Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, E. A.
Right arrow Articles by Roesler, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, E. A.
Right arrow Articles by Roesler, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 1, 211-217, January 1, 1999


Role of CCAAT Enhancer-binding Protein beta  in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription*

Edwards A. ParkDagger §, Shulan SongDagger , Charles Vinson, and William J. Roeslerparallel

From the Dagger  Department of Pharmacology, College of Medicine, University of Tennessee Health Science Center, Memphis, Tennessee 38163, the parallel  Department of Biochemistry, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5E5, Canada, and the  Laboratory of Biochemistry, NCI, National Institutes of Health, Bethesda, Maryland 20892

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Transcription of the gene for phosphoenolpyruvate carboxykinase (PEPCK) is stimulated by thyroid hormone (T3) and cAMP. Two DNA elements in the PEPCK promoter are required for T3 responsiveness including a thyroid hormone response element and a binding site called P3(I) for the CCAAT enhancer-binding protein (C/EBP). Both the alpha  and beta  isoforms of C/EBP are highly expressed in the liver. C/EBPalpha contributes to the liver-specific expression and cAMP responsiveness of the PEPCK gene. In this study, we examined the ability of C/EBPbeta when bound to the P3(I) site to regulate PEPCK gene expression. We report that C/EBPbeta can stimulate basal expression and participate in the induction of PEPCK gene transcription by T3 and cAMP. The cAMP-responsive element-binding protein and AP1 proteins that contribute to the induction by cAMP are not involved in the stimulation by T3. A small region of the transactivation domain of C/EBPbeta is sufficient for the stimulation of basal expression and cAMP responsiveness. Our results suggest that C/EBPalpha and C/EBPbeta are functionally interchangeable when bound to the P3(I) site of the PEPCK promoter.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Expression of the phosphoenolpyruvate carboxykinase (PEPCK)1 gene is controlled by a variety of hormones including glucagon (via cAMP), thyroid hormone (T3), glucocorticoids, retinoic acid (RA), and insulin (1). Our studies have been directed at elucidating the mechanisms by which T3 and cAMP stimulate the expression of the gene for PEPCK in the liver. Regulation of gene transcription by T3 is mediated through the binding of liganded T3 receptors (TR) to T3 response elements (TRE) in the promoters of genes (2, 3). The TR binds to DNA primarily as a heterodimer with the retinoid X receptor (RXR) (3, 4). The ligand binding, dimerization, and transactivation domains of TR are contained within a broad region between amino acids 160 and 456 (3, 5). Binding of T3 by the TR results in conformational changes in the receptor and alteration of its transactivation properties (5). There are two isoforms alpha  and beta  of the TR, and the TRbeta is highly expressed in the liver (2, 6). Two elements in the PEPCK promoter are required for the full induction of PEPCK transcription by T3 (see Fig. 1A). The first is the PEPCK-T3-responsive element (PTRE) contained within nucleotides -330 to -319, and the second is a binding site for the CCAAT enhancer-binding protein (C/EBP) called P3(I) between -250 and -234 (7, 8). The PTRE has an unusual architecture consisting of two direct repeats separated by zero nucleotides (7). Mutation of either the PTRE or the P3(I) site eliminates the T3 response (8).

Several elements in the promoter are involved in the cAMP induction of PEPCK transcription including a cAMP-responsive element (CRE) at -90 to -82, the P3(I) site, and an AP-1 binding site at -260 to -250 (Fig. 1A) (9, 10). Three families of transcription factors that contribute to the cAMP stimulation include the cAMP-responsive element-binding protein (CREB), AP-1 proteins, and C/EBP (11). The P3(I) site is central to both the T3 and cAMP induction of PEPCK transcription. In vivo studies have confirmed the importance of the P3(I) site in regulation of PEPCK gene expression. Transgenic mice carrying a PEPCK-bovine growth hormone fusion gene with a mutation in the P3(I) site have reduced hepatic expression of the bovine growth hormone transgene and reduced cAMP responsiveness of the PEPCK-bovine growth hormone reporter vector (12).

C/EBP proteins constitute a family of transcription factors of which the alpha  and beta  isoforms are highly expressed in the liver (13-15). C/EBPalpha is expressed primarily in liver and adipose tissue and regulates the expression of hepatic genes involved in energy metabolism (16, 17). In addition to participating in hormonal responsiveness, C/EBP proteins play an important role in PEPCK gene transcription by contributing to the induction of the PEPCK gene at birth and directing liver-specific expression (11, 17, 18). Our early studies showed that C/EBPalpha and beta  could bind to the CRE, P3(I), and P4(I) elements in the PEPCK promoter (15, 19). C/EBPalpha can participate in the T3 and cAMP induction of PEPCK transcription, and recent studies have shown that C/EBPalpha can mediate a cAMP induction without CREB being present (8, 11, 20).

Since C/EBPbeta is highly expressed in the liver and binds to identical sites in the PEPCK promoter, we examined whether C/EBPbeta when bound to the P3(I) site could participate in the hormonal induction of PEPCK transcription. Our data demonstrate that C/EBPbeta can stimulate PEPCK gene expression through the P3(I) site and modulate hormone responsiveness. The results indicate that the alpha  or beta  isoforms of C/EBP have similar functions when bound to this element.

    MATERIALS AND METHODS

Gel Mobility Assays-- Gel mobility assays were conducted on 5% non-denaturing polyacrylamide gels (80:1 acrylamide:bisacrylamide) in 22 mM Tris and 190 mM glycine at 4 °C (8). Double-stranded oligomers were labeled with Klenow enzyme and [alpha -32P]dCTP (8). The binding reactions were performed at room temperature in 10% glycerol, 80 mM KCl, 25 mM Tris (pH 7.4), 1 mM EDTA, and 1 mM dithiothreitol. Each binding reaction contained 1.0 µg of poly(dI-dC) as nonspecific competitor and proteins as indicated. Nuclear proteins were prepared from HepG2 cells by the method of Shapiro et al. (21). Antibodies to C/EBPalpha and RXRalpha were obtained from Santa Cruz Biochemicals. The antibody to C/EBPbeta was a generous gift from Anna May Diehl.

Construction of CAT and Luciferase Vectors-- The ligation of the PEPCK promoter from -490 to +73 to the CAT reporter gene (-490-PCAT) has been described (7). To introduce the Gal4 binding site into the P3(I) site of the PEPCK promoter (-490-P3G4), the -490-PCAT vector containing a BstIIE site in the P3(I) element (-490P3(I)-PCAT) (8) was digested with BstIIE and SauI and the double-stranded oligomer containing the sequence ggttacctcggagtactgtcctccgt was inserted into nucleotides -248 to -223. The -490 to +73 region of the PEPCK promoter was ligated in front of the luciferase reporter gene by removing the PEPCK promoter fragment from -490-PCAT by digestion with KpnI and BglII and ligating into the polylinker of pGL3 basic (Promega).

