of Shc protein. The cellular content of the Shc proteins did not change in cells incubated at low temperature or with the inhibitor dansylcadaverine, further confirming a consistent relationship between decreased IGF-I receptor internalization and decreased IGF-I stimulation of Shc phosphorylation.
The step in the endocytotic pathway inhibited by the Tyr-1310 mutation is not known. However, there is evidence that low temperature and dansylcadaverine delay receptor internalization at steps proximal to the formation of early endosomes. It has been shown that incubating cells at a 16 °C results in a marked decrease in the fraction of bound insulin that cannot dissociate from intact cells by low pH washing, indicative of a delay in early endosome formation via clathrin-coated pits (36). In the CHO cells investigated in this study, we have demonstrated a similar marked inhibition of ligand-induced IGF-I receptor internalization at 15 °C. Previous studies have shown that dansylcadaverine appears to inhibit a step in endocytotic vesicle formation that involves the pinching off of vesicles from the plasma membrane (33, 37). Based on these sites of inhibition, our findings are consistent with a model in which the tyrosine phosphorylation of Shc occurs predominantly by activated IGF-I receptors in endosomes, or at least by receptors in vesicles that have moved past the point in the endocytotic pathway inhibited by dansylcadaverine. Our findings further demonstrate that changes in Shc phosphorylation as a consequence of altered receptor internalization correlate with the intensity of IGF-I induced signaling via the MAP kinase pathway.
The endosome has previously been implicated as a major site of Shc tyrosine phosphorylation in response to epidermal growth factor stimulation in liver parenchyma (38), but the relative activity of receptors at different points in the ligand-induced internalization pathway in phosphorylating Shc or other substrates was not investigated in this earlier study. In a report published subsequent to the completion of our study, the inhibition of ligand-induced insulin receptor internalization in receptor overexpressing CHO cells by mutation or incubation at 4 °C was shown to be associated with decreased insulin-stimulated tyrosine phosphorylation of annexin II (39). It was hypothesized that annexin II is selectively phosphorylated by receptors that have moved from the microvillous to nonvillous regions of the plasma membrane (40), but not yet entered coated pits and endosomes. In accordance with our findings, it was briefly noted in this study that insulin-stimulated phosphorylation of the 64-kDa isoform of Shc was also inhibited at 4 °C (39). Thus, the internalization of insulin receptors as well as IGF-I receptors appears to be required for phosphorylation and activation of the Shc proteins.
In contrast to Shc phosphorylation, we did not observe a decrease in IGF-I-stimulated IRS-1 tyrosine phosphorylation when receptor internalization was inhibited by mutation, low temperature, or dansylcadaverine, indicating that IRS-1 phosphorylation is not dependent on IGF-I receptor internalization. Furthermore, data from dansylcadaverine-treated cells demonstrate that IGF-I receptor internalization does not regulate the intensity of signaling via the IRS pathway, as measured by association of the p85 regulatory subunit of PI 3-kinase with IRS proteins or p70 S6 kinase activation. The observation that IGF-I receptor internalization is not required for IRS-1 phosphorylation is consistent with a previous study on insulin receptors demonstrating that insulin-stimulated IRS-1 tyrosine phosphorylation can be observed at 4 °C in CHO fibroblasts and 3T3-L1 adipocytes (41). Thus, it appears that IRS-1 phosphorylation can be catalyzed by activated IGF-I or insulin receptors at the cell surface and/or in coated pits closely associated with the plasma membrane. When receptor internalization is inhibited by low temperature, the amount of tyrosine-phosphorylated IRS-1 per activated (phosphorylated) IGF-I receptor in these structures increases, whereas Shc phosphorylation is completely inhibited. It is important to note that these findings of effective IRS-1 tyrosine phosphorylation despite decreased receptor internalization do not exclude an important role for activated endosomal or intracellular membrane-associated receptors in the phosphorylation of IRS-1. In vivo administration of colchicine and a peroxovanadium compound has been shown to exclusively activate endosomal insulin receptors in the liver, and this leads to tyrosine phosphorylation of IRS-1, demonstrating the signaling capacity of endosomal insulin receptors in signaling (42). Another study has provided evidence that IRS-1 can be phosphorylated by activated insulin receptors in intracellular membrane compartments in rat adipocytes after insulin stimulation (43).
