|
J Biol Chem, Vol. 274, Issue 1, 165-169, January 1, 1999
The Kidney-expressed Winged Helix Transcription Factor
FREAC-4 Is Regulated by Ets-1
A POSSIBLE ROLE IN KIDNEY DEVELOPMENT*
Anna
Cederberg ,
Malin
Hulander ,
Peter
Carlsson , and
Sven
Enerbäck §¶
From the Department of Molecular Biology, The
Lundberg Laboratory, Göteborg University, Medicinareg. 9C,
S-413 90 Göteborg, Sweden and the § The Unit for
Biotechnology, Department of Physical Chemistry, Chalmers
University of Technology, S-412 96 Göteborg, Sweden
 |
ABSTRACT |
In this paper we show that the kidney-expressed
winged helix transcription factor FREAC-4 is regulated by Ets-1,
another kidney-expressed transcription factor. Through transfection
experiments three Ets-1 cis-elements are identified within
the first 152 nucleotides upstream of the transcription start in the
freac-4 promoter. These sites are confirmed in a DNase I
in vitro protection assay using recombinant Ets-1 protein.
In cotransfection experiments using an Ets-1 expression vector, the
induction of freac-4 reporter gene activity is attenuated approximately 6-fold when the three Ets-1 binding sites are mutated. Furthermore, we demonstrate that overexpression of Ets-1 in the human
embryonic kidney cell line 293 is sufficient to increase freac-4 mRNA levels. These results are compatible with
the hypothesis that Ets-1 acts as an upstream regulator of FREAC-4
expression during kidney development.
 |
INTRODUCTION |
The forkhead family of transcription factors belongs to the
"winged helix" superfamily of DNA binding proteins (1, 2), a name
derived from the x-ray crystallography data on HNF-3 bound to DNA
(3). Forkhead proteins bind to DNA through a highly conserved region of
some 105 amino acids, the forkhead motif (4). This domain was first
identified in a Drosophila gene, forkhead (fkh), named after a homeotic mutation in which proper
formation of terminal structures, most striking gut formation, is
affected (5). The forkhead motif has since been identified in over 40 genes isolated from a vast range of organisms, among them man (6). Less
is known about the biological function of the various forkhead genes.
However, important roles in tumorigenesis (7-11), embryonic
development (12-16), and regulation of tissue-specific gene expression
(17-20) have been demonstrated for members of this gene family. Highly
complex functions, such as specification of visual projection maps in
the retina, have been shown to depend on correct spatial expression of
the forkhead genes CBF-1 and CBF-2 (21). It has
also been shown that the Drosophila gene fkh
directly participates in hormonal regulation of gene expression (22).
The ecdysone responsive unit, controlling the stage-specific responses
of sgs-4 (salivary gland
secretion protein gene) to 20-hydroxyecdysone, interacts
with the gene product of fkh in vivo (22). Recently,
forkhead proteins have been implicated as nuclear targets for
transforming growth factor- and insulin-like signaling (23-25).
We have earlier reported that freac-4 (26) and
freac-9 (27) are two human forkhead genes that are
predominately expressed in the kidney. The mouse homologue of
freac-4, BF-2, has been shown to be essential for
stromal mesenchyme differentiation during kidney morphogenesis (28). In
this paper we demonstrate that the kidney expressed transcription
factor Ets-1 is essential for regulation of freac-4. We also
discuss a possible role for Ets-1 as an upstream regulator of
freac-4 during kidney development.
 |
MATERIALS AND METHODS |
Cell Culture, Transfections, and Reporter Gene Assays--
Cells
were obtained through the American Tissue Culture Collection: COS-7
(monkey transformed kidney; CRL-165) and 293 (human embryonic kidney;
CRL-1573). We have previously demonstrated that these cell lines
express freac-4 transcripts (26). All cells were cultured in
Dulbecco's modified Eagle's medium supplemented with 10% fetal calf
serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin (Life
Technologies, Inc.). For transfections, different FREAC-4 luciferase
constructs were used as described previously (26). A 1.6-kilobase pair
HindIII restriction fragment of the human Ets-1 cDNA was
subcloned into pCB6+ to be used as an expression construct for Ets-1
protein in transfection assays. A typical transient transfection
contained 100 ng of luciferase reporter plasmid and 160-200 ng of
cotransfected expression plasmid. These plasmids were diluted into 560 µl of OptiMEM together with 2 µg of LipofectAMINE (Life
Technologies, Inc.) and added to cells cultured in a gelatin-coated
16-mm tissue culture well. Cell harvest and luciferase assay were
performed according to Promega Corp. (Technical Bullentin 101). To
compensate for differences in transfection efficiency, 10 ng of a
-galactosidase-expressing plasmid, pCMV gal (CLONTECH), was added to each transfection.
-Galactosidase activity was measured using a Lumi -galactosidase
assay (CLONTECH). A typical stable transfection
contained 20 µg of linearized Ets-1 expression plasmid, diluted into
8 ml of OptiMEM together with 50 µg of Lipofectin (Life Technologies,
Inc.) and added to cells cultured in a gelatin-coated 82-mm tissue
culture dish. Medium was changed after ~20 h, and after another
24 h 800 µg of G418 sulfate/ml (LifeTechnologies, Inc.) was
added to the medium. After 10-15 days resistant foci appeared.
In Vitro Mutagenesis--
A genomic DNA fragment spanning from
nucleotides 2122 to 2485 was subcloned into pBluescript
SK (Stratagene). The three potential Ets-1 binding sites
in this region were mutated with QuikChangeTM Site-directed
Mutagenesis Kit (Stratagene) using the following primers:
site number 1, CGAGAAGGGCTGATTTAATAGGCTTGCTTTCC and
GGAAAGCAAGCCTATTAAATCAGCCCTTCTCG; site number 2, CCTAGGCTTGCTTTAATTCCCTCGGCAGCG and CGCTGCCGAGGGAATTAAAGCAAGCCTAGG; and
site number 3, GCTATAAGCCGATTAAGGTCCGCCCTCTCC and
GGAGAGGGCGGACCTTAATCGGCTTATAGC. Mutagenesis was verified by sequencing. The mutant promoters were then cloned into pGL2-Basic.
Protein Expression and Purification--
An Ets-1 expression
vector, N331 (30), was used to express the protein under the control
of a T7 promoter in Escherichia coli BL21(DE3);pLysS cells
as has earlier been described (29). In brief, T7 polymerase expression
was induced with 1 mM
isopropyl- -D-thiogalactopyranoside for 1 h at
37 °C, cells were lysed by sonication in a buffer containing 50 mM Tris, pH 7.9, 1 mM EDTA, 1 M
KCl, 1 mM dithiothreitol, and 1 mM
phenylmethylsulfonyl fluoride. The soluble fraction was cleared by
centrifugation, dialyzed into 20 mM sodium citrate, pH 5.3, 150 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, and 0.2 mM phenylmethylsulfonyl fluoride and applied to a DEAE-cellulose column. Purity of >90% was
determined by Coomassie Blue staining.
DNase I Footprinting--
DNase I footprinting was performed
with labeled restriction enzyme fragments corresponding to nucleotides
2251-2426 (Fig. 1 in Ref. 26). Plasmids were linearized with
XhoI and 5'-labeled with [ -32P]dATP and
[ -32P]dCTP using the Klenow enzyme. The probes were
cut out from the plasmids with SacI and gel purified. 20,000 cpm Cerenkov of probe was added to a binding reaction with a final
volume of 50 µl in the presence of various amounts of Ets-1 protein
extract or bovine serum albumin (25 mM Tris·HCl, pH 7.8, 50 mM KCl, 0.5 mM EDTA, 0.5 mM
dithiothreitol, 6.25 mM MgCl2, 2% polyvinyl
alcohol, 10% glycerol, 5 µg of poly[d(I·C)]/ml) and incubated
for 15 min in room temperature. DNase I digestion and work-up procedure
followed the method of Jones et al. (30).
RNase Protection Assays--
A 257-base pair SacII
restriction fragment spanning nucleotides 3719-3976 (Fig. 1 in Ref.
26) was used as a specific probe for freac-4. T3 RNA
polymerase and [ -32P]CTP were used to label a cRNA
antisense probe. Labeled antisense probe, approximately 170,000 cpm
Cerenkov for each reaction, was added to 50 µg of total RNA in a
hybridization buffer (80% formamide, 100 mM sodium
citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA) at 50 °C overnight. After digestion with RNase
A and RNase T1, the protected fragment was electrophoresed on a 6%
sequencing gel. A 262-base pair XhoI/SacI
restriction fragment of the human cDNA for Ets-1 was subcloned and
used to make cRNA antisense probe. The assay was carried out as
outlined for freac-4 with the exception that 25 µg of
total RNA was used. The -actin probe used was derived from the
plasmid pTRI-Actin-Mouse (Ambion). RNA samples were treated with DNase
I free of RNase activity.
 |
RESULTS |
Cotransfections with an Ets-1 Expression Vector Induces an Increase
in freac-4 Reporter Gene Activity--
Even though it has been clearly
demonstrated that BF-2 (the mouse homologue of the human
freac-4 gene) is essential for differentiation of the
condensed mesenchyme into tubular epithelium during kidney formation
(28), very little is known about upstream and downstream signaling in
the freac-4/BF-2 pathway. We became interested in the
transcription factor Ets-1 as a possible regulator of such a pathway
because Ets-1 has been implicated as a regulator of gene expression in
mesodermal cells that are involved in morphogenic processes such as
organ formation (31). Ets-1 is widely expressed in the murine and chick
embryo during kidney formation, and its expression pattern has been
shown to include tubular structures of the mesonephric kidney as well
as glomeruli in the developing kidney (32, 33). In a first experiment a
2273 freac-4 promoter reporter construct (FREAC-4-luc;
Fig. 1; see also Fig. 3A) was used to transfect the kidney derived cell line COS-7. This construct contains 2273 nucleotides upstream of the transcription start. When
increasing amounts of an Ets-1 expression plasmid was included in the
transfections a clear induction (approximately 15-fold) could be
demonstrated (Fig. 1). A dose-response pattern is present in the range
of 0-50 ng of Ets-1 expression plasmid, whereas 200 ng of the same
plasmid in no significant way changed the activation profile as
compared with 50 ng of expression vector.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 1.
A dose-response curve for FREAC-4-luc with
0-200 ng of Ets-1 expression plasmid generated in a cotransfection
experiment using COS-7 cells. The amount of DNA in each
transfection is 300 ng using an insert-less expression vector
(Mock) to compensate for differences in amount of DNA.
Luciferase activity in relative light units (RLU) is shown
as the means of at least three independent transfections ± S.D.
|
|
The Ets-1 Inducibility Is Mapped to a 152 freac-4 Reporter Gene
Construct That Contains Three Potential Ets-1 Binding Sites--
Two
derivatives of the 2273 construct (FREAC-4-luc), 527-luc and
152-luc extending 527 and 152 nucleotides upstream of the
transcription start (see Fig. 3A), were used to study the inducibility conferred by Ets-1 in cotransfection experiments. As can
be seen in Fig. 2 FREAC-4-luc, 527-luc
and 152-luc are all induced approximately 40-fold. Because the
luciferase vector void of any freac-4 promoter sequence is
not induced by Ets-1 cotransfections, we conclude that the
freac-4 promoter sequence in 152-luc most likely contains
binding sites for Ets-1 (Fig. 3B). A nucleotide frequency
profile, derived from repetitive cycles of selection and amplification
of a double stranded oligonucleotide template using recombinant Ets-1
protein (34), was used to identify potential Ets-1 binding sites in the
152-luc construct. Three potential Ets-1 binding sites are depicted
in Fig. 3. The variation in induction seen between independent
cotransfection experiments, e.g. ~15-fold (Fig. 1; see
also Fig. 5) to ~40-fold (Fig. 2), was found to correlate with the
total amount of DNA used in the transfections, i.e. a total
amount of 200 ng (experiment in Fig. 2) gave reproducibly a ~40-fold
induction, whereas 260 ng (see Fig. 5) to 300 ng (Fig. 1) in a similar
manner gave a ~15-fold induction.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 2.
Cotransfections using COS-7 cells with 100 ng
of either reporter constructs; FREAC-4-luc, 527 or 152 with 100 ng
of an expression vector encoding Ets-1 or mock (void of insert). A
luciferase reporter plasmid without any freac-4 promoter
sequence was used as a control (vector). Reporter gene
activity is expressed as relative activity with the activity of
FREAC-4-luc cotransfected with mock set to 1.0. Values are the means of
at least three independent transfections ± S.D.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
A, the three reporter constructs used
extend to 2273, 527, and 152 respectively, relative to the start
of transcription. The 152 construct contains three potential Ets-1
binding sites located at 95 to 104, 77 to 86, and 24 to 15;
nucleotide numbering is as described by Ernstsson et al.
(26). TATA motif and location of transcription start as described by
Ernstsson et al. (26). B, the three potential
Ets-1 binding sites in the freac-4 promoter show a high
degree of sequence similarity to a consensus sequence based on
sequences known to bind Ets-1 (34).
|
|
When the Potential Ets-1 Binding Sites in the freac-4 Promoter Are
Mutated the Ets-1 Induction Is Attenuated--
To confirm the presence
of Ets-1 binding sites within the 152 region of the
freac-4 promoter, we set up a DNase I in vitro protection assay using a probe spanning from 152 to +23, relative the
start of transcription (Fig. 3B; corresponding to
nucleotides 2251-2426 of Fig. 1 in Ref. 26). Purified recombinant
Ets-1 protein (rEts-1) was used (see "Materials and Methods"), and
three protected regions could be demonstrated Fig.
4. These three regions, 12 to 23,
77 to 86, and 93 to 102, are all centered over the conserved
GGAA motif in the three predicted Ets-1 sites as discussed above. To
further analyze the role these sites play in Ets-1 induction of
reporter gene activity derived from the 152-luc construct, we
introduced mutations in each of these sites. We chose to change the
obligatory purine dinucleotide GG of the GGAA core motif for Ets-1
binding sites into the pyrimidine dinucleotide TT (34, 35). As can be
seen in Fig. 5 each of these mutations drastically reduced the Ets-1-mediated induction of reporter gene activity with ~60-70%. When all three mutations were combined, a
further decrease in reporter gene activity was noted to less than 20%
as compared with that of the wild type construct. Similar levels of
reduction in reporter gene activity, after mutation of Ets-1 binding
sites, have been reported for the rat prolactin promoter (36) as well
as for the NF B1 promoter (37).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
DNase I footprint using recombinant Ets-1
protein (rEts-1) and bovine serum albumin
(BSA). Three regions are protected: 12 to 23, 77
to 86, and 93 to 102. These three regions show a high sequence
similarity with sequences known to interact with Ets-1 (see Fig.
3B). For details see "Experimental Procedures."
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 5.
Cotransfections using wild type
(wt) 152 freac-4 promoter construct or
reporter constructs in which the three Ets-1 binding sites have been
mutated. m#1, 93 to 102; m#2, 77 to
86; m#3, 12 to 23. In all instances the obligatory GGA
motif in Ets-binding sites have been changed to TTA (35). In one
construct (m#1+2+3) all three mutations have been
introduced.
|
|
Expression of Ets-1 in 293 Cells, a Human Embryonic Kidney Cell
Line Induces freac-4 Expression--
In an attempt to find out if an
increased Ets-1 expression would be sufficient per se to
up-regulate freac-4 mRNA levels, in a kidney-derived
cell line, we stably transfected 293 cells with an Ets-1 expression
vector also encoding NeoR to facilitate selection of Ets-1
expressing clones. In Fig. 6 we
demonstrate that cell clones with an increased Ets-1 mRNA level also have a higher level of freac-4 mRNA. Despite the
fact that this experimental approach not can differ between indirect or direct effects on the freac-4 promoter, these results are
compatible with the view that Ets-1 acts as a positive upstream
regulator of freac-4 expression and that the
Ets-1-dependent activation is mediated through Ets-1
sites present in the freac-4 promoter.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
RNase protection assay. An expression
vector encoding Ets-1 and NeoR have been stably transfected
in to the human embryonic kidney cell line 293. G418-resistant clones
were assayed for amount of freac-4 mRNA. Clones
transfected with an expression vector void of Ets-1 coding sequence are
shown in lane A. Shown in lanes B and
C are two clones that are derived from transfections using a
vector encoding Ets-1. To ensure equal loading of total RNA in each
experiment, the RNA samples were assayed for expression of
-actin.
|
|
 |
DISCUSSION |
The Ets-1 proto-oncogene, the founding member of the Ets-family of
transcription factors, was originally described as the cellular
homologue of the v-ets oncogene, which is translated as a
135-kDa gag-myb-ets fusion protein from the
replication-deficient retrovirus E26 in chickens (38-40). Members of
this family play important roles in regulating gene expression in
response to multiple developmental and mitogenic signals (41-43).
Previous studies in mammals have demonstrated that Ets-1 is a
transcription factor important during development of lymphoid cells and
their subsequent activation (44, 45). Other sites of Ets-1 expression
are vascular structures, the central nervous system (including the
closed neural tube) as well as the developing kidney (32, 33).
Freac-4 and its mouse homologue BF-2 have a more
restricted expression pattern, as compared with Ets-1, including
testis, spinal cord, brain, and the developing kidney (26, 28, 46,
47).
In this paper we have demonstrated the presence of at least three Ets-1
binding sites within the freac-4 promoter (Figs.
3B and 4). When an Ets-1 expression plasmid is cotransfected
with various freac-4 promoter reporter constructs a clear
induction is noted (~15-40-fold; Figs. 1 and 2). When the three
Ets-1 binding sites present on the 152-luc construct are mutated, the
Ets-1 induction is reduced by a factor of ~6 as compared with the
wild type promoter (Fig. 5). This is consistent with Ets-1 as a major regulator/activator of freac-4 gene expression, other
cis-elements and trans-activators are also likely
to contribute, because we have previously shown that both p53 and WT-1
(Wilms' tumor suppressor gene-1) are involved in the regulation of
freac-4 (26).
In transfection assays, for practical reasons, only limited amounts of
promoter sequence can be used. The expression level of transactivators
used in cotransfection assays is also a factor to consider when
interpreting the results of such experiments. To investigate whether or
not an increased level of wild type Ets-1 mRNA expression would be
sufficient to up-regulate freac-4 expression, we stably
transfected the human embryonic kidney cell line 293 with an Ets-1
expression vector. Total RNA was then used in a RNase protection assay,
and we could demonstrate an increased level of freac-4
mRNA in cell clones with an increased level of Ets-1 mRNA (Fig.
6). We would also like to point out that untransfected 293 cells have a
low level of Ets-1 expression (a faint band in lane
A of Fig. 6). Taken together, these experiments show that it is
possible that Ets-1 could act as an upstream regulator of FREAC-4
expression in kidney cells. This notion gains further support from the
fact that Ets-1 is expressed during early kidney development in the
tubular structures of mesonephros day E10.5 pc (33), whereas the early
stages of kidney development in BF-2 / mice remain
unaffected (28). BF-2 is expressed at E12.5 pc in a population of cells
that surround the condensation of nephrogenic mesenchyme (28). Thus the
temporal appearance of Ets-1 and BF-2 in the developing kidney does not
exclude Ets-1 as a possible upstream regulator in the BF-2/Freac-4
pathway. In Fig. 7 we have outlined a
hypothetical regulative pathway in which Ets-1, p53, WT-1, and
BF2/freac-4 participate. This pathway is based on the
experiments described in this paper as well as work by others: (i) p53
is known to repress expression of both Ets-1 (48) and
freac-4 (26); (ii) p53 is expressed in the developing kidney
during embryogenesis (49); (iii) transgenic mice expressing wild type
p53, under control of the mouse mammary tumor virus promoter, undergo
progressive renal failure due to defective kidney differentiation with
small kidneys with about half of the normal number of nephrons (50);
(iv) WT-1 up-regulates freac-4 expression (26); and (v) in
WT-1 / mice metanephrogenic mesenchyme remains uninduced and no
kidney is formed (51). Clearly more research is needed to elucidate the
pathway through which BF-2/FREAC-4 participates in the regulation of
nephrogenesis, and we hope that the results presented in this paper
will contribute to a better understanding of this regulative
pathway.
 |
ACKNOWLEDGEMENT |
We thank Barbara Graves for kindly sharing
Ets-1 plasmids with us.
 |
FOOTNOTES |
*
This work was supported by grants from the Swedish Medical
Research Council, the Swedish Foundation for Strategic Research, the
IngaBritt and Arne Lundberg Foundation, the Juvenile Diabetes Foundation, and the Magnus Bergvall Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of Molecular
Biology, Lundberg Laboratory, Medicinareg. 9C, S-413 90 Göteborg, Sweden. Tel.: 46-31-7733804; Fax: 46-31-7733801; E-mail: sven.enerback{at}molbio.gu.se.
 |
REFERENCES |
-
Donaldson, L. W.,
Petersen, J. M.,
Graves, B. J.,
and McIntosh, L. P.
(1994)
Biochemistry
3307,
13509-13516
-
Liang, H.,
Olejniczak, E. T.,
Mao, X.,
Nettesheim, D. G., Yu, L.,
Thompson, C. B.,
and Fesik, S. W.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11655-11659[Abstract/Free Full Text]
-
Clark, K. L.,
Halay, E. D.,
Lai, E.,
and Burley, S. K.
(1993)
Nature
364,
412-420[CrossRef][Medline]
[Order article via Infotrieve]
-
Hacker, U.,
Grossniklaus, U.,
Gehring, W. J.,
and Jackle, H.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
8754-8758[Abstract/Free Full Text]
-
Weigel, D.,
Jurgens, G.,
Kuttner, F.,
Seifert, E.,
and Jackle, H.
(1989)
Cell
57,
645-658[CrossRef][Medline]
[Order article via Infotrieve]
-
Kaufmann, E.,
and Knochel, W.
(1996)
Mech. Dev.
57,
3-20[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, J.,
and Vogt, P. K.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
4490-4494[Abstract/Free Full Text]
-
Parry, P.,
Wei, Y.,
and Evans, G.
(1994)
Genes Chromosom. Cancer
11,
79-84[Medline]
[Order article via Infotrieve]
-
Shapiro, D. N.,
Sublett, J. E.,
Li, B.,
Downing, J. R.,
and Naeve, C. W.
(1993)
Cancer Res.
53,
5108-5112[Abstract/Free Full Text]
-
Downing, J. R.,
Khandekar, A.,
Shurtleff, S. A.,
Head, D. R.,
Parham, D. M.,
Webber, B. L.,
Pappo, A. S.,
Hulshof, M. G.,
Conn, W. P.,
and Shapiro, D. N.
(1995)
Am. J. Pathol.
146,
626-634[Abstract]
-
Galili, N.,
Davis, R. J.,
Fredericks, W. J.,
Mukhopadhyay, S.,
Rauscher, F. d.,
Emanuel, B. S.,
Rovera, G.,
and Barr, F. G.
(1993)
Nat. Genet.
5,
230-235[CrossRef][Medline]
[Order article via Infotrieve]
-
Ang, S. L.,
Wierda, A.,
Wong, D.,
Stevens, K. A.,
Cascio, S.,
Rossant, J.,
and Zaret, K. S.
(1993)
Development
119,
1301-1315[Abstract]
-
Ruiz i Altaba, A.,
Prezioso, V. R.,
Darnell, J. E.,
and Jessell, T. M.
(1993)
Mech. Dev.
44,
91-108[CrossRef][Medline]
[Order article via Infotrieve]
-
Sasaki, H.,
and Hogan, B. L.
(1993)
Development
118,
47-59[Abstract]
-
Weinstein, D. C.,
Ruiz i Altaba, A.,
Chen, W. S.,
Hoodless, P.,
Prezioso, V. R.,
Jessell, T. M.,
and Darnell, J., Jr.
(1994)
Cell
78,
575-588[CrossRef][Medline]
[Order article via Infotrieve]
-
Xuan, S.,
Baptista, C. A.,
Balas, G.,
Tao, W.,
Soares, V. C.,
and Lai, E.
(1995)
Neuron
14,
1141-1152[CrossRef][Medline]
[Order article via Infotrieve]
-
Clevidence, D. E.,
Overdier, D. G.,
Tao, W.,
Qian, X.,
Pani, L.,
Lai, E.,
and Costa, R. H.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
3948-3952[Abstract/Free Full Text]
-
Enerbäck, S.,
Ohlsson, B. G.,
Samuelsson, L.,
and Bjursell, G.
(1992)
Mol. Cell. Biol.
12,
4622-4633[Abstract/Free Full Text]
-
Hellqvist, M.,
Mahlapuu, M.,
Samuelsson, L.,
Enerbäck, S.,
and Carlsson, P.
(1996)
J. Biol. Chem.
271,
4482-4490[Abstract/Free Full Text]
-
Pani, L.,
Overdier, D. G.,
Porcella, A.,
Qian, X.,
Lai, E.,
and Costa, R. H.
(1992)
Mol. Cell. Biol.
12,
3723-3732[Abstract/Free Full Text]
-
Yuasa, J.,
Hirano, S.,
Yamagata, M.,
and Noda, M.
(1996)
Nature
382,
632-635[CrossRef][Medline]
[Order article via Infotrieve]
-
Lehmann, M.,
and Korge, G.
(1996)
EMBO J.
15,
4825-4834[Medline]
[Order article via Infotrieve]
-
Chen, X.,
Rubock, M. J.,
and Whitman, M.
(1996)
Nature
383,
691-696[CrossRef][Medline]
[Order article via Infotrieve]
-
Lin, K.,
Dorman, J. B.,
Rodan, A.,
and Kenyon, C.
(1997)
Science
278,
1319-1322[Abstract/Free Full Text]
-
Ogg, S.,
Paradis, S.,
Gottlieb, S.,
Patterson, G. I.,
Lee, L.,
Tissenbaum, H. A.,
and Ruvkun, G.
(1997)
Nature
389,
994-999[CrossRef][Medline]
[Order article via Infotrieve]
-
Ernstsson, S.,
Pierrou, S.,
Hulander, M.,
Cederberg, A.,
Hellqvist, M.,
Carlsson, P.,
and Enerbäck, S.
(1996)
J. Biol. Chem.
271,
21094-21099[Abstract/Free Full Text]
-
Ernstsson, S.,
Betz, R.,
Lagercrantz, S.,
Larsson, C.,
Ericksson, S.,
Cederberg, A.,
Carlsson, P.,
and Enerbäck, S.
(1997)
Genomics
46,
78-85[CrossRef][Medline]
[Order article via Infotrieve]
-
Hatini, V.,
Huh, S. O.,
Herzlinger, D.,
Soares, V. C.,
and Lai, E.
(1996)
Genes Dev.
10,
1467-1478[Abstract/Free Full Text]
-
Petersen, J. M.,
Skalicky, J. J.,
Donaldson, L. W.,
McIntosh, L. P.,
Alber, T.,
and Graves, B. J.
(1995)
Science
269,
1866-1869[Abstract/Free Full Text]
-
Jones, K. A.,
Yamamoto, K. R.,
and Tjian, R.
(1985)
Cell
42,
559-572[CrossRef][Medline]
[Order article via Infotrieve]
-
Kola, I.,
Brookes, S.,
Green, A. R.,
Garber, R.,
Tymms, M.,
Papas, T. S.,
and Seth, A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7588-7592[Abstract/Free Full Text]
-
Maroulakou, I. G.,
Papas, T. S.,
and Green, J. E.
(1994)
Oncogene
9,
1551-1565[Medline]
[Order article via Infotrieve]
-
Queva, C.,
Leprince, D.,
Stehelin, D.,
and Vandenbunder, B.
(1993)
Oncogene
8,
2511-2520[Medline]
[Order article via Infotrieve]
-
Nye, J. A.,
Petersen, J. M.,
Gunther, C. V.,
Jonsen, M. D.,
and Graves, B. J.
(1992)
Genes Dev.
6,
975-990[Abstract/Free Full Text]
-
Thompson, C. B.,
Wang, C. Y.,
Ho, I. C.,
Bohjanen, P. R.,
June, C. H.,
Miesfeldt, S.,
Zhang, L.,
Nabel, G. J.,
Karpinski, B.,
and Leiden, J. M.
(1992)
Mol. Cell. Biol.
12,
1043-1053[Abstract/Free Full Text]
-
Bradford, A. P.,
Conrad, K. E.,
Wasylyk, B.,
and Gutierrez-Hartmann, A.
(1995)
Mol. Cell. Biol.
15,
2849-2857[Abstract]
-
Lambert, P. F.,
Ludford-Menting, M. J.,
Deacon, N. J.,
Kola, I.,
and Doherty, R. R.
(1997)
Mol. Biol. Cell
8,
313-323[Abstract]
-
Radke, K.,
Beug, H.,
Kornfeld, S.,
and Graf, T.
(1982)
Cell
31,
643-653[CrossRef][Medline]
[Order article via Infotrieve]
-
Leprince, D.,
Gegonne, A.,
Coll, J.,
de Tasine, C.,
Schneeberger, A.,
Lagrou, C.,
and Stehelin, D.
(1983)
Nature
306,
395-397[CrossRef][Medline]
[Order article via Infotrieve]
-
Nunn, M. F.,
Seeburg, P. H.,
Moscovici, C.,
and Duesberg, P. H.
(1983)
Nature
306,
391-395[CrossRef][Medline]
[Order article via Infotrieve]
-
Macleod, K.,
Leprince, D.,
and Stehelin, D.
(1992)
Trends Biochem. Sci.
17,
251-256[CrossRef][Medline]
[Order article via Infotrieve]
-
Lai, Z. C.,
and Rubin, G. M.
(1992)
Cell
70,
609-620[CrossRef][Medline]
[Order article via Infotrieve]
-
Hipskind, R. A.,
Rao, V. N.,
Mueller, C. G.,
Reddy, E. S.,
and Nordheim, A.
(1991)
Nature
354,
531-534[CrossRef][Medline]
[Order article via Infotrieve]
-
Bath, N. K.,
Komschlies, K. L.,
Fujiwara, S.,
Fisher, R. J.,
Mathieson, B. J.,
Gregorio, T. A.,
Young, H. A.,
Kasik, J. W.,
Ozato, K.,
and Papas, T. S.
(1989)
J. Immunol.
142,
672-678[Abstract]
-
Muthusamy, N.,
Barton, K.,
and Leiden, J. M.
(1995)
Nature
377,
639-642[CrossRef][Medline]
[Order article via Infotrieve]
-
Hatini, V.,
Tao, W.,
and Lai, E.
(1994)
J. Neurobiol.
25,
1293-1309[CrossRef][Medline]
[Order article via Infotrieve]
-
Pierrou, S.,
Hellqvist, M.,
Samuelsson, L.,
Enerbäck, S.,
and Carlsson, P.
(1994)
EMBO J.
1354,
5002-5012
-
Iotsova, V.,
Crepieux, P.,
Montpellier, C.,
Laudet, V.,
and Stehelin, D.
(1996)
Oncogene
13,
2331-2337[Medline]
[Order article via Infotrieve]
-
Schmid, P.,
Lorenz, A.,
Hameister, H.,
and Montenarh, M.
(1991)
Development
113,
857-865[Abstract]
-
Godley, L. A.,
Kopp, J. B.,
Eckhaus, M.,
Paglino, J. J.,
Owens, J.,
and Varmus, H. E.
(1996)
Genes Dev.
10,
836-850[Abstract/Free Full Text]
-
Kreidberg, J. A.,
Sariola, H.,
Loring, J. M.,
Maeda, M.,
Pelletier, J.,
Housman, D.,
and Jaenisch, R.
(1993)
Cell
74,
679-691[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. Kumar and K. N. Pandey
Cooperative Activation of Npr1 Gene Transcription and Expression by Interaction of Ets-1 and p300
Hypertension,
July 1, 2009;
54(1):
172 - 178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Transcriptional Regulation of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter by Transcriptional Activators and Repressor
Mol. Endocrinol.,
March 1, 2009;
23(3):
373 - 387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. D. Pearse, R.-X. Tian, J. Nigro, J. B. Iorgulescu, L. Puzis, and E. A. Jaimes
Angiotensin II increases the expression of the transcription factor ETS-1 in mesangial cells
Am J Physiol Renal Physiol,
May 1, 2008;
294(5):
F1094 - F1100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. T. Berg, L. J. Myers, M. A. Richardson, G. Sandusky, and B. W. Grinnell
Smad6s Regulates Plasminogen Activator Inhibitor-1 through a Protein Kinase C-{beta}-dependent Up-regulation of Transforming Growth Factor-{beta}
J. Biol. Chem.,
April 15, 2005;
280(15):
14943 - 14947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sun, S. Koo, N. White, E. Peralta, C. Esau, N. M. Dean, and R. J. Perera
Development of a micro-array to detect human and mouse microRNAs and characterization of expression in human organs
Nucleic Acids Res.,
December 22, 2004;
32(22):
e188 - e188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Dahle, L. M. Gronning, A. Cederberg, H. K. Blomhoff, N. Miura, S. Enerback, K. A. Tasken, and K. Tasken
Mechanisms of FOXC2- and FOXD1-mediated Regulation of the RIalpha Subunit of cAMP-dependent Protein Kinase Include Release of Transcriptional Repression and Activation by Protein Kinase Balpha and cAMP
J. Biol. Chem.,
June 14, 2002;
277(25):
22902 - 22908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Dahl and R. T. Mulcahy
Cell-Type Specific Differences in Glutamate Cysteine Ligase Transcriptional Regulation Demonstrate Independent Subunit Control
Toxicol. Sci.,
June 1, 2001;
61(2):
265 - 272.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. NAITO, M. S. RAZZAQUE, A. NAZNEEN, D. LIU, H. NIHEI, T. KOJI, and T. TAGUCHI
Renal Expression of the Ets-1 Proto-oncogene during Progression of Rat Crescentic Glomerulonephritis
J. Am. Soc. Nephrol.,
December 1, 2000;
11(12):
2243 - 2255.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Calmont, K. Reichwald, P. Ronco, and J. Rossert
Identification of a Short cis-Acting Element in the Human Vasopressin Type 2 Receptor Gene Which Confers High-Level Expression of a Reporter Gene Specifically in Collecting Duct Cells
Mol. Endocrinol.,
October 1, 2000;
14(10):
1682 - 1695.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Beck and D. Markovich
The Mouse Na+-Sulfate Cotransporter Gene Nas1. CLONING, TISSUE DISTRIBUTION, GENE STRUCTURE, CHROMOSOMAL ASSIGNMENT, AND TRANSCRIPTIONAL REGULATION BY VITAMIN D
J. Biol. Chem.,
April 14, 2000;
275(16):
11880 - 11890.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|