![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 9, 5174-5183, February 27, 1998
From the Department of Pharmacology, Medical Science Center,
University of Wisconsin, Madison, Wisconsin 53706
Transcriptional activation of the
Cyp1B1 gene in rodents is stimulated by both polycyclic
hydrocarbons and cAMP. The mouse Cyp1B1 gene structure
contains three exons, of which the second nucleotide of exon 2 is the
translation start site. Primer extension analysis identified a
transcription start domain defining an exon 1 of 371 base pairs. The
sequence 1.075 kilobases upstream of the transcription start site
showed 11 xenobiotic-responsive elements (XRE) (TnGCGTG or
GCGTG) that are putative aryl hydrocarbon receptor (AhR)-binding sites
and three steroidogenic factor-1 motifs that are associated with
cAMP-mediated transcriptional activation of genes. A transiently
transfected Cyp1B1-luciferase construct, composed of exon 1 and 1.075 kilobases of 5'-flanking region, was induced by
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; 10.0 ± 3.0-fold, n = 6) in C3H10T1/2 cells, which exclusively express Cyp1B1. The 90-base pair basal promoter contains
two SP-1 sites, one SF-1 site, and a TATA-like box. TCDD induction and basal expression were dependent on positive regulatory elements present
between Cytochrome Cyp1B1 gene expression in rodents and humans
is inducible both through activation of the
AhR1 by TCDD and by a
cAMP-mediated pathway (1-7). This work has also shown that CYP1B1 is
one of the largest known P450 cytochromes (543 amino acids) that is
translated from an exceptionally large 5.2-kb mRNA, most of which
is contributed by a 3.1-kb 3'-untranslated region. Nevertheless, the
structure of the human CYP1B1 gene is uniquely compact
compared with other mammalian cytochrome P450 genes as evidenced by the
presence of only three exons, the first of which is untranslated
(8).
In addition to these unusual sequence characteristics,
Cyp1B1 exhibits an exceptional pattern of tissue expression.
Constitutive CYP1B1 and chemically induced transcription linked to the
AhR are seen in stromal fibroblasts isolated from rodent embryos (1, 9,
10) and from endocrine-regulated tissues such as mammary gland (11),
uterus, and prostate, where Cyp1A1 is very poorly expressed
(1, 4, 7). Cyp1B1 is also expressed constitutively in rodent
steroidogenic tissues and is stimulated by hormones that typically
elevate cAMP levels in these cells (4, 6). For many rodent tissues
(lung, liver, and kidney), there is essentially no constitutive CYP1B1,
and elevated expression is only seen after administration of AhR
agonists. However, this induction through the AhR is 30-40 times less
effective than for Cyp1A1 (1, 4). For rat mammary cells,
cell culture conditions greatly affect Cyp1B1 expression. In
culture, Cyp1B1 is preferentially expressed in stromal
fibroblasts and partly in epithelia, whereas Cyp1A1 is seen
predominantly in epithelia (11); however, Cyp1B1 is expressed constitutively in ductal epithelia in
vivo.2 For human cells,
CYP1B1 is again expressed in fibroblasts in preference to
CYP1A1 and is coexpressed with CYP1A1 in selected epithelial cell types. Skin and mammary cells coexpress
CYP1A1 and CYP1B1 following TCDD induction, but
only Cyp1B1 is seen constitutively in these cells (11,
12).
The AhR mediates gene transcription by forming a nuclear heterodimer
with the related helix-loop-helix protein AhR nuclear translocator
(Arnt) (13-15). The formation of this complex is stimulated by binding
of agonists such as TCDD and polycyclic aromatic hydrocarbons to the
AhR, which then dissociates from the associated cytosolic partners such
as HSP90 (16). The mechanism by which the AhR·Arnt complex stimulates
transcription has been extensively dissected through analysis of the
Cyp1A1 5'-flanking region (17). The AhR·Arnt heterodimer
preferentially selects the core TnGCGTG sequence from random
combinations of oligonucleotide heptamers, but less strictly requires
the starting T in the sequence context provided by certain genes (18).
Most AhR-responsive genes contain multiple copies of such
xenobiotic-responsive elements (XREs), and typical of enhancer
elements, the response is increased by repetition of the elements and
is independent of the orientation (19-21). In vivo DNA
footprinting of the Cyp1A1 upstream region suggests that
activation of an upstream XRE may open up the downstream region for
binding by other nuclear regulatory complexes (13, 22). The enhancer
activity of XREs in the Cyp1A1 promoter is increased by the
presence of adjacent GC-rich elements (23). Thus, an additional set of
proteins may work in cooperation with the AhR·Arnt complex to
transfer a signal to the transcriptional machinery (13, 17). The AhR
protein sequence has also been dissected by mutagenesis in transfection
assays to establish the presence of trans-acting domains in
the C-terminal part of the protein (24). The participation of labile
repressor proteins has been indicated by cycloheximide treatment, which
produces a stimulatory effect on Cyp1A1 transcription. This
effect is attributed to removal of labile repressor proteins that bind
close to certain XREs (25). Distinct elements also provide additional
negative trans-acting effects that may be specific to the
cell type or growth state of the cells (26, 27).
