![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 9, 5086-5092, February 27, 1998
From the Stimulation of macrophages with endotoxin and/or
cytokines is responsible for the expression of the inducible isoform of
nitric oxide synthase (iNOS). Because macrophages are exposed to low pH
within the microenvironment of inflammatory lesions, the potential role
of acidic pH as an additional regulator of iNOS was investigated. Substitution of the culture medium of rat peritoneal macrophages at pH
7.4 with medium at pH 7.0 up-regulated iNOS activity, as reflected by a
2.5-fold increase in nitrite accumulation. The increase in iNOS
activity was associated with a similar increase in iNOS mRNA
expression that reflected an increase in iNOS mRNA synthesis rather
than stability. Low environmental pH-induced iNOS gene transcription
involved the activation of nuclear factor- Acidosis is a hallmark of both ischemia and inflammation
processes. The decrease of pH in tissue ischemia is secondary to the
release of H+ during ATP hydrolysis and to the accumulation
of CO2 (1). The acidic environment in inflammatory lesions
and abscesses (2) is due to increased metabolic acid generation
during cell activation. This originates primarily from the hexose
monophosphate shunt, by the dissociation of hydrated CO2
(3).
In most cases, acidosis occurs along with nitric oxide
(NO)1 generation. In
ischemia, NO generation is due in one part to the acidification and
reduction of the large pool of nitrite present within the tissue (4).
In inflammatory processes, macrophage exposure to bacterial
lipopolysaccharide (LPS) or cytokines such as tumor necrosis factor Whether an acidic environment beside LPS and cytokines contributes to
the regulation of iNOS in inflammatory processes has not been
investigated. Thus, the experiments reported here were performed to
investigate if a low environmental pH was able to activate iNOS in
macrophages and, if so, to examine the signal transduction pathway
involved. Our results provide the first evidence that, indeed, limited
acidification of macrophage environment is sufficient to induce the
expression of iNOS gene and the synthesis of NO. This effect is due to
increased translocation of NF- Cell Isolation and Culture--
Resident macrophages were
obtained from male Sprague-Dawley rats by peritoneal lavage with MEM
(Life Technologies, Inc., Cergy Pontoise, France). Peritoneal cells
were washed by centrifugation and then resuspended in MEM containing 2 mM L-glutamine, 100 units/ml penicillin, and
100 µg/ml streptomycin and supplemented with 10% FCS. Cells were
plated either in 24-well culture plates (Costar, Cambridge, MA)
(106 cells in 0.5 ml/well) or in 60-mm Petri dishes (Nunc,
Roskilde, Denmark) (107 cells in 5 ml). After a 2-h
incubation at 37 °C in a 5% CO2, 95% air atmosphere,
the nonadherent cells were removed by aspiration, and the macrophage
monolayers were then overlaid with MEM supplemented with 1% FCS and
adjusted by addition of HCl to pH ranging between 7.4 and 6.8. The pH
of the culture medium was checked just before use. In addition, and
when so indicated, culture media were supplemented with
5-(N,N-hexamethylene) amiloride (HMA, LC
Services, Woburn, MA), monensin, actinomycin D,
5,6-dichloro-1-
Low Environmental pH Is Responsible for the Induction of
Nitric-oxide Synthase in Macrophages
EVIDENCE FOR INVOLVEMENT OF NUCLEAR FACTOR-
B
ACTIVATION*
,
,
,
,
,
¶
INSERM U. 64, Hôpital Tenon,
75020 Paris and § INSERM U. 402, Hôpital
Saint-Antoine, 75012 Paris, France
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B (NF-
B) transcription
factor since exposure of macrophages to low environmental pH both
increased NF-
B binding activity in the nucleus and enhanced
NF-
B-driven reporter gene expression. In addition, treatment of
macrophages with pyrrolidine dithiocarbamate or
n-acetyl-leucinyl-leucinyl-norleucinal, two drugs
preventing NF-
B translocation to the nucleus, canceled low
pH-induced nitrite accumulation. The overall mechanism required the
synthesis of tumor necrosis factor
(TNF
). Indeed, 1) elevated
TNF
bioactivity was observed in the medium of macrophages exposed to
pH 7.0, and 2) incubation of macrophages with a neutralizing
anti-TNF
antibody impaired both NF-
B activation and nitrite
accumulation in response to acid challenge. In summary, exposure of
macrophages to acidic microenvironment in inflammatory lesions leads to
the up-regulation of iNOS activity through the activation of
NF-
B.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
(TNF
) and interferon-
(IFN-
) causes the expression of the
inducible isoform of NO synthase (NOS II or iNOS) that is responsible
for high output production of NO (5). The expression of iNOS is
regulated mainly at the transcriptional level. Analyses of the murine
iNOS promoter have shown the presence of numerous consensus sequences
for the binding of transcription factors (6, 7), of which nuclear
factor-
B (NF-
B) (8), interferon regulatory factor-1 (IRF-1) (9),
and signal transducer and activator of transcription (STAT) 1
(10)
are functionally important for iNOS induction. NF-
B is composed of a
p50/p65 (or p50/RelA) heterodimer that is retained in the cytoplasm of
macrophages by its binding to the inhibitory protein I
B
(11). Macrophage exposure to LPS or TNF
results in the rapid
phosphorylation of I
B
and its degradation by the proteasome,
allowing NF-
B to translocate to the nucleus and promote iNOS gene
transcription.
