Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cederberg, A.
Right arrow Articles by Enerbäck, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cederberg, A.
Right arrow Articles by Enerbäck, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 1, 165-169, January 1, 1999


The Kidney-expressed Winged Helix Transcription Factor FREAC-4 Is Regulated by Ets-1
A POSSIBLE ROLE IN KIDNEY DEVELOPMENT*

Anna CederbergDagger , Malin HulanderDagger , Peter CarlssonDagger , and Sven EnerbäckDagger §

From the Dagger  Department of Molecular Biology, The Lundberg Laboratory, Göteborg University, Medicinareg. 9C, S-413 90 Göteborg, Sweden and the § The Unit for Biotechnology, Department of Physical Chemistry, Chalmers University of Technology, S-412 96 Göteborg, Sweden

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
REFERENCES

In this paper we show that the kidney-expressed winged helix transcription factor FREAC-4 is regulated by Ets-1, another kidney-expressed transcription factor. Through transfection experiments three Ets-1 cis-elements are identified within the first 152 nucleotides upstream of the transcription start in the freac-4 promoter. These sites are confirmed in a DNase I in vitro protection assay using recombinant Ets-1 protein. In cotransfection experiments using an Ets-1 expression vector, the induction of freac-4 reporter gene activity is attenuated approximately 6-fold when the three Ets-1 binding sites are mutated. Furthermore, we demonstrate that overexpression of Ets-1 in the human embryonic kidney cell line 293 is sufficient to increase freac-4 mRNA levels. These results are compatible with the hypothesis that Ets-1 acts as an upstream regulator of FREAC-4 expression during kidney development.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES

The forkhead family of transcription factors belongs to the "winged helix" superfamily of DNA binding proteins (1, 2), a name derived from the x-ray crystallography data on HNF-3gamma bound to DNA (3). Forkhead proteins bind to DNA through a highly conserved region of some 105 amino acids, the forkhead motif (4). This domain was first identified in a Drosophila gene, forkhead (fkh), named after a homeotic mutation in which proper formation of terminal structures, most striking gut formation, is affected (5). The forkhead motif has since been identified in over 40 genes isolated from a vast range of organisms, among them man (6). Less is known about the biological function of the various forkhead genes. However, important roles in tumorigenesis (7-11), embryonic development (12-16), and regulation of tissue-specific gene expression (17-20) have been demonstrated for members of this gene family. Highly complex functions, such as specification of visual projection maps in the retina, have been shown to depend on correct spatial expression of the forkhead genes CBF-1 and CBF-2 (21). It has also been shown that the Drosophila gene fkh directly participates in hormonal regulation of gene expression (22). The ecdysone responsive unit, controlling the stage-specific responses of sgs-4 (salivary gland secretion protein gene) to 20-hydroxyecdysone, interacts with the gene product of fkh in vivo (22). Recently, forkhead proteins have been implicated as nuclear targets for transforming growth factor-beta and insulin-like signaling (23-25).

We have earlier reported that freac-4 (26) and freac-9 (27) are two human forkhead genes that are predominately expressed in the kidney. The mouse homologue of freac-4, BF-2, has been shown to be essential for stromal mesenchyme differentiation during kidney morphogenesis (28). In this paper we demonstrate that the kidney expressed transcription factor Ets-1 is essential for regulation of freac-4. We also discuss a possible role for Ets-1 as an upstream regulator of freac-4 during kidney development.