The results presented here show an extensive analysis of the mouse
Cyp1B1 gene, including its 5'-regulatory region and
transcription start site in embryo fibroblasts. This work establishes
that several of the features of the Cyp1A1 5'-flanking
region are repeated in the upstream region of the mouse
Cyp1B1 gene, particularly a similar enhancer region that
directs AhR-mediated transcriptional activation. This report also
describes several important differences in the regulation of basal
transcription that may account for the different expression pattern
seen for Cyp1B1 mRNA. Most notably, we demonstrate for
the first time a mechanism for involvement of the AhR in basal
expression of a gene in addition to TCDD induction and a novel protein
complex formed at a pair of enhancer XREs.
Isolation of Cyp1B1 Genomic Clones--
A 129SV mouse liver
genomic library contained within the Lambda Fix II phage (Stratagene)
was screened using a SmaI restriction fragment of the mouse
cDNA (1). This 1028-base pair probe encompasses 175 bp upstream of
the initiation ATG codon that encodes the first methionine and 853 bp
downstream. Two genomic clones (clones 8 and 10) were enriched to
homogeneity by repeated rescreening at lower densities, and
Characterization of the Mouse Cyp1B1 Gene
IDENTIFICATION OF AN ENHANCER REGION THAT DIRECTS ARYL
HYDROCARBON RECEPTOR-MEDIATED CONSTITUTIVE AND INDUCED EXPRESSION*
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
1075 and
810. Five XRE motifs localized in the enhancer
region were completely conserved between mouse and human CYP1B1 sequences. Similar inductions were seen in Hepa-1
cells, which express Cyp1A1 but not Cyp1B1.
However, basal Cyp1B1 promoter activities were 4-10-fold
higher in C3H10T1/2 cells providing the enhancer region was present,
partially reproducing the in vivo cell-specific expression
of Cyp1B1. Gel shift experiments established that TCDD
stimulates AhR binding to the downstream XRE in the enhancer region.
However, oligonucleotides that encompass two other XREs show a high
affinity complex of similar size that is evident even without TCDD
treatment and that does not contain either the AhR or AhR nuclear
translocator. The fourth XRE is immediately adjacent to an E-box, and
this oligonucleotide formed a smaller complex that was dependent on
this E-box sequence. Negative regulatory sequences have been located
between the promoter and TCDD-responsive enhancer regions. Constitutive
expression of the Cyp1B1 gene was lost in AhR-deficient
cells and was restored by transfected AhR cDNA. Reporter constructs
function in a parallel manner, demonstrating the key role of the AhR in
constitutive as well as TCDD-induced expression of Cyp1B1
in mouse embryo fibroblasts.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-DNA was
purified at a high multiplicity of infection according to standard
protocols (28). SalI restriction digestion of clone 8 (14.5 kb) resulted in one restriction fragment of 9.5 kb and another fragment
of 5 kb. Clone 10 revealed an ~9-kb restriction fragment and another
3-kb fragment.
DNA Sequencing--
Double-stranded DNA sequencing of the
5'-flanking region, exon 1, and intron 1 was carried out according to
the dideoxy termination method (29) using the double-stranded
template PGEM24.7 and Sequenase Version 2.0 (U. S. Biochemical
Corp.). The universal T7 and PX1-3 5'-GCT GCG ATG AAG CGT GGT
oligomers were synthesized, and end labeling was carried out using T4
kinase and [
-32P]ATP. Based on the sequence obtained
from these first reactions, synthetic primers were designed to
"walk" along this template from both the 5'-upstream and
3'-downstream regions. Exon 2, intron 2, and exon 3 sequences were
determined by the Applied Biosystems PRISM dye terminator cycle
sequencing method as described by the manufacturer. The first two
primers used for the sequences were designed according to the
Cyp1B1 cDNA sequences. The DNA sequence was analyzed
using the Genetics Computer Group sequence analysis software program
(Version 7).
Primer Extension--
C3H10T1/2 cells were cultured in
Dulbecco's modified Eagle's/F-12 medium and 10% fetal bovine serum
containing penicillin (50 units/ml). Cells were treated with TCDD (1 nM) for 2 h and harvested in phosphate-buffered
saline. Preparation of poly(A)+-enriched RNA was carried
out according to Bradley et al. (30). Primer extension was
carried out according to standard protocols (28). 3'-Downstream
[
-32P]ATP-labeled oligonucleotides (5'-GAC CTA GAC
ACC TGA GGC CCG CTG CTT TAG-3', 5'-AGC GGG ACC TTA GGG-3' and 5'-CTG
CGC GCT GGA GCA AAG CTC AAC CAG GAG-3'; 5 × 106 cpm)
were used as primers. The same labeled oligonucleotides were used as
primers for double-stranded sequencing of the Cyp1B1 genomic
DNA.