The Gal4 site was introduced into the TRE region of -330-PTRE/G4 CAT by PCR amplification with the 5' primer, ccctctagatcggaggtactgtcctccgtctgac, containing the altered nucleotides and a 3' primer, ttagatctcagagcgtctcgcc (+73 to +52), which included the BglII site at +73. The 5' primer introduced a XbaI site. The amplified promoter fragment was digested with XbaI and BglII and ligated in front of the CAT reporter gene. The sequence was confirmed by sequence analysis at the St. Jude Center for Biotechnology.

Construction of Gal4-C/EBP Expression Vectors-- Gal4-C/EBPbeta 1-108 and 1-66 were constructed by PCR amplification. The forward primer, which contained an EcoRI site and the first 18 nucleotides of the rat C/EBPbeta cDNA, tccgaattcatgcaccgcctgctggcctgggac, was used in PCR amplification. Additionally, two reverse primers containing PstI sites and the nucleotides representing amino acids 108-102 (gagctgcaggtaaccgtagtcggccggcttc) or 66-59 (gagctgcagcagctaggggctgaagtcgatg) were used. Following PCR amplification with the forward and reverse primers and the rat C/EBPbeta cDNA as template (14), the appropriate DNA fragment was isolated from an agarose gel and digested with EcoRI and PstI. This DNA fragment was ligated into the mammalian Gal4 DNA expression vector called pM (CLONTECH). To create the Gal4-C/EBPbeta 1-25, the Gal4-C/EBPbeta 1-108 vector was digested with BalI and HindIII. The restriction site overhangs were filled in with Klenow enzyme and the four deoxynucloetide triphosphates, and then the plasmid was religated. The Gal4-C/EBPbeta 1-264 was created by digestion of 1-108 with BalI and PstI. The BalI to PstI fragment of C/EBPbeta cDNA containing amino acids 25-264 was ligated into this site. The Gal4-C/EBPbeta 1-138 were generated by digestion of 1-264 with HindIII and SfuI. These restriction site overhangs were filled in with Klenow enzyme and religated. Construction of the Gal4-C/EBPalpha vectors is given elsewhere (11, 20). The sequence of all Gal4-C/EBPbeta vectors was confirmed by sequence analysis.

Cell Transfections, Luciferase Assays, and CAT Assays-- HepG2 cells were transfected by calcium phosphate precipitation as described previously (8). Each transfection contained 5.0 µg of PEPCK-CAT vector, 5.0 µg of the expression vector RSV-TRbeta , and 2.0 µg of SV40-beta -gal as a transfection control. Total DNA concentration was kept constant by the addition of pBluescript (Stratagene). CAT assays were conducted with [3H]chloramphenicol and n-butyryl-coenzyme A using the xylene phase extraction method (8). All transfections were performed in duplicate and repeated three to six times. For the transfections with the luciferase vectors, the calcium phosphate precipitate included 3.0 µg of PEPCK-luciferase, 1.0 µg of an expression vector for the catalytic subunit of protein kinase A, and 1.0 µg of SV40-beta -gal. Luciferase assays were conducted with the luciferin reagent as outlined by the manufacturer (Promega).

    RESULTS

The goal of these studies was to evaluate the role of C/EBPbeta proteins bound to the P3(I) site in modulating PEPCK gene expression. To demonstrate that C/EBP proteins are involved in the T3 induction of PEPCK transcription, we tested a set of specific dominant negative vectors. A-C/EBP is a dominant negative C/EBP vector, which has the C/EBP leucine zipper attached to an acidic amphipathic helix containing 4 heptad repeats (22). The amphipathic helix interacts with the basic region of C/EBP proteins. A-C/EBP forms a strong non-DNA binding heterodimer and will inhibit all C/EBP proteins (22). A-CREB is a dominant negative CREB protein with a CREB leucine zipper and an amphipathic helix (23). A-Fos is a dominant negative Jun vector with the Fos leucine zipper and an amphipathic helix (24). To examine the effect of these dominant negative proteins on the T3 responsiveness of the PEPCK gene, a PEPCK-CAT vector containing 490 base pairs of the PEPCK promoter driving the CAT reporter gene (-490-PCAT) was cotransfected with three dominant negative vectors (Table I). The addition of T3 stimulated the -490-PCAT vector 3.5-fold. Cotransfection with A-C/EBP inhibited the 3-4-fold induction of -490-PCAT by T3. The dominant negative CREB did not affect the induction by T3, and cotransfection with the dominant negative Jun actually improved the T3 response from 3.5-fold to 9-fold. Although the reason for the enhanced responsiveness is not clear, it has been shown that C/EBP and Fos/Jun can bind to the P3(II) and P4(I) sites in the PEPCK promoter (15). Inhibition of the Fos/Jun binding may allow increased binding of C/EBP proteins. When the PTRE was converted to an optimal TRE containing a direct repeat of the AGGTCA motif separated by four nucleotides (DR4) in the context of the PEPCK promoter, the dominant negative C/EBP vector still inhibited the T3 induction (data not shown). Therefore, the inhibition of the T3 stimulation by A-C/EBP is dependent not on the specific sequence of the PTRE but on its context within the PEPCK promoter.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Dominant negative C/EBP proteins inhibit the thyroid hormone induction of PEPCK gene transcription
HepG2 cells were transfected with 5 µg of PEPCK-CAT vector (-490-PCAT), 5 µg of RSV-TRbeta , 5 µg of dominant negative expression vector for either C/EBP (A-C/EBP), CREB (A-CREB), or Jun (A-Fos), and 2.0 µg of SV40-beta -gal. For the transfections with luciferase vectors, HepG2 cells were transfected with 3 µg of SV40-luciferase (DR4X2 SV40-Luc), 3 µg of RSV-TRbeta , 3 µg of dominant negative vector, and 1 µg of SV40-beta -gal. Following transfection, the cells were placed in DMEM containing 10% charcoal-stripped fetal calf serum. Thyroid hormone (T3) was added at a concentration of 100 nM for 48 h prior to harvesting for CAT assays. All transfections were repeated three to five times in duplicate. The results are presented as the -fold induction by T3 ± S.E.

As a control, two copies of a consensus TRE containing a DR4 motif were ligated in front of the enhancerless SV40 promoter driving the luciferase reporter gene and transfected into HepG2 cells with the three dominant negative proteins. Transcription of the SV40-luciferase vector was stimulated 11-fold by T3 (Table I). None of the dominant negative vectors decreased the T3 response. In fact, the T3 induction of the SV40-luciferase vector was increased in the presence of A-C/EBP. These observations indicate that the role of C/EBP in T3 responsiveness is specific to the PEPCK gene and that the inhibition of PEPCK-CAT by A-C/EBP is not an inhibition of the TR. We have used both the CAT and luciferase reporter genes in these studies. Our results are similar with either reporter gene. Generally, we have used the CAT gene for our studies with T3 and PEPCK promoter so that we can easily compare our results with our previous work. Our recent experiments with cAMP and the PEPCK promoter have been conducted with the luciferase gene.