In a recently published report (44), the Shc proteins were shown to be localized on rough endoplasmic reticulum membranes and redistributed to several regions in the cell, including clathrin-coated pits and endosomes, after tyrosine kinase receptor activation. Furthermore, the presence of distinct subcellular compartmentalized pools of Shc was demonstrated in PC-12 cells (45). Based on these data, plus the findings in the current study, it will be important to explore in future investigations the possibility that activation of receptors and their subsequent endocytosis may lead to the recruitment and tyrosine phosphorylation of the Shc proteins. Rapidly emerging evidence supports a role for compartmentation in targeting the actions of multiple cellular signaling intermediates, including PI 3-kinase (46), protein phosphatases (47), protein kinase C (48), cAMP-dependent protein kinase (49), and the MAP kinase cascade (47). The observation that different substrates or combinations of substrates are phosphorylated by IGF-I receptors at distinct cellular sites defined by the internalization pathway suggests an important role for the ligand-induced internalization mechanism in establishing the subcellular compartmentation of receptors. Factors that modify receptor internalization, either by altering the membrane microenvironment or directly interacting with receptors, could change the distribution of receptors in different cellular compartments and, thus, change the specific pattern of post-receptor responses initiated by receptor activation.
In conclusion, the present study demonstrates that IGF-I receptor internalization is required for cell signaling via the Shc/MAP kinase pathway, but not the IRS-1 pathway. Using three different approaches to modify receptor internalization in intact CHO fibroblasts, our data provide strong evidence for the role of IGF-I receptor endocytosis in modulating post-receptor signaling events. Cellular compartmentation established by ligand-induced receptor internalization may provide a mechanism for independently modulating the stimulation of specific signaling molecules and, thus, the activation of divergent pathways that lead to distinct biological responses.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Karen TenDyke and Velta Ramolins for excellent technical assistance, Dr. Francesco Giorgino for helpful suggestions concerning this study, and Drs. Steve Jacobs and Morris White for the antibodies and reagents.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grant DK43038 and Diabetes and Endocrinology Research Center Grant DK36836.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by National Institutes of Health Training Grant DK07260
and a Mary K. Iacocca Foundation postdoctoral fellowship.
§ Present address: Dipartimento di Biologia e Patalogia Cellulare e Molecolare L. Califano, Federico II Naples Medical School, 80131 Naples, Italy.
¶ To whom correspondence should be addressed: Joslin Diabetes Center, One Joslin Place, Boston, MA 02215. Tel.: 617-732-2474; Fax: 617-732-2650.
1 The abbreviations used are: IGF-I, insulin-like growth factor-I; BSA, bovine serum albumin; ERK, extracellular signal regulated kinase; IRS-1, insulin receptor substrate-1; IRS-2, insulin receptor substrate-2; MAP kinase, mitogen-activated protein kinase; PI, phosphatidylinositide; PBS, phosphate-buffered saline; DTT, dithiothreitol; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Vasilcanu, D. Vasilcanu, B. Sehat, S. Yin, A. Girnita, M. Axelson, and L. Girnita Insulin-Like Growth Factor Type-I Receptor-Dependent Phosphorylation of Extracellular Signal-Regulated Kinase 1/2 but not Akt (Protein Kinase B) Can Be Induced by Picropodophyllin Mol. Pharmacol., March 1, 2008; 73(3): 930 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jensen, B. Hansen, P. De Meyts, L. Schaffer, and B. Urso Activation of the Insulin Receptor by Insulin and a Synthetic Peptide Leads to Divergent Metabolic and Mitogenic Signaling and Responses J. Biol. Chem., November 30, 2007; 282(48): 35179 - 35186. [Abstract] [Full Text] [PDF] |
||||
![]() |
|