J Biol Chem, Vol. 274, Issue 1, 444-450, January 1, 1999
The Golden Hamster Aphrodisin Gene
STRUCTURE, EXPRESSION IN PAROTID GLANDS OF FEMALE ANIMALS, AND
COMPARISON WITH A SIMILAR MURINE GENE*
Hans-Jürgen
Mägert
,
Alexandra
Cieslak,
Ozan
Alkan,
Bernhard
Lüscher§,
Wolfgang
Kauffels¶, and
Wolf-Georg
Forssmann
From the Lower Saxony Institute for Peptide Research,
D-30 625 Hannover, Germany and Departments of § Molecular
Biology and ¶ Gynecology and Obstetrics, Hannover Medical School,
D-30625 Hannover, Germany
 |
ABSTRACT |
The so-called lipocalins are a family of
extracellular proteins that are known to typically fulfill tasks as
transport proteins for small hydrophobic molecules. However, in the
last decade, a large diversity has been described concerning their
functions, for example as enzymes, immunomodulators, or proteins
involved in coloration and pheromone action. Aphrodisin belongs to
those lipocalins, which are of significant importance for the
pheromonal stimulation of copulatory behavior in male hamsters. We
recently succeeded in characterizing the corresponding cDNA and
demonstrated the expression of the aphrodisin gene in the vagina,
uterus, and Bartholin's glands of female hamsters. Here we report the
structure of the aphrodisin gene and the functionality of its promoter
region. We further compare the aphrodisin gene to the related gene for mouse odorant-binding protein 1a, indicating similar functions of their
products. As a novelty, we show that the aphrodisin gene, in addition
to the above-mentioned tissues, is also expressed in female hamster
parotid glands. In contradiction to the results expected, we finally
demonstrate that aphrodisin already occurs in vaginal discharge before
the female animals reach fertility. These findings may lead to the
identification of as yet unknown aphrodisin functions.
 |
INTRODUCTION |
Lipocalins are a family of proteins that typically exhibit a
molecular mass in the range of ~17-30 kDa. Their main function seems
to be the transport of low molecular mass hydrophobic substances such
as retinol, progesterone, odorants, and even pheromones within hydrophilic environments. For this purpose, lipocalins exhibit a
certain tertiary structure, which is comparable to a coffee filter,
containing an apolar binding pocket for specific ligands. This
structure is formed by two sets of four antiparallel
-strands arranged in two orthogonally stranded
-sheets (for review, see Ref.
1). Besides their functions as transporter molecules, in the last
decade manifold additional tasks have been described, including
functions as enzymes (2, 3), gustatory proteins (4, 5),
immunomodulators (6), cell regulators (7-9), and proteins involved in
the coloration of animals (10). Depending on the existence of all or
just a subset of three conserved amino acid stretches, lipocalins are
meanwhile divided into subgroups of the so-called kernel and outlier
lipocalins (1). Surprisingly, even bacterial lipocalins have recently
been discovered as members of the latter subgroup (11, 12).
Another prominent member of the outlier lipocalins is aphrodisin, which
was originally isolated from hamster vaginal discharge, where it occurs
in relatively high concentrations, such as 100 µg/20 mg of discharge
(13, 14). Aphrodisin was demonstrated to be essential for the
pheromonal stimulation of copulatory behavior in male hamsters acting
via the vomeronasal organ (15), which is located within the nasal
septum of a large number of different vertebrates. Although it may be
degenerated, humans also seem to possess a functionally active
vomeronasal organ (16-18). At the present time it is still not known
whether aphrodisin itself or the combination with a low molecular mass
ligand is necessary for pheromonal activity (19). However, the ability
of purified aphrodisin to modulate the production of the second
messenger inositol-1,4,5-triphosphate in membranes of the male
hamster's vomeronasal organ could already be demonstrated (20).
To obtain nucleotide sequence information for the construction of
hybridization probes and PCR1
primers to facilitate the identification of related systems in species
other than the hamster, we have cloned and characterized the aphrodisin
cDNA. We further demonstrated the high level expression of the
corresponding gene in vaginal tissue, several segments of the uterus,
and the Bartholin's glands and characterized part of its promoter
region (21, 22). In this paper, we report the structure of the entire
aphrodisin gene and show the functionality of its promoter. As a
novelty, we describe its expression in the parotid glands of female but
not of male golden hamsters. In contradiction to the results expected
for a copulation-stimulating pheromone, we demonstrate the significant
occurrence of aphrodisin in golden hamster vaginal discharge before the
female animals reach fertility. In addition, we describe the gene for
mouse odorant-binding protein 1a (MMOBP1A), which possibly exhibits a
function comparable with that of aphrodisin. These results may in the
future allow the discovery of so far unknown functions of aphrodisin,
the characterization of related proteins and their genes in mammalian
species other than hamster, and the investigation of regulatory
mechanisms of the gene.
 |
EXPERIMENTAL PROCEDURES |
Oligodeoxyribonucleotides--
The oligonucleotides listed below
were purchased from Perkin-Elmer and used as PCR primers, sequencing
primers, and hybridization probes (listed in 5'
3' direction)
(primers used for primer walking sequencing are not listed): AP-24,
GCTTCTTGAAACAATTTATTTAATCAGT; AP-42,
CTAAACACTGAAGTCAACTCCTGGAACCCAG; AP-44,
CTTAGTGACTATTTATGGGCTTTTTGAATG; OZ-1,
TTAAAGAGCTCACGCGTGCGGCCGCTTGGGACAGGGTGGAAGG; OZ-2,
CCAAACTCGAGATCTGGTGCCTGACTTTGCTTTTCC; MAP-66,
TGCTGCTTGCTTTGACTTTGGACTGGCAC; MAP-67, ATCAGCAGCAATAGCAACAGTTTTCCATGG; MAP-68, CTTACCTGTGAAAAGGAATGCAAGGAAATG; MAP-69,
CCCAGTGATTGTGGTCAATGAGCACTGTCC; MAP-70, TGCAAGAAGATGGCAAGACCTACAAAACTC;
MAP-71, CTCATCCACAAGTTTATAACGATTATTCCC; MAP-81,
GGGAATAATCGTTATAAACTTGTGGATGAG; MAP-82,
GAGAACTTAACATTTTATAGTGAGAACGTGG; MAP-83,
TGTGCCAGTCCAAATGTCAAAGCAAGCAGC; MAP-84, GCCATGATGGTACAAGACTTTCTTTTCTAC; MAP-105, GATAAAATATGTCATTCCTTACTCTACTCAC; MAP-106,
ACTCACTTTCTTTTACAGATTACTGTCCTG; MAPEX-1, CCTTCACAACTACTTATCTGCTTTGAGC;
MAPEX-2, GAGGGAAGCTCACACTTTATAAACAC; MAPEX-3,
CAACTCATATTCTAATGGTTTGTATGG; MAPEX-4, TCAGTTTAYATTYTTGATAATTTGC; MAPEX-5, GATGTAATGGTAGCAAAGAACAAACC; MAPEX-6,
CAACTACAATGCTTTGGTCATAGAGGG; MAPEX-7, GTAGAACATTGAGAGTTACTGACTTTTG; and
MAPEX-8, GCAGTAATTTTTTTACTATTTCAGAGATCC.
Cloning and Characterization of the Golden Hamster Aphrodisin
Gene--
Cloning, Southern blotting, subcloning of positive
restriction fragments, and sequencing of the golden hamster aphrodisin gene were accomplished as already described (21). PCR fragments were
cloned in pGEM-T vector (Promega). Nucleotide sequences were determined
on both strands. In the case of PCR-generated fragments, at least three
independent clones were sequenced. Comparison of obtained partial
sequences with each other was performed by means of the MacMolly
software package (Softgene, Berlin, Germany). Potential regulatory
elements within the 5'-flanking region of the golden hamster aphrodisin
gene and the related MMOBP1A gene of the mouse were detected using the
MatInspector program (23) on an Apple Power Macintosh 8200/120
computer. For analysis of the functionality of different promoter
fragments, luciferase reporter gene assays with human T 84 cells and
different derivatives of the vector pGL2 were performed exactly as
described (24). The largest of the promoter fragments used was
generated by PCR (25) with the primer pair OZ-1/OZ-2 and a pUC18
derivate containing the 5'-terminal 5.7-kbp SstI fragment of
the gene as a template (21). Reaction conditions were as follows:
99 °C, 2 min; addition of 2.5 units of Taq DNA-polymerase
(Boehringer Mannheim)/50-µl reaction volume at 72 °C; 95 °C,
30 s, 48 °C, 30 s, 65 °C, 5 min, 19 cycles; 95 °C,
30 s, 48 °C, 30 s, 65 °C, 10 min, one cycle. 1 µg of
the above-mentioned plasmid template was used/50-µl reaction mixture.
The 2144-bp fragment obtained was cloned site-directed into the
SstI-XhoI sites of the vector pGL2 basic
(Promega). Two additional subclones containing smaller 5'-terminally
truncated insertions were generated by linearization of the clone with
SstI, subsequent hydrolysis with either PstI or
Bpu 1102I, generation of blunt ends using Klenow enzyme
(Boehringer Mannheim), and religation.
Gene Expression Analysis--
Golden hamster vaginal discharge
and saliva samples were taken by rinsing the vagina or throat with
physiological sodium chloride solution using a catheter. The liquid was
collected in small reaction tubes by means of a funnel and stored at
20 °C. Concentration of the proteins was achieved by precipitation
with a 10-fold volume of ethanol and subsequent sedimentation at
4 °C. Western blot analysis, RNA extraction, cDNA first strand
synthesis, and analytical RT-PCR were performed as described recently
(22).
Cloning of Fragments of the MMOBP1A Gene--
High molecular
mass mouse genomic DNA was a kind gift from Sigrid Wattler. Three
fragments of the mouse MMOBP1A gene spanning the end of exon 1 to the
beginning of exon 2, the end of exon 2 to the beginning of exon 3, and
the end of exon 3 to the beginning of exon 4, were amplified using the
primer pairs MAP-66/67, MAP-68/69, and MAP-70/71, respectively, 100 ng
of the mouse genomic DNA in each reaction, GeneAmp Tth
DNA-polymerase, and a model 9600 thermal cycler (both from
Perkin-Elmer) under the following conditions: 94 °C, 3 min;
98 °C, 0 s, 50 °C, 30 s, 72 °C, 2 min, 39 cycles; 98 °C, 0 s, 50 °C, 30 s, 72 °C, 5 min, one cycle.
Exons 1-4 of the MMOBP1A gene were amplified in the same way but using
the primer pairs MAPEX-1/2, MAPEX-3/4, MAPEX-5/6, and MAPEX-7/8,
respectively. 5'- and 3'-terminal fragments of the gene were amplified
by means of the GenomeWalker mouse kit (CLONTECH,
Palo Alto, CA) (26) according to the manufacturer's instructions with
modifications. The GeneAmp XL PCR kit (Perkin-Elmer) was used without
TthStart antibody under the following conditions: first
amplification, 94 °C, 25 s, 72 °C, 4 min, seven cycles;
94 °C, 25 s, 55 °C, 10 s, 67 °C, 4 min, 32 cycles;
67 °C for an additional 4 min; cold start; PCR primers GSP-1 and
AP-1; second amplification, 94 °C, 25 s, 72 °C, 4 min, five
cycles; 94 °C, 25 s, 55 °C, 10 s, 67 °C, 4 min, 24 cycles; 67 °C for an additional 4 min; cold start; PCR primers GSP-2
and AP-2. GSP-1 and GSP-2 were MAP-83/MAP-84 for the amplification of
the 5'-terminal fragment and MAP-81/MAP-82 for the 3'-terminal
fragment. However, because the obtained fragment did not represent the
entire 3' terminus of the gene, a second amplification step was
performed with the primers MAP-105 and MAP-106, which were derived from
the novel sequence information. Fragments obtained were cloned and
sequenced as described above.
 |
RESULTS |
Gene Analysis--
As already described, a 5.7-kbp SstI
fragment of the aphrodisin gene, spanning the region from the 5'
terminus down to position 5657 of the data base entry, was cloned in
pBSK. To obtain an additional subclone containing the 3'-terminal
remainder of the gene, Southern blotting was performed with different
restriction fragments of the gene and the oligonucleotide AP-24, which
was derived from the 3' terminus of the cDNA, as a hybridization
probe. A positive 1.5-kbp EcoRI fragment, which seemed to be
large enough to overlap with the 5.7-kbp SstI fragment, was
subcloned in pBSK. However, the partial sequencing results obtained
indicated that a further gene fragment for the connection of both
subfragments mentioned above was still needed. Finally, this fragment
was generated by PCR with primers derived from the 3' terminus of the
5.7-kbp SstI fragment (AP-42) and the 3'-terminal region of
the 1.5-kbp EcoRI fragment (AP-44) and DNA of the phage
clone as a template. The 2124-bp PCR fragment obtained was subcloned in
pGEM-T vector, and the nucleotide sequence of the entire golden hamster
aphrodisin gene was assembled by means of the primer walking sequencing
strategy with subsequent sequence comparisons.
By comparison of the nucleotide sequence of the gene with the already
known cDNA sequence, the following gene structure was determined:
the entire aphrodisin gene spans a length of >6 kbp excluding the
5'-flanking region. It consists of seven exons, which are split by six
introns. With the exception of intron 5, all exon-intron splice
junctions agree well with the exon | GTRAG-intron-AG | exon
rule (27). Exon 7 does not contain any coding region but just
represents the main part of the 3' untranslated region (Fig.
1).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic drawings of the structures of the
genes for golden hamster aphrodisin and MMOBP1A. Exon sizes are
given in bp above the boxes representing the exons. Intron
sizes are given in bp between the boxes. Translated regions
are in dark gray, untranslated regions in light
gray. Transcription factors exhibiting potential binding sites
within the gene promoters as well as the TATA and CAAT boxes are
indicated. Within the scheme of the MMOBP1A gene, Evi-1 is printed in
italics because it is the only potential regulating element
mentioned with a matrix similarity <0.9.
|
|
To investigate the general importance of an aphrodisin-related
pheromone system in mammals, we have tried in vain for a long time to
clone the corresponding cDNAs and genes from different species
using PCR primers and hybridization probes derived from the nucleotide
sequence of the hamster. This intention harbors extraordinary
difficulties, because proteins of the lipocalin family normally exhibit
a high divergence of their amino acid sequences. As a rule, different
lipocalins share sequence identities in the range of ~25-35%. Until
recently, among the known lipocalins, rat odorant-binding protein (28)
showed the highest sequence identity to aphrodisin (40% at the protein
level). However, in the past year, two expressed sequence tag data base
entries of 5'-terminal partial cDNAs from mouse have appeared
(accession numbers AA172872 and AA172874), which exhibit sequence
identities to aphrodisin of >60% at the nucleotide level and ~50%
at the amino acid level. Thus, it is presumed that these sequences
represent a murine equivalent of aphrodisin. Recently, another
nucleotide sequence entry generated by Mameli and
co-workers2 appeared in the EMBL
nucleotide sequence data base. The product of the corresponding gene
was designated MMOBP1A. Although the sequence encoding the secretory
signal peptide of the precursor was missing, the MMOBP1A cDNA
sequence in overlapping regions showed absolute identity to the
expressed sequence tag clones mentioned above. Taking together the
sequence information of all three clones, a cDNA sequence encoding
an entire putative MMOBP1A precursor protein could be assembled.
Because of all known lipocalins this protein exhibits the highest
sequence identity to aphrodisin at the nucleotide (66%) as well as at
the amino acid level (47%), a similar biological function is likely.
To obtain further data for the verification of this hypothesis, we
decided to compare the structures of the corresponding genes,
especially concerning the positions of their introns. For this purpose,
we derived MMOBP1A-specific PCR primers (MAP-66-MAP-71) flanking the
expected positions of the introns, presuming a distribution nearly
identical to that of the aphrodisin gene. At the time we began these
experiments, only the expressed sequence tag clones spanning a partial
cDNA region including the putative exons 1-4 and the beginning of
exon 5 were known. Thus, only primers for the amplification of introns 1-3 could be derived. For amplification of the 5'- and 3'-terminal remnants of the gene, we performed GenomeWalker PCR reactions as
described above. From the upstream-directed GenomeWalker PCR we
obtained a fragment of ~350 bp including the part of the gene from
nucleotide 4 of the translated region up to position
300 relative to
the putative cap site. From the downstream-directed GenomeWalker PCR,
we obtained a contig of ~4260 bp spanning the region from nucleotide
44 of exon 4 down to ~1400 bp of the 3'-flanking region of the gene.
Inner-positioned, PCR-amplified introns 1-3 as well as introns 4-6
included within the downstream GenomeWalker contig were only roughly
sequenced to estimate their size. This means that ambiguous nucleotide
positions occurring within the sequence that are generated to a
particular low amount by the sequencer have not been precisely
determined. On the other hand, exons 1-4 were not sequenced but
amplified, using the four primer pairs MAPEX-1/2-MAPEX-7/8, and
subsequently analyzed on an agarose gel to determine whether they
contain additional introns not known from the aphrodisin gene. Indeed,
the sizes of the fragments obtained exactly matched those calculated
for exons without additional introns (data not shown). Taken together,
the amplification and sequencing of the MMOBP1A gene fragments and
comparison with the golden hamster aphrodisin gene revealed an almost
identical positioning of the introns (Figs. 1 and
2), verifying the relation of both genes
to one another. However, only introns 1-3 and 6 match the sizes of the
corresponding aphrodisin gene introns, because introns 4 and 5 show
deviations (Fig. 1).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of the cDNA and amino acid
sequences of hamster aphrodisin and MMOBP1A. Nucleotides identical
in both cDNAs are marked with vertical dashes; agreeing
amino acids are marked with black dots above the aphrodisin
sequence. The positions of the introns of both genes are indicated; the
nucleotides flanking the introns are underlined.
|
|
Analysis of the Aphrodisin gene Promoter and Sequence Comparison
with the MMOBP1A Promoter--
The promoter region of the aphrodisin
gene has already been determined by primer extension analysis (21). To
verify its functionality in vivo, we performed several
promoter-luciferase reporter gene assays with different subfragments of
the promoter and a selected number of cell lines. For this purpose, a
2144-bp aphrodisin gene 5'-flanking fragment was amplified by means of the primer OZ-1, derived from the upstream terminus of the 5.- kbp
SstI fragment, and the second primer OZ-2, spanning the
region from the adenosine nucleotide of the ATG translational start
codon up to the position located 23 nucleotides upstream of the ATG start codon and 26 nucleotides downstream from the already determined cap site. The fragment obtained was cloned into the luciferase reporter
gene vector pGL2 basic. Two additional clones, containing 1170- and
669-bp subfragments of the 2144-bp fragment, were generated as
described above.
Because no cell line that seemed to be ideal for aphrodisin gene
promoter analysis (for instance, a hamster vaginal epithelium cell
line) was available, we tested the cell lines RK 13 (rat kidney), CRL
6176 (cat salivary glands), and T 84 (human colon carcinoma) for their
suitability for aphrodisin gene promoter activity studies. Of these
cell lines, only the human T 84 cells gave reproducible results and
showed a significant promoter functionality. The results obtained are
presented in Fig. 3: the entire
aphrodisin gene 5'-flanking fragment of 2144 bp exhibited a promoter
activity that is 36-fold above the activity of the basic vector,
whereas the 1170- and 669-bp fragments showed 17- and 16-fold
activities, respectively. These results strongly indicate the
functionality of the aphrodisin gene promoter region in T 84 cells.
They further indicate the existence of an activating element within the
1-kbp region, starting ~1150 bp upstream of the cap site.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Results of the luciferase reporter gene
assays with three different aphrodisin promoter fragments in T 84 cells. The relative promoter activities were calculated from three
independent assays.
|
|
As another strategy to identify potential regulatory regions within the
aphrodisin gene and its 5'-flanking region, we analyzed its nucleotide
sequence using the MatInspector program (23). The 300-bp 5'-flanking
region of the MMOBP1A gene obtained by the above-mentioned genome
walking PCR was sequenced precisely on both strands and was analyzed in
the same way as the aphrodisin gene promoter. For detection of high
probability regulatory elements, the core similarities generally had to
be 100%, whereas the matrix similarities had to be at least 90%. In
addition, two alternative criteria had to be fulfilled. First, the core
sequence of a regulatory element had to occur in the promoter regions
of both genes, the golden hamster aphrodisin gene and the MMOBP1A gene.
Second, if the first requirement could not be met, the random
expectation value for a high probability regulating element within the
aphrodisin gene promoter had to be 0.1 at the most.
Using this strategy, potential binding sides for the following
transcription factors could be detected within the promoters of both
genes: AP-1 (29), Evi-1 (30), GATA-1 (twice) (31), and c-Ets-1(p54)
(twice) (32). Furthermore, CAAT boxes in reverse complementary
orientation and TATA boxes occur in the expected positions. In
addition, putative binding sites for Elk-1 (33, 34) and IRF-1 (35, 36)
are represented within the aphrodisin gene 5'-flanking region (Figs. 1
and 4 and Table
I).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
Comparison of two corresponding parts of the
golden hamster aphrodisin and MMOBP1A gene promoters. The
enumeration of the nucleotides is relative to the cap site and in the
case of MMOBP1A to the putative cap site. Potential regulatory elements
are indicated (also see Table I). The similarity of the presented
regions is ~67%.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Potential regulatory elements of the aphrodisin and MMOBP1A gene
promoters identified by the MatInspector program
The core similarity of all elements had to be 1.0. With the exception
of the MMOBP1A Evi-1 site, the matrix similarity had to be at least
0.9. Core sequences are in capital letters, matrix sequences in small
letters. The IRF-1 site (printed in italics) occurs on the minus
strand, all other elements on the plus strand. The positions are
relative to the cap site and in the case of MMOBP1A to the putative cap
site (see Fig. 4). NA, not applicable.
|
|
Expression of the Aphrodisin Gene--
The expression of the
aphrodisin gene in different segments of the female hamster genital
tract has already been demonstrated. Because aphrodisin probably
functions as a transporter for low molecular mass hydrophobic pheromone
molecules, which act via the vomeronasal organ of the male hamster,
additional expression of the gene in several regions of the hamster
throat seemed to be likely. We therefore performed Western blot
analysis with protein extracts (6 µg of total protein) from the
saliva of male and female golden hamsters. Surprisingly, and contrary
to our expectations, we obtained signals in the expected size range
only from female animals (Fig.
5A). In the saliva of male
golden hamsters, which are the recipients of pheromonal signals from
the female animals, no aphrodisin-specific signals were detectable. To
verify these results at the nucleic acid level, we also performed
RT-PCR analysis with total RNA extracted from the parotid glands of
female and male hamsters and, as a positive control, from hamster
vagina. In this case, we also obtained significant signals only from
female hamster parotid glands (Fig. 5B), verifying the
results of the Western blot analysis. The corresponding PCR fragments
have been reamplified, directly sequenced, and identified as
aphrodisin-specific. Unexpectedly, the data obtained clearly indicate
an expression of the aphrodisin gene in female golden hamster parotid
glands and the secretion of the protein into the female hamster's
saliva.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 5.
Detection of aphrodisin gene expression in
female golden hamster parotid glands. A, Western blot with
saliva from golden hamsters of both sexes and vaginal discharge. The
aphrodisin-specific signal appearing in the expected size range is
indicated by an arrow. Aphrodisin immunoreactivity is
detectable in vaginal discharge and saliva of female hamsters. Saliva
of male animals does not show any aphrodisin immunoreactivity.
B, aphrodisin-specific RT-PCR analysis of cDNA from
golden hamster uterus (positive control), parotid glands from female
and male golden hamsters and rabbit uterus (negative control). Shown is
the autoradiograph of a Southern blot with reaction products of an
aphrodisin-specific RT-PCR. The blot was hybridized with an
oligonucleotide probe, the sequence of which is positioned between the
two PCR primers relative to the sequence of the aphrodisin cDNA.
The number of cycles is indicated above the autoradiograph.
Positive signals are visible from the uterus and female hamster parotid
gland. Male hamster parotid gland and rabbit uterus (negative control)
do not show any signal.
|
|
Another question arising in the context of aphrodisin as a putative
pheromone transporter concerns the dependence of gene expression on the
stage of fertility of juvenile female hamsters. Provided that
aphrodisin functions exclusively as a transporter for sex pheromones,
its secretion into female hamster vaginal discharge only would make
sense from the time the newborn hamsters reach fertility. To test this
hypothesis, we performed Western blot analysis on vaginal discharge
from two female animals taken from day 22 to day 43 after birth. Golden
hamsters normally reach fertility between days 28 and 40 after birth,
whereby both values represent the lowest and highest values,
respectively, as known from the literature (37). A comparable high
concentration of aphrodisin in vaginal discharge was detectable within
all of the analyzed samples (Fig. 6).
Thus, secretion of aphrodisin into vaginal discharge does not seem to
depend on the point at which female animals reach fertility.

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 6.
Western blots with samples of vaginal
discharge from a female hamster taken from days 22-43 after
birth. The number of the day at which the sample was
taken is indicated above the blots. The time period when hamsters
normally reach fertility (days 28-40) is marked by a horizontal
line. Aphrodisin immunoreactivity in the expected size range is
visible in all samples, even already at day 22 after birth.
|
|
 |
DISCUSSION |
One of the main reasons for our decision to characterize the
aphrodisin cDNA and gene was the intention to identify and
investigate related systems in species other than the hamster. Indeed,
sequence comparisons with data base entries led to the discovery of the aphrodisin-related MMOBP1A, the gene structure of which is reported in
this paper. As in the case of the aphrodisin gene, it exhibits a
seven-exon/six-intron structure. The construction of a phylogenetic tree of several lipocalins based on their amino acid sequences was
already performed by Igarashi and co-workers (38). As an alternative,
we compared the aphrodisin gene with other lipocalin genes (MMOBP1A,
2UG,
LG, PP14, and RPDS; see Ref. 38) also possessing seven exons
under the criterion of their structure. For this purpose, we added the
absolute values of size deviations in base pairs of each exon of a
given gene from the corresponding exon of the aphrodisin gene. The
resulting value was expected to be low for closely related genes and
high for genes showing a more distant relation to the aphrodisin gene.
Using this strategy, the following relation was obtained in descending
order: MMOBP1A > PP14 >
LG >
2UG > RPDS.
Despite the fact that, at this time, the structure of the MMOBP1A gene
was still not known, the order of relation obtained fully verifies the
phylogenetic tree as presented by Igarashi and co-workers (38). Thus,
the close relation of MMOBP1A to aphrodisin is demonstrated at the
level of sequence identity, as well as at the level of gene structure.
The 290-bp region following the putative cap site of the MMOBP1A gene
in the 5' direction also shows a striking sequence identity of 67% to
the corresponding region of the aphrodisin gene. This similarity is
additionally reflected in the pattern of potential regulatory elements
in both gene promoters. As described above, we have identified
potential binding sites for the transcription factors Elk-1, IRF-1,
AP-1, Evi-1, GATA-1 (twice), and c-Ets-1 (twice) within the 2144-bp
5'-flanking region of the aphrodisin gene (Fig. 4). In the case of the
MMOBP1A gene, only a 290-bp fragment of the 5'-flanking region was
available. However, within this fragment the putative binding sites for
AP-1, Evi-1, GATA-1 (twice), and c-Ets-1 (p54) (twice) as well as the
putative TATA and CAAT boxes occur at positions identical to those
within the aphrodisin gene. In addition, as in the aphrodisin gene
promoter the CAAT element of the MMOBP1A gene exhibits a reverse
complementary orientation. These findings indicate the significance of
at least a part of the identified elements and comparable mechanisms of regulation of both genes.
Among the corresponding transcription factors possibly interacting with
the aphrodisin gene promoter, Evi-1 is the most probable candidate. It
functions as a transcriptional repressor (39) but also occurs in an
N-terminally elongated form, MDS1/Evi-1, which exhibits a strong
activating effect (40). Both forms recognize the same motif containing
an AGAT core sequence (see Table I). In mice, besides being found in a
few other organs, an Evi-1 gene-specific mRNA was already localized
within the uterus and during embryogenesis within regions of that part
of the nasal cavity that later forms the vomeronasal organ (41). We
have already demonstrated the expression of the aphrodisin gene in the
golden hamster uterus (22). On the other hand, the synthesis of the
putative pheromone transporter aphrodisin within the vomeronasal organ
would also make sense, because this organ is responsible for pheromone
detection. Thus, an involvement of Evi-1 or MDS1/Evi-1 in aphrodisin
gene regulation seems to be likely. Further experiments for the
verification of this presumption are planned.
As presented in this paper, we have performed initial luciferase
reporter gene assays to test the functionality of the aphrodisin gene
promoter in vivo. Although we could show a significant
promoter activity in T 84 cells, this cell system does not seem to be
ideal for aphrodisin promoter studies, and the measured maximum
relative activity of 36-fold is too low to correlate with the extremely high level of aphrodisin gene expression observed in the female golden
hamster genital tract (21, 22). However, the fact that the largest
tested promoter fragment of 2144 bp containing the potential binding
sites for Elk-1 and IRF-1 shows a significant 2-fold enhancement of
promoter activity compared with the 1170-bp promoter fragment might
indicate the actual involvement of at least one of these transcription
factors in aphrodisin gene regulation.
Performing RT-PCR and Western blot analysis, we succeeded in detecting
the parotid glands of female golden hamsters as hitherto unknown loci
of aphrodisin gene expression. The hypothesis that led us to
investigate these organs stands in contradiction to the results
obtained. We first expected an involvement of endogenously synthesized
aphrodisin in the transport of a copulatory behavior-stimulating pheromone of the female hamster to the vomeronasal organ of the male
hamster. Parotid glands were chosen as objects of investigation because
they are located within the hamster's throat cavity and are relatively
easy to isolate. The fact that not the male hamsters, as pheromone
recipients, but the female hamsters express the aphrodisin gene within
their parotid glands may lead to the discovery of as yet unknown
aphrodisin functions. For instance, female hamsters lick their
offspring in an intensive way, thereby probably transferring saliva-borne aphrodisin onto its skin. Thus, aphrodisin-mediated effects on the social behavior of hamsters that are possibly important for the protection of young animals are thinkable. The second unexpected result of our investigations, namely the abundant occurrence of aphrodisin in vaginal discharge before the female animals reach fertility, would be in agreement with this hypothesis. On the other
hand, in young nonfertile female hamsters, the synthesis of aphrodisin
as an apoprotein lacking its putative ligand required for the
pheromonal effect must also be taken into consideration. Possibly, this
ligand is synthesized from the time when female animals reach
fertility, then binding to the already present aphrodisin to generate
the bioactive complex. Because several lipocalins are capable of
binding different ligands, a variable modulation of the
aphrodisin-ligand complex function by ligands specific for a certain
tissue or developmental stage also cannot be excluded.
To unambiguously clarify these questions, further studies on the
aphrodisin-dependent social and copulatory behavior of live animals have to be performed. A great step toward this goal is given by
the fact that an aphrodisin-related system of the mouse has now been
identified, enabling the construction and analysis of MMOBP1A knock-out
mice. Furthermore, it is now possible to construct hybridization probes
and primers corresponding to regions highly conserved within the genes
for aphrodisin and MMOBP1A, which may be used for the detection of
related systems in other mammals. Although the importance of aphrodisin
and related lipocalins for the reproduction of mammals at this time is
difficult to predict, future use of such proteins in the breeding of
animals is thinkable.
 |
ACKNOWLEDGEMENTS |
We thank Gundhild Schmeding and Peter
Pietrzyk for excellent technical assistance.
 |
FOOTNOTES |
*
This work was supported by Deutsche Forschungsgemeinschaft
Grant Ma 1605/1-2.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ225170.
To whom correspondence should be addressed: Lower Saxony Institute
for Peptide Research, Feodor-Lynen-Strasse 31, D-30 625 Hannover,
Germany. Tel.: 49-511-546-6310; Fax: 49-511-546-6102; E-mail:
HJ-Maegert{at}gmx.de.
2
M. Mameli, D. Pes, I. Andreini, J. Kreiger, H. Breer, and P. Pelosi, unpublished data; EMBL accession no. Y10971 (1997).
 |
ABBREVIATIONS |
The abbreviations used are:
PCR, polymerase
chain reaction;
MMOBP1A, mouse odorant-binding protein 1a;
bp, base
pair;
kbp, kilobase pair;
RT, reverse transcription..
 |
REFERENCES |
-
Flower, D. R.
(1996)
Biochem. J.
318,
1-14
-
Urade, Y.,
Nagata, A.,
Suzuki, Y.,
Fujii, Y.,
and Hayaishi, O.
(1989)
J. Biol. Chem.
264,
1041-1045[Abstract/Free Full Text]
-
Nagata, A.,
Suzuki, Y.,
Igarashi, M.,
Eguchi, N.,
Toh, H.,
Urade, Y.,
and Hayaishi, O.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4020-4024[Abstract/Free Full Text]
-
Schmale, H.,
Holtgreve-Grez, H.,
and Christiansen, H.
(1990)
Nature
343,
366-369[CrossRef][Medline]
[Order article via Infotrieve]
-
Bläker, M.,
Kock, K.,
Ahlers, C.,
Buck, F.,
and Schmale, H.
(1993)
Biochim. Biophys. Acta
1172,
131-137[Medline]
[Order article via Infotrieve]
-
Morrow, D. M.,
Xiong, N.,
Getty, R. R.,
Ratajczak, M. Z.,
Morgan, D.,
Seppala, M.,
Riittinen, L.,
Gerwitz, A. M.,
and Tykocinski, M. L.
(1994)
Am. J. Pathol.
145,
1485-1495[Abstract]
-
Boyles, J. K.,
Notterpek, L. M.,
and Anderson, L. J.
(1990)
J. Biol. Chem.
265,
17805-17815[Abstract/Free Full Text]
-
Spreyer, P.,
Schaal, H.,
Kuhn, G.,
Rothe, T.,
Unterbeck, A.,
Olek, K.,
and Müller, H. W.
(1990)
EMBO J.
9,
2479-2484[Medline]
[Order article via Infotrieve]
-
Flower, D. R.
(1994)
FEBS Lett.
354,
7-11[CrossRef][Medline]
[Order article via Infotrieve]
-
Riley, C. T.,
Barbeau, B. K.,
Keim, P. S.,
Kézdy, F. J.,
Heinrikson, R. L.,
and Law, J. H.
(1984)
J. Biol. Chem.
259,
13159-13165[Abstract/Free Full Text]
-
Bishop, R. E.,
Penfold, S. S.,
Frost, L. S.,
Höltje, J.-V.,
and Weiner, J. H.
(1995)
J. Biol. Chem.
270,
23097-23103[Abstract/Free Full Text]
-
Flower, D. R.,
Sansom, C. E.,
Beck, M. E.,
and Attwood, T. K.
(1995)
Trends Biochem. Sci.
20,
498-499[CrossRef][Medline]
[Order article via Infotrieve]
-
Singer, A. G.,
Macrides, F.,
Clancy, A. N.,
and Agosta, W. C.
(1986)
J. Biol. Chem.
261,
13323-13326[Abstract/Free Full Text]
-
Henzel, W. J.,
Rodriguez, H.,
Singer, A. G.,
Stults, J. T.,
Macrides, F.,
Agosta, W. C.,
and Niall, H.
(1988)
J. Biol. Chem.
263,
16682-16687[Abstract/Free Full Text]
-
Clancy, A. N.,
Macrides, F.,
Singer, A. G.,
and Agosta, W. C.
(1984)
Physiol. Behav.
33,
653-660[CrossRef][Medline]
[Order article via Infotrieve]
-
Moran, D. T.,
Jafek, B. W.,
and Rowley, J. C.
(1991)
J. Steroid Biochem. Mol. Biol.
39,
545-552
-
Steensas, L. J.,
Lavker, R. M.,
Monti-Bloch, L.,
Grosser, B. I.,
and Berliner, D. L.
(1991)
J. Steroid Biochem. Mol. Biol.
39,
553-560[CrossRef][Medline]
[Order article via Infotrieve]
-
Monti-Bloch, L.,
and Grosser, B. I.
(1991)
J. Steroid Biochem. Mol. Biol.
39,
573-582[CrossRef][Medline]
[Order article via Infotrieve]
-
Singer, A. G.,
and Macrides, F.
(1990)
Chem. Senses
15,
199-203[Abstract/Free Full Text]
-
Kroner, C.,
Breer, H.,
Singer, A. G.,
and O'Connell, R. J.
(1996)
NeuroReport
7,
2989-2992[Medline]
[Order article via Infotrieve]
-
Mägert, H. J.,
Hadrys, T.,
Cieslak, A.,
Gröger, A.,
Feller, S.,
and Forssmann, W. G.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
2091-2095[Abstract/Free Full Text]
-
Kruhøffer, M.,
Bub, A.,
Cieslak, A.,
Adermann, K.,
Kunstyr, I.,
Forssmann, W. G.,
and Mägert, H. J.
(1997)
Cell Tissue Res.
287,
153-160[Medline]
[Order article via Infotrieve]
-
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884[Abstract/Free Full Text]
-
Pardigol, A.,
Mägert, H. J.,
Hill, O.,
and Forssmann, W. G.
(1996)
Biochem. Biophys. Res. Commun.
224,
638-644[CrossRef][Medline]
[Order article via Infotrieve]
-
Saiki, R. K.,
Gelfand, D. H.,
Stoffel, S.,
Scharf, S. J.,
Higuchi, R.,
Horn, G. T.,
Mullis, K. B.,
and Ehrlich, H. A.
(1988)
Science
239,
487-491[Abstract/Free Full Text]
-
Siebert, P. D.,
Chenchik, A.,
Kellog, D. E.,
Lukyanov, K. A.,
and Lukyanov, S. A.
(1995)
Nucleic Acids Res.
23,
1087-1088[Free Full Text]
-
Mount, S. M.
(1982)
Nucleic Acids Res.
10,
459-472[Abstract/Free Full Text]
-
Pevsner, J.,
Reed, R. R.,
Feinstein, P. G.,
and Snyder, S. H.
(1988)
Science
241,
336-339[Abstract/Free Full Text]
-
Angel, P.,
Imagawa, M.,
Chiu, R.,
Stein, B.,
Imbra, R. J.,
Rahmsdorf, H. J.,
Jonat, C.,
Herrlich, P.,
and Karin, M.
(1987)
Cell
49,
729-739[CrossRef][Medline]
[Order article via Infotrieve]
-
Perkins, A. S.,
Fishel, R.,
Jenkins, N. A.,
and Copeland, N. G.
(1991)
Mol. Cell. Biol.
11,
2665-2674[Abstract/Free Full Text]
-
Evans, T.,
Reitman, M.,
and Felsenfeld, G.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
5976-5980[Abstract/Free Full Text]
-
Ho, I. C.,
Bhat, N.,
Gottschalk, L. R.,
Lindenstein, T.,
Thompson, C. B.,
Papas, T. S.,
and Leiden, J. M.
(1990)
Science
250,
814-818[Abstract/Free Full Text]
-
Hipskind, R. A.,
Rao, V. N.,
Moeller, C. G. F.,
Reddy, E. S. P.,
and Nordheim, A.
(1991)
Nature
354,
531-534[CrossRef][Medline]
[Order article via Infotrieve]
-
Rao, V. N.,
and Reddy, E. S. P.
(1992)
Oncogene
7,
65-70[Medline]
[Order article via Infotrieve]
-
Fujita, T.,
Sakakibara, J.,
Yoshiaki, S.,
Miyamoto, M.,
Kimura, Y.,
and Taniguchi, T.
(1988)
EMBO J.
7,
3397-3405[Medline]
[Order article via Infotrieve]
-
Kessler, D. S.,
Levy, D. E.,
and Darnell, J. E., Jr.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8521-8525[Abstract/Free Full Text]
-
Güttner, J., Bruhin, H., and Heinecke, H.
(eds)
(1993)
Wörterbuch der Versuchstierkunde, Gustav Fischer, Jena, Stuttgart
-
Igarashi, M.,
Nagata, A.,
Toh, H.,
Urade, Y.,
and Hayaishi, O.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
5376-5380[Abstract/Free Full Text]
-
Bartholomew, C.,
Kilbey, A.,
Clark, A. M.,
and Walker, M.
(1997)
Oncogene
14,
569-577[CrossRef][Medline]
[Order article via Infotrieve]
-
Soderholm, J.,
Kobayashi, H.,
Mathieu, C.,
Rowley, J. D.,
and Nucifora, G.
(1997)
Leukemia
11,
352-358[CrossRef][Medline]
[Order article via Infotrieve]
-
Perkins, A. S.,
Mercer, J. A.,
Jenkins, N. A.,
and Copeland, N. G.
(1991)
Development
111,
479-487[Abstract]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Briand, F. Blon, D. Trotier, and J.-C. Pernollet
Natural Ligands of Hamster Aphrodisin
Chem Senses,
June 1, 2004;
29(5):
425 - 430.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. A. De Wolf and G. M. Brett
Ligand-Binding Proteins: Their Potential for Application in Systems for Controlled Delivery and Uptake of Ligands
Pharmacol. Rev.,
June 1, 2000;
52(2):
207 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Magert, L. Standker, P. Kreutzmann, H.-D. Zucht, M. Reinecke, C. P. Sommerhoff, H. Fritz, and W.-G. Forssmann
LEKTI, a Novel 15-Domain Type of Human Serine Proteinase Inhibitor
J. Biol. Chem.,
July 30, 1999;
274(31):
21499 - 21502.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.