Construction of 5'- and 3'-Deletions Linked to the Luciferase
Reporter Gene--
A fragment of Cyp1B1 genomic DNA
containing exon 1 and its 5'-flanking region was amplified by PCR using
T7 and PX1-3 as the primers. The PCR products were digested with
SacI and treated with T4 DNA polymerase prior to subcloning
into the SacI and SmaI sites of the luciferase
reporter vector pGL3Basic (Promega, Madison, WI). With this procedure,
plasmids p1075/+371, p1075/+150, p1075/159, and p1075/207 were
generated. p1075/+371 contains all of exon 1 (371 bp) and 1075 bp of
5'-flanking region. The DNA fragments with which p1075/+267, p1075/+22,
and p1075/90 were constructed were generated using 5'-upstream primer
T7 and 3'-downstream primers that had a NheI restriction
site linker. The DNA fragments used to generate constructs p821/+124,
p432/+124, and p210/+124 were prepared using a 5'-upstream primer that
had a KpnI linker and 3'-downstream primers that had an
NheI linker. The native orientation of all constructs was
verified by DNA sequence analyses. A 265-bp DNA fragment (
821 to
1075) was generated by PCR using 5'-upstream primer T7 and a
3'-downstream primer (5'-CAA CGG TAC CGC CAA CAA ACG GTT GGG TTG-3')
that had a KpnI restriction site linker. The PCR products
were digested by KpnI and then subcloned into the KpnI sites of plasmid p210/+124. Both the native and reverse
orientations of the 265-bp DNA were inserted into p210/+124. p210N260
was the native orientation, and p210R260 was the reverse
orientation.
Transfection and Luciferase and
-Galactosidase
Assays--
C3H10T1/2 and Hepa-1 cells and AhR-deficient embryo
fibroblast cell lines were cultured in Dulbecco's modified
Eagle's/F-12 medium and 5% fetal bovine serum. The AhR-deficient
mouse primary embryo fibroblasts (kindly provided by Dr. P. Fernandez-Salguero, National Institutes of Health, Bethesda, MD) were
used to generate AhR-deficient embryo fibroblast cell lines
according to the method described by Reznikoff et al.
(31). All plasmids containing constructs were transfected by the
calcium phosphate coprecipitation method (32). The AhR-encoding
cDNA plasmid (pmuAhR) was kindly provided by Dr. Christopher
Bradfield (University of Wisconsin, Madison, WI). Approximately 24 h prior to transfection, cells were seeded at 5.5 × 105 in 60-mm dishes. 300 µl of transfection buffer
contained 6.5 µg of reporter recombinant plasmid and 1.5 µg of
internal reference plasmid pCH110, in which the
-galactosidase gene
is driven by the SV40 promoter. 5 h following transfection, the
cells were treated with 15% glycerol for 7 min, and then fresh medium
containing 7% fetal bovine serum was supplied again. TCDD (1 nM) was added to the induction group 24 h prior to
harvesting. Luciferase activity was determined using the luciferase
assay system (Promega) according to the manufacturer's instructions
and immediately measured in a luminometer. The
-galactosidase assay
was carried out in a total volume of 250 µl of assay buffer
containing 0.12 M Na2HPO4, 0.08 M NaH2PO4, 0.02 M KCl,
0.002 M MgCl2, 0.1 M
-mercaptoethanol, 50 µg of
o-nitrophenyl-
-galactoside, and 100 µg of cell
extract.
Mobility Shift Assay--
Nuclear extracts were prepared from
control and TCDD-induced (1 nM/2 h) C3H10T1/2 cells, and
mobility shift DNA-binding protein assays were carried out as described
(33). The oligonucleotides were labeled with [
-32P]ATP
using T4 polynucleotide kinase. 10 µg of the nuclear protein and
10,000 cpm of probe were used in each reaction in the experiments. Competition experiments were conducted by co-incubation with 10, 50, and 200-fold excesses of unlabeled competitors. The sequence of
Cyp1A1 DXE1 is GATCTACGGCTCCCCTCCCCCAGCTAGCG (positions
1109 to
1085). The rest of the oligonucleotide sequences are
shown in Table I.
| |
RESULTS |
|---|
|
|
|---|
Mouse Cyp1B1 Gene Structure and Identification of the Transcription Start Site-- Restriction endonuclease analysis of a 14.5-kb mouse genomic clone has established a map of the exon/intron distribution and their representation within this genomic clone. Hybridization of these restriction fragments with probes specific for exons 2 and 3 has defined the positions of these exons. A complete DNA sequence analysis was carried out using the genomic clone as the template to encompass all sequences found in the 4.9-kb cDNA, 2.967-kb intron sequences, and 1.1 kb of upstream sequence. Comparison of the sequence obtained from the genomic clone with the cDNA sequence established that the gene includes sequences identical to those found in the cDNA and thus has allowed us to determine the mouse Cyp1B1 gene structure. A diagram summarizing the mouse Cyp1B1 gene structure is presented in Fig. 1A. The mouse Cyp1B1 gene exhibits three exons. Introns 1 and 2 are composed of 0.376 and 2.591 kb, respectively. Exon 1 is composed of 0.371 kb. The open reading frame (1.63 kb) is encoded by exon 2 (starting at the second nucleotide; 1.042 kb) and 16% of exon 3 (3.78 kb). The intron 1/exon 2 and intron 2/exon 3 junction sites obey the GT/AG rule (Fig. 1B), characteristic of exon/intron junction sites (34).
|
Location of Putative cis-Acting Elements--
Fig.
2 shows the 5'-flanking region of
Cyp1B1; 26 bp upstream of the start site, there is a TATA
box-like sequence (TTAAAA), and 13 bp farther upstream, there is a
steroidogenic factor-1 (SF-1) motif (TCCAGT). This transcription factor
is selectively expressed in steroidogenic cells and interacts with
shared promoter elements in several steroidogenic P450 genes to
increase expression in response to cAMP elevation (35). Two SP-1 sites,
implicated in the constitutive expression of P450 genes (21) and
separated by an XRE, are located 65-87 nucleotides upstream of the
initiation start site. The experiments described below show that this
90-base (
1 to
90) region is necessary to confer full basal promoter activity to the Cyp1B1 gene. DNA sequencing also revealed 11 putative XREs (TnGCGTG or GCGTG), five of which are located
between
820 and
1075. We will demonstrate later that this
265-bp segment is the primary region for TCDD-mediated induction of the
Cyp1B1 gene. Two other XREs are located in the proximal
promoter region and immediately on the 3'-side of the transcription
start site, respectively. The remaining four XREs are located in the
region between the proximal promoter and the TCDD enhancer region. The 5'-flanking region also contains multiple GC-rich sequences in proximity to XREs (not highlighted in Fig. 2) that resemble DXEs, shown
to be critical for TCDD induction (36). In addition, we found five
E-box elements, implicated in the binding of helix-loop-helix Arnt
nuclear regulatory factor (37), and two further SF-1 motifs. One E-box,
one SF-1 site, and four DXEs are located in the TCDD enhancer region.
The noncoding exon 1 exhibited two E-box elements and one XRE.
|
Upstream cis-Acting Regulatory Elements Involved in TCDD
Induction--
To identify cis-acting elements involved in
regulation of the mouse Cyp1B1 gene, a set of
Cyp1B1-luciferase reporter plasmids were transfected into
two mouse cell lines (C3H10T1/2 and Hepa-1) that differ in their
expression of Cyp1B1. C3H10T1/2 cells are mouse stromal
fibroblasts that predominantly express Cyp1B1, and Hepa-1
cells are mouse hepatoma cells that preferentially express Cyp1A1. 3'-End deletion of 578 nucleotides (from +371 to
207) did not significantly change the TCDD-induced activity of
luciferase in either cell line (Fig.
3A). By contrast, a
5'-deletion of 265 bp (from
1075 to
821) completely removed TCDD
induction in both cell lines (Fig.
3).4 The data suggest that
TCDD induction is primarily dependent on positive regulatory elements
present between
821 and
1075, where five XREs are localized. Other
more proximal XREs play, at most, a secondary role in TCDD induction.
Further 5'-deletion of 611 nucleotides (from
821 to
210) did not
result in any change in TCDD-induced luciferase activity (Fig.
3B). Although induction factors varied up to 3-fold between
separate cultures, analysis of transfections in transfection
experiments with different batches of cells showed that the most active
Cyp1B1-luciferase plasmid (p1075/+150) was equally inducible
in both C3H10T1/2 (10.0 ± 3.0-fold) and Hepa-1 cells (9.34 ± 3.4-fold) (Fig. 3C).
|
210 to +124) in either the native or reverse orientation. In both
cell lines, TCDD induction with the p210N265 construct was increased to
well above the levels seen for the complete p1075/+150 construct and
was not much affected when the enhancer was placed in the reverse
orientation (Fig. 3B).
Upstream cis-Acting Regulatory Elements Involved in Constitutive
Expression--
Basal promoter activities (Fig.
4, A and B) were
increased in both cell lines ~3-fold by deletion of the exon 1 sequence +267 to +150, indicating the presence of negative regulation
through effects on either promoter activity or mRNA stability.
Deletion of sequence +22 to
90 removed 85% of the basal promoter
activity (Fig. 4, A and B), whereas TCDD
induction was retained (Fig. 3A). This is fully consistent
with the primer extension and DNA sequence analyses, which both showed
that the sequence between +22 and
90 contains the major start site
and key elements of the mouse Cyp1B1 promoter region.
Further deletion to
207 had little additional effect on the low basal
promoter activity (Fig. 4, A and B). These results indicate that the 110-bp sequence from +20 to
90 is essential for constitutive expression. The significant promoter activity remaining after deletions to
207, particularly when enhanced 9-fold
by TCDD induction, indicates a second weak promoter region. This is
consistent with the second upstream start site indicated by the primer
extension experiments.
|
1075 to
821) caused a
substantial decrease in basal expression in both cell types (Fig. 4,
C and D) as well as prevented TCDD induction
(Fig. 3B). Further 5'-deletions from
821 to
432 and
particularly to
210 increased the basal activities without affecting
TCDD induction. These results suggest that the 265-bp enhancer region
plays an additional important role in constitutive expression and that negative regulatory elements exist in the region of
210 to
821. Evidently, nuclear factors that bind to these cis-elements
must be present in both C3H10T1/2 and Hepa-1 cells. In both cell types, the native orientation of the enhancer (210+N265) restored
basal activity to the level obtained from the parent vector
(
1075), whereas the reverse orientation
(210+R265) was substantially less effective (Fig. 4,
C and D). This contrasts with the insensitivity to orientation described for TCDD-induced activity.
The basal activity of the full-length Cyp1B1-luciferase
construct (
1075 to +371) was 4-6-fold more active than that of the control vector (pGL3Basic) in C3H10T1/2 cells, but 40% less active than that of the control vector in Hepa-1 cells (Fig. 4, A
and B). This distinction is lost when the enhancer and
inhibitory exon 1 regions are both deleted
(Cyp1B1-luciferase construct
821 to +124) (Fig. 4,
C and D). Since the inhibitory effect of exon 1 is similar for each cell type, it seems that this cell specificity for
Cyp1B1-luciferase is conferred by 10-fold lower basal
activation through the enhancer region in Hepa-1 cells relative to
C3H10T1/2 cells. This is nevertheless far less than the 100-fold
difference in Cyp1B1 mRNA expression.
A Cyp1A1-chloramphenicol acetyltransferase construct
containing 3.1 kb of 5'-flanking region was active and TCDD-inducible in C3H10T1/2 cells, although to a lesser extent than in Hepa-1 cells
(3-fold versus 50-fold) (data not shown). This again
contrasts with the difference in Cyp1A1 mRNA expression,
which was ~1000-fold. Thus, again the reporter construct does not
reproduce the cell specificity seen for P450 gene expression.
Effect of the AhR on Cyp1B1 Promoter Activity--
Using
embryos obtained from previously characterized AhR
/
mice (38), we have generated C57B6 mouse embryo fibroblast cell lines
that we have shown by immunoblotting to be completely deficient in
AhR.5 Expression of
Cyp1B1 in primary mouse embryo fibroblasts and mouse embryo
fibroblast lines developed from wild-type C57B6 mice was essentially
the same as in C3H10T1/2 cells that were derived in a similar manner
from C3H mice (39). Mouse embryo fibroblasts derived from
AhR
/
C57B6 mice were used to define the role of the AhR
in the basal expression of CYP1B1. Constitutive CYP1B1 protein
expression is undetectable in all the cultures of AhR-deficient
fibroblast cell lines (data not shown), whereas expression is normal in
equivalent lines generated from heterozygous littermates that carry a
single AhR allele that expresses AhR at wild-type levels.5
Fig. 5 shows that both basal expression
and TCDD induction of Cyp1B1 promoter activity are lost in
the AhR-deficient cells. When the cDNA encoding the AhR is
cotransfected with Cyp1B1-luciferase into the deficient
cells, the uninduced luciferase activity is increased 10-fold compared
with transfection with p1075/+371 Cyp1B1-luciferase alone.
This relative activity is comparable to that seen with C3H10T1/2 cells,
which normally express the AhR. When this cotransfection was
accompanied by TCDD stimulation, there was an increase in luciferase
activity of only 25% compared with uninduced activity. The same result
was obtained in two separate transfection experiments. This increase in
induction compares with 8-fold induction by TCDD when the p1075/+371
Cyp1B1-luciferase construct is transfected into C3H10T1/2
cells.
|
Binding of Nuclear Proteins to XREs-- The binding of nuclear protein, particularly the AhR·Arnt complex to XREs found in the enhancer domain, has been analyzed by gel mobility shift assays. Four 30-base oligonucleotides were tested containing XRE1/XRE2 (oligonucleotide A), XRE3 (oligonucleotide B), XRE4 (oligonucleotide C), and XRE5 (oligonucleotide D), respectively (Table I). Each oligonucleotide was tested in gel mobility shift assays with nuclear extracts from control and TCDD-induced C3H10T1/2 cells. These extracts were also tested with a 30-base oligonucleotide containing rat Cyp1A1 XRE1 (oligonucleotide 1A1). This is located in an equivalent 5'-flanking region of the Cyp1A1 gene and has been used in many other studies (18, 36). Mouse embryo fibroblast cells, however, contain 5-10 times less AhR and Arnt (40) than hepatoma cells such as Hepa-1, which have been used for these previous studies with the Cyp1A1 XRE.
|
|
|
fibroblasts to about the
same extent as binding to oligonucleotides A and C.
| |
DISCUSSION |
|---|
|
|
|---|
This characterization of the mouse Cyp1B1 gene establishes that the Cyp1B1 gene is radically different in its structure and regulation from the Cyp1A1 gene, even though they share 40% identity in their protein sequences. Although much more selectively expressed in cells than Cyp1A1, Cyp1B1 is often constitutively expressed (1, 4). Here we show that Cyp1B1 differs from Cyp1A1 through a key contribution of the AhR to this constitutive expression. There are several points of close similarity to human CYP1B1, notably in the gene structure and in features of an AhR-responsive enhancer region (Fig. 7A) (8). This is clearly defined here as critical for both basal and TCDD-induced expression. The mouse Cyp1B1 proximal promoter shares features with human CYP1B1, but also shows several striking differences.
The mouse Cyp1B1 gene, like the human CYP1B1 gene (8), has three closely spaced exons compared with the seven exons of the CYP1A1 gene (42), which is more typical of mammalian P450 genes (43, 44). Previous work has shown that Cyp1B1 is also exceptional among mammalian P450 genes in the length of the translated region (543 versus 520 amino acids for Cyp1A1) and the 3'-untranslated region (3.15 versus 1 kb). In spite of these differences, Cyp1B1 shares with Cyp1A1 inducibility by TCDD and other polycyclic aromatic hydrocarbons through the AhR. This work demonstrates the presence of an upstream enhancer domain that is similar to that in Cyp1A1 in location, size, and number of XREs (five). This provides strong support to the idea that both induction processes are governed by the same mechanism. In spite of this similarity, Cyp1B1 exhibits different cell selectivity in expression compared with Cyp1A1 and, unlike Cyp1A1, commonly exhibits substantial constitutive expression. The analysis of promoter activity presented here rigorously establishes for the first time that the AhR is required for basal expression by acting through the same enhancer domain. Thus, the similar enhancer domains in Cyp1B1 and Cyp1A1 function differently under basal conditions. We have also shown complex formation distinct from AhR·Arnt heterodimers with two XREs in the Cyp1B1 enhancer. These unusual TCDD-insensitive complexes may explain high basal expression of Cyp1B1. Transient transfections with 5'-flanking constructs of Cyp1B1 and Cyp1A1 reproduce only some of the cell selectivity of TCDD-induced expression seen with the genes. This is consistent with the idea that chromatin structure and modification are important elements in TCDD action and this selectivity (13).
The double start site for the Cyp1B1 gene detected by primer extension is conserved in a variety of rodent cells, such as rat mammary fibroblasts and rat adrenal glands.7 The gene sequence upstream of the start site does not contain a TATA box element, but exhibits a TATA-like sequence (TTAAAA) similar to what has been reported for human CYP1B1 (8). The initiation site is flanked by XREs (GCGTG) on the upstream and downstream sides, suggesting that the AhR and Arnt may be directly involved in the transcription initiation process. The upstream XRE separates a pair of SP-1-like sequences immediately adjacent to the TATA-like sequence. Recent analysis of the human CYP1B1 promoter established the importance of these conserved SP-1- and TATA-like sequences to basal promoter activity (45). Work from different laboratories has shown that SP-1 elements, in cooperation with an XRE, are capable of producing an enhancement of transcriptional activation in a synergistic fashion (21, 46). This proximal promoter region is also notable for a pair of SF-1-binding elements that have been associated with cAMP-mediated induction of hydroxylases involved in steroidogenesis (35, 47-49). Since Cyp1B1 expression is under hormonal control mediated by cAMP in endocrine-regulated tissues (4-6), these putative SF-1 elements (AGGTCA) may provide binding sites for this transcription factor. However, the mouse and human sequences within the proximal promoter regions are quite different. For example, the human CYP1B1 promoter sequence lacks the XREs that flank the mouse Cyp1B1 transcription start site and the SF-1 element. An SF-1-binding motif in the proximal promoter regions of Cyp11A1, Cyp21, and CYP19 are crucial for up-regulation in response to cAMP (50-52).
A second low efficiency start site located 332 nucleotides upstream of
the first site by primer extension repeats the upstream 10-base
sequence AGAGGGTTGG. This secondary site lacks the upstream SP-1- or
TATA-like sequences, but when linked to luciferase (
1075 to
207),
retains 5-10% of the maximum basal activity without affecting TCDD
induction. Multiple start sites have been reported for genes containing
TATA-less promoters such as the housekeeping aspartate aminotransferase
gene (53). Initiation of transcription from different start sites could
be tissue-specific and may contribute to tissue-specific gene
expression (54-56).
Cyp1B1-luciferase reporter analysis reveal that the same
265-bp sequence (
810 to
1075) is critical for regulation of basal activity and TCDD stimulation. This enhancer contains a cluster of five
XREs, which are completely conserved in the human CYP1B1 enhancer (Fig. 7A). Deletion of this region not only removed
nearly all TCDD induction, but decreased basal expression 10-fold. The mouse Cyp1B1 enhancer region shows substantial similarity to
the key upstream enhancer of rat Cyp1A1 (as illustrated in
Fig. 7B), which is also located at ~1 kb upstream of the
start site (
821 to
1110) (57). This region in the rat
Cyp1A1 gene contains five XREs and six GC-rich elements
(DXEs), which have been linked to a capacity to modify induction
mediated by the AhR (17, 36). Alignment of the Cyp1B1 and
Cyp1A1 enhancer regions showed a 47-bp region (
971 to
1018) that is over 70% identical to a similarly placed sequence in
rat Cyp1A1 (
940 to
987). Two DXEs (DXE4 and DXE5) that
are located in this 47-bp region in rat Cyp1A1 bind distinct
nuclear factors that are different from the AhR, Arnt, and
SP-1.8 The mouse
Cyp1B1 enhancer region has four GC-rich elements that resemble DXEs. Since the Cyp1B1 enhancer region has similar
sequence characteristics, the mechanism of the regulation of
Cyp1B1 response to TCDD may be very similar to that
described for Cyp1A1. However, Cyp1A1 is rarely
expressed at significant constitutive levels, indicating that the
respective enhancers respond differently to low levels of constitutive
nuclear AhR. This mouse Cyp1B1 enhancer also contains one
SF-1 site (position
907), which is conserved in the corresponding
human CYP1B1 enhancer and may contribute to cAMP
responsiveness.
Gel mobility shift assays show that AhR·Arnt heterodimers bind to one site in the Cyp1B1 enhancer region (XRE5) in a manner analogous to Cyp1A1 XRE1, including TCDD stimulation of binding. XRE5 is also flanked on the 3'-side by a GC-rich sequence that is similar to DXE1, which is located adjacent to XRE2 in the Cyp1A1 enhancer. Surprisingly, the remaining three XRE-containing oligonucleotides formed different complexes. XRE1/XRE2 (oligonucleotide A) and XRE4 (oligonucleotide C) formed complexes of the same size as the AhR·Arnt complex of XRE5. They are clearly distinct complexes since they are retained in AhR-deficient embryo fibroblasts and Arnt-deficient Hepa-1 cells. In addition, these complexes were formed to a higher extent, were insensitive to TCDD, were not blocked by anti-AhR antibodies, and were only weakly competitive with XRE5 or Cyp1A1 XRE1. These two anomalous XREs bound the same protein, as evidenced by very high mutual competition but weak competition with XRE5 and Cyp1A1 XRE1. XRE1/XRE2 and XRE4 share a 12-base core sequence (GCGGCGCACGCA) that is identical in 10 out of 12 positions in XRE5. Interestingly, even though XRE4 and XRE5 bind distinct complexes, they also share an identical 11-base sequence that contains the XRE. The GG pair from the consensus 12-base sequence that is replaced by TC in XRE5 may determine which complex binds to this DNA element. This alternative complex does not depend on the XRE sequence, and indeed, binding is enhanced by substitution in this element (Table I, XRE4/MutA). The oligonucleotide containing XRE3 formed a much smaller complex that did not involve either AhR·Arnt heterodimers or the XRE sequence. Mutational analysis shows that the E-box sequence, but not the adjacent XRE, is critical to this complex and that even when this is substituted, no binding occurs to the XRE.
These anomalous complexes that form in the enhancer region may well contribute to the basal activity of Cyp1B1. These complexes suggest that the sensitivity of basal promoter activity to the AhR is due to a large increase in an additional AhR-stimulated protein. Similar complexes were observed with nuclear extracts from Hepa-1 cells. Significantly, we have found that TCDD induction is retained after deletion of a sequence containing XRE3, XRE4, and XRE5 from a rat Cyp1B1-luciferase promoter construct.9 It seems that when an extended promoter sequence is present, the AhR exhibits strong TCDD-responsive enhancer activity through the XRE1/XRE2 element alone. This suggests that the blocking secondary structures form less readily in the full enhancer than in the 30-mers. Consistent with enhancer characteristics, this region mediates TCDD induction effectively in either native or reverse orientations when directly linked to the proximal promoter region. Interestingly, the native orientation appears to be much more effective in stimulating basal promoter activity. This difference could reflect a sensitivity of the enhancer orientation to the lower amount of nuclear AhR under basal conditions or be caused by a fundamental difference between the basal and TCDD-induced mechanisms for the enhancer elements. The second interpretation is consistent with the novel complexes described above for the Cyp1B1 enhancer region that are independent of TCDD.
Although this enhancer region functions equally well in mediating TCDD induction in C3H10T1/2 fibroblasts and Hepa-1 cells, basal Cyp1B1 promoter activity is 10-fold more effective in C3H10T1/2 fibroblasts. This is far lower than the differences observed for in vivo expression of the genes in these cells (>100-fold). However, like expression of the genes, we again see selectivity in basal transcription rather than induction, which is also retained for Cyp1B1 in Hepa1 cells, although with greatly diminished total activities. The major difference seems to reside with a 10-fold greater effectiveness of the basal activity of the upstream enhancer region in C3H10T1/2 cells.
Evidence has been previously presented that TCDD activation of the AhR causes an initial cooperative binding to the enhancer domain that then causes an opening up of cis-acting elements more proximal to the transcription start site (13, 22). The low cell selectivity shown by the transiently transfected Cyp1B1 and Cyp1A1 promoter constructs between C3H10T1/2 cells and Hepa-1 cells indicates either that cis-acting elements farther upstream are critical determinants of cell-specific expression or that there is cell-selective exposure of the distinct Cyp1B1 or Cyp1A1 chromatin regions. Selective expression of Cyp1A1 and Cyp1A2 was only modeled by luciferase promoter constructs when they were fully integrated into the genome after stable transfections (58).
Deletion analysis also revealed two inhibitory domains in the
Cyp1B1 upstream region that each decreased basal promoter
activity without affecting TCDD induction. The inhibitory region
located between
210 and
432 also contained the minor start site
(
332), two XREs, an E-box, and a putative SP-1 site (18-base G-rich
sequence, G6TG6TG4). A negative
cis-acting regulatory element has been identified for the
Cyp1A1 gene in rat epidermal cells (27). This is associated with differentiation at high passage numbers concomitant with down-regulation of Cyp1A1 and Cyp1B1 (27). A
sequence similar to half of this element is found in the mouse
Cyp1B1 region immediately downstream of the enhancer element
in a position equivalent to the Cyp1A1 element (27). This
cis-acting element is distinct from the negative regulatory
element described for the CYP1A1 5'-flanking region by Hines
and co-workers (59, 60). The second inhibitory domain is located in
exon 1 (+150 to +269). Since exon 1 will be included in the luciferase
transcript, this element may either inhibit transcription or affect the
stability or translation efficiency of the transcript.
Recent work with AhR-deficient mice (AhR
/
) has shown
that Cyp1A2 and Ugt106 basal expression is lost
compared with heterozygous AhR+/
littermates that express
the AhR (38). In studies to be published elsewhere, we have developed
AhR
/
fibroblast cell lines from these
mice5 and have shown that
these cells do not express either basal or TCDD-induced
Cyp1B1, consistent with involvement of the AhR in basal
expression. We have also seen that there is no basal or TCDD-induced
Cyp1B1-luciferase activity unless the cells are
cotransfected with a vector encoding the AhR. The response to TCDD is
small probably because activities produced by the receptor alone are remarkably high. Basal activities are comparable to basal activities in
C3H10T1/2 cells in spite of low levels of transfected AhR. Similar high
basal activities have been seen for Cyp1A1 promoter constructs in AhR-deficient hepatoma cells (61). Hyper-responsiveness has also been seen after cotransfection of steroid receptors with reporter constructs (62). This probably reflects the diminished association of nucleosomes with the transiently transfected
promoters.
This first dissection of the upstream region of mouse Cyp1B1 has revealed some strong similarity to Cyp1A1, sufficient to suggest a common mechanism of AhR action in transcriptional activation of these genes. We have also provided clear evidence for the role of the AhR in constitutive and TCDD-induced activation of Cyp1B1. It remains to be determined whether different sequences in the 265-bp upstream enhancer play a role in the basal and induced activities. Cyp1B1 enhancer activity is also balanced against two domains that confer inhibitory effects on transcription. Recent human genetic studies have shown that a deficiency of human CYP1B1 leads to congenital glaucoma (63). This confirms previous suggestions based on the selective expression in steroid-responsive and steroidogenic tissues that CYP1B1 produces a physiological oxygenase product that has regulatory functions (4). It will be important to identify factors such as those binding to the enhancer XREs that may contribute to constitutive regulation of this upstream region.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. P. Fernandez-Salguero and F. Gonzalez for assistance in generating AhR-deficient primary mouse embryo fibroblasts and Xin Shen for technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant CA 16265.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Pharmacology,
Medical Science Center, University of Wisconsin, 1300 University Ave.,
Madison, WI 53706. Tel.: 608-263-3128; Fax: 608-262-1257; E-mail:
jefcoate{at}facstaff.wisc.edu.
1 The abbreviations used are: AhR, aryl hydrocarbon receptor; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; kb, kilobase(s); bp, base pair(s); Arnt, AhR nuclear translocator; XRE, xenobiotic-responsive element; DXE, diverse sequence xenobiotic-responsive element (36); PCR, polymerase chain reaction; SF-1, steroidogenic factor-1.
2 J. Weisz, P. B. Brake, and C. R. Jefcoate, unpublished results.
3 W. F. Greenlee, personal communication.
4 A second experiment using different batches of Hepa-1 cells and media provided similar relative activities, but p1075/+150 provided only half the induction.
5 D. L. Alexander and C. R. Jefcoate, unpublished results.
6 Ü. Savas and C. R. Jefcoate, unpublished results.
7 K. K. Bhattacharyya and C. R. Jefcoate, unpublished results.
8 L. Zhang and J. B. Fagan, unpublished results.
9 L. Zhang and C. R. Jefcoate, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|