Previous studies had shown that C/EBP, CREB, and AP-1 proteins were involved in the stimulation of PEPCK transcription by cAMP (9). To determine whether dominant negative vectors for C/EBP, CREB, or Jun would affect the cAMP response, HepG2 cells were cotransfected with a mammalian expression vector for the catalytic subunit of protein kinase A (PKA), -490 PEPCK-luciferase (-490-PLuc), and the dominant negative vectors. Overexpression of PKA increased the luciferase activity 6-fold, and this stimulation was reduced by each dominant negative protein (Table II). These results confirm that the cAMP induction requires all three proteins and support the mutational studies of the PEPCK gene in which disruption of CRE, P3(I), P3(II), or P4(I) decreased the induction by cAMP (9, 10). The A-C/EBP and A-Fos vectors decreased the basal expression of the PEPCK gene, while A-CREB did not reduce basal expression.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Dominant negative C/EBP, CREB, and Jun proteins inhibit the cAMP induction of PEPCK gene transcription
HepG2 cells were transfected with 3 µg of a PEPCK-luciferase gene (-490-PLuc), 1 µg of an expression vector for the catalytic subunit of protein kinase A (PKA), 1 µg of a dominant negative expression vector for either C/EBP (A-C/EBP), CREB (A-CREB), or Jun (A-Fos), and 1 µg of SV40-beta gal. The cells were harvested 36 h after transfection. The luciferase activity was corrected for protein content of the cell extract and transfection efficiency. All transfections were performed three to five times in duplicate. The inductions by PKA are presented as -fold induction ± S.E. To assess basal transcription, the 490-PLuc vector in the absence of a dominant negative vector was assigned a value of 1.0, and the effect of the A-vectors was determined by comparison with this activity.

To test whether the DNA binding domain of the TRbeta was required for the T3 induction of PEPCK transcription, the PTRE was converted into a Gal4 binding site to create -330 PTRE/G4-PCAT (see Fig. 1A). This CAT vector was cotransfected with a Gal4-TRbeta mammalian expression vector, which has the ligand binding/transactivation domain of the TRbeta (amino acids 168-456) fused to the Gal4 DNA binding domain (25). The Gal4-TRbeta will bind to the Gal4 site in the PEPCK-CAT vector. An 80-fold stimulation of PEPCK-CAT activity was obtained (Table III). Even with the robust T3 induction obtained with the Gal4-TRbeta vector, mutation of the P3(I) site (-330 PTRE/G4-P3 M PCAT) eliminated the T3 response. Cotransfection of -330 PTRE/G4-PCAT with A-C/EBP also severely decreased the T3 induction (data not shown).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Models of PEPCK reporter genes and Gal4-C/EBPbeta expression vectors. A, the names of the various vectors used in these studies is indicated at left. The -490 PEPCK vectors contains -490 bp of the PEPCK promoter ligated to either the CAT reporter gene (CAT) or the luciferase reporter gene (Luc). The binding sites indicated above the promoter include the PEPCK T3 response element (PTRE), the C/EBP binding site called P3(I), the cAMP response element (CRE), the AP-1 site called P3(II), the P4 site ,and the Gal4 binding site (Gal4). The DR4 × 2 SV40 vector contains two copies of a direct repeat or the AGGTCA motif separated by 4 nucleotides ligated to the SV40 enhancerless promoter. B, the sequence of the P3(I) region between nucleotides -254 and -230 (P3(I) WT) is shown. The core C/EBP binding motif is underlined. Various mutations in the P3(I) region are shown below, and the mutated nucleotides are underlined. The P3G4 sequence contains the Gal4 DNA binding element. C, the Gal4-C/EBPbeta expression vectors are shown. At the top is a model of the C/EBPbeta protein with the numbers underneath indicating amino acids. BR and LZ represent the basic region and the leucine zipper, respectively. The numbers on the right indicate the amino acids of C/EBPbeta included in each expression vector.

                              
View this table:
[in this window]
[in a new window]
 
Table III
T3 responsiveness of the PEPCK promoter can be mediated by TR homodimers or heterodimers
HepG2 cells were transfected with 5 µg of the PEPCK-CAT vector and either 0.5 µg of Gal4-TRbeta , 0.5 µg of Delta Delta TRbeta , 0.5 µg of Gal-RXRalpha , or 5 µg of RSV-TRbeta . All transfections contained 2 µg of SV40-beta -gal. Following transfection, the cells were placed in medium containing 10% charcoal-stripped fetal bovine serum with 100 nM T3. Cells were harvested after 48 h and assayed for CAT activity. All transfections were done in duplicate and repeated at least three times. The data are presented as -fold induction ± S.E.

To determine if the T3 effect could be mediated by TR-RXR heterodimers, we used a Gal4-RXRalpha mammalian expression vector (Gal4-RXRalpha ) and a mammalian expression vector for the ligand binding domain of TRbeta (CMV-Delta Delta TRbeta ) (26). Delta Delta TRbeta cannot bind DNA. When cotransfected with Gal4-RXRalpha , Delta Delta TRbeta associates with the promoter through heterodimerization with Gal4-RXRalpha . Co-transfection of -330 PTRE/G4 PCAT with the combination of Gal4-RXRalpha and Delta Delta TRbeta stimulated transcription 56-fold in the presence of T3 (Table III). Delta Delta TRbeta alone did not mediate a T3 response, and mutation of the P3(I) site eliminated the T3 induction. These observations indicate that the TRbeta ligand binding domain is sufficient for the interaction with C/EBP proteins if it is tethered to the PEPCK promoter. In addition, these results suggest that the T3 effect could be mediated by either TR homodimers or TR-RXR heterodimers.

The next experiments examined whether sequences adjacent to the C/EBP binding site were required for T3 and cAMP responsiveness. A series of mutations was introduced through the P3(I) binding region in the context of the -490-PLuc and -490-PCAT vectors. The C/EBP binding site (TTGTGTAAG) is contained within nucleotides -243 to -235. The mutations that were introduced into the -490-PCAT vector of nucleotides -248 to -245, -243 to -238, and -237 to -235 are shown in Fig. 1B. Alteration of nucleotides -243/-238 and -237/-235 eliminated C/EBP binding, whereas mutation of nucleotides -248/-245 did not affect C/EBP binding (data not shown). Mutation of nucleotides -243/-238 and -237/-235 diminished PKA responsiveness and basal expression (Table IV). The mutation of nucleotides -248/45 caused a slight reduction in the PKA responsiveness and a small increase in basal transcription. Alteration of the base pairs -243/-238 and -237/-235 eliminated the T3 response. Mutation of nucleotides -248 to -245 reduced the T3 stimulation modestly. In conjunction with the data from the dominant negative vectors, these results indicate that the protein bound to the P3(I) site that contributes to basal expression and hormone responsiveness is a member of the C/EBP family.

                              
View this table:
[in this window]
[in a new window]
 
Table IV
Effect of various mutations within P3(I) region on responsiveness to T3, overexpression of PKA, and basal expression
Mutations were introduced into the P3(I) region (PMut) of the -490-PCAT and -490-PLuc vectors. The sequence of the nucleotide changes is shown in Fig. 1B. To assess basal activity and cAMP inducibility, HepG2 cells were transfected with 3 µg of -490-PLuc, 1.0 µg of PKA, and 1.0 µg of SV40-beta -gal as described in the legend to Table II. To measure the effects of T3, HepG2 cells were transfected with 5 µg of PCAT vector, 5 µg of RSV-TRbeta , and 2.5 µg of SV40-beta -gal as described in the legend to Table I. T3 at a concentration of 100 nM was added for 48 h. All transfections were performed three to five times in duplicate. The results are presented as -fold induction ± S.E.

Both the alpha  and beta  isoforms of C/EBP are present in the liver (13, 15). To evaluate the relative abundance of C/EBP isoforms binding to P3(I) in rat liver or HepG2 cell nuclei, supershift gel mobility assays were conducted using nuclear proteins isolated from rat liver or HepG2 cells, a labeled P3(I) oligomer and antibodies to C/EBPalpha or C/EBPbeta . Antibodies to C/EBPalpha and C/EBPbeta generated supershifted complexes, indicating that both C/EBP isoforms are present in rat liver nuclear extract and can bind P3(I) (data not shown). Since our transfection experiments were conducted in HepG2 cells, the binding of proteins from HepG2 cell nuclear extract to the P3(I) element was examined (Fig. 2). The pattern of binding of HepG2 cell nuclear extract to P3(I) was similar to that observed with rat liver nuclear extract, but one significant difference was observed. The antibody to C/EBPalpha caused only a slight disruption of binding, while the antibody to C/EBPbeta supershifted most of the binding activity. C/EBPalpha has been shown to be present in HepG2 cells (13), but C/EBPbeta is the predominant isoform. Adding competitor nucleotides with mutations in -248/-245 did not affect the gel shift pattern, but adding those with mutations in -243/-238 did disrupt most of the protein DNA interactions. These data suggest that C/EBPbeta is the major protein binding to this site in HepG2 cells.


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 2.   Binding of proteins HepG2 nuclei to the P3(I) region of the PEPCK gene. Gel mobility assays were conducted as described under "Materials and Methods." Each binding reaction contained 25,000 cpm of probe representing the sequence from -254 to -230 in the PEPCK promoter and proteins isolated from HepG2 nuclei (HepG2 NE). Oligomers to the P3(I) region containing the mutated nucleotides 248-245 (M248), 243-238 (M243), and 237-235 (M237) were also used, as is indicated above each lane. The sequence of the mutant oligomers is given in Fig. 1B. To some binding reactions were added antibodies to either C/EBPalpha (C/Ealpha ), C/EBPbeta (C/Ebeta ), RXRalpha , or the IgG fraction, as is indicated above the lane. The autoradiograms were scanned and printed using Adobe Photoshop.

Previous studies had established that C/EBPalpha could restore cAMP and T3 responsiveness to the PEPCK promoter (8, 11). Since C/EBPbeta is the major C/EBP isoform in HepG2 cells, our next experiments examined the ability of the C/EBPbeta to modulate the basal transcription and cAMP responsiveness of the PEPCK promoter. To conduct these experiments, a series of Gal4-C/EBPbeta mammalian expression vectors was created (shown in Fig. 1C). A Gal4 DNA binding site was introduced into the P3(I) site in the -490 PEPCK-CAT vector to generate -490-P3G4-PLuc (see Fig. 1A). The -490 P3G4-PLuc vectors were cotransfected with the expression vectors Gal4-C/EBPbeta into HepG2 cells. The results from these experiments are shown in Table V.

                              
View this table:
[in this window]
[in a new window]
 
Table V
C/EBPbeta participates in the cAMP induction of the PEPCK gene
HepG2 cells were transfected with 3 µg of -490-PLuc, 1.0 µg of PKA, 1.0 µg of Gal4 expression vector, and 1.0 µg of SV40-beta -gal as described in the legend to Table II. The Gal4-C/EBPbeta vectors are shown in Fig. 1C. The transfections were done in duplicate and repeated four to six times. The results are presented as -fold induction by PKA ± S.E. To assess basal transcription, the 490-P3G4 Luc vector cotransfected with the empty Gal4 vector was assigned a value of 1.0 and the effect of the Gal4-C/EBP vectors was determined by comparison with this activity.

Introduction of the Gal4 site into the P3(I) element reduced basal expression 60%. When -490-P3G4-PLuc was cotransfected with Gal4-C/EBPbeta 1-264, expression of -490-P3G4-PLuc was not stimulated. Others have reported that the leucine zipper and basic regions of C/EBPbeta are inhibitory when expressed in the context of a Gal4 fusion protein (27). The Gal4-C/EBPbeta vectors expressing amino acids 1-138 and 1-108 were able to stimulate the basal expression 8-10-fold above the -490-P3G4-PLuc vector (Table V). Smaller regions of C/EBPbeta were unable to increase the basal expression of the PEPCK-Luc gene. These results indicate that peptides within the first 108 amino acids of the transactivation domain of C/EBPbeta will stimulate basal transcription.

To evaluate the ability of these constructs to mediate a cAMP induction, the Gal4-C/EBPbeta expression vectors were cotransfected with the catalytic subunit of PKA and -490-PLuc (Table V). The -490-PLuc vector was stimulated 9.4-fold by the overexpression of PKA, while mutation of the P3(I) site decreased this induction to 2.3-fold. The Gal-C/EBPbeta 1-264 was not able to increase the cAMP responsiveness of the PEPCK promoter. Previously, it had been shown that a Gal4-C/EBPbeta vector with full-length C/EBPbeta was not able to restore cAMP responsiveness (11). However, cotransfection with Gal4-C/EBPbeta 1-138 and 1-108 completely restored cAMP responsiveness. The Gal4-C/EBPbeta 1-66 increased the cAMP stimulation from 2.2-7-fold, and the Gal4-C/EBPbeta 1-25 vector did not mediate a cAMP response. As a control, the -490-P3G4-PLuc was cotransfected with Gal4-C/EBPalpha 6-217, which contains amino acids 6-217 of C/EBPalpha ligated to the Gal4 DNA binding domain (11). The Gal4-C/EBPalpha 6-217 vector stimulated both basal expression and cAMP responsiveness, as had been reported previously (20). These results demonstrate that either isoform of C/EBP can regulate PEPCK gene expression through the P3(I) site.

We tested whether the Gal4-C/EBPbeta vectors could restore T3 responsiveness to the -490-P3G4 reporter gene. The -490 P3G4-PCAT vector was cotransfected with Gal4-C/EBPbeta expression vectors and the transfected cells exposed to T3. As is shown in Table VI, introduction of the Gal4 site into P3(I) eliminated T3 responsiveness. Cotransfection with Gal4-C/EBPbeta 1-138 and 1-108 increased the T3 response 2.5- and 2.8-fold, respectively. The Gal4-C/EBPbeta 1-66 vector was less effective in restoring T3 responsiveness, while the vector with amino acids 1-25 had no effect. These data suggest that additional regions of the protein such as the basic region or leucine zipper are needed for the T3 induction. Gal4 expression vectors expressing full-length C/EBPalpha or beta  were tested, but these vectors did not increase the T3 response (data not shown). Since the Gal4-C/EBP vectors with full-length C/EBP did not restore T3 responsiveness to the PEPCK gene, the basic region or the leucine zipper may need to be associated with the P3 site to mediate this response.

                              
View this table:
[in this window]
[in a new window]
 
Table VI
Gal4-C/EBPbeta can restore T3 responsiveness to a PEPCK promoter
HepG2 cells were transfected with 5 µg of -490-PCAT, 5 µg of RSV-TRbeta , 1 µg of Gal4-C/EBPbeta , and 2 µg of SV40-beta -gal as described in Table I. Cells were treated with 100 nM T3 for 48 h. The transfections were done in duplicate and repeated four times. The results are presented as -fold induction by T3 ± S.E.

Previously, we reported that cotransfection of Gal4-C/EBPalpha 6-217 with -490-P3G4-PCAT partially restored T3 inducibility (8). Since the DNA binding and dimerization domains of C/EBP are on the carboxyl terminus, it is possible that having the Gal4 domain on the amino terminus of the fusion protein was preventing the full restoration of T3 responsiveness. The Gal4-C/EBPalpha 6-217 "flipped" vector, which has the Gal4 DNA binding domain on the carboxyl terminus of the fusion protein rather than the amino terminus, was tested (Table VII). Like Gal4-C/EBPalpha 6-217, this vector increased the T3 response to 2.4-fold. Serial deletions of Gal4-C/EBPalpha were tested, and they were less effective than Gal4-C/EBPalpha 6-217 in providing a T3 induction (Table VII). These observations suggest that either the C/EBPalpha or beta  isoforms will be able to mediate a T3 induction of PEPCK gene expression. Importantly, these results demonstrate that different regions of the C/EBP proteins participate in the T3 and cAMP response. The transactivation domains of C/EBPalpha or beta  are sufficient to restore cAMP responsiveness, but other domains of C/EBPalpha or beta  appear to be required for the full T3 response.

                              
View this table:
[in this window]
[in a new window]
 
Table VII
Gal4-C/EBPalpha can restore T3 responsiveness to a PEPCK promoter
HepG2 cells were transfected with 5 µg of -490-PCAT, 5 µg of RSV-TRbeta , 5 µg of Gal4-C/EBPalpha fusion plasmid, and 5 µg of SV40-beta -gal as described in Table I. Cells were treated with 100 NM T3 for 48 h. The transfections were done in duplicate and were repeated four times. The results are presented as -fold induction by T3 ± S.E.


    DISCUSSION

Expression of the PEPCK gene is controlled by hormonal signals as well as by developmental and tissue-specific factors. Each hormonal response of the PEPCK gene is mediated through a combination of hormone response elements and accessory factor sites. Our studies have defined various transcription factors involved in regulation by T3 and cAMP. Previous work has focused on the role of C/EBPalpha in the T3 and cAMP effects because C/EBPalpha is highly expressed in the liver and clearly contributes to the induction of PEPCK expression at birth (8, 18, 20). In this study, we have examined the contributions of C/EBPbeta to the basal expression and hormonal responsiveness of the PEPCK gene. Our results indicate that C/EBPbeta , along with the TR, can mediate the T3 induction of PEPCK transcription. C/EBPbeta can participate in cAMP responsiveness, and 108 amino acids of the transactivation domain will impart full cAMP responsiveness to the PEPCK promoter.

In several genes, the transcriptional stimulation by T3 is dependent on both the TR and other transcription factors, often called accessory factors. Accessory factors can be positioned in close proximity or widely separated from the TR. In the liver, NF-Y is required for the T3 stimulation of S14 gene transcription (28). The TREs of the S14 gene are located between -2,700 and -2,500, while the NF-Y binding site is near the start site of transcription (28, 29). In the heart, myocyte-specific enhancer factor 2 (MEF2) is involved in the T3 induction of the alpha -cardiac myosin heavy chain gene (30). MEF2 and the TR bind to adjacent sites in the alpha -myosin heavy chain promoter and can physically interact in solution (30). The stimulation of the human placental lactogen B gene by T3 is dependent on the binding of the pituitary factor GHF1 (also called Pit-1) (31). Our studies have identified C/EBP proteins as an additional family of accessory factors involved in T3 action.

C/EBP proteins possess three functional regions including a transactivation domain on the amino terminus, a basic region that binds DNA and leucine zipper that dimerizes with other C/EBP proteins. Within the first 100 amino acids of C/EBPalpha and beta  are three conserved peptide sequences, which contribute to the transactivation capabilities of these proteins (27, 32, 33). In C/EBPbeta , these peptides regions were called activation domain modules 1, 2, and 3 (ADM1, 2, and 3) and removal of any of these peptides reduced the ability of C/EBPbeta to stimulate basal transcription (27). The ADM3 (amino acids 83-92) is homologous to the homology box 2 (HOB2) domain found in Fos and Jun (34). The Gal4-C/EBPbeta vector expressing the first 108 amino acids of C/EBPbeta stimulated PEPCK basal transcription and restored cAMP responsiveness. In the Gal4-C/EBPbeta vector expressing amino acids 1-66, the ADM3 is deleted and a portion of ADM2 (amino acids 56-72) is removed. Since the Gal4-C/EBPbeta 1-66 vector did not stimulate basal expression of -490-P3G4-PLuc, it suggests that ADM3 is crucial for the stimulation of basal transcription. However, amino acids 1-66 did partially restore the cAMP response, indicating that additional regions of C/EBPbeta are involved in mediating the cAMP induction.

The regions of C/EBPalpha that are involved in cAMP responsiveness have been narrowly defined (20). Amino acids 1-124 were sufficient for a cAMP effect (20). In these studies, three Gal4 sites were ligated in front of a CAT reporter gene driven by a neutral promoter and this reporter vector was cotransfected with Gal4-C/EBPalpha vectors. Further deletion beyond amino acid 124 from the carboxyl terminus of C/EBPalpha resulted in a loss of cAMP responsiveness. In addition, the first 50 amino acids were essential for the cAMP induction. Most interestingly, mutation of amino acids 67, 77, and 78 in C/EBPalpha that interact with TBP did not affect the ability of this Gal4-C/EBPalpha protein to mediate a cAMP response (20, 32). However, the Gal4-C/EBPalpha vector with these mutations was unable to stimulate basal transcription. Therefore, different amino acids within C/EBPalpha are involved in the regulation of basal transcription and cAMP responsiveness. Our results suggest that different domains of C/EBPalpha and beta  mediate cAMP responsiveness. Amino acids 96-124 are essential for the cAMP induction by C/EBPalpha . There are no homologous domains within C/EBPbeta . These experiments were conducted in a slightly different manner since the transfections in this study were all conducted with a Gal4 binding site in the context of the PEPCK gene, while those of the previous study were conducted using multimerized Gal4 sites. Nonetheless, there does not appear to be a single homologous peptide region of C/EBPalpha and beta  that is responsible for the cAMP induction.