    MATERIALS AND METHODS

Cell Culture, Transfections, and Reporter Gene Assays-- Cells were obtained through the American Tissue Culture Collection: COS-7 (monkey transformed kidney; CRL-165) and 293 (human embryonic kidney; CRL-1573). We have previously demonstrated that these cell lines express freac-4 transcripts (26). All cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc.). For transfections, different FREAC-4 luciferase constructs were used as described previously (26). A 1.6-kilobase pair HindIII restriction fragment of the human Ets-1 cDNA was subcloned into pCB6+ to be used as an expression construct for Ets-1 protein in transfection assays. A typical transient transfection contained 100 ng of luciferase reporter plasmid and 160-200 ng of cotransfected expression plasmid. These plasmids were diluted into 560 µl of OptiMEM together with 2 µg of LipofectAMINE (Life Technologies, Inc.) and added to cells cultured in a gelatin-coated 16-mm tissue culture well. Cell harvest and luciferase assay were performed according to Promega Corp. (Technical Bullentin 101). To compensate for differences in transfection efficiency, 10 ng of a beta -galactosidase-expressing plasmid, pCMVbeta gal (CLONTECH), was added to each transfection. beta -Galactosidase activity was measured using a Lumibeta -galactosidase assay (CLONTECH). A typical stable transfection contained 20 µg of linearized Ets-1 expression plasmid, diluted into 8 ml of OptiMEM together with 50 µg of Lipofectin (Life Technologies, Inc.) and added to cells cultured in a gelatin-coated 82-mm tissue culture dish. Medium was changed after ~20 h, and after another 24 h 800 µg of G418 sulfate/ml (LifeTechnologies, Inc.) was added to the medium. After 10-15 days resistant foci appeared.

In Vitro Mutagenesis-- A genomic DNA fragment spanning from nucleotides 2122 to 2485 was subcloned into pBluescript SK- (Stratagene). The three potential Ets-1 binding sites in this region were mutated with QuikChangeTM Site-directed Mutagenesis Kit (Stratagene) using the following primers: site number 1, CGAGAAGGGCTGATTTAATAGGCTTGCTTTCC and GGAAAGCAAGCCTATTAAATCAGCCCTTCTCG; site number 2, CCTAGGCTTGCTTTAATTCCCTCGGCAGCG and CGCTGCCGAGGGAATTAAAGCAAGCCTAGG; and site number 3, GCTATAAGCCGATTAAGGTCCGCCCTCTCC and GGAGAGGGCGGACCTTAATCGGCTTATAGC. Mutagenesis was verified by sequencing. The mutant promoters were then cloned into pGL2-Basic.

Protein Expression and Purification-- An Ets-1 expression vector, Delta N331 (30), was used to express the protein under the control of a T7 promoter in Escherichia coli BL21(DE3);pLysS cells as has earlier been described (29). In brief, T7 polymerase expression was induced with 1 mM isopropyl-beta -D-thiogalactopyranoside for 1 h at 37 °C, cells were lysed by sonication in a buffer containing 50 mM Tris, pH 7.9, 1 mM EDTA, 1 M KCl, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride. The soluble fraction was cleared by centrifugation, dialyzed into 20 mM sodium citrate, pH 5.3, 150 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, and 0.2 mM phenylmethylsulfonyl fluoride and applied to a DEAE-cellulose column. Purity of >90% was determined by Coomassie Blue staining.

DNase I Footprinting-- DNase I footprinting was performed with labeled restriction enzyme fragments corresponding to nucleotides 2251-2426 (Fig. 1 in Ref. 26). Plasmids were linearized with XhoI and 5'-labeled with [alpha -32P]dATP and [alpha -32P]dCTP using the Klenow enzyme. The probes were cut out from the plasmids with SacI and gel purified. 20,000 cpm Cerenkov of probe was added to a binding reaction with a final volume of 50 µl in the presence of various amounts of Ets-1 protein extract or bovine serum albumin (25 mM Tris·HCl, pH 7.8, 50 mM KCl, 0.5 mM EDTA, 0.5 mM dithiothreitol, 6.25 mM MgCl2, 2% polyvinyl alcohol, 10% glycerol, 5 µg of poly[d(I·C)]/ml) and incubated for 15 min in room temperature. DNase I digestion and work-up procedure followed the method of Jones et al. (30).

RNase Protection Assays-- A 257-base pair SacII restriction fragment spanning nucleotides 3719-3976 (Fig. 1 in Ref. 26) was used as a specific probe for freac-4. T3 RNA polymerase and [alpha -32P]CTP were used to label a cRNA antisense probe. Labeled antisense probe, approximately 170,000 cpm Cerenkov for each reaction, was added to 50 µg of total RNA in a hybridization buffer (80% formamide, 100 mM sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA) at 50 °C overnight. After digestion with RNase A and RNase T1, the protected fragment was electrophoresed on a 6% sequencing gel. A 262-base pair XhoI/SacI restriction fragment of the human cDNA for Ets-1 was subcloned and used to make cRNA antisense probe. The assay was carried out as outlined for freac-4 with the exception that 25 µg of total RNA was used. The beta -actin probe used was derived from the plasmid pTRI-Actin-Mouse (Ambion). RNA samples were treated with DNase I free of RNase activity.