B to the nucleus. Additionally, our
data show that an amplification loop involving TNF
production and
NF-
B activation is required for this process.
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-D-ribofuranosyl benzimidazole (DRB),
pyrrolidine dithiocarbamate (PDTC), or
n-acetyl-leucinyl-leucinyl-norleucinal (nor-LEU) (all from
Sigma) or anti-murine TNF
neutralizing antibody (106
neutralizing units/ml; Genzyme, Cambridge, MA). At indicated times,
cell-free culture supernatants were harvested and assayed for nitrite
concentration. Adherent cells were used for nucleus or RNA
extraction.
Determination of Intracellular pH in Macrophages-- Macrophages at 107 cells/ml were washed twice with MEM and loaded with the acetoxymethyl ester of 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF, Sigma) at 10 µM by incubation at 37 °C for 10 min. Cells were washed twice, and the cell suspension was immediately analyzed in a Perkin-Elmer model LS-5 spectrofluorometer for the fluorescence of BCECF. The sample was alternately excited at 450 and 500 nm, and the emission was measured at 530 nm using 2.5-nm slits. At the end of each experimental procedure, the cells were permeabilized with 0.05% (v/v) Triton X-100, and aliquots of the suspension were titrated with 1 N HCl and 1 N NaOH to establish the fluorescence at known pH values. Calibration curves of fluorescence versus pH were obtained as described previously (12).
Determination of iNOS Activity-- Inducible NOS activity was assayed indirectly by measuring nitrite production. Nitrite was measured by a colorimetric assay based on the Griess reaction, as described previously (13). Briefly, 75-µl aliquots of macrophage-conditioned medium were incubated with 150-µl aliquots of Griess reagent (1% sulfanilamide, 0.1% naphthylethylenediamine dihydrochloride, 2.5% H3PO4). The absorbance was read at 540 nm after 15 min. Nitrite concentration was determined with reference to a standard curve by using concentrations from 1.5 to 50 µM sodium nitrite in culture media.
Semi-quantitative RT-PCR and Analysis of PCR Products-- Total RNA was isolated using a commercially available kit (Trizol reagent, Life Technologies, Inc.) according to the manufacturer's instructions. One µg of total RNA was reverse-transcribed to cDNA by using Moloney murine leukemia virus-reverse transcriptase (200 units/µl; Life Technologies, Inc.). Reverse-transcribed samples were analyzed for iNOS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific cDNA by PCR amplification. Specific primers for iNOS and GAPDH were as follows: CACAAGGCCACATCGGATTTC (sense) and TGCATACCACTTCAACCCGAG (antisense); TCCCTCAAGATTGTCAGCAA (sense) and AGATCCACAA CGGATACATT (antisense), respectively (14). PCR was performed in a 50-µl reaction volume containing Taq polymerase buffer, deoxynucleotide mixture (0.2 mM each), MgCl2 (1.5 mM), Taq DNA polymerase (2.5 units) (Promega, Southampton, UK), oligonucleotide primers (0.5 µM each), and reverse-transcribed RNA. Complementary DNA was amplified in a temperature cycler as follows: 4 min at 94 °C, and 30-32 cycles of 30 s at 94 °C, 1 min at 55 °C, and 2 min at 72 °C, with a final extension step of 10 min at 72 °C. Thirty and 32 PCR cycles were found in the exponential phase of PCR amplification of GAPDH and iNOS cDNA, respectively. Ten-µl samples of PCR products were analyzed on 1.7% agarose gels containing 0.2 µg/ml ethidium bromide. Densitometry of the bands was performed on the gels using an Imager scanner (Appligene, Illkirch, France) and NIH image densitometry software (version 1.44).