One important issue is why the Gal4-C/EBPalpha and beta  vectors do not restore full T3 responsiveness. One possibility is that either the leucine zipper or the basic region of C/EBP is required for the T3 induction, as has been shown in the regulation of other genes. For example, the leucine zipper of C/EBPbeta synergizes with Sp1 in the regulation of the rat CYP2D5 P450 gene (35). We cannot address this question with the Gal4-C/EBP expression vectors because, when the full-length C/EBPalpha or beta  protein is attached to the Gal4 DNA binding domain, the resulting protein inhibits basal and hormone-regulated transcription (20, 27). This observation suggests that the DNA binding domain must be in contact with the C/EBP binding site. Another possibility is that the Gal4 DNA binding domain altered the configuration of the C/EBP transactivation domain, making the necessary protein interactions for T3 responsiveness impossible. While both the alpha  and beta  isoforms of C/EBP can have a role in the regulation of PEPCK expression, in vivo they are not functionally redundant. In C/EBPalpha knock-out mice, the PEPCK gene was not induced at birth although PEPCK expression did rise after several hours (17, 18). In addition, the PEPCK gene was poorly responsive to cAMP (18). C/EBPalpha knock-out mice die at birth of hypoglycemia and other complications (17, 18). In the liver of adult mice in which the C/EBPalpha was conditionally knocked out, PEPCK expression was decreased (36). C/EBPbeta knock-out mice displayed a mixed phenotype with 50% of the mice dying at birth and showing reduced PEPCK gene expression (18). The remaining mice were viable and normal with respect to PEPCK expression. Other data indicate that the binding of C/EBPbeta to the PEPCK promoter may be increased by cAMP. When animals are injected with cAMP, the abundance of C/EBPbeta rises rapidly in the liver and the binding of C/EBPbeta to the P3(I) site increases (37). In physiologic situations such as with increased exercise, the abundance of C/EBPbeta increases in the liver (37). Our data demonstrate that, when C/EBPbeta is bound to the P3(I) site, it can stimulate basal expression and contribute to cAMP responsiveness.

While our studies have focused on the PTRE as T3 response element, this site is involved in several other hormone responses. Accessory factors are essential for the glucocorticoid induction of PEPCK transcription. Two weak glucocorticoid-responsive elements (GRE) have been identified (38). Like the TRE in the PEPCK gene, these GREs function well only in the context of the PEPCK promoter and confer very modest glucocorticoid responsiveness to a neutral promoter (38). Three accessory factor sites (AF1, AF2, and AF3) that are needed for glucocorticoid responsiveness have been defined (40, 41, 42). Mutation of any of these sites reduces the stimulation by glucocorticoids. AF3 overlaps the PTRE, and both chicken ovalbumin upstream promoter-transcription factor and the retinoic acid receptor (RAR) can bind the AF3/PTRE site (39, 42). The stimulation of transcription by retinoic acid (RA) is mediated in part through the AF3/PTRE site in the promoter (8, 42, 43). Interestingly, even though the RAR binds the PTRE, the RA induction is independent of C/EBP proteins further demonstrating the specificity of the involvement of C/EBP proteins in the T3 response (8).

Coactivator proteins provide a potential mechanism by which TR and C/EBP proteins could interact in the regulation of the PEPCK gene (44). Many of the transcription factors involved in the hormonal control of PEPCK expression are capable of interacting with various coactivators. The steroid receptor coactivator (SRC-1) can enhance the transactivation capability of a variety of steroid hormone receptors including the TR, RAR, glucocorticoid receptor, progesterone receptor, and estrogen receptor (45). SRC-1 has widespread tissue-specific distribution and is part of a family of nuclear receptor coactivators including SRC-2 (also cloned as GRIP1, TIF2) and SRC-3 (called RAC3, pCIP, and AIB1) (44, 46, 47). The CREB-binding protein was initially described as a coactivator for CREB, which enhanced cAMP signaling (48). Subsequently, CREB-binding protein has been demonstrated to interact with a wide variety of proteins including steroid hormone receptors, SRC proteins, and C/EBPbeta (44, 49, 50). Coactivators may help to coordinate the interactions of these various transcription factors on the PEPCK promoter in the absence of direct physical contact between the factors themselves.

    ACKNOWLEDGEMENTS

We thank Anna Mae Diehl for the generous gift of C/EBPbeta antibody. We thank Drs. R. Evans and M. Tsai for the TRbeta and RXRalpha expression vectors.

    FOOTNOTES

* This work was supported in part by Grant DK-46399 from the National Institute of Health and a grant from the Medical Research Council of Canada (to W. J. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Dr. Edwards A. Park, Dept. of Pharmacology, University of Tennessee, College of Medicine, 874 Union Ave., Memphis, TN 38163. Tel.: 901-448-4779; Fax: 901-448-7300; E-mail: epark{at}utmem1.utmem.edu.

    ABBREVIATIONS

The abbreviations used are: PEPCK, phosphoenolpyruvate carboxykinase; T3, 3,5,3'-triiodothyronine; TR, thyroid hormone receptor; TRE, thyroid hormone-responsive element; PTRE, TRE in the PEPCK promoter; P3(I), C/EBP binding site in PEPCK promoter; RXR, retinoid X receptor; RAR, retinoic acid receptor; DR4, direct repeat separated by 4 nucleotides; CAT, chloramphenicol acetyltransferase; Luc, luciferase; AF, accessory factor; C/EBP, CCAAT enhancer-binding protein; CRE, cAMP-responsive element; CREB, cAMP-responsive element-binding protein; AP-1, activation protein 1; RA, retinoic acid; beta -gal, beta -galactosidase; DMEM, Dulbecco's modified Eagle's medium; PKA, protein kinase A; PCR, polymerase chain reaction; ADM, activation domain module; GRE, glucocorticoid-responsive element..