    RESULTS

Cotransfections with an Ets-1 Expression Vector Induces an Increase in freac-4 Reporter Gene Activity-- Even though it has been clearly demonstrated that BF-2 (the mouse homologue of the human freac-4 gene) is essential for differentiation of the condensed mesenchyme into tubular epithelium during kidney formation (28), very little is known about upstream and downstream signaling in the freac-4/BF-2 pathway. We became interested in the transcription factor Ets-1 as a possible regulator of such a pathway because Ets-1 has been implicated as a regulator of gene expression in mesodermal cells that are involved in morphogenic processes such as organ formation (31). Ets-1 is widely expressed in the murine and chick embryo during kidney formation, and its expression pattern has been shown to include tubular structures of the mesonephric kidney as well as glomeruli in the developing kidney (32, 33). In a first experiment a -2273 freac-4 promoter reporter construct (FREAC-4-luc; Fig. 1; see also Fig. 3A) was used to transfect the kidney derived cell line COS-7. This construct contains 2273 nucleotides upstream of the transcription start. When increasing amounts of an Ets-1 expression plasmid was included in the transfections a clear induction (approximately 15-fold) could be demonstrated (Fig. 1). A dose-response pattern is present in the range of 0-50 ng of Ets-1 expression plasmid, whereas 200 ng of the same plasmid in no significant way changed the activation profile as compared with 50 ng of expression vector.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1.   A dose-response curve for FREAC-4-luc with 0-200 ng of Ets-1 expression plasmid generated in a cotransfection experiment using COS-7 cells. The amount of DNA in each transfection is 300 ng using an insert-less expression vector (Mock) to compensate for differences in amount of DNA. Luciferase activity in relative light units (RLU) is shown as the means of at least three independent transfections ± S.D.

The Ets-1 Inducibility Is Mapped to a -152 freac-4 Reporter Gene Construct That Contains Three Potential Ets-1 Binding Sites-- Two derivatives of the -2273 construct (FREAC-4-luc), -527-luc and -152-luc extending 527 and 152 nucleotides upstream of the transcription start (see Fig. 3A), were used to study the inducibility conferred by Ets-1 in cotransfection experiments. As can be seen in Fig. 2 FREAC-4-luc, -527-luc and -152-luc are all induced approximately 40-fold. Because the luciferase vector void of any freac-4 promoter sequence is not induced by Ets-1 cotransfections, we conclude that the freac-4 promoter sequence in -152-luc most likely contains binding sites for Ets-1 (Fig. 3B). A nucleotide frequency profile, derived from repetitive cycles of selection and amplification of a double stranded oligonucleotide template using recombinant Ets-1 protein (34), was used to identify potential Ets-1 binding sites in the -152-luc construct. Three potential Ets-1 binding sites are depicted in Fig. 3. The variation in induction seen between independent cotransfection experiments, e.g. ~15-fold (Fig. 1; see also Fig. 5) to ~40-fold (Fig. 2), was found to correlate with the total amount of DNA used in the transfections, i.e. a total amount of 200 ng (experiment in Fig. 2) gave reproducibly a ~40-fold induction, whereas 260 ng (see Fig. 5) to 300 ng (Fig. 1) in a similar manner gave a ~15-fold induction.


View larger version (7K):
[in this window]
[in a new window]
 
Fig. 2.   Cotransfections using COS-7 cells with 100 ng of either reporter constructs; FREAC-4-luc, -527 or -152 with 100 ng of an expression vector encoding Ets-1 or mock (void of insert). A luciferase reporter plasmid without any freac-4 promoter sequence was used as a control (vector). Reporter gene activity is expressed as relative activity with the activity of FREAC-4-luc cotransfected with mock set to 1.0. Values are the means of at least three independent transfections ± S.D.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   A, the three reporter constructs used extend to -2273, -527, and -152 respectively, relative to the start of transcription. The -152 construct contains three potential Ets-1 binding sites located at -95 to -104, -77 to -86, and -24 to -15; nucleotide numbering is as described by Ernstsson et al. (26). TATA motif and location of transcription start as described by Ernstsson et al. (26). B, the three potential Ets-1 binding sites in the freac-4 promoter show a high degree of sequence similarity to a consensus sequence based on sequences known to bind Ets-1 (34).

When the Potential Ets-1 Binding Sites in the freac-4 Promoter Are Mutated the Ets-1 Induction Is Attenuated-- To confirm the presence of Ets-1 binding sites within the -152 region of the freac-4 promoter, we set up a DNase I in vitro protection assay using a probe spanning from -152 to +23, relative the start of transcription (Fig. 3B; corresponding to nucleotides 2251-2426 of Fig. 1 in Ref. 26). Purified recombinant Ets-1 protein (rEts-1) was used (see "Materials and Methods"), and three protected regions could be demonstrated Fig. 4. These three regions, -12 to -23, -77 to -86, and -93 to -102, are all centered over the conserved GGAA motif in the three predicted Ets-1 sites as discussed above. To further analyze the role these sites play in Ets-1 induction of reporter gene activity derived from the -152-luc construct, we introduced mutations in each of these sites. We chose to change the obligatory purine dinucleotide GG of the GGAA core motif for Ets-1 binding sites into the pyrimidine dinucleotide TT (34, 35). As can be seen in Fig. 5 each of these mutations drastically reduced the Ets-1-mediated induction of reporter gene activity with ~60-70%. When all three mutations were combined, a further decrease in reporter gene activity was noted to less than 20% as compared with that of the wild type construct. Similar levels of reduction in reporter gene activity, after mutation of Ets-1 binding sites, have been reported for the rat prolactin promoter (36) as well as for the NFkappa B1 promoter (37).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   DNase I footprint using recombinant Ets-1 protein (rEts-1) and bovine serum albumin (BSA). Three regions are protected: -12 to -23, -77 to -86, and -93 to -102. These three regions show a high sequence similarity with sequences known to interact with Ets-1 (see Fig. 3B). For details see "Experimental Procedures."


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5.   Cotransfections using wild type (wt) -152 freac-4 promoter construct or reporter constructs in which the three Ets-1 binding sites have been mutated. m#1, -93 to -102; m#2, -77 to -86; m#3, -12 to -23. In all instances the obligatory GGA motif in Ets-binding sites have been changed to TTA (35). In one construct (m#1+2+3) all three mutations have been introduced.

Expression of Ets-1 in 293 Cells, a Human Embryonic Kidney Cell Line Induces freac-4 Expression-- In an attempt to find out if an increased Ets-1 expression would be sufficient per se to up-regulate freac-4 mRNA levels, in a kidney-derived cell line, we stably transfected 293 cells with an Ets-1 expression vector also encoding NeoR to facilitate selection of Ets-1 expressing clones. In Fig. 6 we demonstrate that cell clones with an increased Ets-1 mRNA level also have a higher level of freac-4 mRNA. Despite the fact that this experimental approach not can differ between indirect or direct effects on the freac-4 promoter, these results are compatible with the view that Ets-1 acts as a positive upstream regulator of freac-4 expression and that the Ets-1-dependent activation is mediated through Ets-1 sites present in the freac-4 promoter.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   RNase protection assay. An expression vector encoding Ets-1 and NeoR have been stably transfected in to the human embryonic kidney cell line 293. G418-resistant clones were assayed for amount of freac-4 mRNA. Clones transfected with an expression vector void of Ets-1 coding sequence are shown in lane A. Shown in lanes B and C are two clones that are derived from transfections using a vector encoding Ets-1. To ensure equal loading of total RNA in each experiment, the RNA samples were assayed for expression of beta -actin.


    DISCUSSION

The Ets-1 proto-oncogene, the founding member of the Ets-family of transcription factors, was originally described as the cellular homologue of the v-ets oncogene, which is translated as a 135-kDa gag-myb-ets fusion protein from the replication-deficient retrovirus E26 in chickens (38-40). Members of this family play important roles in regulating gene expression in response to multiple developmental and mitogenic signals (41-43). Previous studies in mammals have demonstrated that Ets-1 is a transcription factor important during development of lymphoid cells and their subsequent activation (44, 45). Other sites of Ets-1 expression are vascular structures, the central nervous system (including the closed neural tube) as well as the developing kidney (32, 33). Freac-4 and its mouse homologue BF-2 have a more restricted expression pattern, as compared with Ets-1, including testis, spinal cord, brain, and the developing kidney (26, 28, 46, 47).