Enzyme-linked Immunosorbent Assay-PCR-- Quantitative PCR amplification was carried out with a pair of primers of which one was biotinylated (15). Specific primers for iNOS and GAPDH were GGAGCTGTAGCACTGCATCAGAA (sense), AGACCTCTGGATCTTGACCGTGA (antisense), and GGTGAAGGTCGGTGTCAACGGA (sense), GCGGGATCGCGCTCCTGGAAGA (antisense), respectively. PCR was performed in a 50-µl reaction volume containing Taq polymerase buffer, deoxynucleotide mixture (0.2 mM each), MgCl2 (1.5 mM), Taq DNA polymerase (1.25 units) (Promega) preincubated with Taq Start antibody (0.125 µl) (CLONTECH, Palo Alto, CA), oligonucleotide primers (0.25 µM each), and reverse-transcribed RNA. Temperature was initially at 94 °C for 4 min, followed by cycles at 94 °C for 20 s, 60 °C for 40 s, and 72 °C for 40 s. At sequential cycle numbers, 5 µl of the reaction mixture was taken through oil and transferred onto avidin-coated microtiter plates for quantification of the amplified products by hybridization with a fluorescein isothiocyanate-labeled internal oligonucleo tide probe. Specific probes for iNOS and GAPH were CGCTTCGATGTGCTGCCT and AGAAGGCAGCCCTGGTGA, respectively. The amount of probe was then measured by an alkaline-phosphatase coupled anti-fluorescein isothiocyanate antibody (16).
Electrophoretic Mobility Shift Assay (EMSA)--
Nuclear
extracts were prepared from adherent macrophages by the method
previously described (17) and were stored at
80 °C until analysis.
Protein was determined by using the Bio-Rad reagent according to the
manufacturer's instructions. Where indicated, nuclear extracts were
incubated for 30 min at 4 °C with polyclonal antibodies against p50
or RelA subunits of NF-
B (Santa Cruz Biotechnology, Santa Cruz, CA),
before the binding reaction. The double-stranded NF-
B site probe:
5'-AGCTTCAGAGGGGACTTTCCGAGAGG-3'; 3'-AGTCTCCCCTGAAAGGCTCTCCA GCT-5' (18), double-stranded IFN regulatory factor element
(IRF-E) probe: 5'-CACTGTCAATATTTCAC-3';
3'-GACAGTTATAAAGTGAAAGTATTA-5' (9), double-stranded
-activated
site (GAS) probe: 5'-TGTTTGTTCCTTTTCCCCTAACA-3'; 3'-GGAAAAGGGGATTGTGAC-5' (9) and double-stranded activator protein 1 (AP-1) site probe: 5'-AGCTAGGTGACTCACCAAGCT-3';
3'-TCCACTGAGTGG TTCGAAGCT-5' (19) were annealed and labeled
using a commercially available kit (Rediprime DNA labeling system,
Amersham Corp., Buckinghamshire, UK) in the presence of 50 µCi of
[
-32P]dCTP (10 mCi/ml, Amersham Corp.). Unincorporated
nucleotides were removed by passage through Nuctrap purification
columns (Stratagene, La Jolla, CA). Binding reactions were carried out
in a 20-µl binding reaction mixture (10 mM Tris-HCl, pH
7.5, 50 mM NaCl, 0.5 mM dithiothreitol, 10%
glycerol, 0.2% Nonidet P-40, and 3 µg of poly(dI-dC)) containing 5-10 µg of nuclear proteins and the DNA probe (40,000-200,000 cpm).
In some experiments, the binding reaction mixture also contained a
large excess of unlabeled oligonucleotides. Samples were incubated at
room temperature for 25 min and fractionated by electrophoresis on a
7% non-denaturing polyacrylamide gel in TAE buffer (7 mM Tris, pH 7.5, 3 mM sodium acetate, 1 mM EDTA),
which had been pre-electrophoresed for 1 h at 80 V. Gels were run
at 160 V for 2.5 h. Following electrophoresis, gels were
transferred to No. 3MM paper (Whatman Ltd.), dried in a gel dryer under
vacuum at 80 °C, and exposed to x-ray Hyperfilm-MP at
20 °C
using an intensifying screen.
Transient Transfection of RAW 264.7 Cells and Luciferase
Assay--
RAW 264.7 cells were transfected with (Ig
)3-conaluc, a
reporter plasmid that contains three copies of the immunoglobulin
chain enhancer
B site upstream of the minimal conalbumin promoter fused to the luciferase reporter gene (generous gift from Dr. A. Israel, Institut Pasteur, Paris, France), using the DEAE-dextran procedure (6, 20). Briefly, after cells were washed with Tris-buffered
saline solution, 10 µg of plasmid was added per 107 cells
in 1 ml of warm Tris-buffered saline solution containing 250 µg of
DEAE-dextran. The cells were incubated at 37 °C for 1 h
followed by a 2-min shock with 10% Me2SO at room
temperature. The cells were washed twice, plated in 35-mm plates at
2.5 × 106 cells/ml in 2 ml of DMEM supplemented with
10% FCS at 37 °C in 5% CO2. Twenty-four h later, the
medium was replaced with DMEM supplemented with 1% FCS and adjusted at
different pH, and the cells were incubated for additional 2 h. The
cells were then washed, exposed for 15 min to chilled lysis buffer (25 mM Tris, pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 1% Triton X-100, and 15% glycerol), and scraped. The lysates were centrifuged at 13,000 × g for 10 min. Luciferase activity was assayed
in lysis buffer containing 50 mM ATP and 100 µM luciferin, using a Lumat LB 9507 luminometer (Berthold
Bad Wildbad, Germany) (17).
Determination of TNF
Production--
The concentration of
bioactive TNF
in the culture medium of macrophages was measured by a
L-929 fibroblast lytic assay, as described previously (21). Results
were expressed as percent cytotoxicity.
Statistics-- Results are presented as the mean ± S.E. Statistical significance (p < 0.05) was determined by Student's t test.
| |
RESULTS |
|---|
|
|
|---|
Macrophages Exposed to Low Environmental pH Demonstrate Increased iNOS Activity-- Substitution of the medium of adherent macrophages with media at different pH modified iNOS activity as reflected by changes in nitrite accumulation; as the environmental pH became more acidic, more nitrite was detected in the culture media (Fig. 1). Its amount plateaued at pH 6.9-7.0. Because modification of the microenvironmental pH generally induces parallel modification of the steady-state intracellular pH (22), involvement of intracellular acidification in this process was tested. First, intracellular pH decreased from 7.04 ± 0.03 to 6.77 ± 0.01 after lowering environmental pH from 7.4 to 6.9-7.0, as measured fluorimetrically with the H+ indicator dye BCECF. Second, pharmacological control of the Na+/H+ antiport, which exchanges extracellular Na+ for intracellular H+, caused measurable changes in NO synthesis. As indicated in Fig. 2, the addition of the amiloride analog HMA, a Na+/H+ exchange inhibitor which decreases intracellular pH (23), caused a dose-dependent increase in nitrite accumulation. Conversely, the addition of monensin, a Na+ ionophore mimicking the effects of the antiporter activation (24), caused a dose-dependent decrease in nitrite accumulation. These results suggested that intracellular acidification was sufficient to trigger NO synthesis.
|
|
|
Low Environmental pH Response Is Due to the Activation of
NF-
B--
The 5'-flanking region of mouse iNOS gene contains
numerous consensus sequences for the binding of transcription factors, including NF-
B, IRF-1, STAT 1
, and AP-1 (6, 7). Therefore, it is
possible that low environmental pH stimulates iNOS gene transcription
by modulating the activity of some of these factors. To test the above
hypothesis, the effect of extracellular pH on the DNA binding activity
of these transcription factors was measured by EMSA. Nuclear extracts
from control macrophages cultured at neutral environmental pH exhibited
weak DNA binding activity to the NF-
B site-containing
oligonucleotide (Fig. 4A). As
the environmental pH became more acidic, more binding activity of
NF-
B was detected. At pH 7.0, NF-
B activation was similar to that
promoted by LPS challenge. By contrast, acidic pH did not affect DNA
binding activity of IRF-1, STAT 1
, or AP-1, whereas LPS was
stimulatory (Fig. 4B).
|
B binding sites (Fig.
4A). We further characterized the two NF-
B·DNA
complexes by using antibodies directed against the p50 and RelA NF-
B
subunits (Fig. 4A). Incubation of macrophage nuclear
extracts with the anti-p50 antibody reduced the density of both bands
with a concomitant supershift suggesting the presence of p50 in the two
complexes. The anti-RelA antibody suppressed the upper band suggesting
the presence of RelA. Thus we identified the lower and upper complexes as the p50 homodimer and the p50/RelA heterodimer, respectively.
To test whether low extracellular pH enhanced NF-
B-driven reporter
gene expression, RAW 264.7 cells were transfected transiently with
(Ig
)3-conaluc, a reporter plasmid in which the activity of the
minimal conalbumin promoter could be enhanced by three copies of the
NF-
B response element (17). Luciferase activity from such
transfected cells after exposure to media at different pH is shown in
Fig. 5; low pH stimulation of luciferase
activity was analogous to that of nitrite accumulation under the same
conditions.
|
B in low pH-induced iNOS up-regulation was
investigated using two inhibitors of NF-
B activation in macrophages
as follows: the thiol compound PDTC, a radical scavenger (26), and the
peptide aldehyde nor-LEU, a proteasome inhibitor (27). Addition of
either drug blunted the macrophage response to low environmental pH
(Fig. 6).
|
Low Environmental pH-induced NF-
B Activation Requires the
Autocrine Production of TNF
--
Because NF-
B initiates the
transcription of a variety of genes that are all involved in
inflammatory processes, it is likely that low environmental pH-induced
NF-
B activation amplifies the synthesis of pro-inflammatory
cytokines beside that of iNOS. To address this issue, the capacity of
macrophages exposed to acidic pH to release bioactive TNF
was
determined. Fig. 7 shows that a decrease
in environmental pH from 7.4 to 7.0 caused a 1.8-fold increase in
TNF
release. PDTC blunted this response. We next evaluated whether
the rise of TNF
level in the culture medium of macrophages was
involved in the observed increase in nitrite accumulation. To this end,
a neutralizing anti-TNF
antibody diluted at 1/100 was added to the
culture medium. This concentration was sufficient to totally inactivate
the TNF
released by macrophages (data not shown). Anti-TNF
both
prevented the activation of NF-
B and suppressed the accumulation of
nitrites (Fig. 8), indicating that an
autocrine loop involving TNF
induction of NF-
B was responsible for the induction of iNOS by low environmental pH.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Our results provide evidence that low environmental pH stimulates NO synthesis by macrophages and, more specifically, up-regulates iNOS mRNA expression. These responses were observed for a range of extracellular pH values occurring in inflammatory lesions (2). The decrease in intracellular pH in macrophages exposed to low environmental pH and the increase in nitrite accumulation in the culture medium of macrophages treated by the amiloride analog HMA indicate that acidic intracellular pH is involved in triggering NO synthesis. Since NO has been shown to impair intracellular pH recovery in macrophages following acid loading (28), an amplification loop involving low pH induction of NO synthesis is likely in these cells.
The mechanisms responsible for low pH-induced NO synthesis are potentially numerous. First, changes in pH might affect the activity of the enzyme iNOS. Indeed, in vitro analysis has shown that iNOS activity was pH-dependent (29). However, the optimum activity was reached at pH 8.0, whereas reduced activity occurred at acidic pH. Second, a low environmental pH might influence the availability of substrates such as L-arginine and cofactors necessary for NO production. However, L-arginine and its precursor, L-citrulline, are transported by pH-insensitive specific carriers (30). In fact, the main rate-limiting step for NO production by macrophages in low environmental pH is transcriptional since DRB blunted this response. The possibility that pH controls the transcription of genes has been demonstrated previously. For instance, Yamaji et al. (31) reported that exposure of epithelial cells from mouse proximal tubule to an acid environment led to transcriptional activation of immediate early genes such as c-fos and c-jun. Similarly, an acute decrease in extracellular pH from 7.4 to 6.9 caused a marked increase in the expression of mRNA for phosphoenolpyruvate carboxykinase in epithelial cells from pig proximal tubule (32).
Transcription factors such as NF-
B (8), IRF-1 (9, 33), and STAT 1
(10) underlie the synergistic activation of the promoter of the murine
iNOS gene in response to LPS and IFN-
. Thus, we directly assessed
the ability of environmental pH to control the induction or the
activation of these factors. By using an EMSA we observed that low
environmental pH increased the DNA binding activity of NF-
B. The
stimulatory effect was specific for NF-
B since the DNA binding
activity of IRF-1 and STAT 1
was not modified under these
conditions. Dose-response experiments indicated a biphasic effect. A
slightly acidic environment (7.2 to 6.9) amplified NF-
B activation
(Fig. 4A), whereas a more acidic environment (below 6.9)
reduced NF-
B activation (data not shown). The inhibitory effect of
marked acidosis on NF-
B activation has already been demonstrated
(34). Taken together, these results suggest that weak acidosis in
settling inflammation may amplify NF-
B-dependent iNOS
expression, resulting in a more efficient defense against bacteria.
Once acid generation is high, protons may limit the induction of iNOS
and prevent its toxicity toward the surrounding tissue.
The mechanisms whereby low environmental pH increases NF-kB activation
may include up-regulation of NF-
B synthesis and/or down-regulation
of NF-
B degradation and/or reduction of NF-
B binding to cytosolic
I
B. Acidic pH could potentially alter the linkage between NF-
B
and I
B without modifying I
B phosphorylation or degradation (11).
However, the fact that the low environmental pH responses could be
abrogated by addition of PDTC or nor-LEU is consistent with the
involvement of I
B degradation. Indeed, both drugs prevent I
B
inactivation as follows: PDTC, as other antioxidants, limits I
B
phosphorylation and nor-LEU, as other proteasome inhibitors, inhibits
I
B degradation but not phosphorylation (27). Furthermore, the
results of experiments with nor-LEU suggest that low environmental pH
induces NF-
B activation by promoting I
B degradation via the
ubiquitin-proteasome pathway. Our study did not address the
relationship between environmental pH and expression of proteins
involved in this pathway. However, Bailey et al. (35)
recently reported that acidosis in chronic renal failure stimulated
muscle proteolysis by activating the
ATP-ubiquitin-proteasome-dependent pathway. This response
included increased transcription of genes encoding ubiquitin and
proteasome subunits C3 and C9. Thus, further studies would be required
to determine whether low environmental pH induces NF-
B activation in
macrophages by these mechanisms.
In addition, a possibility to explain the in vivo effect of
low pH on the transcription step is that acidosis could directly affect
the binding of NF-
B subunits to DNA. However, this is unlikely.
Indeed, studies by Zabel et al. (18) have demonstrated that
NF-
B could form a complex with DNA within a large pH range, the
highest amount of protein-DNA complex being formed at the physiological
pH of 7.5.
The NF-
B transcription factor regulates the transcription of a great
variety of genes that are involved in inflammatory responses. They
include genes coding for cytokines such as IFN-
, interleukin-1, -2, -6, and -8, granulocyte/macrophage or granulocyte colony-stimulating factor, TNF
, as well as genes coding for acute phase response proteins and cell adhesion molecules (reviewed in Ref. 36). One could
speculate that transcription of these genes might be similarly
susceptible to induction by low environmental pH. Accordingly, acidosis
was found to potentiate TNF
synthesis by macrophages (Fig. 7). We
addressed the issue of whether low environmental pH-induced TNF
synthesis was in turn responsible for NO synthesis by using a
neutralizing antibody specific for TNF
(Fig. 8). This antibody
blunted both NF-
B activation and nitrite accumulation. Thus, TNF
appears to be involved in NF-
B activation which eventually leads to
iNOS gene transcription. A similar amplification loop involving TNF
induction of NF-
B has been already described. For instance,
O'Connell et al. (37) demonstrated that the proliferation rate of cells derived from a Sezary lymphoma was stimulated by the
autocrine production of TNF
. This response resulted from the
activation of NF-
B which also led to further TNF
production.
In summary, in addition to hypoxia (38), LPS, and cytokines (5), low
environmental pH causes amplification of NO synthesis in inflammatory
tissues. Evidence that this up-regulation is mediated through the
activation of NF-
B suggests a novel mechanism whereby the nuclear
translocation of this transcription factor may be triggered. Our
studies also suggest that correction of acidosis in inflammatory
processes may have a therapeutic role by limiting the transcription of
cytokine genes with a conserved NF-
B binding site in the
promoter.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Valerie Miranda and Nelly Knobloch for secretarial assistance.
| |
FOOTNOTES |
|---|
* This work was supported by INSERM and the Faculté de Médecine Saint-Antoine.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: INSERM U.64, Hôpital Tenon, 4 rue de la Chine, 75020 Paris, France. Tel.: 33 1 40 30 79 51; Fax: 33 1 40 30 20 89; E-mail: laurent.baud{at}tnn.ap-hop-paris.fr.
1
The abbreviations used are: NO, nitric oxide;
AP-1, activator protein 1; EMSA, electrophoretic mobility shift assay;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HMA,
5-(N,N-hexamethylene) amiloride; iNOS, inducible NO
synthase; NF-
B, nuclear factor-
B; nor-LEU,
n-acetyl-leucinyl-leucinyl-norleucinal; PDTC, pyrrolidine dithiocarbamate; TNF
, tumor necrosis factor
; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; RT-PCR, reverse transcriptase-polymerase chain reaction; STAT, signal transducer and
activator of transcription; IFN, interferon; LPS, lipopolysaccharide; BCECF, 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein; MEM, minimum
Eagle's medium; IRF-1, interferon regulatory factor-1; DRB,
5,6-dichloro-1-
-D-ribofuranosyl benzimidazole.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. A. Kellum, M. Song, and E. Almasri Hyperchloremic acidosis increases circulating inflammatory molecules in experimental sepsis. Chest, October 1, 2006; 130(4): 962 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lewis and C. Murdoch Macrophage Responses to Hypoxia: Implications for Tumor Progression and Anti-Cancer Therapies Am. J. Pathol., September 1, 2005; 167(3): 627 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lang, P. Dong, E. K. Hosszu, and I. R. Doyle Effect of CO2 on LPS-induced cytokine responses in rat alveolar macrophages Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L96 - L103. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Christou, N. Bailey, M. S. Kluger, S. A. Mitsialis, and S. Kourembanas Extracellular acidosis induces heme oxygenase-1 expression in vascular smooth muscle cells Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2647 - H2652. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Regis, M. Bosticardo, L. Conti, S. De Angelis, D. Boselli, B. Tomaino, P. Bernabei, M. Giovarelli, and F. Novelli Iron regulates T-lymphocyte sensitivity to the IFN-{gamma}/STAT1 signaling pathway in vitro and in vivo Blood, April 15, 2005; 105(8): 3214 - 3221. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kato, C. A. Lambert, A. C. Colige, P. Mineur, A. Noel, F. Frankenne, J.-M. Foidart, M. Baba, R.-I. Hata, K. Miyazaki, et al. Acidic Extracellular pH Induces Matrix Metalloproteinase-9 Expression in Mouse Metastatic Melanoma Cells through the Phospholipase D-Mitogen-activated Protein Kinase Signaling J. Biol. Chem., March 25, 2005; 280(12): 10938 - 10944. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Lang, M. Figueroa, K. D. Sanders, M. Aslan, Y. Liu, P. Chumley, and B. A. Freeman Hypercapnia via Reduced Rate and Tidal Volume Contributes to Lipopolysaccharide-induced Lung Injury Am. J. Respir. Crit. Care Med., January 15, 2005; 171(2): 147 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |