|
J Biol Chem, Vol. 274, Issue 10, 6062-6073, March 5, 1999
A Human -Spectrin Gene Promoter Directs High Level Expression
in Erythroid but Not Muscle or Neural Cells*
Patrick G.
Gallagher §,
Denise E.
Sabatino¶,
Marc
Romana ,
Amanda P.
Cline¶,
Lisa J.
Garrett¶,
David M.
Bodine¶, and
Bernard G.
Forget **
From the Departments of Pediatrics, Internal
Medicine, and ** Genetics, Yale University School of Medicine, New
Haven, Connecticut 06520-8021 and the ¶ Hematopoiesis Section,
Genetics and Molecular Biology Branch, National Human Genome
Research Institute, National Institutes of Health,
Bethesda, Maryland 20892-4442
 |
ABSTRACT |
-Spectrin is an erythrocyte membrane protein
that is defective in many patients with abnormalities of red blood cell
shape including hereditary spherocytosis and elliptocytosis. It is
expressed not only in erythroid tissues but also in muscle and brain.
We wished to determine the regulatory elements that determine the tissue-specific expression of the -spectrin gene. We mapped the 5'-end of the -spectrin erythroid cDNA and cloned the
5'-flanking genomic DNA containing the putative -spectrin gene
promoter. Using transfection of promoter/reporter plasmids in human
tissue culture cell lines, in vitro DNase I footprinting
analyses, and gel mobility shift assays, a -spectrin gene erythroid
promoter with two binding sites for GATA-1 and one site for
CACCC-related proteins was identified. All three binding sites were
required for full promoter activity; one of the GATA-1 motifs and the
CACCC-binding motif were essential for activity. The -spectrin gene
promoter was able to be transactivated in heterologous cells by forced expression of GATA-1. In transgenic mice, a reporter gene directed by
the -spectrin promoter was expressed in erythroid tissues at all
stages of development. Only weak expression of the reporter gene was
detected in muscle and brain tissue, suggesting that additional
regulatory elements are required for high level expression of the
-spectrin gene in these tissues.
 |
INTRODUCTION |
Spectrin, the most abundant protein of the erythrocyte membrane
skeleton, is composed of two structurally similar but nonidentical proteins, - and -spectrin, encoded by separate genes. - and -spectrin are composed primarily of homologous 106-amino acid repeats that fold into three antiparallel -helices connected by
short nonhelical segments (1, 2). - and -spectrin combine to form
heterodimers, which in turn self-associate to form tetramers and higher
order oligomers to form a lattice-like structure that is critical for
erythrocyte membrane stability as well as erythrocyte shape and
deformability. In the red cell, spectrin maintains cellular shape,
regulates the lateral mobility of integral membrane proteins, and
provides structural support for the lipid bilayer (3, 4). Quantitative
and qualitative disorders of both - and -spectrin have been
associated with abnormalities of erythrocyte shape including hereditary
spherocytosis and hereditary elliptocytosis (5, 6).
Erythrocyte -spectrin contains binding sites for actin, protein 4.1, and ankyrin, as well as the  -spectrin self-association site (3).
The human -spectrin erythroid cDNA transcript contains an open
reading frame of 6411 bp1
(7). The deduced amino acid sequence predicts a peptide of 2137 amino
acids with a predicted molecular mass of 246 kDa. The -spectrin
erythroid cDNA transcript is encoded by 32 exons (8). The
chromosomal gene, localized to 14q23-q24.2 (9), spans over >100
kilobase pairs of genomic DNA.
-Spectrin transcripts have also been identified in nonerythroid
tissues including heart, skeletal muscle, brain, platelets, trachea,
and lens (10-22). In the nervous system tissue, -spectrin is
expressed in the granular cells of the cerebellum and in regions of the
neocortex (15). In muscle, there are several populations of
-spectrin, including an immunoreactive isoform clustered with the
acetylcholine receptor (10, 17, 18, 23-26). In some nonerythroid tissues, -spectrin may exist as homodimers or homotetramers, without
an -spectrin partner (15, 17, 18, 25). In nonerythroid tissues,
spectrin may establish or maintain local concentrations of proteins of
the plasma membrane, participate in the early stages of cell junction
formation, and regulate access of secretory vesicles to the plasma
membrane as well as play a role in maintaining the structural integrity
of cellular membranes (3, 27, 28).
The mechanisms by which -spectrin has acquired distinct isoforms
with specialized functions are beginning to be revealed. The isoform
diversity of -spectrin arises from both different gene products and
from differential, alternative splicing of the same gene product. In
humans, the cDNAs for two -spectrin proteins have been cloned,
and their gene products have been studied (4, 7, 21, 29-32). These
spectrins share similar antigenic sites and domain structures,
differing in a number of ways such as their cellular patterns of
expression and their relative affinities of binding to ankyrin and band
3. In brain and muscle, an alternatively spliced mRNA isoform of
the -spectrin gene has been identified. This tissue-specific,
differential processing occurs at the 3'-end of the -spectrin
pre-mRNA, generating a -spectrin cDNA isoform in brain and
muscle encoded by 36 exons (cf. 32 in erythroid) (7, 8, 11,
21). The predicted isoform contains an COOH terminus different from
that in erythrocyte, with the last 22 amino acids of erythrocyte
-spectrin replaced by a new sequence of 213 amino acids.
There are no data regarding the molecular mechanisms that regulate
the tissue-specific or developmental stage-specific expression of
-spectrin isoforms. For example, it is unknown whether or not
isoforms of -spectrin are transcribed from the same gene by
tissue-specific utilization of alternate promoters. This report describes the identification and characterization of a promoter of the
human -spectrin gene that directs high level expression in erythroid
cells at all stages of development. This expression of the human
-spectrin gene is mediated by a compact promoter that requires
GATA-1 and CACCC-binding proteins for its activity. This promoter does
not direct high level activity in nonerythroid tissues, including brain
and muscle, suggesting that additional regulatory elements are required
for expression of the -spectrin gene in these tissues.
 |
MATERIALS AND METHODS |
RNA Preparation--
Total RNA was prepared from human fetal
liver tissue; human bone marrow; or the human tissue culture cell line
K562 (chronic myelogenous leukemia in blast crisis with erythroid
characteristics, ATCC, CCL 243), HEL (erythroleukemia, ATCC, TIB 180),
or HeLa (epithelial-like carcinoma, cervix, CCL 2) using the
guanidinium thiocynate-chloroform method as described (33).
5'-Rapid Amplification of cDNA Ends (RACE)--
1 µg of
total human fetal liver RNA was reverse transcribed using primer A
(Table I) and avian myeloblastosis virus reverse transcriptase
(Promega, Madison, WI). Single-stranded oligonucleotide ligation and
PCR amplification were carried out as described using primers B + D and
C + D (34, 35). Amplification products were subcloned and sequenced.
Genomic Cloning--
A human -spectrin cDNA fragment
corresponding to the 5'-end of the coding region, V252 (7), was used as
hybridization probe to screen a human genomic DNA library. The library
is a Charon 4A bacteriophage library containing fragments of
genomic DNA partially digested with AluI and
HaeIII with EcoRI linkers added. Selected
recombinants that hybridized to the screening probe were purified and
subcloned into pGEM-7Z plasmid vectors (Promega). Subcloned fragments
were analyzed by restriction endonuclease digestion, Southern blotting,
and nucleotide sequencing.
Mapping the Transcription Initiation Site--
The transcription
initiation site of the erythroid -spectrin cDNA was determined
using an RNase protection assay. A 32P-labeled antisense
RNA probe was synthesized by transcription with T7 polymerase of a
180-bp DdeI-ApaI fragment corresponding to the
first exon and 5'-flanking sequences of the human -spectrin gene.
The probe (1 × 105 cpm/assay) was hybridized to
template RNA at 42 °C for 16 h. Templates in these reactions
were 20 µg of total human fetal liver RNA, 20 µg of total RNA from
the human cell lines K562 and HEL, or 20 µg of tRNA. Hybrids were
digested with a mixture of the nucleases RNase A and RNase T1 (0.125 units and 5 units, respectively, per assay) at 37 °C for 30 min.
After digestion, protected fragments were detected by autoradiography
after electrophoresis in 6% polyacrylamide, 7 M urea gels.
Further increases in nuclease concentration or length of incubation did
not alter the pattern of the protected fragment (not shown).
Nucleotide Sequencing--
Nucleotide sequencing was performed
using the dideoxy chain termination method of Sanger et al.
(36) with T7 DNA polymerase (Sequenase; U.S. Biochemical Corp.). The
sequencing primers were the Sp6 or T7 vectors of the pGEM-7Z plasmid
vector or, for some reactions, synthetic oligonucleotides corresponding
to known cDNA sequences (Table I). Deoxyinosine trisphosphate was
substituted for deoxyguanosine trisphosphate to resolve band
compressions and ambiguities.
Preparation of Nuclear Extracts--
Nuclear extracts were
prepared from K562, HEL, MEL (murine erythroleukemia, NIGMS GM00086E),
and HeLa cells by hypotonic lysis followed by high salt extraction of
nuclei as described by Andrews and Faller (37).
DNase I Footprinting in Vitro--
Probes for DNase I
footprinting were by produced by PCR amplification of plasmid p173 (see
below) as template and a pair of oligonucleotide primers that flank the
plasmid polylinker. One oligonucleotide was 5'-end-labeled with
[32P]ATP using polynucleotide kinase prior to use in PCR.
Reaction mixes contained 1-20 µg of MEL cell nuclear extracts,
20,000 cpm of labeled probe, and 1 µg of poly(dI-dC) (38). After
digestion with DNase I, samples were electrophoresed in 6%
polyacrylamide gels, and the gels were dried and subjected to autoradiography.
Cell Culture--
The tissue culture cell lines K562 and HEL
(erythroid), SH-SY5Y (neural), and HeLa (nonerythroid) were used to
study expression of the putative promoter of the gene. K562, MEL, and
SH-Sy5Y cells were maintained in RPMI 1640 medium containing 10% fetal
calf serum. HeLa cells were maintained in Eagle's minimal essential media supplemented with 10% fetal calf serum.
Preparation of Promoter-Reporter Plasmids for Transfection
Assays--
Test plasmids were prepared by inserting a 700-bp fragment
of the 5'-flanking -spectrin genomic DNA upstream of the firefly luciferase reporter gene in the plasmid pGL2B (Promega) in both orientations. These plasmids were designated p700-forward and p700-reverse, respectively. Serial truncations of this 700-bp fragment
in the pGL2B plasmid were constructed using convenient restriction
enzyme sites or PCR amplification. Test plasmids were sequenced to
exclude cloning or PCR-generated artifacts.
Transient Transfection Analyses--
All plasmids tested were
purified using Qiagen columns (Qiagen, Inc., Chatsworth, CA) or cesium
chloride plasmid purification, and at least two preparations of each
plasmid were tested in triplicate. 107 K562, MEL, and
SH-SY5Y cells were transfected by electroporation with a single pulse
of 300 V at 960 microfarads with 20 µg of test plasmid and 0.5 µg
of pCMV , a mammalian reporter plasmid expressing -galactosidase
driven by the human cytomegalovirus immediate early gene promoter
(CLONTECH, Palo Alto, CA). 105 HeLa
cells were transfected with 2.0 µg of test plasmid and 0.25 µg of
the pCMV plasmid by lipofection using 4 µl of Lipofectamine (Life
Technologies, Inc.). Twenty-four hours after transfection, cells were
harvested and lysed, and the levels of both luciferase and
-galactosidase activity were determined in cell extracts. All assays
were performed in triplicate. Differences in transfection efficiency
were determined by co-transfection with the pCMV plasmid.
COS cells (107) were transfected with 20 µg of the
expression plasmids pMT/BKLF (39) (a kind gift of Drs. M. Crossley and S. Orkin) or pSG5/erythroid Kruppel-like factor (EKLF) (40) (a kind
gift of Dr. J. Bieker) as described above. Forty-eight hours after
transfection, nuclear extracts were prepared for use in gel shift
analyses. Antibodies to GATA-1 and Sp1 were obtained from Santa Cruz
Biotechnology, Inc. (Santa Cruz, CA). Antibodies to BKLF and EKLF were
a kind gift of Drs. M. Crossley and S. Orkin.
Gel Mobility Shift Analyses--
Binding reactions were carried
out as described (41). Competitor oligonucleotides were added at molar
excesses of 10- or 100-fold. Resulting complexes were separated by
electrophoresis through 6% polyacrylamide gels in 0.5×
Tris-borate-EDTA at 21 °C at 200 watts for 2 h. Gels were dried
and subjected to autoradiography.
Preparation of Promoter-Reporter Plasmids for Transgenic
Mice--
A 576-bp -spectrin promoter fragment was excised from
plasmid p504 (see below) as a KpnI/HindIII
fragment and cloned into the KpnI/HindIII sites
of pSP72. The HindIII site in the pSP72 -spectrin plasmid
was destroyed by digestion with HindIII, filling in the
ends, and religation. A 1909-bp BsaHI/HindIII
fragment containing the coding region of the human
A -globin gene was cloned into the
ClaI/HindIII sites of pSP72. A 2614 bp
AatII/PvuII fragment from the -spectrin
plasmid was ligated to a 2266 bp EcoRV/AatII
fragment from the A -globin plasmid to create the plasmid
pSP72 sp/A . The 2483-bp sp/A gene
was excised from this plasmid with EcoRV and
HindIII and used for microinjection.
Generation of Transgenic Mice--
Transgenic mice were
generated as described in Hogan et al. (42) and Sabatino
et al. (43). Fertilized eggs were collected from
superovulated FVB/N female mice approximately 9 h after mating to
CB6F1 male mice. After purification, -spectrin
promoter/A -globin DNA fragments were microinjected into
the male pronucleus of fertilized eggs. The injected eggs were
transferred into pseudopregnant CB6F1 foster mothers. Founders were
identified by Southern blotting of genomic DNA obtained from tail
biopsies. Copy number was determined by comparing transgenic mouse DNA
to K562 DNA. Founder animals were crossed to FVB/N mice for propagation.
Analysis of Transgene Expression--
Total cellular RNA was
extracted from mouse tissues, including 10.5-day embryo blood cells,
13.5-day fetal livers, and adult reticulocytes using TRIZOL reagent
(Life Technologies). The tissue-specific pattern of expression of the
erythroid -spectrin promoter/A -globin reporter
transgene was analyzed using an RNase protection assay. Linear DNA
templates for the RNase protection assay were prepared by
EcoRI digestion of a human
-spectrin/A -globin plasmid or by HindIII
digestion of a murine -globin plasmid. Templates were purified by
agarose gel electrophoresis. The 32P-labeled antisense RNA
probe was synthesized by transcription with T7 polymerase (MAXIscript
In Vitro Transcription Kit; Ambion, Inc., Austin, TX). The
probe (1 × 105 cpm/assay) was hybridized to template
RNA at 42 °C overnight. Templates in these reactions were 1 µg of
total murine spleen or bone marrow RNA; 10 µg of total RNA from
muscle, brain, heart, liver, kidney, lung, or testis; or 10 µg of
tRNA. Hybrids were digested with a mixture of the nucleases RNase A and
RNase T1. After digestion, protected fragments were detected by
autoradiography after electrophoresis in 8% nondenaturing
polyacrylamide gels.
Computer Analyses--
Computer-assisted analyses of derived
nucleotide sequences were performed utilizing the sequence analysis
software package of the University of Wisconsin Genetics Computer Group
(44) and the BLAST algorithm, National Center for Biotechnology
Information (Bethesda, MD) (45).
 |
RESULTS |
Cloning of Chromosomal Gene: Isolation and Analysis of Recombinant
Clones--
Primary screening of a human genomic DNA library with the
-spectrin cDNA probe V252 (Fig.
1A) yielded six
hybridization-positive plaques. Selected recombinants were analyzed,
and one clone was identified, 27, that spanned ~21 kilobase pairs
of DNA containing the -spectrin gene. A limited restriction map of
this region is shown in Fig. 1B.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1.
The 5'-end of the human
-spectrin gene. A, structure of the
5'-end of the human -spectrin-1 erythroid cDNA. A diagram of the
5'-end of the human -spectrin cDNA is shown. The location of the
initiation codon is shown, as is the location of intron/exon
boundaries. Sequence obtained by 5'-RACE is denoted by a
hatched box. Oligonucleotide primers used in
5'-RACE are denoted by the arrows. The location of the probe
used in genomic library screening, V252, and the end of the 5'-most
-spectrin cDNA clone (7) are shown. B, genomic
organization of the 5'-end of the human -spectrin gene. Five
overlapping clones containing the -spectrin gene were isolated from
a human genomic DNA library. These clones spanned a distance of over 40 kilobase pairs. Clone 27 contained exon 1 of the -spectrin
erythroid cDNA in a 2.0-kilobase pair EcoRI fragment. A
restriction map of clone 27 with EcoRI (E) and
BamHI (B) is shown.
|
|
Mapping the Human -Spectrin Erythroid mRNA Transcription
Initiation Site and Identification of 5' cDNA Sequences--
To
identify the 5'-end of the human -spectrin cDNA, RNase mapping
with RNase A and RNase T1 nucleases was performed. These experiments
identified a single transcription initiation site (Fig.
2) and predicted the presence of an
additional 64 bp in the mRNA upstream of the 5'-end of the sequence
obtained from cDNA cloning. These additional 64 bp of upstream
5'-untranslated sequence were obtained by 5'-RACE. Sequences obtained
by RACE were verified by comparison with corresponding genomic DNA
sequences (Fig. 3). The sequences around
the transcription start site, GCA+1CCAG, closely match
transcription initiation recognition sequences, YYA+1NWYY
(46). No additional ATGs were present in the 5'-untranslated sequences.
Taken together, these data suggest that this sequence is at or very
near the 5'-end of the human -spectrin erythroid cDNA.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Mapping the 5'-end of the human
-spectrin cDNA. RNase mapping was carried
out using a riboprobe (left) and 10 µg of K562, HEL, HL60
total RNA, or tRNA as template. The size of the extension products, 113 nucleotides (right), indicates that the 5'-end of the
mRNA is located at position 162 relative to the adenosine of the
initiator methionine codon. The cDNA sequence of this additional
5'-untranslated cDNA was determined by 5'-RACE and is shown in Fig.
4.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 3.
5'-Flanking genomic DNA sequence. The
nucleotide sequence of the 5'-flanking genomic DNA of the human
-spectrin gene is shown. Consensus sequences for potential
DNA-protein binding sites are underlined. The transcription
initiation site, +1, is denoted by the arrow. The junction
between exon 1 and intron 1 is marked by the inverted
triangle.
|
|
The 5'-Flanking Genomic DNA Sequence of the Human -Spectrin-1
Gene Exhibits Features of an Erythroid Gene Promoter--
The
nucleotide sequence of the 5'-flanking genomic DNA upstream of the
human -spectrin cDNA transcription start site is shown in Fig.
3. Inspection of the sequence reveals a lack of consensus TATA or CCAAT
sequences. Consensus sequences for a number of potential DNA-binding
proteins, including GATA-1 (two sites) and Sp1/CACCC-related proteins,
characteristics of an erythroid gene promoter, are present in the
5'-flanking sequences. GATA motifs bind GATA-1, a zinc finger
transcription factor essential for erythroid development. GC or
G(T/C)ACC motifs are the binding sites for a number of transcription factor proteins, including ubiquitous Sp1 and Sp1-like proteins, and
cell-restricted proteins such as EKLF.
A -Spectrin-1 Gene Promoter Fragment Is Active in Erythroid
Cells--
To investigate if the region from 623 to +77 was capable
of directing expression of a reporter gene in cultured mammalian cells,
test plasmids p700-forward and p700-reverse were transiently transfected into erythroid (K562 and MEL), neural (SY5Y), or
nonerythroid (NIH3T3) cells. The relative luciferase activity was
determined 48 h after transfection and compared with the activity
obtained with pGL2B, a negative control, the promoterless plasmid, and pGL2P, a positive control, the luciferase reporter gene under control
of the SV40 early promoter. As shown in Fig.
4, the putative -spectrin gene
erythroid promoter plasmid, p700-forward, directed high level
expression of the luciferase reporter gene only in erythroid cells. The
plasmid with the promoter in reverse orientation, p700-reverse, did not
direct expression of the reporter gene in any of the cell lines.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4.
Activity of the
-spectrin gene erythroid promoter in erythroid and
nonerythroid cell lines in transient transfection assays. Plasmids
containing 5'-flanking DNA of the -spectrin gene inserted upstream
of the firefly luciferase gene were transfected into K562, HEL, SY5Y,
or HeLa cells as described. Relative luciferase activity was expressed
as that obtained from the test plasmids versus the activity
obtained from the promoterless plasmid pGL2B plasmid taking into
account the transfection efficiency. The data are means ± S.D. of
at least six independent transfection experiments. Mutations in
consensus DNA-protein binding sites are marked with an X.
n.d., not determined.
|
|
Transient transfection analysis of deletions of this -spectrin gene
erythroid promoter fragment identified a 250-bp minimal promoter
fragment, p173, that directed erythroid-specific expression of the
reporter gene (Fig. 4). The 250-bp minimal promoter fragment contains
potential binding sites for GATA-1, as well as Sp1- and CACCC-related
proteins, a combination shown to be adequate for expression of a
minimal promoter in other erythroid-specific genes. There was minimal
to no reporter gene activity in transfected HeLa or SY5Y cells.
The -Spectrin Erythroid Promoter Contains Binding Sites for
GATA-1 and CGCC- and CACCC-related Binding Proteins--
Consensus
sequences for a number of potential DNA-binding proteins, including
GATA-1 and CACCC-related proteins, were present in the -spectrin
gene promoter. To identify binding sites for transcription factors
within the -spectrin promoter, DNase I footprinting analysis with
nuclear extracts from MEL cells was performed (Fig.
5). Footprints at three protected sites
were observed. Two sites, sites 1 and 2, contain consensus binding
sequences for GATA-1. The third site, site 3, consists of a long
GC-rich region of sequences that are recognized by members of the
Kruppel-like family of transcription factors as well as CACCC-related
proteins.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
In vitro DNase I footprinting of
the human -spectrin promoter. In
vitro DNase I footprinting of the human -spectrin gene promoter
was performed using erythroid (MEL) extracts as described under
"Materials and Methods." Three protected sites were identified, two
corresponding to GATA-1 consensus binding sites and the third to a long
GC-rich region of sequences that are recognized by members of the
Kruppel family of transcription factors as well as CACCC-related
proteins.
|
|
GATA-1 Binds Both -Spectrin Gene Promoter Sites in
Vitro--
To determine if nuclear proteins could bind these GATA-1
sites in vitro, double-stranded oligonucleotides containing
the corresponding -spectrin promoter GATA-1 sequences (site 1, E + F; site 2, G + H; Table I) or control
sequences (I + J; Table I) (47) were prepared and used in gel shift
analyses. When oligonucleotides containing either of the footprinted
GATA-1 sequences were used in gel shift analyses, a single retarded
species was observed in MEL (erythroid) extracts (Fig.
6A), but not in HeLa extracts (not shown). These species migrated at the same location as a control
oligonucleotide containing a GATA-1 consensus sequence. This species
was effectively competed both by an excess of unlabeled homologous
oligonucleotide and by an excess of unlabeled control GATA-1
oligonucleotide. The inclusion of GATA-1 antisera abolished most or all
of the DNA binding (Fig. 6B). These data indicate that
GATA-1 binds in vitro to sites 1 and 2 of the -spectrin gene promoter.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 6.
Gel mobility shift assays of footprinted
sites 1 and 2 of the human -spectrin gene
promoter. Gel mobility shift assays using -spectrin promoter
oligonucleotides corresponding to footprinted sites 1 or 2, both of
which contain GATA-1 consensus binding sequences, were performed using
erythroid (MEL) nuclear extracts. A, the radiolabeled,
double-stranded oligonucleotide used in lanes 1-6 corresponds to site
1; the radiolabeled, double-stranded oligonucleotide used in lanes
7-12 corresponds to site 2; and the radiolabeled, double-stranded
oligonucleotide used in lanes 13 and 14 is a GATA-1 control. Increasing
amounts of unlabeled, double-stranded oligonucleotide, self
(lanes 3 and 4 and lanes
9 and 10) or control (lanes
5 and 6 and lanes 9 and
10), were added to the reactions as competitor. No complexes
were obtained using HeLa extracts (not shown). B, gel
mobility shift assays using -spectrin promoter oligonucleotides
corresponding to footprinted site 1 or 2, both of which contain GATA-1
consensus binding sequences, and a control GATA-1 oligonucleotide, were
performed using erythroid (MEL) extracts. A GATA-1 antibody was added
to the reaction mixtures where indicated.
|
|
CACCC-box Binding Proteins Bind to the -Spectrin Gene Promoter
GC-rich Site in Vitro--
Site 3 identified by DNase I footprinting
contains an extended GC-rich sequence, 5'-CCGCCTCCCCGCCCCCGCCG-3', a
consensus binding site for CACCC-box-binding proteins. Although
CACCC-box-binding proteins bind both CACCC and CGCCC sequences, they
show distinct binding preferences (39, 48-50). To determine if the
nuclear protein Sp1, BKLF, or EKLF binds this extended GC-rich sequence in vitro, double-stranded oligonucleotides containing the
corresponding -spectrin promoter site 3 sequences (I + J; Table I)
or control sequences (Sp1 M + N (48, 51); CACCC O + P (40); Table I) were prepared and used in gel shift analyses. When double-stranded oligonucleotides containing the site 3 sequences were used in gel shift
analyses with MEL extracts, one larger, slower migrating species and
two smaller, faster migrating species were detected. These species
migrated at the same location as those obtained using control
oligonucleotides containing either CACCC (Fig.
7A) or Sp1 (not shown)
consensus sequences. All three species were effectively competed by an
excess of unlabeled homologous oligonucleotide and an excess of
unlabeled CACCC or Sp1 control oligonucleotides. The inclusion of Sp1
antisera supershifted the larger, slower migrating species in the gel
(Fig. 7B).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7.
Gel mobility shift assays of footprinted site
3 of the human -spectrin gene promoter.
A, gel mobility shift assays using -spectrin promoter
oligonucleotides corresponding to footprinted site 3, which contains
Sp1/CACCC consensus binding sequences, and MEL (erythroid) nuclear
extracts. The radiolabeled, double-stranded oligonucleotide used in
lanes 1-6 corresponds to site 3, and the
radiolabeled, double-stranded oligonucleotide used in lanes
7-12 is a CACCC control. Increasing amounts of unlabeled,
double-stranded oligonucleotide, site 3 (lanes 3 and 4 and lanes 11 and 12),
CACCC control (lanes 5 and 9), or Sp1
control (lanes 6 and 10) were added to
the reactions as compet itor. B, gel mobility shift assays using a
-spectrin promoter oligonucleotide corresponding to footprinted site
3 and a control Sp1 oligonucleotide, were performed using erythroid
(MEL) extracts. An Sp1 antibody was added to the reaction mixtures
where indicated.
|
|
To determine if the CACCC-box-binding transcription factors BKLF or
EKLF could bind the -spectrin gene promoter GC-rich site in
vitro, gel shifts using nuclear extracts prepared from COS cells
transfected with expression plasmids containing either BKLF or EKLF
cDNAs and either the -spectrin gene promoter site 3 oligonucleotide or a control -globin CACCC oligonucleotide (Q + R)
(52) were performed. A major complex was identified in BKLF-transfected cells (Fig. 8A). This complex
migrated at the same location as the control -globin CACCC control
oligonucleotide. The complexes obtained with both the -spectrin and
-globin oligonucleotides were supershifted with an anti-BKLF
antibody. When extracts from EKLF-transfected cells were used in
similar experiments, a major complex was identified using the
-globin CACCC consensus sequence oligonucleotide, and a very minor
complex was identified using the -spectrin site 3 oligonucleotide
(Fig. 8B). Both the -globin and -spectrin complexes
migrated at the same location. Although the complexes were not
completely competed away, the complexes obtained with both the
-spectrin and -globin oligonucleotides were supershifted with an
anti-EKLF antibody. Together, these data indicate that various
CACCC-box-binding proteins bind to the -spectrin gene promoter
in vitro.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 8.
Gel mobility shift assays of footprinted site
3 of the human -spectrin gene promoter and
antibodies to BKLF and EKLF. A, gel mobility shift
assays using a -spectrin promoter oligonucleotide corresponding to
footprinted site 3, which contains Sp1/CACCC consensus binding
sequences and nuclear extracts from BKLF-transfected COS cells. A BKLF
antibody was added to the reaction mixtures where indicated.
B, gel mobility shift assays using -spectrin promoter
oligonucleotides corresponding to footprinted site 3 and nuclear
extracts from EKLF-transfected COS cells. An EKLF antibody was added to
the reaction mixtures where indicated. When nuclear extracts from
untransfected COS cells were used in gel shift analyses, complexes
migrating at the same location as those obtained using the -globin
CACCC control oligonucleotide were not seen (not shown).
|
|
GATA-1 and CACCC-related Proteins Are Both Major Activators of the
Human Erythroid -Spectrin Gene Promoter--
To assess the relative
importance of these transcription factor binding sites in promoter
function, mutations were introduced into each of the three sites
protected in DNase I footprinting experiments. Mutation of the site 1 GATA-1 consensus sequence (GATA to GTTA) reduced promoter activity by
half (Fig. 4). Mutating the site 2 GATA-1 consensus sequence in a
similar manner (GATA to GTTA) reduced promoter activity to very low
levels, indicating that this site is of major importance in the
-spectrin gene promoter. Mutation of the site 3 CACCC-binding
consensus sequence (CCCGCCTCCCCGCCCCCGCC to AAAGGAAAGGAAAGGAAAAG)
reduced promoter activity nearly to background, indicating that this
site is of major importance in the -spectrin gene promoter (Fig.
4).
GATA-1, but Not BKLF or EKLF, Transactivates the -Spectrin Gene
Erythroid Promoter in Heterologous Cells--
None of the -spectrin
promoter fragments directed expression of a reporter gene in HeLa
cells, but the addition of GATA-1 by co-transfection conferred promoter
activity to a -spectrin promoter fragment. Co-transfection of 1 µg
of a -spectrin erythroid promoter fragment, p504, and increasing
amounts of a GATA-1 cDNA expression plasmid resulted in increasing
promoter activity with increasing amounts of GATA-1 plasmid (Fig.
9). The ability of GATA-1 to
transcriptionally activate the -spectrin erythroid promoter in these
cells, which do not contain this erythroid-specific factor, correlates
with the inability of the -spectrin erythroid promoter to function
in these cells. Co-transfection of 1 µg of a -spectrin erythroid
promoter fragment, p504, and increasing amounts of a BKLF cDNA
expression plasmid did not result in any change in promoter activity
(Fig. 9). Co-transfection of 1 µg of the -spectrin erythroid
promoter fragment, p504, and increasing amounts of an EKLF cDNA
expression plasmid resulted in essentially no change in promoter
activity with increasing amounts of EKLF plasmid (Fig. 9).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 9.
Forced expression of the human
-spectrin gene promoter in HeLa cells.
Top, co-transfection of a -spectrin gene
promoter/reporter plasmid with increasing amounts of a GATA-1 cDNA
expression plasmid. Middle, co-transfection of a
-spectrin gene promoter/reporter plasmid with increasing amounts of
a BKLF cDNA expression plasmid. Bottom, co-transfection
of a -spectrin gene promoter/reporter plasmid with increasing
amounts of an EKLF cDNA expression plasmid.
|
|
Transgenic Mice Express the -Spectrin/A -Globin
Transgene in Erythroid Cells at All Stages of Development--
The
role of the -spectrin promoter fragment, p504, in directing
expression of a reporter gene in vivo was examined. Three transgenic lines and two day 13.5 fetal livers containing the -spectrin/A -globin transgene were analyzed (Fig.
10A). RNase protection
demonstrated that two of three -spectrin/A -globin
transgenic lines and one of two fetal livers expressed the
-spectrin/A -globin transgene in erythroid cells
(Table II). No
-spectrin/A -globin RNA was detected in erythroid
cells of the third transgenic line or the other fetal liver. The number
of transgenes in each line was estimated by Southern blot analyses to
be between three and six copies per expressing animal.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 10.
In vivo analysis of human
-globin reporter gene expression in erythroid and
nonerythroid tissues. A, left, diagram of
the -spectrin promoter/A -globin gene fragment used to
generate transgenic mice. Right, diagram of the -spectrin
promoter/A -globin gene and the riboprobe used in
transgene expression in transgenic mice. Predicted fragment sizes
obtained in RNase protection assays are shown. B, RNase
protection assay of A -globin mRNA from transgenic
mice expressing the -spectrin gene promoter/A -globin
transgene. C, RNase protection assay of murine -globin
mRNA from the same samples used to detect A -globin
expression above. The RNA samples were from transgenic line 553A. Mice
were perfused with normal saline prior to sacrifice.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Developmental pattern of -globin reporter gene expression in
erythroid tissues of -spectrin/A -globin transgenic mice
|
|
After correction for copy number, the level of
-spectrin/A -globin mRNA was compared with the
mRNA of the four murine -globin genes. In all transgenic lines
expressing the -spectrin/A -globin transgene, the
A -globin reporter gene was expressed in day 10.5 yolk
sac-derived peripheral blood cells, in day 13.5 fetal liver, and in
adult reticulocytes, i.e. at all stages of erythroid
development, at levels ranging from 12 to 37% of the levels of murine
-globin expression in the same cells. Cellulose acetate
electrophoresis was performed to confirm the presence of -globin
chains in day 13.5 fetal liver and adult circulating erythrocytes. The
fetal and adult erythrocytes of mice expressing the
-spectrin/A -globin transgene contained endogenous
mouse hemoglobins as well as an additional hemoglobin band composed of
two mouse -globin chains and two human -globin chains (43). These
results were confirmed by acid/urea gel electrophoresis and high
pressure liquid chromatography analysis (not shown).
The -spectrin/A -Globin Transgene Directs Lower
Levels of Expression in Nonerythroid Tissues--
In the two
transgenic lines expressing the -spectrin/A -globin
transgene in erythroid tissues, 553A and 553C, the level of transgene
expression was examined in nonerythroid tissues using RNase protection.
The level of -spectrin/A -globin mRNA (Fig.
10B) was compared with the mRNA of the four murine
-globin genes (Fig. 10C).
-Spectrin/A -globin gene expression/murine -globin
gene expression in individual tissues was compared with
-spectrin/A -globin gene expression/murine -globin
gene expression in bone marrow, with the percentage of expression in
marrow equal to 100% (Fig. 11). There
was essentially no expression in thymus, liver, kidney, and lung.
Expression in heart and skeletal muscle ranged from 10 to 44%, with
decreased expression in transgenic animals (with one exception) who
were perfused with saline immediately prior to sacrificing. Expression
levels in brain were variable, with minimal expression in line 553A and
10-40% expression in line 553C.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 11.
-Spectrin/A -globin
gene expression/murine -globin gene expression
in nonerythroid tissues compared with
-spectrin/A -globin
gene expression/murine -globin gene expression
in bone marrow.
-Spectrin/A -globin transgene
expression/endogenous murine -globin gene expression in nonerythroid
tissues was compared with expression of the transgene in bone marrow.
The percentage of expression in bone marrow was calculated equal to
100%.
|
|
 |
DISCUSSION |
Our studies show that a promoter of the human -spectrin gene
directs high levels of expression in erythroid cells at all stages of
erythroid development. Although the genes encoding erythrocyte membrane
proteins have been cloned for a number of years, there are very little
data about the regulatory elements that control their expression. Until
now, there have been no in vivo studies of elements involved
in the regulation of these genes. In vitro studies of the
promoters of glycophorin B and C, ankyrin-1, and band 3 (53-57), other
red blood cell membrane proteins, have been performed. These studies
demonstrate that, like the -spectrin erythroid promoter, a
combination of GATA-1 and CACCC-binding proteins appears to be
essential for high level expression of these genes. Thus, the promoters
of erythrocyte membrane protein genes share similarities to other
erythroid gene promoters (49, 58-60).
The human -spectrin erythroid promoter appears to be quite
"compact" in that a relatively short fragment of DNA directs high level expression in erythroid cells. A number of erythroid gene promoters require distant regulatory elements (enhancers) to confer high levels of expression (49). Additional regulatory elements not
present in the DNA promoter fragment tested in vivo appear to be required for erythroid expression of the -spectrin promoter, since only three of five mouse lines expressed the transgene.
Consensus binding sites for GATA-1 and CACCC-binding proteins are
present in very close proximity in the -spectrin promoter, mimicking
other erythroid gene promoters (e.g. 61-66). This
combination may lead to cooperation between GATA-1 and CACCC-binding
proteins to enhance transcription (63, 66, 67). Sp1 and EKLF have been
both been shown to physically interact with GATA-1 in the regulatory
elements of certain erythroid genes to synergistically activate
transcription in transfected cells (68).
CACCC-box binding proteins and members of the Kruppel family of
transcription factors both bind CACCC and CGCCC sequences, although
they show distinct binding preferences (Fig.
12) (39, 48-50). Although Sp1, BKLF,
and to a much lesser degree EKLF were found to bind to the GC-rich,
CACCC-binding region of the -spectrin promoter in vitro,
it is unknown what transcription factors bind this site in
vivo. The interactions of Sp1 and/or BKLF with a broad spectrum of
erythroid gene promoters make them likely candidates for binding to
this site (39). EKLF has been shown to bind to the CACCC-box consensus
sequences of other non-globin, erythroid gene promoters, such as the
ALAS-E gene (69), and to increase expression directed by the
glycophorin B promoter transiently transfected into GATA-1-expressing
S2 cells, but these studies have been carried out in vitro.
If EKLF does indeed bind the -spectrin gene promoter, it will join
the -globin gene as a downstream target of EKLF. Additional studies,
such as analysis of the ability of EKLF to act as a transcriptional
activator of the -spectrin gene promoter in Drosophila S2 cells that
lack endogenous Sp1 and analysis of -spectrin content in
hematopoietic cells from EKLF / erythroid cells will
shed additional light on this question.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 12.
Comparison of the nucleotide sequences of
CGCC and CACCC binding. Sites in the human -spectrin gene
erythroid promoter, in other erythroid gene regulatory elements, and in
-thalassemia are shown.
|
|
It is tempting to speculate what type of additional regulatory elements
regulate the expression of spectrin in nonerythroid cells. In
dystrophin, also a member of the spectrin superfamily of proteins, five
autonomous promoters direct the transcription of alternate transcripts
in a cell-specific and developmentally controlled manner (70). Because
alternate transcripts of -spectrin are present in nonerythroid
tissues, it is not unreasonable to postulate that these tissue-specific
isoforms are controlled by alternate promoters. Studies of other
erythrocyte membrane protein genes have shown that alternate promoters
direct the expression of tissue-specific transcripts of ankyrin-1 and
band 3 (41, 54, 56, 71-73).
 |
ACKNOWLEDGEMENTS |
We thank Drs. M. Crossley, S. Orkin, and J. Bieker for sharing reagents.
 |
FOOTNOTES |
*
This work was supported in part by grants from the National
Institutes of Health, the March of Dimes Birth Defects Foundation, and
the American Heart Association, Connecticut Affiliate.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF063907.
§
To whom correspondence should be addressed: Dept. of Pediatrics,
Yale University School of Medicine, 333 Cedar St., P.O. Box 208064, New
Haven, CT 06520-8064. Tel.: 203-688-2896; Fax: 203-785-6974; E-mail:
Patrick.Gallagher{at}Yale.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
bp, base pair(s);
RACE, rapid amplification of cDNA ends;
PCR, polymerase chain
reaction;
EKLF, erythroid Kruppel-like factor;
BKLF, basic Kruppel-like
factor.
 |
REFERENCES |
-
Speicher, D. W.,
and Marchesi, V. T.
(1984)
Nature
311,
177-180[CrossRef][Medline]
[Order article via Infotrieve]
-
Yan, Y.,
Winograd, E.,
Viel, A.,
Cronin, T.,
Harrison, S. C.,
and Branton, D.
(1993)
Science
262,
2027-2030[Abstract/Free Full Text]
-
Morrow, J. S.,
Rimm, D. L.,
Kennedy, S. P.,
Cianci, C. D.,
Sinard, J. H.,
and Weed, S. A.
(1997)
in
Handbook of Physiology (Hoffman, J., and Jamieson, J., eds), pp. 485-540, Oxford University Press, London
-
Winkelmann, J.,
and Forget, B.
(1993)
Blood
81,
3173-3185[Abstract/Free Full Text]
-
Benz, E. J., Jr.
(1994)
in
The Molecular Basis of Blood Diseases (Stamatoyannopoulos, G., Nienhuis, A. W., Majerus, P. W., and Varmus, H., eds), pp. 257-262, W.B. Saunders Co., Philadelphia
-
Lux, S. E.,
and Palek, J.
(1995)
in
Blood: Principles and Practice of Hematology (Handin, R. I., Lux, S. E., and Stossel, T. P., eds), pp. 1701-1816, J.B. Lippincott, Philadelphia
-
Winkelmann, J. C.,
Costa, F. F.,
Linzie, B. L.,
and Forget, B. G.
(1990)
J. Biol. Chem.
265,
20449-20454[Abstract/Free Full Text]
-
Amin, K. M.,
Scarpa, A. L.,
Winkelmann, J. C.,
Curtis, P. J.,
and Forget, B. G.
(1993)
Genomics
18,
118-125[CrossRef][Medline]
[Order article via Infotrieve]
-
Fukushima, Y.,
Byers, M. G.,
Watkins, P. C.,
Winkelmann, J. C.,
Forget, B. G.,
and Shows, T. B.
(1990)
Cytogenet. Cell Genet.
53,
232-233[Medline]
[Order article via Infotrieve]
-
Bewick, G. S.,
Young, C.,
and Slater, C. R.
(1996)
J. Neurocytol.
25,
367-379[Medline]
[Order article via Infotrieve]
-
Chu, Z. L.,
Wickrema, A.,
Krantz, S. B.,
and Winkelmann, J. C.
(1994)
Blood
84,
1992-1999[Abstract/Free Full Text]
-
Ehmer, S.,
Herrmann, R.,
Bittner, R.,
and Voit, T.
(1997)
Acta Neuropathol.
94,
240-246[CrossRef][Medline]
[Order article via Infotrieve]
-
Goodman, S. R.,
Zimmer, W. E.,
Clark, M. B.,
Zagon, I. S.,
Barker, J. E.,
and Bloom, M. L.
(1995)
Brain Res. Bull.
36,
593-606[CrossRef][Medline]
[Order article via Infotrieve]
-
Lambert, S.,
and Bennett, V.
(1993)
J. Neurosci.
13,
3725-3735[Abstract]
-
Malchiodi-Albedi, F.,
Ceccarini, M.,
Winkelmann, J. C.,
Morrow, J. S.,
and Petrucci, T. C.
(1993)
J. Cell Sci.
106,
67-78[Abstract]
-
Mora, M.,
Di Blasi, C.,
Barresi, R.,
Morandi, L.,
Brambati, B.,
Jarre, L.,
and Cornelio, F.
(1996)
Brain Res. Dev. Brain Res.
91,
70-82[CrossRef][Medline]
[Order article via Infotrieve]
-
Porter, G. A.,
Dmytrenko, G. M.,
Winkelmann, J. C.,
and Bloch, R. J.
(1992)
J. Cell Biol.
117,
997-1005[Abstract/Free Full Text]
-
Porter, G.,
Scher, M.,
Resneck, W.,
Porter, N.,
Fowler, V.,
and Bloch, R.
(1997)
Cell Motil. Cytoskeleton
37,
7-19[CrossRef][Medline]
[Order article via Infotrieve]
-
Prchal, J. T.,
Papayannopoulou, T.,
and Yoon, S. H.
(1990)
J. Cell. Physiol.
144,
287-294[CrossRef][Medline]
[Order article via Infotrieve]
-
Vybiral, T.,
Winkelmann, J. C.,
Roberts, R.,
Joe, E.,
Casey, D. L.,
Williams, J. K.,
and Epstein, H. F.
(1992)
Cell Motil. Cytoskeleton
21,
293-304[CrossRef][Medline]
[Order article via Infotrieve]
-
Winkelmann, J. C.,
Chang, J. G.,
Tse, W. T.,
Scarpa, A. L.,
Marchesi, V. T.,
and Forget, B. G.
(1990)
J. Biol. Chem.
265,
11827-11832[Abstract/Free Full Text]
-
Zimmer, W. E.,
Ma, Y.,
Zagon, I. S.,
and Goodman, S. R.
(1992)
Brain Res.
594,
75-83[CrossRef][Medline]
[Order article via Infotrieve]
-
Bloch, R. J.,
and Morrow, J. S.
(1989)
J. Cell Biol.
108,
481-493[Abstract/Free Full Text]
-
Daniels, M. P.
(1990)
J. Cell Sci.
97,
615-626[Abstract/Free Full Text]
-
Pumplin, D. W.
(1995)
J. Cell Sci.
108,
3145-3154[Abstract]
-
Wood, S. J.,
and Slater, C. R.
(1998)
J. Cell Biol.
140,
675-684[Abstract/Free Full Text]
-
Beck, K. A.,
and Nelson, W. J.
(1996)
Am. J. Physiol.
270,
C1263-C1270[Abstract/Free Full Text]
-
Viel, A.,
and Branton, D.
(1996)
Curr. Opin. Cell Biol.
8,
49-55[CrossRef][Medline]
[Order article via Infotrieve]
-
Chang, J. G.,
Scarpa, A.,
Eddy, R. L.,
Byers, M. G.,
Harris, A. S.,
Morrow, J. S.,
Watkins, P.,
Shows, T. B.,
and Forget, B. G.
(1993)
Genomics
17,
287-293[CrossRef][Medline]
[Order article via Infotrieve]
-
Hu, R. J.,
Watanabe, M.,
and Bennett, V.
(1992)
J. Biol. Chem.
267,
18715-18722[Abstract/Free Full Text]
-
Prchal, J. T.,
Morley, B. J.,
Yoon, S. H.,
Coetzer, T. L.,
Palek, J.,
Conboy, J. G.,
and Kan, Y. W.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
7468-7472[Abstract/Free Full Text]
-
Winkelmann, J. C.,
Leto, T. L.,
Watkins, P. C.,
Eddy, R.,
Shows, T. B.,
Linnenbach, A. J.,
Sahr, K. E.,
Kathuria, N.,
Marchesi, V. T.,
and Forget, B. G.
(1988)
Blood
72,
328-334[Abstract/Free Full Text]
-
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
-
Edwards, J. B.,
Delort, J.,
and Mallet, J.
(1991)
Nucleic Acids Res.
19,
5227-5232[Abstract/Free Full Text]
-
Frohman, M. A.,
Dush, M. K.,
and Martin, G. R.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8998-9002[Abstract/Free Full Text]
-
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
-
Andrews, N. C.,
and Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499[Free Full Text]
-
Mason, P.,
Enver, T.,
Wilkinson, D.,
and Williams, J.
(1993)
in
Gene Transcription: A Practical Approach (Hames, B., and Higgins, S., eds), pp. 47-54, IRL Press, Oxford
-
Crossley, M.,
Whitelaw, E.,
Perkins, A.,
Williams, G.,
Fujiwara, Y.,
and Orkin, S. H.
(1996)
Mol. Cell. Biol.
16,
1695-1705[Abstract]
-
Miller, I. J.,
and Bieker, J. J.
(1993)
Mol. Cell. Biol.
13,
2776-2786[Abstract/Free Full Text]
-
Gallagher, P. G.,
and Forget, B. G.
(1998)
J. Biol. Chem.
273,
1339-1348[Abstract/Free Full Text]
-
Hogan, B.,
Constantini, F.,
and Lacey, E.
(1986)
Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Sabatino, D. E.,
Cline, A. P.,
Gallagher, P. G.,
Garrett, L. J.,
Stamatoyannopoulos, G.,
Forget, B. G.,
and Bodine, D. M.
(1998)
Mol. Cell. Biol.
18,
6634-6640[Abstract/Free Full Text]
-
Genetics Computer Group.
(1994)
The GCG Sequence Analysis Software Package, version 8, Genetics Computer Group, Inc., Madison, WI
-
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
-
Javahery, R.,
Khachi, A.,
Lo, K.,
Zenzie-Gregory, B.,
and Smale, S. T.
(1994)
Mol. Cell. Biol.
14,
116-127[Abstract/Free Full Text]
-
Mignotte, V.,
Wall, L.,
deBoer, E.,
Grosveld, F.,
and Romeo, P. H.
(1989)
Nucleic Acids Res.
17,
37-54[Abstract/Free Full Text]
-
Hartzog, G. A.,
and Myers, R. M.
(1993)
Mol. Cell. Biol.
13,
44-56[Abstract/Free Full Text]
-
Orkin, S. H.
(1995)
Curr. Opin. Cell. Biol.
7,
870-877[CrossRef][Medline]
[Order article via Infotrieve]
-
Treisman, R.,
Orkin, S. H.,
and Maniatis, T.
(1983)
Nature
302,
591-596[CrossRef][Medline]
[Order article via Infotrieve]
-
Kadonaga, J.,
Jones, K.,
and Tjian, R.
(1986)
Trends Biochem. Sci.
11,
20-23
-
Crossley, M.,
Tsang, A. P.,
Bieker, J. J.,
and Orkin, S. H.
(1994)
J. Biol. Chem.
269,
15440-15444[Abstract/Free Full Text]
-
Colin, Y.,
Joulin, V.,
Le Van Kim, C.,
Romeo, P. H.,
and Cartron, J. P.
(1990)
J. Biol. Chem.
265,
16729-16732[Abstract/Free Full Text]
-
Gallagher, P.,
Romana, M.,
Tse, W.,
Eber, S.,
Lux, S.,
and Forget, B.
(1994)
Blood
84,
361 (abstr.)
-
Rahuel, C.,
Vinit, M. A.,
Lemarchandel, V.,
Cartron, J. P.,
and Romeo, P. H.
(1992)
EMBO. J.
11,
4095-4102[Medline]
[Order article via Infotrieve]
-
Sahr, K. E.,
Daniels, B. P.,
and Hanspal, M.
(1996)
Blood
88,
4500-4509[Abstract/Free Full Text]
-
Vignal, A.,
London, J.,
Rahuel, C.,
and Cartron, J. P.
(1990)
Gene (Amst.)
95,
289-293[CrossRef][Medline]
[Order article via Infotrieve]
-
Orkin, S. H.
(1995)
Eur. J. Biochem.
231,
271-281[Medline]
[Order article via Infotrieve]
-
Orkin, S. H.
(1995)
J. Biol. Chem.
270,
4955-4958[Free Full Text]
-
Weiss, M. J.,
and Orkin, S. H.
(1995)
Exp. Hematol.
23,
99-107[Medline]
[Order article via Infotrieve]
-
Eleouet, J. F.,
and Romeo, P. H.
(1993)
Eur. J. Biochem.
212,
763-770[Medline]
[Order article via Infotrieve]
-
Frampton, J.,
Walker, M.,
Plumb, M.,
and Harrison, P. R.
(1990)
Mol. Cell. Biol.
10,
3838-3842[Abstract/Free Full Text]
-
Gregory, R. C.,
Taxman, D. J.,
Seshasayee, D.,
Kensinger, M. H.,
Bieker, J. J.,
and Wojchowski, D. M.
(1996)
Blood
87,
1793-1801[Abstract/Free Full Text]
-
Max-Audit, I.,
Eleouet, J. F.,
and Romeo, P. H.
(1993)
J. Biol. Chem.
268,
5431-5437[Abstract/Free Full Text]
-
Tsai, S. F.,
Strauss, E.,
and Orkin, S. H.
(1991)
Genes Dev.
5,
919-931[Abstract/Free Full Text]
-
Walters, M.,
and Martin, D. I.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10444-10448[Abstract/Free Full Text]
-
Fischer, K. D.,
Haese, A.,
and Nowock, J.
(1993)
J. Biol. Chem.
268,
23915-23923[Abstract/Free Full Text]
-
Merika, M.,
and Orkin, S. H.
(1995)
Mol. Cell. Biol.
15,
2437-2447[Abstract]
-
Surinya, K. H.,
Cox, T. C.,
and May, B. K.
(1997)
J. Biol. Chem.
272,
26585-26594[Abstract/Free Full Text]
-
Ahn, A. H.,
and Kunkel, L. M.
(1993)
Nat. Genet.
3,
283-291[CrossRef][Medline]
[Order article via Infotrieve]
-
Cox, K. H.,
Adair-Kirk, T. L.,
and Cox, J. V.
(1995)
J. Biol. Chem.
270,
19752-19760[Abstract/Free Full Text]
-
Kopito, R. R.,
Andersson, M. A.,
and Lodish, H. F.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
7149-7153[Abstract/Free Full Text]
-
Kudrycki, K. E.,
and Shull, G. E.
(1993)
Am. J. Physiol.
264,
F540-F547[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. G. Gallagher, D. G. Nilson, L. A. Steiner, Y. D. Maksimova, J. Y. Lin, and D. M. Bodine
An insulator with barrier-element activity promotes {alpha}-spectrin gene expression in erythroid cells
Blood,
February 12, 2009;
113(7):
1547 - 1554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Gallagher, R. I. Liem, E. Wong, M. J. Weiss, and D. M. Bodine
GATA-1 and Oct-1 Are Required for Expression of the Human {alpha}-Hemoglobin-stabilizing Protein Gene
J. Biol. Chem.,
November 25, 2005;
280(47):
39016 - 39023.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Y. Wong, J. Lin, B. G. Forget, D. M. Bodine, and P. G. Gallagher
Sequences Downstream of the Erythroid Promoter Are Required for High Level Expression of the Human {alpha}-Spectrin Gene
J. Biol. Chem.,
December 31, 2004;
279(53):
55024 - 55033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Zhou, Q. Zhao, R. Sutton, H. Cumming, X. Wang, L. Cerruti, M. Hall, R. Wu, J. M. Cunningham, and S. M. Jane
The Role of p22 NF-E4 in Human Globin Gene Switching
J. Biol. Chem.,
June 18, 2004;
279(25):
26227 - 26232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Richard, M. Weinreich, K.-H. Chang, J. Ieremia, M. M. Stevenson, and C. A. Blau
Modulating erythrocyte chimerism in a mouse model of pyruvate kinase deficiency
Blood,
June 15, 2004;
103(12):
4432 - 4439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. F. Frazar, J. L. Weisbein, S. M. Anderson, A. P. Cline, L. J. Garrett, G. Felsenfeld, P. G. Gallagher, and D. M. Bodine
Variegated Expression from the Murine Band 3 (AE1) Promoter in Transgenic Mice Is Associated with mRNA Transcript Initiation at Upstream Start Sites and Can Be Suppressed by the Addition of the Chicken {beta}-Globin 5' HS4 Insulator Element
Mol. Cell. Biol.,
July 15, 2003;
23(14):
4753 - 4763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Persons, P. W. Hargrove, E. R. Allay, H. Hanawa, and A. W. Nienhuis
The degree of phenotypic correction of murine beta -thalassemia intermedia following lentiviral-mediated transfer of a human gamma -globin gene is influenced by chromosomal position effects and vector copy number
Blood,
March 15, 2003;
101(6):
2175 - 2183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Boulanger, D. E. Sabatino, E. Y. Wong, A. P. Cline, L. J. Garrett, M. Garbarz, D. Dhermy, D. M. Bodine, and P. G. Gallagher
Erythroid Expression of the Human alpha -Spectrin Gene Promoter Is Mediated by GATA-1- and NF-E2-binding Proteins
J. Biol. Chem.,
October 25, 2002;
277(44):
41563 - 41570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Lyons, N. D. Lawson, L. Lei, P. E. Bennett, B. M. Weinstein, and P. P. Liu
A nonsense mutation in zebrafish gata1 causes the bloodless phenotype in vlad tepes
PNAS,
April 16, 2002;
99(8):
5454 - 5459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Gallagher, D. E. Sabatino, D. S. Basseres, D. M. Nilson, C. Wong, A. P. Cline, L. J. Garrett, and D. M. Bodine
Erythrocyte Ankyrin Promoter Mutations Associated with Recessive Hereditary Spherocytosis Cause Significant Abnormalities in Ankyrin Expression
J. Biol. Chem.,
November 2, 2001;
276(45):
41683 - 41689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Moreau-Gaudry, P. Xia, G. Jiang, N. P. Perelman, G. Bauer, J. Ellis, K. H. Surinya, F. Mavilio, C.-K. Shen, and P. Malik
High-level erythroid-specific gene expression in primary human and murine hematopoietic cells with self-inactivating lentiviral vectors
Blood,
November 1, 2001;
98(9):
2664 - 2672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Gallagher, M. Romana, W. T. Tse, S. E. Lux, and B. G. Forget
The human ankyrin-1 gene is selectively transcribed in erythroid cell lines despite the presence of a housekeeping-like promoter
Blood,
August 1, 2000;
96(3):
1136 - 1143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. G. Sargent, C. C. DuBois, A. M. Buller, and J. A. Lloyd
The Roles of 5'-HS2, 5'-HS3, and the gamma -Globin TATA, CACCC, and Stage Selector Elements in Suppression of beta -Globin Expression in Early Development
J. Biol. Chem.,
April 16, 1999;
274(16):
11229 - 11236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Sabatino, C. Wong, A. P. Cline, L. Pyle, L. J. Garrett, P. G. Gallagher, and D. M. Bodine
A Minimal Ankyrin Promoter Linked to a Human gamma -Globin Gene Demonstrates Erythroid Specific Copy Number Dependent Expression with Minimal Position or Enhancer Dependence in Transgenic Mice
J. Biol. Chem.,
September 8, 2000;
275(37):
28549 - 28554.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|