In this paper we have demonstrated the presence of at least three Ets-1 binding sites within the freac-4 promoter (Figs. 3B and 4). When an Ets-1 expression plasmid is cotransfected with various freac-4 promoter reporter constructs a clear induction is noted (~15-40-fold; Figs. 1 and 2). When the three Ets-1 binding sites present on the -152-luc construct are mutated, the Ets-1 induction is reduced by a factor of ~6 as compared with the wild type promoter (Fig. 5). This is consistent with Ets-1 as a major regulator/activator of freac-4 gene expression, other cis-elements and trans-activators are also likely to contribute, because we have previously shown that both p53 and WT-1 (Wilms' tumor suppressor gene-1) are involved in the regulation of freac-4 (26).

In transfection assays, for practical reasons, only limited amounts of promoter sequence can be used. The expression level of transactivators used in cotransfection assays is also a factor to consider when interpreting the results of such experiments. To investigate whether or not an increased level of wild type Ets-1 mRNA expression would be sufficient to up-regulate freac-4 expression, we stably transfected the human embryonic kidney cell line 293 with an Ets-1 expression vector. Total RNA was then used in a RNase protection assay, and we could demonstrate an increased level of freac-4 mRNA in cell clones with an increased level of Ets-1 mRNA (Fig. 6). We would also like to point out that untransfected 293 cells have a low level of Ets-1 expression (a faint band in lane A of Fig. 6). Taken together, these experiments show that it is possible that Ets-1 could act as an upstream regulator of FREAC-4 expression in kidney cells. This notion gains further support from the fact that Ets-1 is expressed during early kidney development in the tubular structures of mesonephros day E10.5 pc (33), whereas the early stages of kidney development in BF-2 -/- mice remain unaffected (28). BF-2 is expressed at E12.5 pc in a population of cells that surround the condensation of nephrogenic mesenchyme (28). Thus the temporal appearance of Ets-1 and BF-2 in the developing kidney does not exclude Ets-1 as a possible upstream regulator in the BF-2/Freac-4 pathway. In Fig. 7 we have outlined a hypothetical regulative pathway in which Ets-1, p53, WT-1, and BF2/freac-4 participate. This pathway is based on the experiments described in this paper as well as work by others: (i) p53 is known to repress expression of both Ets-1 (48) and freac-4 (26); (ii) p53 is expressed in the developing kidney during embryogenesis (49); (iii) transgenic mice expressing wild type p53, under control of the mouse mammary tumor virus promoter, undergo progressive renal failure due to defective kidney differentiation with small kidneys with about half of the normal number of nephrons (50); (iv) WT-1 up-regulates freac-4 expression (26); and (v) in WT-1 -/- mice metanephrogenic mesenchyme remains uninduced and no kidney is formed (51). Clearly more research is needed to elucidate the pathway through which BF-2/FREAC-4 participates in the regulation of nephrogenesis, and we hope that the results presented in this paper will contribute to a better understanding of this regulative pathway.


View larger version (7K):
[in this window]
[in a new window]
 
Fig. 7.   A hypothetical regulative pathway for FREAC-4/BF-2.


    ACKNOWLEDGEMENT

We thank Barbara Graves for kindly sharing Ets-1 plasmids with us.

    FOOTNOTES

* This work was supported by grants from the Swedish Medical Research Council, the Swedish Foundation for Strategic Research, the IngaBritt and Arne Lundberg Foundation, the Juvenile Diabetes Foundation, and the Magnus Bergvall Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Molecular Biology, Lundberg Laboratory, Medicinareg. 9C, S-413 90 Göteborg, Sweden. Tel.: 46-31-7733804; Fax: 46-31-7733801; E-mail: sven.enerback{at}molbio.gu.se.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
REFERENCES

  1. Donaldson, L. W., Petersen, J. M., Graves, B. J., and McIntosh, L. P. (1994) Biochemistry 3307, 13509-13516
  2. Liang, H., Olejniczak, E. T., Mao, X., Nettesheim, D. G., Yu, L., Thompson, C. B., and Fesik, S. W. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11655-11659[Abstract/Free Full Text]
  3. Clark, K. L., Halay, E. D., Lai, E., and Burley, S. K. (1993) Nature 364, 412-420[CrossRef][Medline] [Order article via Infotrieve]
  4. Hacker, U., Grossniklaus, U., Gehring, W. J., and Jackle, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8754-8758[Abstract/Free Full Text]
  5. Weigel, D., Jurgens, G., Kuttner, F., Seifert, E., and Jackle, H. (1989) Cell 57, 645-658[CrossRef][Medline] [Order article via Infotrieve]
  6. Kaufmann, E., and Knochel, W. (1996) Mech. Dev. 57, 3-20[CrossRef][Medline] [Order article via Infotrieve]
  7. Li, J., and Vogt, P. K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4490-4494[Abstract/Free Full Text]
  8. Parry, P., Wei, Y., and Evans, G. (1994) Genes Chromosom. Cancer 11, 79-84[Medline] [Order article via Infotrieve]
  9. Shapiro, D. N., Sublett, J. E., Li, B., Downing, J. R., and Naeve, C. W. (1993) Cancer Res. 53, 5108-5112[Abstract/Free Full Text]
  10. Downing, J. R., Khandekar, A., Shurtleff, S. A., Head, D. R., Parham, D. M., Webber, B. L., Pappo, A. S., Hulshof, M. G., Conn, W. P., and Shapiro, D. N. (1995) Am. J. Pathol. 146, 626-634[Abstract]
  11. Galili, N., Davis, R. J., Fredericks, W. J., Mukhopadhyay, S., Rauscher, F. d., Emanuel, B. S., Rovera, G., and Barr, F. G. (1993) Nat. Genet. 5, 230-235[CrossRef][Medline] [Order article via Infotrieve]
  12. Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J., and Zaret, K. S. (1993) Development 119, 1301-1315[Abstract]
  13. Ruiz i Altaba, A., Prezioso, V. R., Darnell, J. E., and Jessell, T. M. (1993) Mech. Dev. 44, 91-108[CrossRef][Medline] [Order article via Infotrieve]
  14. Sasaki, H., and Hogan, B. L. (1993) Development 118, 47-59[Abstract]
  15. Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., Hoodless, P., Prezioso, V. R., Jessell, T. M., and Darnell, J., Jr. (1994) Cell 78, 575-588[CrossRef][Medline] [Order article via Infotrieve]
  16. Xuan, S., Baptista, C. A., Balas, G., Tao, W., Soares, V. C., and Lai, E. (1995) Neuron 14, 1141-1152[CrossRef][Medline] [Order article via Infotrieve]
  17. Clevidence, D. E., Overdier, D. G., Tao, W., Qian, X., Pani, L., Lai, E., and Costa, R. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3948-3952[Abstract/Free Full Text]
  18. Enerbäck, S., Ohlsson, B. G., Samuelsson, L., and Bjursell, G. (1992) Mol. Cell. Biol. 12, 4622-4633[Abstract/Free Full Text]
  19. Hellqvist, M., Mahlapuu, M., Samuelsson, L., Enerbäck, S., and Carlsson, P. (1996) J. Biol. Chem. 271, 4482-4490[Abstract/Free Full Text]
  20. Pani, L., Overdier, D. G., Porcella, A., Qian, X., Lai, E., and Costa, R. H. (1992) Mol. Cell. Biol. 12, 3723-3732[Abstract/Free Full Text]
  21. Yuasa, J., Hirano, S., Yamagata, M., and Noda, M. (1996) Nature 382, 632-635[CrossRef][Medline] [Order article via Infotrieve]
  22. Lehmann, M., and Korge, G. (1996) EMBO J. 15, 4825-4834[Medline] [Order article via Infotrieve]
  23. Chen, X., Rubock, M. J., and Whitman, M. (1996) Nature 383, 691-696[CrossRef][Medline] [Order article via Infotrieve]
  24. Lin, K., Dorman, J. B., Rodan, A., and Kenyon, C. (1997) Science 278, 1319-1322[Abstract/Free Full Text]
  25. Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A., and Ruvkun, G. (1997) Nature 389, 994-999[CrossRef][Medline] [Order article via Infotrieve]
  26. Ernstsson, S., Pierrou, S., Hulander, M., Cederberg, A., Hellqvist, M., Carlsson, P., and Enerbäck, S. (1996) J. Biol. Chem. 271, 21094-21099[Abstract/Free Full Text]
  27. Ernstsson, S., Betz, R., Lagercrantz, S., Larsson, C., Ericksson, S., Cederberg, A., Carlsson, P., and Enerbäck, S. (1997) Genomics 46, 78-85[CrossRef][Medline] [Order article via Infotrieve]
  28. Hatini, V., Huh, S. O., Herzlinger, D., Soares, V. C., and Lai, E. (1996) Genes Dev. 10, 1467-1478[Abstract/Free Full Text]
  29. Petersen, J. M., Skalicky, J. J., Donaldson, L. W., McIntosh, L. P., Alber, T., and Graves, B. J. (1995) Science 269, 1866-1869[Abstract/Free Full Text]
  30. Jones, K. A., Yamamoto, K. R., and Tjian, R. (1985) Cell 42, 559-572[CrossRef][Medline] [Order article via Infotrieve]
  31. Kola, I., Brookes, S., Green, A. R., Garber, R., Tymms, M., Papas, T. S., and Seth, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7588-7592[Abstract/Free Full Text]
  32. Maroulakou, I. G., Papas, T. S., and Green, J. E. (1994) Oncogene 9, 1551-1565[Medline] [Order article via Infotrieve]
  33. Queva, C., Leprince, D., Stehelin, D., and Vandenbunder, B. (1993) Oncogene 8, 2511-2520[Medline] [Order article via Infotrieve]
  34. Nye, J. A., Petersen, J. M., Gunther, C. V., Jonsen, M. D., and Graves, B. J. (1992) Genes Dev. 6, 975-990[Abstract/Free Full Text]
  35. Thompson, C. B., Wang, C. Y., Ho, I. C., Bohjanen, P. R., June, C. H., Miesfeldt, S., Zhang, L., Nabel, G. J., Karpinski, B., and Leiden, J. M. (1992) Mol. Cell. Biol. 12, 1043-1053[Abstract/Free Full Text]
  36. Bradford, A. P., Conrad, K. E., Wasylyk, B., and Gutierrez-Hartmann, A. (1995) Mol. Cell. Biol. 15, 2849-2857[Abstract]
  37. Lambert, P. F., Ludford-Menting, M. J., Deacon, N. J., Kola, I., and Doherty, R. R. (1997) Mol. Biol. Cell 8, 313-323[Abstract]
  38. Radke, K., Beug, H., Kornfeld, S., and Graf, T. (1982) Cell 31, 643-653[CrossRef][Medline] [Order article via Infotrieve]
  39. Leprince, D., Gegonne, A., Coll, J., de Tasine, C., Schneeberger, A., Lagrou, C., and Stehelin, D. (1983) Nature 306, 395-397[CrossRef][Medline] [Order article via Infotrieve]
  40. Nunn, M. F., Seeburg, P. H., Moscovici, C., and Duesberg, P. H. (1983) Nature 306, 391-395[CrossRef][Medline] [Order article via Infotrieve]
  41. Macleod, K., Leprince, D., and Stehelin, D. (1992) Trends Biochem. Sci. 17, 251-256[CrossRef][Medline] [Order article via Infotrieve]
  42. Lai, Z. C., and Rubin, G. M. (1992) Cell 70, 609-620[CrossRef][Medline] [Order article via Infotrieve]
  43. Hipskind, R. A., Rao, V. N., Mueller, C. G., Reddy, E. S., and Nordheim, A. (1991) Nature 354, 531-534[CrossRef][Medline] [Order article via Infotrieve]
  44. Bath, N. K., Komschlies, K. L., Fujiwara, S., Fisher, R. J., Mathieson, B. J., Gregorio, T. A., Young, H. A., Kasik, J. W., Ozato, K., and Papas, T. S. (1989) J. Immunol. 142, 672-678[Abstract]
  45. Muthusamy, N., Barton, K., and Leiden, J. M. (1995) Nature 377, 639-642[CrossRef][Medline] [Order article via Infotrieve]
  46. Hatini, V., Tao, W., and Lai, E. (1994) J. Neurobiol. 25, 1293-1309[CrossRef][Medline] [Order article via Infotrieve]
  47. Pierrou, S., Hellqvist, M., Samuelsson, L., Enerbäck, S., and Carlsson, P. (1994) EMBO J. 1354, 5002-5012
  48. Iotsova, V., Crepieux, P., Montpellier, C., Laudet, V., and Stehelin, D. (1996) Oncogene 13, 2331-2337[Medline] [Order article via Infotrieve]
  49. Schmid, P., Lorenz, A., Hameister, H., and Montenarh, M. (1991) Development 113, 857-865[Abstract]
  50. Godley, L. A., Kopp, J. B., Eckhaus, M., Paglino, J. J., Owens, J., and Varmus, H. E. (1996) Genes Dev. 10, 836-850[Abstract/Free Full Text]
  51. Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D., and Jaenisch, R. (1993) Cell 74, 679-691[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
HypertensionHome page
P. Kumar and K. N. Pandey
Cooperative Activation of Npr1 Gene Transcription and Expression by Interaction of Ets-1 and p300
Hypertension, July 1, 2009; 54(1): 172 - 178.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Transcriptional Regulation of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter by Transcriptional Activators and Repressor
Mol. Endocrinol., March 1, 2009; 23(3): 373 - 387.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. D. Pearse, R.-X. Tian, J. Nigro, J. B. Iorgulescu, L. Puzis, and E. A. Jaimes
Angiotensin II increases the expression of the transcription factor ETS-1 in mesangial cells
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1094 - F1100.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. T. Berg, L. J. Myers, M. A. Richardson, G. Sandusky, and B. W. Grinnell
Smad6s Regulates Plasminogen Activator Inhibitor-1 through a Protein Kinase C-{beta}-dependent Up-regulation of Transforming Growth Factor-{beta}
J. Biol. Chem., April 15, 2005; 280(15): 14943 - 14947.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Y. Sun, S. Koo, N. White, E. Peralta, C. Esau, N. M. Dean, and R. J. Perera
Development of a micro-array to detect human and mouse microRNAs and characterization of expression in human organs
Nucleic Acids Res., December 22, 2004; 32(22): e188 - e188.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Dahle, L. M. Gronning, A. Cederberg, H. K. Blomhoff, N. Miura, S. Enerback, K. A. Tasken, and K. Tasken
Mechanisms of FOXC2- and FOXD1-mediated Regulation of the RIalpha Subunit of cAMP-dependent Protein Kinase Include Release of Transcriptional Repression and Activation by Protein Kinase Balpha and cAMP
J. Biol. Chem., June 14, 2002; 277(25): 22902 - 22908.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
E. L. Dahl and R. T. Mulcahy
Cell-Type Specific Differences in Glutamate Cysteine Ligase Transcriptional Regulation Demonstrate Independent Subunit Control
Toxicol. Sci., June 1, 2001; 61(2): 265 - 272.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. NAITO, M. S. RAZZAQUE, A. NAZNEEN, D. LIU, H. NIHEI, T. KOJI, and T. TAGUCHI
Renal Expression of the Ets-1 Proto-oncogene during Progression of Rat Crescentic Glomerulonephritis
J. Am. Soc. Nephrol., December 1, 2000; 11(12): 2243 - 2255.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
A. Calmont, K. Reichwald, P. Ronco, and J. Rossert
Identification of a Short cis-Acting Element in the Human Vasopressin Type 2 Receptor Gene Which Confers High-Level Expression of a Reporter Gene Specifically in Collecting Duct Cells
Mol. Endocrinol., October 1, 2000; 14(10): 1682 - 1695.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
L. Beck and D. Markovich
The Mouse Na+-Sulfate Cotransporter Gene Nas1. CLONING, TISSUE DISTRIBUTION, GENE STRUCTURE, CHROMOSOMAL ASSIGNMENT, AND TRANSCRIPTIONAL REGULATION BY VITAMIN D
J. Biol. Chem., April 14, 2000; 275(16): 11880 - 11890.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cederberg, A.
Right arrow Articles by Enerbäck, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cederberg, A.
Right arrow Articles by Enerbäck, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement