|
J Biol Chem, Vol. 274, Issue 1, 211-217, January 1, 1999
Role of CCAAT Enhancer-binding Protein in the Thyroid
Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene
Transcription*
Edwards A.
Park §,
Shulan
Song ,
Charles
Vinson¶, and
William J.
Roesler
From the Department of Pharmacology, College of
Medicine, University of Tennessee Health Science Center, Memphis,
Tennessee 38163, the Department of Biochemistry, University of
Saskatchewan, Saskatoon, Saskatchewan S7N 5E5, Canada, and the
¶ Laboratory of Biochemistry, NCI, National Institutes of Health,
Bethesda, Maryland 20892
 |
ABSTRACT |
Transcription of the gene for phosphoenolpyruvate
carboxykinase (PEPCK) is stimulated by thyroid hormone
(T3) and cAMP. Two DNA elements in the PEPCK promoter
are required for T3 responsiveness including a thyroid
hormone response element and a binding site called P3(I) for the CCAAT
enhancer-binding protein (C/EBP). Both the and isoforms of
C/EBP are highly expressed in the liver. C/EBP contributes to the
liver-specific expression and cAMP responsiveness of the PEPCK gene. In
this study, we examined the ability of C/EBP when bound to the P3(I)
site to regulate PEPCK gene expression. We report that C/EBP can
stimulate basal expression and participate in the induction of PEPCK
gene transcription by T3 and cAMP. The cAMP-responsive
element-binding protein and AP1 proteins that contribute to the
induction by cAMP are not involved in the stimulation by
T3. A small region of the transactivation domain of
C/EBP is sufficient for the stimulation of basal expression and cAMP responsiveness. Our results suggest that C/EBP and C/EBP are functionally interchangeable when bound to the P3(I) site of the PEPCK promoter.
 |
INTRODUCTION |
Expression of the phosphoenolpyruvate carboxykinase
(PEPCK)1 gene is controlled
by a variety of hormones including glucagon (via cAMP), thyroid hormone
(T3), glucocorticoids, retinoic acid (RA), and insulin (1).
Our studies have been directed at elucidating the mechanisms by which
T3 and cAMP stimulate the expression of the gene for PEPCK
in the liver. Regulation of gene transcription by T3 is
mediated through the binding of liganded T3 receptors (TR)
to T3 response elements (TRE) in the promoters of genes (2, 3). The TR binds to DNA primarily as a heterodimer with the retinoid X
receptor (RXR) (3, 4). The ligand binding, dimerization, and
transactivation domains of TR are contained within a broad region
between amino acids 160 and 456 (3, 5). Binding of T3 by
the TR results in conformational changes in the receptor and alteration
of its transactivation properties (5). There are two isoforms and
of the TR, and the TR is highly expressed in the liver (2, 6).
Two elements in the PEPCK promoter are required for the full induction
of PEPCK transcription by T3 (see Fig. 1A). The
first is the PEPCK-T3-responsive element (PTRE) contained
within nucleotides 330 to 319, and the second is a binding site for
the CCAAT enhancer-binding protein (C/EBP) called P3(I) between 250
and 234 (7, 8). The PTRE has an unusual architecture consisting of
two direct repeats separated by zero nucleotides (7). Mutation of
either the PTRE or the P3(I) site eliminates the T3
response (8).
Several elements in the promoter are involved in the cAMP induction of
PEPCK transcription including a cAMP-responsive element (CRE) at 90
to 82, the P3(I) site, and an AP-1 binding site at 260 to 250
(Fig. 1A) (9, 10). Three families of transcription factors
that contribute to the cAMP stimulation include the cAMP-responsive element-binding protein (CREB), AP-1 proteins, and C/EBP (11). The
P3(I) site is central to both the T3 and cAMP induction of PEPCK transcription. In vivo studies have confirmed the
importance of the P3(I) site in regulation of PEPCK gene expression.
Transgenic mice carrying a PEPCK-bovine growth hormone fusion gene with
a mutation in the P3(I) site have reduced hepatic expression of the
bovine growth hormone transgene and reduced cAMP responsiveness of the
PEPCK-bovine growth hormone reporter vector (12).
C/EBP proteins constitute a family of transcription factors of which
the and isoforms are highly expressed in the liver (13-15).
C/EBP is expressed primarily in liver and adipose tissue and
regulates the expression of hepatic genes involved in energy metabolism
(16, 17). In addition to participating in hormonal responsiveness,
C/EBP proteins play an important role in PEPCK gene transcription by
contributing to the induction of the PEPCK gene at birth and directing
liver-specific expression (11, 17, 18). Our early studies showed that
C/EBP and could bind to the CRE, P3(I), and P4(I) elements in
the PEPCK promoter (15, 19). C/EBP can participate in the
T3 and cAMP induction of PEPCK transcription, and recent
studies have shown that C/EBP can mediate a cAMP induction without
CREB being present (8, 11, 20).
Since C/EBP is highly expressed in the liver and binds to identical
sites in the PEPCK promoter, we examined whether C/EBP when bound to
the P3(I) site could participate in the hormonal induction of PEPCK
transcription. Our data demonstrate that C/EBP can stimulate PEPCK
gene expression through the P3(I) site and modulate hormone
responsiveness. The results indicate that the or isoforms of
C/EBP have similar functions when bound to this element.
 |
MATERIALS AND METHODS |
Gel Mobility Assays--
Gel mobility assays were conducted on
5% non-denaturing polyacrylamide gels (80:1 acrylamide:bisacrylamide)
in 22 mM Tris and 190 mM glycine at 4 °C
(8). Double-stranded oligomers were labeled with Klenow enzyme and
[ -32P]dCTP (8). The binding reactions were performed
at room temperature in 10% glycerol, 80 mM KCl, 25 mM Tris (pH 7.4), 1 mM EDTA, and 1 mM dithiothreitol. Each binding reaction contained 1.0 µg
of poly(dI-dC) as nonspecific competitor and proteins as indicated. Nuclear proteins were prepared from HepG2 cells by the method of
Shapiro et al. (21). Antibodies to C/EBP and RXR were
obtained from Santa Cruz Biochemicals. The antibody to C/EBP was a
generous gift from Anna May Diehl.
Construction of CAT and Luciferase Vectors--
The ligation of
the PEPCK promoter from 490 to +73 to the CAT reporter gene
( 490-PCAT) has been described (7). To introduce the Gal4 binding site
into the P3(I) site of the PEPCK promoter ( 490-P3G4), the 490-PCAT
vector containing a BstIIE site in the P3(I) element
( 490P3(I)-PCAT) (8) was digested with BstIIE and
SauI and the double-stranded oligomer containing the
sequence ggttacctcggagtactgtcctccgt was inserted into nucleotides 248 to 223. The 490 to +73 region of the PEPCK promoter was ligated in
front of the luciferase reporter gene by removing the PEPCK promoter
fragment from 490-PCAT by digestion with KpnI and
BglII and ligating into the polylinker of pGL3 basic (Promega).
The Gal4 site was introduced into the TRE region of 330-PTRE/G4 CAT
by PCR amplification with the 5' primer,
ccctctagatcggaggtactgtcctccgtctgac, containing the altered nucleotides
and a 3' primer, ttagatctcagagcgtctcgcc (+73 to +52), which included
the BglII site at +73. The 5' primer introduced a
XbaI site. The amplified promoter fragment was digested with
XbaI and BglII and ligated in front of the CAT
reporter gene. The sequence was confirmed by sequence analysis at the
St. Jude Center for Biotechnology.
Construction of Gal4-C/EBP Expression Vectors--
Gal4-C/EBP
1-108 and 1-66 were constructed by PCR amplification. The forward
primer, which contained an EcoRI site and the first 18 nucleotides of the rat C/EBP cDNA,
tccgaattcatgcaccgcctgctggcctgggac, was used in PCR amplification.
Additionally, two reverse primers containing PstI sites and
the nucleotides representing amino acids 108-102
(gagctgcaggtaaccgtagtcggccggcttc) or 66-59
(gagctgcagcagctaggggctgaagtcgatg) were used. Following PCR
amplification with the forward and reverse primers and the rat C/EBP
cDNA as template (14), the appropriate DNA fragment was isolated
from an agarose gel and digested with EcoRI and
PstI. This DNA fragment was ligated into the mammalian Gal4
DNA expression vector called pM (CLONTECH). To
create the Gal4-C/EBP 1-25, the Gal4-C/EBP 1-108 vector was
digested with BalI and HindIII. The restriction
site overhangs were filled in with Klenow enzyme and the four
deoxynucloetide triphosphates, and then the plasmid was religated. The
Gal4-C/EBP 1-264 was created by digestion of 1-108 with
BalI and PstI. The BalI to PstI fragment of C/EBP cDNA containing amino acids
25-264 was ligated into this site. The Gal4-C/EBP 1-138 were
generated by digestion of 1-264 with HindIII and
SfuI. These restriction site overhangs were filled in with
Klenow enzyme and religated. Construction of the Gal4-C/EBP vectors
is given elsewhere (11, 20). The sequence of all Gal4-C/EBP vectors
was confirmed by sequence analysis.
Cell Transfections, Luciferase Assays, and CAT Assays--
HepG2
cells were transfected by calcium phosphate precipitation as described
previously (8). Each transfection contained 5.0 µg of PEPCK-CAT
vector, 5.0 µg of the expression vector RSV-TR , and 2.0 µg of
SV40- -gal as a transfection control. Total DNA concentration was
kept constant by the addition of pBluescript (Stratagene). CAT assays
were conducted with [3H]chloramphenicol and
n-butyryl-coenzyme A using the xylene phase extraction
method (8). All transfections were performed in duplicate and repeated
three to six times. For the transfections with the luciferase vectors,
the calcium phosphate precipitate included 3.0 µg of
PEPCK-luciferase, 1.0 µg of an expression vector for the catalytic
subunit of protein kinase A, and 1.0 µg of SV40- -gal. Luciferase
assays were conducted with the luciferin reagent as outlined by the
manufacturer (Promega).
 |
RESULTS |
The goal of these studies was to evaluate the role of C/EBP
proteins bound to the P3(I) site in modulating PEPCK gene expression. To demonstrate that C/EBP proteins are involved in the T3
induction of PEPCK transcription, we tested a set of specific dominant
negative vectors. A-C/EBP is a dominant negative C/EBP vector, which
has the C/EBP leucine zipper attached to an acidic amphipathic helix containing 4 heptad repeats (22). The amphipathic helix interacts with
the basic region of C/EBP proteins. A-C/EBP forms a strong non-DNA
binding heterodimer and will inhibit all C/EBP proteins (22). A-CREB is
a dominant negative CREB protein with a CREB leucine zipper and an
amphipathic helix (23). A-Fos is a dominant negative Jun vector with
the Fos leucine zipper and an amphipathic helix (24). To examine the
effect of these dominant negative proteins on the T3
responsiveness of the PEPCK gene, a PEPCK-CAT vector containing 490 base pairs of the PEPCK promoter driving the CAT reporter gene
( 490-PCAT) was cotransfected with three dominant negative vectors
(Table I). The addition of T3
stimulated the 490-PCAT vector 3.5-fold. Cotransfection with A-C/EBP
inhibited the 3-4-fold induction of 490-PCAT by T3. The
dominant negative CREB did not affect the induction by T3,
and cotransfection with the dominant negative Jun actually improved the
T3 response from 3.5-fold to 9-fold. Although the reason
for the enhanced responsiveness is not clear, it has been shown that
C/EBP and Fos/Jun can bind to the P3(II) and P4(I) sites in the PEPCK
promoter (15). Inhibition of the Fos/Jun binding may allow increased
binding of C/EBP proteins. When the PTRE was converted to an optimal
TRE containing a direct repeat of the AGGTCA motif separated by four
nucleotides (DR4) in the context of the PEPCK promoter, the dominant
negative C/EBP vector still inhibited the T3 induction
(data not shown). Therefore, the inhibition of the T3
stimulation by A-C/EBP is dependent not on the specific sequence of the
PTRE but on its context within the PEPCK promoter.
View this table:
[in this window]
[in a new window]
|
Table I
Dominant negative C/EBP proteins inhibit the thyroid hormone induction
of PEPCK gene transcription
HepG2 cells were transfected with 5 µg of PEPCK-CAT vector
( 490-PCAT), 5 µg of RSV-TR , 5 µg of dominant negative
expression vector for either C/EBP (A-C/EBP), CREB (A-CREB), or Jun
(A-Fos), and 2.0 µg of SV40- -gal. For the transfections with
luciferase vectors, HepG2 cells were transfected with 3 µg of
SV40-luciferase (DR4X2 SV40-Luc), 3 µg of RSV-TR , 3 µg of
dominant negative vector, and 1 µg of SV40- -gal. Following
transfection, the cells were placed in DMEM containing 10%
charcoal-stripped fetal calf serum. Thyroid hormone (T3) was
added at a concentration of 100 nM for 48 h prior to
harvesting for CAT assays. All transfections were repeated three to
five times in duplicate. The results are presented as the -fold
induction by T3 ± S.E.
|
|
As a control, two copies of a consensus TRE containing a DR4 motif were
ligated in front of the enhancerless SV40 promoter driving the
luciferase reporter gene and transfected into HepG2 cells with the
three dominant negative proteins. Transcription of the SV40-luciferase
vector was stimulated 11-fold by T3 (Table I). None of the
dominant negative vectors decreased the T3 response. In
fact, the T3 induction of the SV40-luciferase vector was
increased in the presence of A-C/EBP. These observations indicate that
the role of C/EBP in T3 responsiveness is specific to the
PEPCK gene and that the inhibition of PEPCK-CAT by A-C/EBP is not an
inhibition of the TR. We have used both the CAT and luciferase reporter
genes in these studies. Our results are similar with either reporter gene. Generally, we have used the CAT gene for our studies with T3 and PEPCK promoter so that we can easily compare our
results with our previous work. Our recent experiments with cAMP and
the PEPCK promoter have been conducted with the luciferase gene.
Previous studies had shown that C/EBP, CREB, and AP-1 proteins were
involved in the stimulation of PEPCK transcription by cAMP (9). To
determine whether dominant negative vectors for C/EBP, CREB, or Jun
would affect the cAMP response, HepG2 cells were cotransfected with a
mammalian expression vector for the catalytic subunit of protein kinase
A (PKA), 490 PEPCK-luciferase ( 490-PLuc), and the dominant negative
vectors. Overexpression of PKA increased the luciferase activity
6-fold, and this stimulation was reduced by each dominant negative
protein (Table II). These results confirm
that the cAMP induction requires all three proteins and support the
mutational studies of the PEPCK gene in which disruption of CRE, P3(I),
P3(II), or P4(I) decreased the induction by cAMP (9, 10). The A-C/EBP
and A-Fos vectors decreased the basal expression of the PEPCK gene,
while A-CREB did not reduce basal expression.
View this table:
[in this window]
[in a new window]
|
Table II
Dominant negative C/EBP, CREB, and Jun proteins inhibit the cAMP
induction of PEPCK gene transcription
HepG2 cells were transfected with 3 µg of a PEPCK-luciferase gene
( 490-PLuc), 1 µg of an expression vector for the catalytic subunit
of protein kinase A (PKA), 1 µg of a dominant negative expression
vector for either C/EBP (A-C/EBP), CREB (A-CREB), or Jun (A-Fos), and 1 µg of SV40- gal. The cells were harvested 36 h after
transfection. The luciferase activity was corrected for protein content
of the cell extract and transfection efficiency. All transfections were
performed three to five times in duplicate. The inductions by PKA are
presented as -fold induction ± S.E. To assess basal
transcription, the 490-PLuc vector in the absence of a dominant
negative vector was assigned a value of 1.0, and the effect of the
A-vectors was determined by comparison with this activity.
|
|
To test whether the DNA binding domain of the TR was required for
the T3 induction of PEPCK transcription, the PTRE was
converted into a Gal4 binding site to create 330 PTRE/G4-PCAT (see
Fig. 1A). This CAT vector was
cotransfected with a Gal4-TR mammalian expression vector, which has
the ligand binding/transactivation domain of the TR (amino acids
168-456) fused to the Gal4 DNA binding domain (25). The Gal4-TR
will bind to the Gal4 site in the PEPCK-CAT vector. An 80-fold
stimulation of PEPCK-CAT activity was obtained (Table
III). Even with the robust T3
induction obtained with the Gal4-TR vector, mutation of the P3(I)
site ( 330 PTRE/G4-P3 M PCAT) eliminated the
T3 response. Cotransfection of 330 PTRE/G4-PCAT with
A-C/EBP also severely decreased the T3 induction (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1.
Models of PEPCK reporter genes and
Gal4-C/EBP expression vectors. A, the names of the
various vectors used in these studies is indicated at left.
The 490 PEPCK vectors contains 490 bp of the PEPCK promoter ligated
to either the CAT reporter gene (CAT) or the luciferase
reporter gene (Luc). The binding sites indicated above the
promoter include the PEPCK T3 response element
(PTRE), the C/EBP binding site called P3(I), the cAMP
response element (CRE), the AP-1 site called P3(II), the P4
site ,and the Gal4 binding site (Gal4). The DR4 × 2 SV40 vector contains two copies of a direct repeat or the AGGTCA motif
separated by 4 nucleotides ligated to the SV40 enhancerless promoter.
B, the sequence of the P3(I) region between nucleotides
254 and 230 (P3(I) WT) is shown. The core C/EBP binding motif is
underlined. Various mutations in the P3(I) region are shown
below, and the mutated nucleotides are
underlined. The P3G4 sequence contains the Gal4 DNA binding
element. C, the Gal4-C/EBP expression vectors are shown.
At the top is a model of the C/EBP protein with the
numbers underneath indicating amino acids.
BR and LZ represent the basic region and the
leucine zipper, respectively. The numbers on the
right indicate the amino acids of C/EBP included in each
expression vector.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
T3 responsiveness of the PEPCK promoter can be mediated by TR
homodimers or heterodimers
HepG2 cells were transfected with 5 µg of the PEPCK-CAT vector and
either 0.5 µg of Gal4-TR , 0.5 µg of  TR , 0.5 µg of
Gal-RXR , or 5 µg of RSV-TR . All transfections contained 2 µg
of SV40- -gal. Following transfection, the cells were placed in
medium containing 10% charcoal-stripped fetal bovine serum with 100 nM T3. Cells were harvested after 48 h and
assayed for CAT activity. All transfections were done in duplicate and
repeated at least three times. The data are presented as -fold
induction ± S.E.
|
|
To determine if the T3 effect could be mediated by TR-RXR
heterodimers, we used a Gal4-RXR mammalian expression vector
(Gal4-RXR ) and a mammalian expression vector for the ligand binding
domain of TR (CMV- TR ) (26).  TR cannot bind DNA.
When cotransfected with Gal4-RXR ,  TR associates with the
promoter through heterodimerization with Gal4-RXR . Co-transfection
of 330 PTRE/G4 PCAT with the combination of Gal4-RXR and
 TR stimulated transcription 56-fold in the presence of
T3 (Table III).  TR alone did not mediate a
T3 response, and mutation of the P3(I) site eliminated the
T3 induction. These observations indicate that the TR
ligand binding domain is sufficient for the interaction with C/EBP
proteins if it is tethered to the PEPCK promoter. In addition, these
results suggest that the T3 effect could be mediated by
either TR homodimers or TR-RXR heterodimers.
The next experiments examined whether sequences adjacent to the C/EBP
binding site were required for T3 and cAMP responsiveness. A series of mutations was introduced through the P3(I) binding region
in the context of the 490-PLuc and 490-PCAT vectors. The C/EBP
binding site (TTGTGTAAG) is contained within
nucleotides 243 to 235. The mutations that were introduced into the
490-PCAT vector of nucleotides 248 to 245, 243 to 238, and
237 to 235 are shown in Fig. 1B. Alteration of
nucleotides 243/ 238 and 237/ 235 eliminated C/EBP binding,
whereas mutation of nucleotides 248/ 245 did not affect C/EBP
binding (data not shown). Mutation of nucleotides 243/ 238 and
237/ 235 diminished PKA responsiveness and basal expression (Table
IV). The mutation of nucleotides 248/45 caused a slight reduction in the PKA responsiveness and a small increase in basal transcription. Alteration of the base pairs 243/ 238 and 237/ 235 eliminated the T3 response.
Mutation of nucleotides 248 to 245 reduced the T3
stimulation modestly. In conjunction with the data from the dominant
negative vectors, these results indicate that the protein bound to the
P3(I) site that contributes to basal expression and hormone
responsiveness is a member of the C/EBP family.
View this table:
[in this window]
[in a new window]
|
Table IV
Effect of various mutations within P3(I) region on responsiveness to
T3, overexpression of PKA, and basal expression
Mutations were introduced into the P3(I) region (PMut) of the
490-PCAT and 490-PLuc vectors. The sequence of the nucleotide
changes is shown in Fig. 1B. To assess basal activity and
cAMP inducibility, HepG2 cells were transfected with 3 µg of
490-PLuc, 1.0 µg of PKA, and 1.0 µg of SV40- -gal as described
in the legend to Table II. To measure the effects of T3, HepG2
cells were transfected with 5 µg of PCAT vector, 5 µg of RSV-TR ,
and 2.5 µg of SV40- -gal as described in the legend to Table I.
T3 at a concentration of 100 nM was added for
48 h. All transfections were performed three to five times in
duplicate. The results are presented as -fold induction ± S.E.
|
|
Both the and isoforms of C/EBP are present in the liver (13,
15). To evaluate the relative abundance of C/EBP isoforms binding to
P3(I) in rat liver or HepG2 cell nuclei, supershift gel mobility assays
were conducted using nuclear proteins isolated from rat liver or HepG2
cells, a labeled P3(I) oligomer and antibodies to C/EBP or C/EBP .
Antibodies to C/EBP and C/EBP generated supershifted complexes,
indicating that both C/EBP isoforms are present in rat liver nuclear
extract and can bind P3(I) (data not shown). Since our transfection
experiments were conducted in HepG2 cells, the binding of proteins from
HepG2 cell nuclear extract to the P3(I) element was examined (Fig.
2). The pattern of binding of HepG2 cell
nuclear extract to P3(I) was similar to that observed with rat liver
nuclear extract, but one significant difference was observed. The
antibody to C/EBP caused only a slight disruption of binding, while
the antibody to C/EBP supershifted most of the binding activity.
C/EBP has been shown to be present in HepG2 cells (13), but C/EBP
is the predominant isoform. Adding competitor nucleotides with
mutations in 248/ 245 did not affect the gel shift pattern, but
adding those with mutations in 243/ 238 did disrupt most of the
protein DNA interactions. These data suggest that C/EBP is the major
protein binding to this site in HepG2 cells.

View larger version (92K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of proteins HepG2 nuclei to the P3(I)
region of the PEPCK gene. Gel mobility assays were conducted as
described under "Materials and Methods." Each binding reaction
contained 25,000 cpm of probe representing the sequence from 254 to
230 in the PEPCK promoter and proteins isolated from HepG2 nuclei
(HepG2 NE). Oligomers to the P3(I) region containing the mutated
nucleotides 248-245 (M248), 243-238 (M243), and
237-235 (M237) were also used, as is indicated above each
lane. The sequence of the mutant oligomers is given in Fig.
1B. To some binding reactions were added antibodies to
either C/EBP (C/E ), C/EBP (C/E ),
RXR , or the IgG fraction, as is indicated above the lane. The
autoradiograms were scanned and printed using Adobe Photoshop.
|
|
Previous studies had established that C/EBP could restore cAMP and
T3 responsiveness to the PEPCK promoter (8, 11). Since
C/EBP is the major C/EBP isoform in HepG2 cells, our next experiments examined the ability of the C/EBP to modulate the basal
transcription and cAMP responsiveness of the PEPCK promoter. To conduct
these experiments, a series of Gal4-C/EBP mammalian expression
vectors was created (shown in Fig. 1C). A Gal4 DNA binding
site was introduced into the P3(I) site in the 490 PEPCK-CAT vector
to generate 490-P3G4-PLuc (see Fig. 1A). The 490
P3G4-PLuc vectors were cotransfected with the expression vectors
Gal4-C/EBP into HepG2 cells. The results from these experiments are
shown in Table V.
View this table:
[in this window]
[in a new window]
|
Table V
C/EBP participates in the cAMP induction of the PEPCK gene
HepG2 cells were transfected with 3 µg of 490-PLuc, 1.0 µg of
PKA, 1.0 µg of Gal4 expression vector, and 1.0 µg of SV40- -gal
as described in the legend to Table II. The Gal4-C/EBP vectors are
shown in Fig. 1C. The transfections were done in duplicate
and repeated four to six times. The results are presented as -fold
induction by PKA ± S.E. To assess basal transcription, the
490-P3G4 Luc vector cotransfected with the empty Gal4 vector was
assigned a value of 1.0 and the effect of the Gal4-C/EBP vectors was
determined by comparison with this activity.
|
|
Introduction of the Gal4 site into the P3(I) element reduced basal
expression 60%. When 490-P3G4-PLuc was cotransfected with Gal4-C/EBP 1-264, expression of 490-P3G4-PLuc was not stimulated. Others have reported that the leucine zipper and basic regions of
C/EBP are inhibitory when expressed in the context of a Gal4 fusion
protein (27). The Gal4-C/EBP vectors expressing amino acids 1-138
and 1-108 were able to stimulate the basal expression 8-10-fold above
the 490-P3G4-PLuc vector (Table V). Smaller regions of C/EBP were
unable to increase the basal expression of the PEPCK-Luc gene. These
results indicate that peptides within the first 108 amino acids of the
transactivation domain of C/EBP will stimulate basal transcription.
To evaluate the ability of these constructs to mediate a cAMP
induction, the Gal4-C/EBP expression vectors were cotransfected with
the catalytic subunit of PKA and 490-PLuc (Table V). The 490-PLuc
vector was stimulated 9.4-fold by the overexpression of PKA, while
mutation of the P3(I) site decreased this induction to 2.3-fold. The
Gal-C/EBP 1-264 was not able to increase the cAMP responsiveness of
the PEPCK promoter. Previously, it had been shown that a Gal4-C/EBP
vector with full-length C/EBP was not able to restore cAMP
responsiveness (11). However, cotransfection with Gal4-C/EBP 1-138
and 1-108 completely restored cAMP responsiveness. The Gal4-C/EBP
1-66 increased the cAMP stimulation from 2.2-7-fold, and the
Gal4-C/EBP 1-25 vector did not mediate a cAMP response. As a
control, the 490-P3G4-PLuc was cotransfected with Gal4-C/EBP 6-217, which contains amino acids 6-217 of C/EBP ligated to the Gal4 DNA binding domain (11). The Gal4-C/EBP 6-217 vector
stimulated both basal expression and cAMP responsiveness, as had been
reported previously (20). These results demonstrate that either isoform of C/EBP can regulate PEPCK gene expression through the P3(I) site.
We tested whether the Gal4-C/EBP vectors could restore
T3 responsiveness to the 490-P3G4 reporter gene. The
490 P3G4-PCAT vector was cotransfected with Gal4-C/EBP expression
vectors and the transfected cells exposed to T3. As is
shown in Table VI, introduction of the
Gal4 site into P3(I) eliminated T3 responsiveness. Cotransfection with Gal4-C/EBP 1-138 and 1-108 increased the T3 response 2.5- and 2.8-fold, respectively. The
Gal4-C/EBP 1-66 vector was less effective in restoring
T3 responsiveness, while the vector with amino acids 1-25
had no effect. These data suggest that additional regions of the
protein such as the basic region or leucine zipper are needed for the
T3 induction. Gal4 expression vectors expressing
full-length C/EBP or were tested, but these vectors did not
increase the T3 response (data not shown). Since the
Gal4-C/EBP vectors with full-length C/EBP did not restore T3 responsiveness to the PEPCK gene, the basic region or
the leucine zipper may need to be associated with the P3 site to
mediate this response.
View this table:
[in this window]
[in a new window]
|
Table VI
Gal4-C/EBP can restore T3 responsiveness to a PEPCK promoter
HepG2 cells were transfected with 5 µg of 490-PCAT, 5 µg of
RSV-TR , 1 µg of Gal4-C/EBP , and 2 µg of SV40- -gal as
described in Table I. Cells were treated with 100 nM
T3 for 48 h. The transfections were done in duplicate and
repeated four times. The results are presented as -fold induction by
T3 ± S.E.
|
|
Previously, we reported that cotransfection of Gal4-C/EBP 6-217
with 490-P3G4-PCAT partially restored T3 inducibility
(8). Since the DNA binding and dimerization domains of C/EBP are on the
carboxyl terminus, it is possible that having the Gal4 domain on the
amino terminus of the fusion protein was preventing the full
restoration of T3 responsiveness. The Gal4-C/EBP 6-217
"flipped" vector, which has the Gal4 DNA binding domain on the
carboxyl terminus of the fusion protein rather than the amino terminus, was tested (Table VII). Like
Gal4-C/EBP 6-217, this vector increased the T3 response
to 2.4-fold. Serial deletions of Gal4-C/EBP were tested, and they
were less effective than Gal4-C/EBP 6-217 in providing a
T3 induction (Table VII). These observations suggest that
either the C/EBP or isoforms will be able to mediate a T3 induction of PEPCK gene expression. Importantly, these
results demonstrate that different regions of the C/EBP proteins
participate in the T3 and cAMP response. The
transactivation domains of C/EBP or are sufficient to restore
cAMP responsiveness, but other domains of C/EBP or appear to be
required for the full T3 response.
View this table:
[in this window]
[in a new window]
|
Table VII
Gal4-C/EBP can restore T3 responsiveness to a PEPCK promoter
HepG2 cells were transfected with 5 µg of 490-PCAT, 5 µg of
RSV-TR , 5 µg of Gal4-C/EBP fusion plasmid, and 5 µg of
SV40- -gal as described in Table I. Cells were treated with 100 NM T3 for 48 h. The transfections were done in
duplicate and were repeated four times. The results are presented as
-fold induction by T3 ± S.E.
|
|
 |
DISCUSSION |
Expression of the PEPCK gene is controlled by hormonal signals as
well as by developmental and tissue-specific factors. Each hormonal
response of the PEPCK gene is mediated through a combination of hormone
response elements and accessory factor sites. Our studies have defined
various transcription factors involved in regulation by T3
and cAMP. Previous work has focused on the role of C/EBP in the
T3 and cAMP effects because C/EBP is highly expressed in
the liver and clearly contributes to the induction of PEPCK expression
at birth (8, 18, 20). In this study, we have examined the contributions
of C/EBP to the basal expression and hormonal responsiveness of the
PEPCK gene. Our results indicate that C/EBP , along with the TR, can
mediate the T3 induction of PEPCK transcription. C/EBP
can participate in cAMP responsiveness, and 108 amino acids of the
transactivation domain will impart full cAMP responsiveness to the
PEPCK promoter.
In several genes, the transcriptional stimulation by T3 is
dependent on both the TR and other transcription factors, often called
accessory factors. Accessory factors can be positioned in close
proximity or widely separated from the TR. In the liver, NF-Y is
required for the T3 stimulation of S14 gene transcription (28). The TREs of the S14 gene are located between 2,700 and 2,500,
while the NF-Y binding site is near the start site of transcription
(28, 29). In the heart, myocyte-specific enhancer factor 2 (MEF2) is
involved in the T3 induction of the -cardiac myosin
heavy chain gene (30). MEF2 and the TR bind to adjacent sites in the
-myosin heavy chain promoter and can physically interact in solution
(30). The stimulation of the human placental lactogen B gene by
T3 is dependent on the binding of the pituitary factor GHF1
(also called Pit-1) (31). Our studies have identified C/EBP proteins as
an additional family of accessory factors involved in T3 action.
C/EBP proteins possess three functional regions including a
transactivation domain on the amino terminus, a basic region that binds
DNA and leucine zipper that dimerizes with other C/EBP proteins. Within
the first 100 amino acids of C/EBP and are three conserved peptide sequences, which contribute to the transactivation capabilities of these proteins (27, 32, 33). In C/EBP , these peptides regions
were called activation domain modules 1, 2, and 3 (ADM1, 2, and 3) and
removal of any of these peptides reduced the ability of C/EBP to
stimulate basal transcription (27). The ADM3 (amino acids 83-92) is
homologous to the homology box 2 (HOB2) domain found in Fos and Jun
(34). The Gal4-C/EBP vector expressing the first 108 amino acids of
C/EBP stimulated PEPCK basal transcription and restored cAMP
responsiveness. In the Gal4-C/EBP vector expressing amino acids
1-66, the ADM3 is deleted and a portion of ADM2 (amino acids 56-72)
is removed. Since the Gal4-C/EBP 1-66 vector did not stimulate
basal expression of 490-P3G4-PLuc, it suggests that ADM3 is crucial
for the stimulation of basal transcription. However, amino acids 1-66
did partially restore the cAMP response, indicating that additional
regions of C/EBP are involved in mediating the cAMP induction.
The regions of C/EBP that are involved in cAMP responsiveness have
been narrowly defined (20). Amino acids 1-124 were sufficient for a
cAMP effect (20). In these studies, three Gal4 sites were ligated in
front of a CAT reporter gene driven by a neutral promoter and this
reporter vector was cotransfected with Gal4-C/EBP vectors. Further
deletion beyond amino acid 124 from the carboxyl terminus of C/EBP
resulted in a loss of cAMP responsiveness. In addition, the first 50 amino acids were essential for the cAMP induction. Most interestingly,
mutation of amino acids 67, 77, and 78 in C/EBP that interact with
TBP did not affect the ability of this Gal4-C/EBP protein to mediate
a cAMP response (20, 32). However, the Gal4-C/EBP vector with these
mutations was unable to stimulate basal transcription. Therefore,
different amino acids within C/EBP are involved in the regulation of
basal transcription and cAMP responsiveness. Our results suggest that
different domains of C/EBP and mediate cAMP responsiveness.
Amino acids 96-124 are essential for the cAMP induction by C/EBP .
There are no homologous domains within C/EBP . These experiments were
conducted in a slightly different manner since the transfections in
this study were all conducted with a Gal4 binding site in the context
of the PEPCK gene, while those of the previous study were conducted
using multimerized Gal4 sites. Nonetheless, there does not appear to be
a single homologous peptide region of C/EBP and that is
responsible for the cAMP induction.
One important issue is why the Gal4-C/EBP and vectors do not
restore full T3 responsiveness. One possibility is that
either the leucine zipper or the basic region of C/EBP is required for the T3 induction, as has been shown in the regulation of
other genes. For example, the leucine zipper of C/EBP synergizes
with Sp1 in the regulation of the rat CYP2D5 P450 gene (35). We cannot address this question with the Gal4-C/EBP expression vectors because, when the full-length C/EBP or protein is attached to the Gal4 DNA binding domain, the resulting protein inhibits basal and
hormone-regulated transcription (20, 27). This observation suggests
that the DNA binding domain must be in contact with the C/EBP binding
site. Another possibility is that the Gal4 DNA binding domain altered the configuration of the C/EBP transactivation domain, making the
necessary protein interactions for T3 responsiveness
impossible. While both the and isoforms of C/EBP can have a
role in the regulation of PEPCK expression, in vivo they are
not functionally redundant. In C/EBP knock-out mice, the PEPCK gene
was not induced at birth although PEPCK expression did rise after
several hours (17, 18). In addition, the PEPCK gene was poorly
responsive to cAMP (18). C/EBP knock-out mice die at birth of
hypoglycemia and other complications (17, 18). In the liver of adult
mice in which the C/EBP was conditionally knocked out, PEPCK
expression was decreased (36). C/EBP knock-out mice displayed a
mixed phenotype with 50% of the mice dying at birth and showing
reduced PEPCK gene expression (18). The remaining mice were viable and normal with respect to PEPCK expression. Other data indicate that the
binding of C/EBP to the PEPCK promoter may be increased by cAMP.
When animals are injected with cAMP, the abundance of C/EBP rises
rapidly in the liver and the binding of C/EBP to the P3(I) site
increases (37). In physiologic situations such as with increased
exercise, the abundance of C/EBP increases in the liver (37). Our
data demonstrate that, when C/EBP is bound to the P3(I) site, it can
stimulate basal expression and contribute to cAMP responsiveness.
While our studies have focused on the PTRE as T3 response
element, this site is involved in several other hormone responses. Accessory factors are essential for the glucocorticoid induction of
PEPCK transcription. Two weak glucocorticoid-responsive elements (GRE)
have been identified (38). Like the TRE in the PEPCK gene, these GREs
function well only in the context of the PEPCK promoter and confer very
modest glucocorticoid responsiveness to a neutral promoter (38). Three
accessory factor sites (AF1, AF2, and AF3) that are needed for
glucocorticoid responsiveness have been defined (40, 41, 42). Mutation
of any of these sites reduces the stimulation by glucocorticoids. AF3
overlaps the PTRE, and both chicken ovalbumin upstream
promoter-transcription factor and the retinoic acid receptor (RAR) can
bind the AF3/PTRE site (39, 42). The stimulation of transcription by
retinoic acid (RA) is mediated in part through the AF3/PTRE site in the
promoter (8, 42, 43). Interestingly, even though the RAR binds the PTRE, the RA induction is independent of C/EBP proteins further demonstrating the specificity of the involvement of C/EBP proteins in
the T3 response (8).
Coactivator proteins provide a potential mechanism by which TR and
C/EBP proteins could interact in the regulation of the PEPCK gene (44).
Many of the transcription factors involved in the hormonal control of
PEPCK expression are capable of interacting with various coactivators.
The steroid receptor coactivator (SRC-1) can enhance the
transactivation capability of a variety of steroid hormone receptors
including the TR, RAR, glucocorticoid receptor, progesterone receptor,
and estrogen receptor (45). SRC-1 has widespread tissue-specific
distribution and is part of a family of nuclear receptor coactivators
including SRC-2 (also cloned as GRIP1, TIF2) and SRC-3 (called RAC3,
pCIP, and AIB1) (44, 46, 47). The CREB-binding protein was initially
described as a coactivator for CREB, which enhanced cAMP signaling
(48). Subsequently, CREB-binding protein has been demonstrated to
interact with a wide variety of proteins including steroid hormone
receptors, SRC proteins, and C/EBP (44, 49, 50). Coactivators may help to coordinate the interactions of these various transcription factors on the PEPCK promoter in the absence of direct physical contact
between the factors themselves.
 |
ACKNOWLEDGEMENTS |
We thank Anna Mae Diehl for the generous gift
of C/EBP antibody. We thank Drs. R. Evans and M. Tsai for the TR
and RXR expression vectors.
 |
FOOTNOTES |
*
This work was supported in part by Grant DK-46399 from the
National Institute of Health and a grant from the Medical Research Council of Canada (to W. J. R.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dr. Edwards A. Park,
Dept. of Pharmacology, University of Tennessee, College of Medicine,
874 Union Ave., Memphis, TN 38163. Tel.: 901-448-4779; Fax:
901-448-7300; E-mail: epark{at}utmem1.utmem.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
PEPCK, phosphoenolpyruvate carboxykinase;
T3, 3,5,3'-triiodothyronine;
TR, thyroid hormone receptor;
TRE, thyroid
hormone-responsive element;
PTRE, TRE in the PEPCK promoter;
P3(I), C/EBP binding site in PEPCK promoter;
RXR, retinoid X receptor;
RAR, retinoic acid receptor;
DR4, direct repeat separated by 4 nucleotides;
CAT, chloramphenicol acetyltransferase;
Luc, luciferase;
AF, accessory
factor;
C/EBP, CCAAT enhancer-binding protein;
CRE, cAMP-responsive
element;
CREB, cAMP-responsive element-binding protein;
AP-1, activation protein 1;
RA, retinoic acid;
-gal, -galactosidase;
DMEM, Dulbecco's modified Eagle's medium;
PKA, protein kinase A;
PCR, polymerase chain reaction;
ADM, activation domain module;
GRE, glucocorticoid-responsive element..
 |
REFERENCES |
-
Hanson, R. W.,
and Reshef, L.
(1997)
Annu. Rev. Biochem.
66,
581-611[CrossRef][Medline]
[Order article via Infotrieve]
-
Lazar, M. A.
(1993)
Endocr. Rev.
14,
184-193[Abstract/Free Full Text]
-
Mangelsdorf, D. J.,
and Evans, R. M.
(1995)
Cell
83,
841-850[CrossRef][Medline]
[Order article via Infotrieve]
-
Mangelsdorf, D. J.,
Ong, E. S.,
Dyck, J. A.,
and Evans, R. M.
(1990)
Nature
345,
224-229[CrossRef][Medline]
[Order article via Infotrieve]
-
Wagner, R. L.,
Apriletti, J. W.,
McGrath, M. E.,
West, B. L.,
Baxter, J. D.,
and Fletterick, R. J.
(1995)
Nature
378,
690-697[CrossRef][Medline]
[Order article via Infotrieve]
-
Murray, M. B.,
Zilz, N. D.,
McCreary, N. L.,
MacDonald, M. J.,
and Towle, H. C.
(1988)
J. Biol. Chem.
263,
12770-12777[Abstract/Free Full Text]
-
Park, E. A.,
Jerden, D. C.,
and Bahouth, S. W.
(1995)
Biochem. J.
309,
913-919
-
Park, E. A.,
Song, S.,
Olive, M.,
and Roesler, W. J.
(1997)
Biochem. J.
322,
343-349
-
Roesler, W. J.,
Graham, J. G.,
Kolen, R.,
Klemm, D. J.,
and McFie, P. J.
(1995)
J. Biol. Chem.
270,
8225-8232[Abstract/Free Full Text]
-
Liu, J.,
Park, E. A.,
Gurney, A. L.,
Roesler, W. J.,
and Hanson, R. W.
(1991)
J. Biol Chem.
266,
19095-19102[Abstract/Free Full Text]
-
Roesler, W. J.,
Crosson, S. M.,
Vinson, C.,
and McFie, P. J.
(1996)
J. Biol. Chem.
271,
8068-8074[Abstract/Free Full Text]
-
Patel, Y. M.,
Yun, J. S.,
Liu, J.,
McGrane, M. M.,
and Hanson, R. W.
(1994)
J. Biol. Chem.
269,
5619-5628[Abstract/Free Full Text]
-
Birkenmeier, E. H.,
Gwynn, B.,
Howard, S.,
Jerry, J.,
Gordan, J. I.,
Landshulz, W. H.,
and McKnight, S. L.
(1989)
Genes Dev.
3,
1146-1156[Abstract/Free Full Text]
-
Cao, Z.,
Umek, R. M.,
and McKnight, S. L.
(1991)
Genes Dev.
5,
1538-1552[Abstract/Free Full Text]
-
Park, E. A.,
Roesler, W. J.,
Liu, J.,
Klemm, D. J.,
Gurney, A. L.,
Thatcher, J. D.,
Shuman, J.,
Friedman, A.,
and Hanson, R. W.
(1990)
Mol. Cell. Biol.
10,
6264-6272[Abstract/Free Full Text]
-
McKnight, S. L.,
Lane, M. D.,
and Gluecksohn-Waelsch, S.
(1989)
Genes Dev.
3,
2021-2024[Free Full Text]
-
Wang, N.-D.,
Finegold, M. J.,
Bradley, A.,
Ou, C. N.,
Abdelsayed, S. V.,
Wilde, M. D.,
Taylor, L. R.,
Wilson, D. R.,
and Darlington, G. J.
(1995)
Science
269,
1108-1112[Abstract/Free Full Text]
-
Croniger, C.,
Trus, M.,
Lysek-Stupp, K.,
Cohen, H.,
Liu, Y.,
Darlington, G. J.,
Poli, V.,
Hanson, R. W.,
and Reshef, L.
(1997)
J. Biol. Chem.
272,
26306-26312[Abstract/Free Full Text]
-
Park, E. A.,
Gurney, A. L.,
Nizielski, S. E.,
Hakimi, P.,
Cao, Z.,
Moorman, A.,
and Hanson, R. W.
(1993)
J. Biol. Chem.
268,
613-619[Abstract/Free Full Text]
-
Roesler, W. J.,
Park, E. A.,
and McFie, P. J.
(1998)
J. Biol. Chem.
273,
14950-14957[Abstract/Free Full Text]
-
Shapiro, D. J.,
Sharp, P. A.,
Wahli, W. W.,
and Keller, M. J.
(1998)
DNA
7,
47-55
-
Krylov, D.,
Olive, M.,
and Vinson, C.
(1995)
EMBO J.
14,
5329-5337[Medline]
[Order article via Infotrieve]
-
Ahn, S.,
Olive, M.,
Aggarwal, S.,
Krylov, D.,
Ginty, D. D.,
and Vinson, C.
(1998)
Mol. Cell. Biol.
18,
967-977[Abstract/Free Full Text]
-
Olive, M.,
Krylov, D.,
Echlin, D. R.,
Gardener, K.,
Taparowsky, E.,
and Vinson, C.
(1997)
J. Biol. Chem.
272,
18586-18594[Abstract/Free Full Text]
-
Baniahmad, A.,
Ha, I.,
Reinberg, D.,
Tsai, S.,
Tsai, M.-J.,
and O'Malley, B. W. O.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8832-8836[Abstract/Free Full Text]
-
Forman, B. M.,
Umesono, K.,
Chen, J.,
and Evans, R. M.
(1995)
Cell
81,
541-550[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, S. C.,
Baer, M.,
Dillner, A. J.,
and Johnson, P. F.
(1995)
EMBO J.
14,
3170-3183[Medline]
[Order article via Infotrieve]
-
Jump, D. B.,
Badin, M. V.,
and Thelen, A.
(1997)
J. Biol. Chem.
272,
27778-27786[Abstract/Free Full Text]
-
Liu, H. C.,
and Towle, H. C.
(1994)
Mol. Endocrinol.
8,
1021-1037[Abstract/Free Full Text]
-
Lee, Y.,
Nadal-Ginard, B.,
Mahdavi, V.,
and Izumo, S.
(1997)
Mol. Cell. Biol.
17,
2745-2755[Abstract]
-
Voz, M. L.,
Peers, B.,
Weidig, M. J.,
Jacquemin, P.,
Belayew, A.,
and Martial, J. A.
(1992)
Mol. Cell. Biol.
12,
3991-3997[Abstract/Free Full Text]
-
Nerlov, C.,
and Ziff, E. B.
(1995)
EMBO J.
14,
4318-4328[Medline]
[Order article via Infotrieve], 1995
-
Nerlov, C.,
and Ziff, E. B.
(1994)
Genes Dev.
8,
350-362[Abstract/Free Full Text]
-
Sutherland, J. A.,
Cook, A.,
Bannister, A. J.,
and Kouzarides, T.
(1992)
Genes Dev.
6,
1810-1819[Abstract/Free Full Text]
-
Lee, Y. H.,
Williams, S. C.,
Baer, M.,
Sterneck, E.,
Gonzalez, F. J.,
and Johnson, P. F.
(1997)
Mol. Cell. Biol.
17,
3028-2047[Abstract]
-
Lee, Y. H.,
Sauer, B.,
Johnson, P. F.,
and Gonzalez, F. J.
(1997)
Mol. Cell. Biol.
17,
6014-6022[Abstract]
-
Nizielski, S. E.,
Arizmendi, C.,
Shteyngarts, A. R.,
Farell, C. J.,
and Friedman, J. E.
(1996)
Am. J. Physiol.
270,
R1005-R1012[Abstract/Free Full Text]
-
Scott, D. K.,
Stromstedt, P. E.,
Wang, J. C.,
and Granner, D. K.
(1998)
Mol. Endo.
12,
482-491[Abstract/Free Full Text]
-
Scott, D. K.,
Mitchell, J. A.,
and Granner, D. K.
(1996)
J. Biol. Chem.
271,
31909-31914[Abstract/Free Full Text]
-
Wang, J. C.,
Stromstedt, P. E.,
O'Brien, R. M.,
and Granner, D. K.
(1996)
Mol. Endocrinol.
10,
794-800[Abstract/Free Full Text]
-
Mitchell, J.,
Noisin, E.,
Hall, R.,
O'Brien, R.,
Imai, E.,
and Granner, D. K.
(1994)
Mol. Endocrinol.
8,
585-594[Abstract/Free Full Text]
-
Scott, D. K.,
Mitchell, J. A.,
and Granner, D. K.
(1996)
J. Biol. Chem.
271,
6260-6264[Abstract/Free Full Text]
-
Hall, R. K.,
Sladek, F. M.,
and Granner, D. K.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
412-416[Abstract/Free Full Text]
-
Shibata, H.,
Spencer, T. E.,
Onate, S. A.,
Tsai, S. Y.,
Tsai, M-J.,
and O'Malley, B. W.
(1997)
Rec. Prog. Horm. Res.
52,
141-165
-
Onate, S. A.,
Tsai, S. Y.,
Tsai, M-J.,
and O'Malley, B. W.
(1995)
Science
270,
1354-1357[Abstract/Free Full Text]
-
Ding, X. F.,
Anderson, C. M.,
Ma, H.,
Hong, H.,
Uht, R. M.,
Kushner, P. J.,
and Stallcup, M. R.
(1998)
Mol. Endocrinol.
12,
302-313[Abstract/Free Full Text]
-
Li, H.,
and Chen, J. D.
(1998)
J. Biol. Chem.
273,
5948-5954[Abstract/Free Full Text]
-
Chriva, J. C.,
Kwok, R. P. S.,
Lamb, N.,
Haglwara, M.,
Montminy, M. R.,
and Goodman, R. H.
(1993)
Nature
365,
855-859[CrossRef][Medline]
[Order article via Infotrieve]
-
Mink, S.,
Haenig, B.,
and Klempnauer, K-H.
(1997)
Mol. Cell. Biol.
17,
6609-6617[Abstract]
-
Kamei, Y.,
Xu, L.,
Heinzel, T.,
Torchia, J.,
Kurokawa, R.,
Gloss, B.,
Lin, S. C.,
Heyman, R. A.,
Rose, D. W.,
Glass, C. K.,
and Rosenfeld, M. G.
(1996)
Cell
85,
403-414[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Wang, T. H. Peiris, A. Mowery, J. Le Lay, Y. Gao, and L. E. Greenbaum
CCAAT/Enhancer Binding Protein-{beta} Is a Transcriptional Regulator of Peroxisome-Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Regenerating Liver
Mol. Endocrinol.,
July 1, 2008;
22(7):
1596 - 1605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. McFie, G.-L. Wang, N. A. Timchenko, H. L. Wilson, X. Hu, and W. J. Roesler
Identification of a Co-repressor That Inhibits the Transcriptional and Growth-Arrest Activities of CCAAT/Enhancer-binding Protein {alpha}
J. Biol. Chem.,
June 30, 2006;
281(26):
18069 - 18080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley and P. G. Quinn
3',5'-Cyclic Adenosine Monophosphate Response Element-Binding Protein and CCAAT Enhancer-Binding Protein Are Dispensable for Insulin Inhibition of Phosphoenolpyruvate Carboxykinase Transcription and for Its Synergistic Induction by Protein Kinase A and Glucocorticoids
Mol. Endocrinol.,
April 1, 2005;
19(4):
913 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol.,
January 1, 2005;
25(1):
472 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-L. Fang, M. Abdolalipour, Z. Duanmu, J. R. Smigelski, A. Weckle, T. A. Kocarek, and M. Runge-Morris
REGULATION OF GLUCOCORTICOID-INDUCIBLE HYDROXYSTEROID SULFOTRANSFERASE (SULT2A-40/41) GENE TRANSCRIPTION IN PRIMARY CULTURED RAT HEPATOCYTES: ROLE OF CCAAT/ENHANCER-BINDING PROTEIN LIVER-ENRICHED TRANSCRIPTION FACTORS
Drug Metab. Dispos.,
January 1, 2005;
33(1):
147 - 156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gautier-Stein, G. Mithieux, and F. Rajas
A Distal Region Involving Hepatocyte Nuclear Factor 4{alpha} and CAAT/Enhancer Binding Protein Markedly Potentiates the Protein Kinase A Stimulation of the Glucose-6-Phosphatase Promoter
Mol. Endocrinol.,
January 1, 2005;
19(1):
163 - 174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Wilson, P. J. McFie, and W. J. Roesler
Different Transcription Factor Binding Arrays Modulate the cAMP Responsivity of the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem.,
November 8, 2002;
277(46):
43895 - 43902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Jurado, S. Song, W. J. Roesler, and E. A. Park
Conserved Amino Acids within CCAAT Enhancer-binding Proteins (C/EBPalpha and beta ) Regulate Phosphoenolpyruvate Carboxykinase (PEPCK) Gene Expression
J. Biol. Chem.,
July 26, 2002;
277(31):
27606 - 27612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yin, Y. Zhang, and F. B. Hillgartner
Sterol Regulatory Element-binding Protein-1 Interacts with the Nuclear Thyroid Hormone Receptor to Enhance Acetyl-CoA Carboxylase-alpha Transcription in Hepatocytes
J. Biol. Chem.,
May 24, 2002;
277(22):
19554 - 19565.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu, Q.-T. Wall, L. Taylor, and N. P. Curthoys
C/EBPbeta contributes to cAMP-activated transcription of phosphoenolpyruvate carboxykinase in LLC-PK1-F+ cells
Am J Physiol Renal Physiol,
October 1, 2001;
281(4):
F649 - F657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Xu, T. Yen, and C. L. Geczy
IL-10 Up-Regulates Macrophage Expression of the S100 Protein S100A8
J. Immunol.,
May 15, 2001;
166(10):
6358 - 6366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Roy, S. J. Wachira, X. Weihua, J. Hu, and D. V. Kalvakolanu
CCAAT/Enhancer-binding Protein-beta Regulates Interferon-induced Transcription through a Novel Element
J. Biol. Chem.,
April 21, 2000;
275(17):
12626 - 12632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Crosson and W. J. Roesler
Hormonal Regulation of the Phosphoenolpyruvate Carboxykinase Gene. ROLE OF SPECIFIC CCAAT/ENHANCER-BINDING PROTEIN ISOFORMS
J. Biol. Chem.,
February 25, 2000;
275(8):
5804 - 5809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Waltner-Law, M. C. Daniels, C. Sutherland, and D. K. Granner
NF-kappa B Inhibits Glucocorticoid and cAMP-mediated Expression of the Phosphoenolpyruvate Carboxykinase Gene
J. Biol. Chem.,
October 6, 2000;
275(41):
31847 - 31856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Croniger, C. Millward, J. Yang, Y. Kawai, I. J. Arinze, S. Liu, M. Harada-Shiba, K. Chakravarty, J. E. Friedman, V. Poli, et al.
Mice with a Deletion in the Gene for CCAAT/Enhancer-binding Protein beta Have an Attenuated Response to cAMP and Impaired Carbohydrate Metabolism
J. Biol. Chem.,
January 5, 2001;
276(1):
629 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Ghosh, R. Lacson, P. Liu, S. B. Cichy, A. Danilkovich, S. Guo, and T. G. Unterman
A Nucleoprotein Complex containing CCAAT/Enhancer-binding Protein beta Interacts with an Insulin Response Sequence in the Insulin-like Growth Factor-binding Protein-1 Gene and Contributes to Insulin-regulated Gene Expression
J. Biol. Chem.,
March 9, 2001;
276(11):
8507 - 8515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Guo, S. B. Cichy, X. He, Q. Yang, M. Ragland, A. K. Ghosh, P. F. Johnson, and T. G. Unterman
Insulin Suppresses Transactivation by CAAT/Enhancer-binding Proteins beta (C/EBPbeta ). SIGNALING TO p300/CREB-BINDING PROTEIN BY PROTEIN KINASE B DISRUPTS INTERACTION WITH THE MAJOR ACTIVATION DOMAIN OF C/EBPbeta
J. Biol. Chem.,
March 9, 2001;
276(11):
8516 - 8523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, L. Yin, and F. B. Hillgartner
The Homeodomain Proteins PBX and MEIS1 Are Accessory Factors That Enhance Thyroid Hormone Regulation of the Malic Enzyme Gene in Hepatocytes
J. Biol. Chem.,
June 22, 2001;
276(26):
23838 - 23848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Jacob and F. M. Stanley
Elk-1, C/EBPalpha , and Pit-1 Confer an Insulin-responsive Phenotype on Prolactin Promoter Expression in Chinese Hamster Ovary Cells and Define the Factors Required for Insulin-increased Transcription
J. Biol. Chem.,
June 29, 2001;
276(27):
24931 - 24936.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley, J. Moll, C. A. Vinson, and P. G. Quinn
Characterization of Elements Mediating Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Protein Kinase A and Insulin. IDENTIFICATION OF A DISTINCT COMPLEX FORMED IN CELLS THAT MEDIATE INSULIN INHIBITION
J. Biol. Chem.,
June 2, 2000;
275(23):
17814 - 17820.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|