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
REFERENCES
  1. Hanson, R. W., and Reshef, L. (1997) Annu. Rev. Biochem. 66, 581-611[CrossRef][Medline] [Order article via Infotrieve]
  2. Lazar, M. A. (1993) Endocr. Rev. 14, 184-193[Abstract/Free Full Text]
  3. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850[CrossRef][Medline] [Order article via Infotrieve]
  4. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A., and Evans, R. M. (1990) Nature 345, 224-229[CrossRef][Medline] [Order article via Infotrieve]
  5. Wagner, R. L., Apriletti, J. W., McGrath, M. E., West, B. L., Baxter, J. D., and Fletterick, R. J. (1995) Nature 378, 690-697[CrossRef][Medline] [Order article via Infotrieve]
  6. Murray, M. B., Zilz, N. D., McCreary, N. L., MacDonald, M. J., and Towle, H. C. (1988) J. Biol. Chem. 263, 12770-12777[Abstract/Free Full Text]
  7. Park, E. A., Jerden, D. C., and Bahouth, S. W. (1995) Biochem. J. 309, 913-919
  8. Park, E. A., Song, S., Olive, M., and Roesler, W. J. (1997) Biochem. J. 322, 343-349
  9. Roesler, W. J., Graham, J. G., Kolen, R., Klemm, D. J., and McFie, P. J. (1995) J. Biol. Chem. 270, 8225-8232[Abstract/Free Full Text]
  10. Liu, J., Park, E. A., Gurney, A. L., Roesler, W. J., and Hanson, R. W. (1991) J. Biol Chem. 266, 19095-19102[Abstract/Free Full Text]
  11. Roesler, W. J., Crosson, S. M., Vinson, C., and McFie, P. J. (1996) J. Biol. Chem. 271, 8068-8074[Abstract/Free Full Text]
  12. Patel, Y. M., Yun, J. S., Liu, J., McGrane, M. M., and Hanson, R. W. (1994) J. Biol. Chem. 269, 5619-5628[Abstract/Free Full Text]
  13. Birkenmeier, E. H., Gwynn, B., Howard, S., Jerry, J., Gordan, J. I., Landshulz, W. H., and McKnight, S. L. (1989) Genes Dev. 3, 1146-1156[Abstract/Free Full Text]
  14. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
  15. Park, E. A., Roesler, W. J., Liu, J., Klemm, D. J., Gurney, A. L., Thatcher, J. D., Shuman, J., Friedman, A., and Hanson, R. W. (1990) Mol. Cell. Biol. 10, 6264-6272[Abstract/Free Full Text]
  16. McKnight, S. L., Lane, M. D., and Gluecksohn-Waelsch, S. (1989) Genes Dev. 3, 2021-2024[Free Full Text]
  17. Wang, N.-D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995) Science 269, 1108-1112[Abstract/Free Full Text]
  18. Croniger, C., Trus, M., Lysek-Stupp, K., Cohen, H., Liu, Y., Darlington, G. J., Poli, V., Hanson, R. W., and Reshef, L. (1997) J. Biol. Chem. 272, 26306-26312[Abstract/Free Full Text]
  19. Park, E. A., Gurney, A. L., Nizielski, S. E., Hakimi, P., Cao, Z., Moorman, A., and Hanson, R. W. (1993) J. Biol. Chem. 268, 613-619[Abstract/Free Full Text]
  20. Roesler, W. J., Park, E. A., and McFie, P. J. (1998) J. Biol. Chem. 273, 14950-14957[Abstract/Free Full Text]
  21. Shapiro, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J. (1998) DNA 7, 47-55
  22. Krylov, D., Olive, M., and Vinson, C. (1995) EMBO J. 14, 5329-5337[Medline] [Order article via Infotrieve]
  23. Ahn, S., Olive, M., Aggarwal, S., Krylov, D., Ginty, D. D., and Vinson, C. (1998) Mol. Cell. Biol. 18, 967-977[Abstract/Free Full Text]
  24. Olive, M., Krylov, D., Echlin, D. R., Gardener, K., Taparowsky, E., and Vinson, C. (1997) J. Biol. Chem. 272, 18586-18594[Abstract/Free Full Text]
  25. Baniahmad, A., Ha, I., Reinberg, D., Tsai, S., Tsai, M.-J., and O'Malley, B. W. O. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8832-8836[Abstract/Free Full Text]
  26. Forman, B. M., Umesono, K., Chen, J., and Evans, R. M. (1995) Cell 81, 541-550[CrossRef][Medline] [Order article via Infotrieve]
  27. Williams, S. C., Baer, M., Dillner, A. J., and Johnson, P. F. (1995) EMBO J. 14, 3170-3183[Medline] [Order article via Infotrieve]
  28. Jump, D. B., Badin, M. V., and Thelen, A. (1997) J. Biol. Chem. 272, 27778-27786[Abstract/Free Full Text]
  29. Liu, H. C., and Towle, H. C. (1994) Mol. Endocrinol. 8, 1021-1037[Abstract/Free Full Text]
  30. Lee, Y., Nadal-Ginard, B., Mahdavi, V., and Izumo, S. (1997) Mol. Cell. Biol. 17, 2745-2755[Abstract]
  31. Voz, M. L., Peers, B., Weidig, M. J., Jacquemin, P., Belayew, A., and Martial, J. A. (1992) Mol. Cell. Biol. 12, 3991-3997[Abstract/Free Full Text]
  32. Nerlov, C., and Ziff, E. B. (1995) EMBO J. 14, 4318-4328[Medline] [Order article via Infotrieve], 1995
  33. Nerlov, C., and Ziff, E. B. (1994) Genes Dev. 8, 350-362[Abstract/Free Full Text]
  34. Sutherland, J. A., Cook, A., Bannister, A. J., and Kouzarides, T. (1992) Genes Dev. 6, 1810-1819[Abstract/Free Full Text]
  35. Lee, Y. H., Williams, S. C., Baer, M., Sterneck, E., Gonzalez, F. J., and Johnson, P. F. (1997) Mol. Cell. Biol. 17, 3028-2047[Abstract]
  36. Lee, Y. H., Sauer, B., Johnson, P. F., and Gonzalez, F. J. (1997) Mol. Cell. Biol. 17, 6014-6022[Abstract]
  37. Nizielski, S. E., Arizmendi, C., Shteyngarts, A. R., Farell, C. J., and Friedman, J. E. (1996) Am. J. Physiol. 270, R1005-R1012[Abstract/Free Full Text]
  38. Scott, D. K., Stromstedt, P. E., Wang, J. C., and Granner, D. K. (1998) Mol. Endo. 12, 482-491[Abstract/Free Full Text]
  39. Scott, D. K., Mitchell, J. A., and Granner, D. K. (1996) J. Biol. Chem. 271, 31909-31914[Abstract/Free Full Text]
  40. Wang, J. C., Stromstedt, P. E., O'Brien, R. M., and Granner, D. K. (1996) Mol. Endocrinol. 10, 794-800[Abstract/Free Full Text]
  41. Mitchell, J., Noisin, E., Hall, R., O'Brien, R., Imai, E., and Granner, D. K. (1994) Mol. Endocrinol. 8, 585-594[Abstract/Free Full Text]
  42. Scott, D. K., Mitchell, J. A., and Granner, D. K. (1996) J. Biol. Chem. 271, 6260-6264[Abstract/Free Full Text]
  43. Hall, R. K., Sladek, F. M., and Granner, D. K. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 412-416[Abstract/Free Full Text]
  44. Shibata, H., Spencer, T. E., Onate, S. A., Tsai, S. Y., Tsai, M-J., and O'Malley, B. W. (1997) Rec. Prog. Horm. Res. 52, 141-165
  45. Onate, S. A., Tsai, S. Y., Tsai, M-J., and O'Malley, B. W. (1995) Science 270, 1354-1357[Abstract/Free Full Text]
  46. Ding, X. F., Anderson, C. M., Ma, H., Hong, H., Uht, R. M., Kushner, P. J., and Stallcup, M. R. (1998) Mol. Endocrinol. 12, 302-313[Abstract/Free Full Text]
  47. Li, H., and Chen, J. D. (1998) J. Biol. Chem. 273, 5948-5954[Abstract/Free Full Text]
  48. Chriva, J. C., Kwok, R. P. S., Lamb, N., Haglwara, M., Montminy, M. R., and Goodman, R. H. (1993) Nature 365, 855-859[CrossRef][Medline] [Order article via Infotrieve]
  49. Mink, S., Haenig, B., and Klempnauer, K-H. (1997) Mol. Cell. Biol. 17, 6609-6617[Abstract]
  50. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S. C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996) Cell 85, 403-414[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
H. Wang, T. H. Peiris, A. Mowery, J. Le Lay, Y. Gao, and L. E. Greenbaum
CCAAT/Enhancer Binding Protein-{beta} Is a Transcriptional Regulator of Peroxisome-Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Regenerating Liver
Mol. Endocrinol., July 1, 2008; 22(7): 1596 - 1605.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. J. McFie, G.-L. Wang, N. A. Timchenko, H. L. Wilson, X. Hu, and W. J. Roesler
Identification of a Co-repressor That Inhibits the Transcriptional and Growth-Arrest Activities of CCAAT/Enhancer-binding Protein {alpha}
J. Biol. Chem., June 30, 2006; 281(26): 18069 - 18080.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Yeagley and P. G. Quinn
3',5'-Cyclic Adenosine Monophosphate Response Element-Binding Protein and CCAAT Enhancer-Binding Protein Are Dispensable for Insulin Inhibition of Phosphoenolpyruvate Carboxykinase Transcription and for Its Synergistic Induction by Protein Kinase A and Glucocorticoids
Mol. Endocrinol., April 1, 2005; 19(4): 913 - 924.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol., January 1, 2005; 25(1): 472 - 487.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
H.-L. Fang, M. Abdolalipour, Z. Duanmu, J. R. Smigelski, A. Weckle, T. A. Kocarek, and M. Runge-Morris
REGULATION OF GLUCOCORTICOID-INDUCIBLE HYDROXYSTEROID SULFOTRANSFERASE (SULT2A-40/41) GENE TRANSCRIPTION IN PRIMARY CULTURED RAT HEPATOCYTES: ROLE OF CCAAT/ENHANCER-BINDING PROTEIN LIVER-ENRICHED TRANSCRIPTION FACTORS
Drug Metab. Dispos., January 1, 2005; 33(1): 147 - 156.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Gautier-Stein, G. Mithieux, and F. Rajas
A Distal Region Involving Hepatocyte Nuclear Factor 4{alpha} and CAAT/Enhancer Binding Protein Markedly Potentiates the Protein Kinase A Stimulation of the Glucose-6-Phosphatase Promoter
Mol. Endocrinol., January 1, 2005; 19(1): 163 - 174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. L. Wilson, P. J. McFie, and W. J. Roesler
Different Transcription Factor Binding Arrays Modulate the cAMP Responsivity of the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem., November 8, 2002; 277(46): 43895 - 43902.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. A. Jurado, S. Song, W. J. Roesler, and E. A. Park
Conserved Amino Acids within CCAAT Enhancer-binding Proteins (C/EBPalpha and beta ) Regulate Phosphoenolpyruvate Carboxykinase (PEPCK) Gene Expression
J. Biol. Chem., July 26, 2002; 277(31): 27606 - 27612.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yin, Y. Zhang, and F. B. Hillgartner
Sterol Regulatory Element-binding Protein-1 Interacts with the Nuclear Thyroid Hormone Receptor to Enhance Acetyl-CoA Carboxylase-alpha Transcription in Hepatocytes
J. Biol. Chem., May 24, 2002; 277(22): 19554 - 19565.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Liu, Q.-T. Wall, L. Taylor, and N. P. Curthoys
C/EBPbeta contributes to cAMP-activated transcription of phosphoenolpyruvate carboxykinase in LLC-PK1-F+ cells
Am J Physiol Renal Physiol, October 1, 2001; 281(4): F649 - F657.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Xu, T. Yen, and C. L. Geczy
IL-10 Up-Regulates Macrophage Expression of the S100 Protein S100A8
J. Immunol., May 15, 2001; 166(10): 6358 - 6366.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Roy, S. J. Wachira, X. Weihua, J. Hu, and D. V. Kalvakolanu
CCAAT/Enhancer-binding Protein-beta Regulates Interferon-induced Transcription through a Novel Element
J. Biol. Chem., April 21, 2000; 275(17): 12626 - 12632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Crosson and W. J. Roesler
Hormonal Regulation of the Phosphoenolpyruvate Carboxykinase Gene. ROLE OF SPECIFIC CCAAT/ENHANCER-BINDING PROTEIN ISOFORMS
J. Biol. Chem., February 25, 2000; 275(8): 5804 - 5809.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Waltner-Law, M. C. Daniels, C. Sutherland, and D. K. Granner
NF-kappa B Inhibits Glucocorticoid and cAMP-mediated Expression of the Phosphoenolpyruvate Carboxykinase Gene
J. Biol. Chem., October 6, 2000; 275(41): 31847 - 31856.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. Croniger, C. Millward, J. Yang, Y. Kawai, I. J. Arinze, S. Liu, M. Harada-Shiba, K. Chakravarty, J. E. Friedman, V. Poli, et al.
Mice with a Deletion in the Gene for CCAAT/Enhancer-binding Protein beta Have an Attenuated Response to cAMP and Impaired Carbohydrate Metabolism
J. Biol. Chem., January 5, 2001; 276(1): 629 - 638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Ghosh, R. Lacson, P. Liu, S. B. Cichy, A. Danilkovich, S. Guo, and T. G. Unterman
A Nucleoprotein Complex containing CCAAT/Enhancer-binding Protein beta Interacts with an Insulin Response Sequence in the Insulin-like Growth Factor-binding Protein-1 Gene and Contributes to Insulin-regulated Gene Expression
J. Biol. Chem., March 9, 2001; 276(11): 8507 - 8515.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Guo, S. B. Cichy, X. He, Q. Yang, M. Ragland, A. K. Ghosh, P. F. Johnson, and T. G. Unterman
Insulin Suppresses Transactivation by CAAT/Enhancer-binding Proteins beta (C/EBPbeta ). SIGNALING TO p300/CREB-BINDING PROTEIN BY PROTEIN KINASE B DISRUPTS INTERACTION WITH THE MAJOR ACTIVATION DOMAIN OF C/EBPbeta
J. Biol. Chem., March 9, 2001; 276(11): 8516 - 8523.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, L. Yin, and F. B. Hillgartner
The Homeodomain Proteins PBX and MEIS1 Are Accessory Factors That Enhance Thyroid Hormone Regulation of the Malic Enzyme Gene in Hepatocytes
J. Biol. Chem., June 22, 2001; 276(26): 23838 - 23848.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. K. Jacob and F. M. Stanley
Elk-1, C/EBPalpha , and Pit-1 Confer an Insulin-responsive Phenotype on Prolactin Promoter Expression in Chinese Hamster Ovary Cells and Define the Factors Required for Insulin-increased Transcription
J. Biol. Chem., June 29, 2001; 276(27): 24931 - 24936.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yeagley, J. Moll, C. A. Vinson, and P. G. Quinn
Characterization of Elements Mediating Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Protein Kinase A and Insulin. IDENTIFICATION OF A DISTINCT COMPLEX FORMED IN CELLS THAT MEDIATE INSULIN INHIBITION
J. Biol. Chem., June 2, 2000; 275(23): 17814 - 17820.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, E. A.
Right arrow Articles by Roesler, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, E. A.
Right arrow Articles by Roesler, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement