Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gallagher, P. G.
Right arrow Articles by Forget, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gallagher, P. G.
Right arrow Articles by Forget, B. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 10, 6062-6073, March 5, 1999


A Human beta -Spectrin Gene Promoter Directs High Level Expression in Erythroid but Not Muscle or Neural Cells*

Patrick G. GallagherDagger §, Denise E. Sabatino, Marc Romanaparallel , Amanda P. Cline, Lisa J. Garrett, David M. Bodine, and Bernard G. Forgetparallel **

From the Departments of Dagger  Pediatrics, parallel  Internal Medicine, and ** Genetics, Yale University School of Medicine, New Haven, Connecticut 06520-8021 and the  Hematopoiesis Section, Genetics and Molecular Biology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892-4442

    ABSTRACT
Top
Abstract
Introduction
References

beta -Spectrin is an erythrocyte membrane protein that is defective in many patients with abnormalities of red blood cell shape including hereditary spherocytosis and elliptocytosis. It is expressed not only in erythroid tissues but also in muscle and brain. We wished to determine the regulatory elements that determine the tissue-specific expression of the beta -spectrin gene. We mapped the 5'-end of the beta -spectrin erythroid cDNA and cloned the 5'-flanking genomic DNA containing the putative beta -spectrin gene promoter. Using transfection of promoter/reporter plasmids in human tissue culture cell lines, in vitro DNase I footprinting analyses, and gel mobility shift assays, a beta -spectrin gene erythroid promoter with two binding sites for GATA-1 and one site for CACCC-related proteins was identified. All three binding sites were required for full promoter activity; one of the GATA-1 motifs and the CACCC-binding motif were essential for activity. The beta -spectrin gene promoter was able to be transactivated in heterologous cells by forced expression of GATA-1. In transgenic mice, a reporter gene directed by the beta -spectrin promoter was expressed in erythroid tissues at all stages of development. Only weak expression of the reporter gene was detected in muscle and brain tissue, suggesting that additional regulatory elements are required for high level expression of the beta -spectrin gene in these tissues.

    INTRODUCTION
Top
Abstract
Introduction
References

Spectrin, the most abundant protein of the erythrocyte membrane skeleton, is composed of two structurally similar but nonidentical proteins, alpha - and beta -spectrin, encoded by separate genes. alpha - and beta -spectrin are composed primarily of homologous 106-amino acid repeats that fold into three antiparallel alpha -helices connected by short nonhelical segments (1, 2). alpha - and beta -spectrin combine to form heterodimers, which in turn self-associate to form tetramers and higher order oligomers to form a lattice-like structure that is critical for erythrocyte membrane stability as well as erythrocyte shape and deformability. In the red cell, spectrin maintains cellular shape, regulates the lateral mobility of integral membrane proteins, and provides structural support for the lipid bilayer (3, 4). Quantitative and qualitative disorders of both alpha - and beta -spectrin have been associated with abnormalities of erythrocyte shape including hereditary spherocytosis and hereditary elliptocytosis (5, 6).

Erythrocyte beta -spectrin contains binding sites for actin, protein 4.1, and ankyrin, as well as the alpha beta -spectrin self-association site (3). The human beta -spectrin erythroid cDNA transcript contains an open reading frame of 6411 bp1 (7). The deduced amino acid sequence predicts a peptide of 2137 amino acids with a predicted molecular mass of 246 kDa. The beta -spectrin erythroid cDNA transcript is encoded by 32 exons (8). The chromosomal gene, localized to 14q23-q24.2 (9), spans over >100 kilobase pairs of genomic DNA.

beta -Spectrin transcripts have also been identified in nonerythroid tissues including heart, skeletal muscle, brain, platelets, trachea, and lens (10-22). In the nervous system tissue, beta -spectrin is expressed in the granular cells of the cerebellum and in regions of the neocortex (15). In muscle, there are several populations of beta -spectrin, including an immunoreactive isoform clustered with the acetylcholine receptor (10, 17, 18, 23-26). In some nonerythroid tissues, beta -spectrin may exist as homodimers or homotetramers, without an alpha -spectrin partner (15, 17, 18, 25). In nonerythroid tissues, spectrin may establish or maintain local concentrations of proteins of the plasma membrane, participate in the early stages of cell junction formation, and regulate access of secretory vesicles to the plasma membrane as well as play a role in maintaining the structural integrity of cellular membranes (3, 27, 28).

The mechanisms by which beta -spectrin has acquired distinct isoforms with specialized functions are beginning to be revealed. The isoform diversity of beta -spectrin arises from both different gene products and from differential, alternative splicing of the same gene product. In humans, the cDNAs for two beta -spectrin proteins have been cloned, and their gene products have been studied (4, 7, 21, 29-32). These spectrins share similar antigenic sites and domain structures, differing in a number of ways such as their cellular patterns of expression and their relative affinities of binding to ankyrin and band 3. In brain and muscle, an alternatively spliced mRNA isoform of the beta -spectrin gene has been identified. This tissue-specific, differential processing occurs at the 3'-end of the beta -spectrin pre-mRNA, generating a beta -spectrin cDNA isoform in brain and muscle encoded by 36 exons (cf. 32 in erythroid) (7, 8, 11, 21). The predicted isoform contains an COOH terminus different from that in erythrocyte, with the last 22 amino acids of erythrocyte beta -spectrin replaced by a new sequence of 213 amino acids.

There are no data regarding the molecular mechanisms that regulate the tissue-specific or developmental stage-specific expression of beta -spectrin isoforms. For example, it is unknown whether or not isoforms of beta -spectrin are transcribed from the same gene by tissue-specific utilization of alternate promoters. This report describes the identification and characterization of a promoter of the human beta -spectrin gene that directs high level expression in erythroid cells at all stages of development. This expression of the human beta -spectrin gene is mediated by a compact promoter that requires GATA-1 and CACCC-binding proteins for its activity. This promoter does not direct high level activity in nonerythroid tissues, including brain and muscle, suggesting that additional regulatory elements are required for expression of the beta -spectrin gene in these tissues.

    MATERIALS AND METHODS

RNA Preparation-- Total RNA was prepared from human fetal liver tissue; human bone marrow; or the human tissue culture cell line K562 (chronic myelogenous leukemia in blast crisis with erythroid characteristics, ATCC, CCL 243), HEL (erythroleukemia, ATCC, TIB 180), or HeLa (epithelial-like carcinoma, cervix, CCL 2) using the guanidinium thiocynate-chloroform method as described (33).

5'-Rapid Amplification of cDNA Ends (RACE)-- 1 µg of total human fetal liver RNA was reverse transcribed using primer A (Table I) and avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI). Single-stranded oligonucleotide ligation and PCR amplification were carried out as described using primers B + D and C + D (34, 35). Amplification products were subcloned and sequenced.

Genomic Cloning-- A human beta -spectrin cDNA fragment corresponding to the 5'-end of the coding region, V252 (7), was used as hybridization probe to screen a human genomic DNA library. The library is a Charon 4A bacteriophage library containing fragments of genomic DNA partially digested with AluI and HaeIII with EcoRI linkers added. Selected recombinants that hybridized to the screening probe were purified and subcloned into pGEM-7Z plasmid vectors (Promega). Subcloned fragments were analyzed by restriction endonuclease digestion, Southern blotting, and nucleotide sequencing.

Mapping the Transcription Initiation Site-- The transcription initiation site of the erythroid beta -spectrin cDNA was determined using an RNase protection assay. A 32P-labeled antisense RNA probe was synthesized by transcription with T7 polymerase of a 180-bp DdeI-ApaI fragment corresponding to the first exon and 5'-flanking sequences of the human beta -spectrin gene. The probe (1 × 105 cpm/assay) was hybridized to template RNA at 42 °C for 16 h. Templates in these reactions were 20 µg of total human fetal liver RNA, 20 µg of total RNA from the human cell lines K562 and HEL, or 20 µg of tRNA. Hybrids were digested with a mixture of the nucleases RNase A and RNase T1 (0.125 units and 5 units, respectively, per assay) at 37 °C for 30 min. After digestion, protected fragments were detected by autoradiography after electrophoresis in 6% polyacrylamide, M urea gels. Further increases in nuclease concentration or length of incubation did not alter the pattern of the protected fragment (not shown).

Nucleotide Sequencing-- Nucleotide sequencing was performed using the dideoxy chain termination method of Sanger et al. (36) with T7 DNA polymerase (Sequenase; U.S. Biochemical Corp.). The sequencing primers were the Sp6 or T7 vectors of the pGEM-7Z plasmid vector or, for some reactions, synthetic oligonucleotides corresponding to known cDNA sequences (Table I). Deoxyinosine trisphosphate was substituted for deoxyguanosine trisphosphate to resolve band compressions and ambiguities.

Preparation of Nuclear Extracts-- Nuclear extracts were prepared from K562, HEL, MEL (murine erythroleukemia, NIGMS GM00086E), and HeLa cells by hypotonic lysis followed by high salt extraction of nuclei as described by Andrews and Faller (37).

DNase I Footprinting in Vitro-- Probes for DNase I footprinting were by produced by PCR amplification of plasmid p173 (see below) as template and a pair of oligonucleotide primers that flank the plasmid polylinker. One oligonucleotide was 5'-end-labeled with [32P]ATP using polynucleotide kinase prior to use in PCR. Reaction mixes contained 1-20 µg of MEL cell nuclear extracts, 20,000 cpm of labeled probe, and 1 µg of poly(dI-dC) (38). After digestion with DNase I, samples were electrophoresed in 6% polyacrylamide gels, and the gels were dried and subjected to autoradiography.

Cell Culture-- The tissue culture cell lines K562 and HEL (erythroid), SH-SY5Y (neural), and HeLa (nonerythroid) were used to study expression of the putative promoter of the gene. K562, MEL, and SH-Sy5Y cells were maintained in RPMI 1640 medium containing 10% fetal calf serum. HeLa cells were maintained in Eagle's minimal essential media supplemented with 10% fetal calf serum.

Preparation of Promoter-Reporter Plasmids for Transfection Assays-- Test plasmids were prepared by inserting a 700-bp fragment of the 5'-flanking beta -spectrin genomic DNA upstream of the firefly luciferase reporter gene in the plasmid pGL2B (Promega) in both orientations. These plasmids were designated p700-forward and p700-reverse, respectively. Serial truncations of this 700-bp fragment in the pGL2B plasmid were constructed using convenient restriction enzyme sites or PCR amplification. Test plasmids were sequenced to exclude cloning or PCR-generated artifacts.

Transient Transfection Analyses-- All plasmids tested were purified using Qiagen columns (Qiagen, Inc., Chatsworth, CA) or cesium chloride plasmid purification, and at least two preparations of each plasmid were tested in triplicate. 107 K562, MEL, and SH-SY5Y cells were transfected by electroporation with a single pulse of 300 V at 960 microfarads with 20 µg of test plasmid and 0.5 µg of pCMVbeta , a mammalian reporter plasmid expressing beta -galactosidase driven by the human cytomegalovirus immediate early gene promoter (CLONTECH, Palo Alto, CA). 105 HeLa cells were transfected with 2.0 µg of test plasmid and 0.25 µg of the pCMVbeta plasmid by lipofection using 4 µl of Lipofectamine (Life Technologies, Inc.). Twenty-four hours after transfection, cells were harvested and lysed, and the levels of both luciferase and beta -galactosidase activity were determined in cell extracts. All assays were performed in triplicate. Differences in transfection efficiency were determined by co-transfection with the pCMVbeta plasmid.

COS cells (107) were transfected with 20 µg of the expression plasmids pMT/BKLF (39) (a kind gift of Drs. M. Crossley and S. Orkin) or pSG5/erythroid Kruppel-like factor (EKLF) (40) (a kind gift of Dr. J. Bieker) as described above. Forty-eight hours after transfection, nuclear extracts were prepared for use in gel shift analyses. Antibodies to GATA-1 and Sp1 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Antibodies to BKLF and EKLF were a kind gift of Drs. M. Crossley and S. Orkin.

Gel Mobility Shift Analyses-- Binding reactions were carried out as described (41). Competitor oligonucleotides were added at molar excesses of 10- or 100-fold. Resulting complexes were separated by electrophoresis through 6% polyacrylamide gels in 0.5× Tris-borate-EDTA at 21 °C at 200 watts for 2 h. Gels were dried and subjected to autoradiography.

Preparation of Promoter-Reporter Plasmids for Transgenic Mice-- A 576-bp beta -spectrin promoter fragment was excised from plasmid p504 (see below) as a KpnI/HindIII fragment and cloned into the KpnI/HindIII sites of pSP72. The HindIII site in the pSP72 beta -spectrin plasmid was destroyed by digestion with HindIII, filling in the ends, and religation. A 1909-bp BsaHI/HindIII fragment containing the coding region of the human Agamma -globin gene was cloned into the ClaI/HindIII sites of pSP72. A 2614 bp AatII/PvuII fragment from the beta -spectrin plasmid was ligated to a 2266 bp EcoRV/AatII fragment from the Agamma -globin plasmid to create the plasmid pSP72beta sp/Agamma . The 2483-bp beta sp/Agamma gene was excised from this plasmid with EcoRV and HindIII and used for microinjection.

Generation of Transgenic Mice-- Transgenic mice were generated as described in Hogan et al. (42) and Sabatino et al. (43). Fertilized eggs were collected from superovulated FVB/N female mice approximately 9 h after mating to CB6F1 male mice. After purification, beta -spectrin promoter/Agamma -globin DNA fragments were microinjected into the male pronucleus of fertilized eggs. The injected eggs were transferred into pseudopregnant CB6F1 foster mothers. Founders were identified by Southern blotting of genomic DNA obtained from tail biopsies. Copy number was determined by comparing transgenic mouse DNA to K562 DNA. Founder animals were crossed to FVB/N mice for propagation.

Analysis of Transgene Expression-- Total cellular RNA was extracted from mouse tissues, including 10.5-day embryo blood cells, 13.5-day fetal livers, and adult reticulocytes using TRIZOL reagent (Life Technologies). The tissue-specific pattern of expression of the erythroid beta -spectrin promoter/Agamma -globin reporter transgene was analyzed using an RNase protection assay. Linear DNA templates for the RNase protection assay were prepared by EcoRI digestion of a human beta -spectrin/Agamma -globin plasmid or by HindIII digestion of a murine alpha -globin plasmid. Templates were purified by agarose gel electrophoresis. The 32P-labeled antisense RNA probe was synthesized by transcription with T7 polymerase (MAXIscript In Vitro Transcription Kit; Ambion, Inc., Austin, TX). The probe (1 × 105 cpm/assay) was hybridized to template RNA at 42 °C overnight. Templates in these reactions were 1 µg of total murine spleen or bone marrow RNA; 10 µg of total RNA from muscle, brain, heart, liver, kidney, lung, or testis; or 10 µg of tRNA. Hybrids were digested with a mixture of the nucleases RNase A and RNase T1. After digestion, protected fragments were detected by autoradiography after electrophoresis in 8% nondenaturing polyacrylamide gels.

Computer Analyses-- Computer-assisted analyses of derived nucleotide sequences were performed utilizing the sequence analysis software package of the University of Wisconsin Genetics Computer Group (44) and the BLAST algorithm, National Center for Biotechnology Information (Bethesda, MD) (45).

    RESULTS

Cloning of Chromosomal Gene: Isolation and Analysis of Recombinant Clones-- Primary screening of a human genomic DNA library with the beta -spectrin cDNA probe V252 (Fig. 1A) yielded six hybridization-positive plaques. Selected recombinants were analyzed, and one clone was identified, lambda 27, that spanned ~21 kilobase pairs of DNA containing the beta -spectrin gene. A limited restriction map of this region is shown in Fig. 1B.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   The 5'-end of the human beta -spectrin gene. A, structure of the 5'-end of the human beta -spectrin-1 erythroid cDNA. A diagram of the 5'-end of the human beta -spectrin cDNA is shown. The location of the initiation codon is shown, as is the location of intron/exon boundaries. Sequence obtained by 5'-RACE is denoted by a hatched box. Oligonucleotide primers used in 5'-RACE are denoted by the arrows. The location of the probe used in genomic library screening, V252, and the end of the 5'-most beta -spectrin cDNA clone (7) are shown. B, genomic organization of the 5'-end of the human beta -spectrin gene. Five overlapping clones containing the beta -spectrin gene were isolated from a human genomic DNA library. These clones spanned a distance of over 40 kilobase pairs. Clone lambda 27 contained exon 1 of the beta -spectrin erythroid cDNA in a 2.0-kilobase pair EcoRI fragment. A restriction map of clone lambda 27 with EcoRI (E) and BamHI (B) is shown.

Mapping the Human beta -Spectrin Erythroid mRNA Transcription Initiation Site and Identification of 5' cDNA Sequences-- To identify the 5'-end of the human beta -spectrin cDNA, RNase mapping with RNase A and RNase T1 nucleases was performed. These experiments identified a single transcription initiation site (Fig. 2) and predicted the presence of an additional 64 bp in the mRNA upstream of the 5'-end of the sequence obtained from cDNA cloning. These additional 64 bp of upstream 5'-untranslated sequence were obtained by 5'-RACE. Sequences obtained by RACE were verified by comparison with corresponding genomic DNA sequences (Fig. 3). The sequences around the transcription start site, GCA+1CCAG, closely match transcription initiation recognition sequences, YYA+1NWYY (46). No additional ATGs were present in the 5'-untranslated sequences. Taken together, these data suggest that this sequence is at or very near the 5'-end of the human beta -spectrin erythroid cDNA.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Mapping the 5'-end of the human beta -spectrin cDNA. RNase mapping was carried out using a riboprobe (left) and 10 µg of K562, HEL, HL60 total RNA, or tRNA as template. The size of the extension products, 113 nucleotides (right), indicates that the 5'-end of the mRNA is located at position -162 relative to the adenosine of the initiator methionine codon. The cDNA sequence of this additional 5'-untranslated cDNA was determined by 5'-RACE and is shown in Fig. 4.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3.   5'-Flanking genomic DNA sequence. The nucleotide sequence of the 5'-flanking genomic DNA of the human beta -spectrin gene is shown. Consensus sequences for potential DNA-protein binding sites are underlined. The transcription initiation site, +1, is denoted by the arrow. The junction between exon 1 and intron 1 is marked by the inverted triangle.

The 5'-Flanking Genomic DNA Sequence of the Human beta -Spectrin-1 Gene Exhibits Features of an Erythroid Gene Promoter-- The nucleotide sequence of the 5'-flanking genomic DNA upstream of the human beta -spectrin cDNA transcription start site is shown in Fig. 3. Inspection of the sequence reveals a lack of consensus TATA or CCAAT sequences. Consensus sequences for a number of potential DNA-binding proteins, including GATA-1 (two sites) and Sp1/CACCC-related proteins, characteristics of an erythroid gene promoter, are present in the 5'-flanking sequences. GATA motifs bind GATA-1, a zinc finger transcription factor essential for erythroid development. GC or G(T/C)ACC motifs are the binding sites for a number of transcription factor proteins, including ubiquitous Sp1 and Sp1-like proteins, and cell-restricted proteins such as EKLF.

A beta -Spectrin-1 Gene Promoter Fragment Is Active in Erythroid Cells-- To investigate if the region from -623 to +77 was capable of directing expression of a reporter gene in cultured mammalian cells, test plasmids p700-forward and p700-reverse were transiently transfected into erythroid (K562 and MEL), neural (SY5Y), or nonerythroid (NIH3T3) cells. The relative luciferase activity was determined 48 h after transfection and compared with the activity obtained with pGL2B, a negative control, the promoterless plasmid, and pGL2P, a positive control, the luciferase reporter gene under control of the SV40 early promoter. As shown in Fig. 4, the putative beta -spectrin gene erythroid promoter plasmid, p700-forward, directed high level expression of the luciferase reporter gene only in erythroid cells. The plasmid with the promoter in reverse orientation, p700-reverse, did not direct expression of the reporter gene in any of the cell lines.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Activity of the beta -spectrin gene erythroid promoter in erythroid and nonerythroid cell lines in transient transfection assays. Plasmids containing 5'-flanking DNA of the beta -spectrin gene inserted upstream of the firefly luciferase gene were transfected into K562, HEL, SY5Y, or HeLa cells as described. Relative luciferase activity was expressed as that obtained from the test plasmids versus the activity obtained from the promoterless plasmid pGL2B plasmid taking into account the transfection efficiency. The data are means ± S.D. of at least six independent transfection experiments. Mutations in consensus DNA-protein binding sites are marked with an X. n.d., not determined.

Transient transfection analysis of deletions of this beta -spectrin gene erythroid promoter fragment identified a 250-bp minimal promoter fragment, p173, that directed erythroid-specific expression of the reporter gene (Fig. 4). The 250-bp minimal promoter fragment contains potential binding sites for GATA-1, as well as Sp1- and CACCC-related proteins, a combination shown to be adequate for expression of a minimal promoter in other erythroid-specific genes. There was minimal to no reporter gene activity in transfected HeLa or SY5Y cells.

The beta -Spectrin Erythroid Promoter Contains Binding Sites for GATA-1 and CGCC- and CACCC-related Binding Proteins-- Consensus sequences for a number of potential DNA-binding proteins, including GATA-1 and CACCC-related proteins, were present in the beta -spectrin gene promoter. To identify binding sites for transcription factors within the beta -spectrin promoter, DNase I footprinting analysis with nuclear extracts from MEL cells was performed (Fig. 5). Footprints at three protected sites were observed. Two sites, sites 1 and 2, contain consensus binding sequences for GATA-1. The third site, site 3, consists of a long GC-rich region of sequences that are recognized by members of the Kruppel-like family of transcription factors as well as CACCC-related proteins.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 5.   In vitro DNase I footprinting of the human beta -spectrin promoter. In vitro DNase I footprinting of the human beta -spectrin gene promoter was performed using erythroid (MEL) extracts as described under "Materials and Methods." Three protected sites were identified, two corresponding to GATA-1 consensus binding sites and the third to a long GC-rich region of sequences that are recognized by members of the Kruppel family of transcription factors as well as CACCC-related proteins.

GATA-1 Binds Both beta -Spectrin Gene Promoter Sites in Vitro-- To determine if nuclear proteins could bind these GATA-1 sites in vitro, double-stranded oligonucleotides containing the corresponding beta -spectrin promoter GATA-1 sequences (site 1, E + F; site 2, G + H; Table I) or control sequences (I + J; Table I) (47) were prepared and used in gel shift analyses. When oligonucleotides containing either of the footprinted GATA-1 sequences were used in gel shift analyses, a single retarded species was observed in MEL (erythroid) extracts (Fig. 6A), but not in HeLa extracts (not shown). These species migrated at the same location as a control oligonucleotide containing a GATA-1 consensus sequence. This species was effectively competed both by an excess of unlabeled homologous oligonucleotide and by an excess of unlabeled control GATA-1 oligonucleotide. The inclusion of GATA-1 antisera abolished most or all of the DNA binding (Fig. 6B). These data indicate that GATA-1 binds in vitro to sites 1 and 2 of the beta -spectrin gene promoter.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligonucleotide primers


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   Gel mobility shift assays of footprinted sites 1 and 2 of the human beta -spectrin gene promoter. Gel mobility shift assays using beta -spectrin promoter oligonucleotides corresponding to footprinted sites 1 or 2, both of which contain GATA-1 consensus binding sequences, were performed using erythroid (MEL) nuclear extracts. A, the radiolabeled, double-stranded oligonucleotide used in lanes 1-6 corresponds to site 1; the radiolabeled, double-stranded oligonucleotide used in lanes 7-12 corresponds to site 2; and the radiolabeled, double-stranded oligonucleotide used in lanes 13 and 14 is a GATA-1 control. Increasing amounts of unlabeled, double-stranded oligonucleotide, self (lanes 3 and 4 and lanes 9 and 10) or control (lanes 5 and 6 and lanes 9 and 10), were added to the reactions as competitor. No complexes were obtained using HeLa extracts (not shown). B, gel mobility shift assays using beta -spectrin promoter oligonucleotides corresponding to footprinted site 1 or 2, both of which contain GATA-1 consensus binding sequences, and a control GATA-1 oligonucleotide, were performed using erythroid (MEL) extracts. A GATA-1 antibody was added to the reaction mixtures where indicated.

CACCC-box Binding Proteins Bind to the beta -Spectrin Gene Promoter GC-rich Site in Vitro-- Site 3 identified by DNase I footprinting contains an extended GC-rich sequence, 5'-CCGCCTCCCCGCCCCCGCCG-3', a consensus binding site for CACCC-box-binding proteins. Although CACCC-box-binding proteins bind both CACCC and CGCCC sequences, they show distinct binding preferences (39, 48-50). To determine if the nuclear protein Sp1, BKLF, or EKLF binds this extended GC-rich sequence in vitro, double-stranded oligonucleotides containing the corresponding beta -spectrin promoter site 3 sequences (I + J; Table I) or control sequences (Sp1 M + N (48, 51); CACCC O + P (40); Table I) were prepared and used in gel shift analyses. When double-stranded oligonucleotides containing the site 3 sequences were used in gel shift analyses with MEL extracts, one larger, slower migrating species and two smaller, faster migrating species were detected. These species migrated at the same location as those obtained using control oligonucleotides containing either CACCC (Fig. 7A) or Sp1 (not shown) consensus sequences. All three species were effectively competed by an excess of unlabeled homologous oligonucleotide and an excess of unlabeled CACCC or Sp1 control oligonucleotides. The inclusion of Sp1 antisera supershifted the larger, slower migrating species in the gel (Fig. 7B).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7.   Gel mobility shift assays of footprinted site 3 of the human beta -spectrin gene promoter. A, gel mobility shift assays using beta -spectrin promoter oligonucleotides corresponding to footprinted site 3, which contains Sp1/CACCC consensus binding sequences, and MEL (erythroid) nuclear extracts. The radiolabeled, double-stranded oligonucleotide used in lanes 1-6 corresponds to site 3, and the radiolabeled, double-stranded oligonucleotide used in lanes 7-12 is a CACCC control. Increasing amounts of unlabeled, double-stranded oligonucleotide, site 3 (lanes 3 and 4 and lanes 11 and 12), CACCC control (lanes 5 and 9), or Sp1 control (lanes 6 and 10) were added to the reactions as compet itor. B, gel mobility shift assays using a beta -spectrin promoter oligonucleotide corresponding to footprinted site 3 and a control Sp1 oligonucleotide, were performed using erythroid (MEL) extracts. An Sp1 antibody was added to the reaction mixtures where indicated.

To determine if the CACCC-box-binding transcription factors BKLF or EKLF could bind the beta -spectrin gene promoter GC-rich site in vitro, gel shifts using nuclear extracts prepared from COS cells transfected with expression plasmids containing either BKLF or EKLF cDNAs and either the beta -spectrin gene promoter site 3 oligonucleotide or a control beta -globin CACCC oligonucleotide (Q + R) (52) were performed. A major complex was identified in BKLF-transfected cells (Fig. 8A). This complex migrated at the same location as the control beta -globin CACCC control oligonucleotide. The complexes obtained with both the beta -spectrin and beta -globin oligonucleotides were supershifted with an anti-BKLF antibody. When extracts from EKLF-transfected cells were used in similar experiments, a major complex was identified using the beta -globin CACCC consensus sequence oligonucleotide, and a very minor complex was identified using the beta -spectrin site 3 oligonucleotide (Fig. 8B). Both the beta -globin and beta -spectrin complexes migrated at the same location. Although the complexes were not completely competed away, the complexes obtained with both the beta -spectrin and beta -globin oligonucleotides were supershifted with an anti-EKLF antibody. Together, these data indicate that various CACCC-box-binding proteins bind to the beta -spectrin gene promoter in vitro.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8.   Gel mobility shift assays of footprinted site 3 of the human beta -spectrin gene promoter and antibodies to BKLF and EKLF. A, gel mobility shift assays using a beta -spectrin promoter oligonucleotide corresponding to footprinted site 3, which contains Sp1/CACCC consensus binding sequences and nuclear extracts from BKLF-transfected COS cells. A BKLF antibody was added to the reaction mixtures where indicated. B, gel mobility shift assays using beta -spectrin promoter oligonucleotides corresponding to footprinted site 3 and nuclear extracts from EKLF-transfected COS cells. An EKLF antibody was added to the reaction mixtures where indicated. When nuclear extracts from untransfected COS cells were used in gel shift analyses, complexes migrating at the same location as those obtained using the beta -globin CACCC control oligonucleotide were not seen (not shown).

GATA-1 and CACCC-related Proteins Are Both Major Activators of the Human Erythroid beta -Spectrin Gene Promoter-- To assess the relative importance of these transcription factor binding sites in promoter function, mutations were introduced into each of the three sites protected in DNase I footprinting experiments. Mutation of the site 1 GATA-1 consensus sequence (GATA to GTTA) reduced promoter activity by half (Fig. 4). Mutating the site 2 GATA-1 consensus sequence in a similar manner (GATA to GTTA) reduced promoter activity to very low levels, indicating that this site is of major importance in the beta -spectrin gene promoter. Mutation of the site 3 CACCC-binding consensus sequence (CCCGCCTCCCCGCCCCCGCC to AAAGGAAAGGAAAGGAAAAG) reduced promoter activity nearly to background, indicating that this site is of major importance in the beta -spectrin gene promoter (Fig. 4).

GATA-1, but Not BKLF or EKLF, Transactivates the beta -Spectrin Gene Erythroid Promoter in Heterologous Cells-- None of the beta -spectrin promoter fragments directed expression of a reporter gene in HeLa cells, but the addition of GATA-1 by co-transfection conferred promoter activity to a beta -spectrin promoter fragment. Co-transfection of 1 µg of a beta -spectrin erythroid promoter fragment, p504, and increasing amounts of a GATA-1 cDNA expression plasmid resulted in increasing promoter activity with increasing amounts of GATA-1 plasmid (Fig. 9). The ability of GATA-1 to transcriptionally activate the beta -spectrin erythroid promoter in these cells, which do not contain this erythroid-specific factor, correlates with the inability of the beta -spectrin erythroid promoter to function in these cells. Co-transfection of 1 µg of a beta -spectrin erythroid promoter fragment, p504, and increasing amounts of a BKLF cDNA expression plasmid did not result in any change in promoter activity (Fig. 9). Co-transfection of 1 µg of the beta -spectrin erythroid promoter fragment, p504, and increasing amounts of an EKLF cDNA expression plasmid resulted in essentially no change in promoter activity with increasing amounts of EKLF plasmid (Fig. 9).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9.   Forced expression of the human beta -spectrin gene promoter in HeLa cells. Top, co-transfection of a beta -spectrin gene promoter/reporter plasmid with increasing amounts of a GATA-1 cDNA expression plasmid. Middle, co-transfection of a beta -spectrin gene promoter/reporter plasmid with increasing amounts of a BKLF cDNA expression plasmid. Bottom, co-transfection of a beta -spectrin gene promoter/reporter plasmid with increasing amounts of an EKLF cDNA expression plasmid.

Transgenic Mice Express the beta -Spectrin/Agamma -Globin Transgene in Erythroid Cells at All Stages of Development-- The role of the beta -spectrin promoter fragment, p504, in directing expression of a reporter gene in vivo was examined. Three transgenic lines and two day 13.5 fetal livers containing the beta -spectrin/Agamma -globin transgene were analyzed (Fig. 10A). RNase protection demonstrated that two of three beta -spectrin/Agamma -globin transgenic lines and one of two fetal livers expressed the beta -spectrin/Agamma -globin transgene in erythroid cells (Table II). No beta -spectrin/Agamma -globin RNA was detected in erythroid cells of the third transgenic line or the other fetal liver. The number of transgenes in each line was estimated by Southern blot analyses to be between three and six copies per expressing animal.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 10.   In vivo analysis of human gamma -globin reporter gene expression in erythroid and nonerythroid tissues. A, left, diagram of the beta -spectrin promoter/Agamma -globin gene fragment used to generate transgenic mice. Right, diagram of the beta -spectrin promoter/Agamma -globin gene and the riboprobe used in transgene expression in transgenic mice. Predicted fragment sizes obtained in RNase protection assays are shown. B, RNase protection assay of Agamma -globin mRNA from transgenic mice expressing the beta -spectrin gene promoter/Agamma -globin transgene. C, RNase protection assay of murine alpha -globin mRNA from the same samples used to detect Agamma -globin expression above. The RNA samples were from transgenic line 553A. Mice were perfused with normal saline prior to sacrifice.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Developmental pattern of gamma -globin reporter gene expression in erythroid tissues of beta -spectrin/Agamma -globin transgenic mice

After correction for copy number, the level of beta -spectrin/Agamma -globin mRNA was compared with the mRNA of the four murine alpha -globin genes. In all transgenic lines expressing the beta -spectrin/Agamma -globin transgene, the Agamma -globin reporter gene was expressed in day 10.5 yolk sac-derived peripheral blood cells, in day 13.5 fetal liver, and in adult reticulocytes, i.e. at all stages of erythroid development, at levels ranging from 12 to 37% of the levels of murine alpha -globin expression in the same cells. Cellulose acetate electrophoresis was performed to confirm the presence of gamma -globin chains in day 13.5 fetal liver and adult circulating erythrocytes. The fetal and adult erythrocytes of mice expressing the beta -spectrin/Agamma -globin transgene contained endogenous mouse hemoglobins as well as an additional hemoglobin band composed of two mouse alpha -globin chains and two human gamma -globin chains (43). These results were confirmed by acid/urea gel electrophoresis and high pressure liquid chromatography analysis (not shown).

The beta -spectrin/Agamma -Globin Transgene Directs Lower Levels of Expression in Nonerythroid Tissues-- In the two transgenic lines expressing the beta -spectrin/Agamma -globin transgene in erythroid tissues, 553A and 553C, the level of transgene expression was examined in nonerythroid tissues using RNase protection. The level of beta -spectrin/Agamma -globin mRNA (Fig. 10B) was compared with the mRNA of the four murine alpha -globin genes (Fig. 10C). beta -Spectrin/Agamma -globin gene expression/murine alpha -globin gene expression in individual tissues was compared with beta -spectrin/Agamma -globin gene expression/murine alpha -globin gene expression in bone marrow, with the percentage of expression in marrow equal to 100% (Fig. 11). There was essentially no expression in thymus, liver, kidney, and lung. Expression in heart and skeletal muscle ranged from 10 to 44%, with decreased expression in transgenic animals (with one exception) who were perfused with saline immediately prior to sacrificing. Expression levels in brain were variable, with minimal expression in line 553A and 10-40% expression in line 553C.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 11.   beta -Spectrin/Agamma -globin gene expression/murine alpha -globin gene expression in nonerythroid tissues compared with beta -spectrin/Agamma -globin gene expression/murine alpha -globin gene expression in bone marrow. beta -Spectrin/Agamma -globin transgene expression/endogenous murine alpha -globin gene expression in nonerythroid tissues was compared with expression of the transgene in bone marrow. The percentage of expression in bone marrow was calculated equal to 100%.


    DISCUSSION

Our studies show that a promoter of the human beta -spectrin gene directs high levels of expression in erythroid cells at all stages of erythroid development. Although the genes encoding erythrocyte membrane proteins have been cloned for a number of years, there are very little data about the regulatory elements that control their expression. Until now, there have been no in vivo studies of elements involved in the regulation of these genes. In vitro studies of the promoters of glycophorin B and C, ankyrin-1, and band 3 (53-57), other red blood cell membrane proteins, have been performed. These studies demonstrate that, like the beta -spectrin erythroid promoter, a combination of GATA-1 and CACCC-binding proteins appears to be essential for high level expression of these genes. Thus, the promoters of erythrocyte membrane protein genes share similarities to other erythroid gene promoters (49, 58-60).

The human beta -spectrin erythroid promoter appears to be quite "compact" in that a relatively short fragment of DNA directs high level expression in erythroid cells. A number of erythroid gene promoters require distant regulatory elements (enhancers) to confer high levels of expression (49). Additional regulatory elements not present in the DNA promoter fragment tested in vivo appear to be required for erythroid expression of the beta -spectrin promoter, since only three of five mouse lines expressed the transgene.

Consensus binding sites for GATA-1 and CACCC-binding proteins are present in very close proximity in the beta -spectrin promoter, mimicking other erythroid gene promoters (e.g. 61-66). This combination may lead to cooperation between GATA-1 and CACCC-binding proteins to enhance transcription (63, 66, 67). Sp1 and EKLF have been both been shown to physically interact with GATA-1 in the regulatory elements of certain erythroid genes to synergistically activate transcription in transfected cells (68).

CACCC-box binding proteins and members of the Kruppel family of transcription factors both bind CACCC and CGCCC sequences, although they show distinct binding preferences (Fig. 12) (39, 48-50). Although Sp1, BKLF, and to a much lesser degree EKLF were found to bind to the GC-rich, CACCC-binding region of the beta -spectrin promoter in vitro, it is unknown what transcription factors bind this site in vivo. The interactions of Sp1 and/or BKLF with a broad spectrum of erythroid gene promoters make them likely candidates for binding to this site (39). EKLF has been shown to bind to the CACCC-box consensus sequences of other non-globin, erythroid gene promoters, such as the ALAS-E gene (69), and to increase expression directed by the glycophorin B promoter transiently transfected into GATA-1-expressing S2 cells, but these studies have been carried out in vitro. If EKLF does indeed bind the beta -spectrin gene promoter, it will join the beta -globin gene as a downstream target of EKLF. Additional studies, such as analysis of the ability of EKLF to act as a transcriptional activator of the beta -spectrin gene promoter in Drosophila S2 cells that lack endogenous Sp1 and analysis of beta -spectrin content in hematopoietic cells from EKLF-/- erythroid cells will shed additional light on this question.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 12.   Comparison of the nucleotide sequences of CGCC and CACCC binding. Sites in the human beta -spectrin gene erythroid promoter, in other erythroid gene regulatory elements, and in beta -thalassemia are shown.

It is tempting to speculate what type of additional regulatory elements regulate the expression of beta  spectrin in nonerythroid cells. In dystrophin, also a member of the spectrin superfamily of proteins, five autonomous promoters direct the transcription of alternate transcripts in a cell-specific and developmentally controlled manner (70). Because alternate transcripts of beta -spectrin are present in nonerythroid tissues, it is not unreasonable to postulate that these tissue-specific isoforms are controlled by alternate promoters. Studies of other erythrocyte membrane protein genes have shown that alternate promoters direct the expression of tissue-specific transcripts of ankyrin-1 and band 3 (41, 54, 56, 71-73).

    ACKNOWLEDGEMENTS

We thank Drs. M. Crossley, S. Orkin, and J. Bieker for sharing reagents.

    FOOTNOTES

* This work was supported in part by grants from the National Institutes of Health, the March of Dimes Birth Defects Foundation, and the American Heart Association, Connecticut Affiliate.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF063907.

§ To whom correspondence should be addressed: Dept. of Pediatrics, Yale University School of Medicine, 333 Cedar St., P.O. Box 208064, New Haven, CT 06520-8064. Tel.: 203-688-2896; Fax: 203-785-6974; E-mail: Patrick.Gallagher{at}Yale.edu.

    ABBREVIATIONS

The abbreviations used are: bp, base pair(s); RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; EKLF, erythroid Kruppel-like factor; BKLF, basic Kruppel-like factor.

    REFERENCES
Top
Abstract
Introduction
References
  1. Speicher, D. W., and Marchesi, V. T. (1984) Nature 311, 177-180[CrossRef][Medline] [Order article via Infotrieve]
  2. Yan, Y., Winograd, E., Viel, A., Cronin, T., Harrison, S. C., and Branton, D. (1993) Science 262, 2027-2030[Abstract/Free Full Text]
  3. Morrow, J. S., Rimm, D. L., Kennedy, S. P., Cianci, C. D., Sinard, J. H., and Weed, S. A. (1997) in Handbook of Physiology (Hoffman, J., and Jamieson, J., eds), pp. 485-540, Oxford University Press, London
  4. Winkelmann, J., and Forget, B. (1993) Blood 81, 3173-3185[Abstract/Free Full Text]
  5. Benz, E. J., Jr. (1994) in The Molecular Basis of Blood Diseases (Stamatoyannopoulos, G., Nienhuis, A. W., Majerus, P. W., and Varmus, H., eds), pp. 257-262, W.B. Saunders Co., Philadelphia
  6. Lux, S. E., and Palek, J. (1995) in Blood: Principles and Practice of Hematology (Handin, R. I., Lux, S. E., and Stossel, T. P., eds), pp. 1701-1816, J.B. Lippincott, Philadelphia
  7. Winkelmann, J. C., Costa, F. F., Linzie, B. L., and Forget, B. G. (1990) J. Biol. Chem. 265, 20449-20454[Abstract/Free Full Text]
  8. Amin, K. M., Scarpa, A. L., Winkelmann, J. C., Curtis, P. J., and Forget, B. G. (1993) Genomics 18, 118-125[CrossRef][Medline] [Order article via Infotrieve]
  9. Fukushima, Y., Byers, M. G., Watkins, P. C., Winkelmann, J. C., Forget, B. G., and Shows, T. B. (1990) Cytogenet. Cell Genet. 53, 232-233[Medline] [Order article via Infotrieve]
  10. Bewick, G. S., Young, C., and Slater, C. R. (1996) J. Neurocytol. 25, 367-379[Medline] [Order article via Infotrieve]
  11. Chu, Z. L., Wickrema, A., Krantz, S. B., and Winkelmann, J. C. (1994) Blood 84, 1992-1999[Abstract/Free Full Text]
  12. Ehmer, S., Herrmann, R., Bittner, R., and Voit, T. (1997) Acta Neuropathol. 94, 240-246[CrossRef][Medline] [Order article via Infotrieve]
  13. Goodman, S. R., Zimmer, W. E., Clark, M. B., Zagon, I. S., Barker, J. E., and Bloom, M. L. (1995) Brain Res. Bull. 36, 593-606[CrossRef][Medline] [Order article via Infotrieve]
  14. Lambert, S., and Bennett, V. (1993) J. Neurosci. 13, 3725-3735[Abstract]
  15. Malchiodi-Albedi, F., Ceccarini, M., Winkelmann, J. C., Morrow, J. S., and Petrucci, T. C. (1993) J. Cell Sci. 106, 67-78[Abstract]
  16. Mora, M., Di Blasi, C., Barresi, R., Morandi, L., Brambati, B., Jarre, L., and Cornelio, F. (1996) Brain Res. Dev. Brain Res. 91, 70-82[CrossRef][Medline] [Order article via Infotrieve]
  17. Porter, G. A., Dmytrenko, G. M., Winkelmann, J. C., and Bloch, R. J. (1992) J. Cell Biol. 117, 997-1005[Abstract/Free Full Text]
  18. Porter, G., Scher, M., Resneck, W., Porter, N., Fowler, V., and Bloch, R. (1997) Cell Motil. Cytoskeleton 37, 7-19[CrossRef][Medline] [Order article via Infotrieve]
  19. Prchal, J. T., Papayannopoulou, T., and Yoon, S. H. (1990) J. Cell. Physiol. 144, 287-294[CrossRef][Medline] [Order article via Infotrieve]
  20. Vybiral, T., Winkelmann, J. C., Roberts, R., Joe, E., Casey, D. L., Williams, J. K., and Epstein, H. F. (1992) Cell Motil. Cytoskeleton 21, 293-304[CrossRef][Medline] [Order article via Infotrieve]
  21. Winkelmann, J. C., Chang, J. G., Tse, W. T., Scarpa, A. L., Marchesi, V. T., and Forget, B. G. (1990) J. Biol. Chem. 265, 11827-11832[Abstract/Free Full Text]
  22. Zimmer, W. E., Ma, Y., Zagon, I. S., and Goodman, S. R. (1992) Brain Res. 594, 75-83[CrossRef][Medline] [Order article via Infotrieve]
  23. Bloch, R. J., and Morrow, J. S. (1989) J. Cell Biol. 108, 481-493[Abstract/Free Full Text]
  24. Daniels, M. P. (1990) J. Cell Sci. 97, 615-626[Abstract/Free Full Text]
  25. Pumplin, D. W. (1995) J. Cell Sci. 108, 3145-3154[Abstract]
  26. Wood, S. J., and Slater, C. R. (1998) J. Cell Biol. 140, 675-684[Abstract/Free Full Text]
  27. Beck, K. A., and Nelson, W. J. (1996) Am. J. Physiol. 270, C1263-C1270[Abstract/Free Full Text]
  28. Viel, A., and Branton, D. (1996) Curr. Opin. Cell Biol. 8, 49-55[CrossRef][Medline] [Order article via Infotrieve]
  29. Chang, J. G., Scarpa, A., Eddy, R. L., Byers, M. G., Harris, A. S., Morrow, J. S., Watkins, P., Shows, T. B., and Forget, B. G. (1993) Genomics 17, 287-293[CrossRef][Medline] [Order article via Infotrieve]
  30. Hu, R. J., Watanabe, M., and Bennett, V. (1992) J. Biol. Chem. 267, 18715-18722[Abstract/Free Full Text]
  31. Prchal, J. T., Morley, B. J., Yoon, S. H., Coetzer, T. L., Palek, J., Conboy, J. G., and Kan, Y. W. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7468-7472[Abstract/Free Full Text]
  32. Winkelmann, J. C., Leto, T. L., Watkins, P. C., Eddy, R., Shows, T. B., Linnenbach, A. J., Sahr, K. E., Kathuria, N., Marchesi, V. T., and Forget, B. G. (1988) Blood 72, 328-334[Abstract/Free Full Text]
  33. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
  34. Edwards, J. B., Delort, J., and Mallet, J. (1991) Nucleic Acids Res. 19, 5227-5232[Abstract/Free Full Text]
  35. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8998-9002[Abstract/Free Full Text]
  36. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467[Abstract/Free Full Text]
  37. Andrews, N. C., and Faller, D. V. (1991) Nucleic Acids Res. 19, 2499[Free Full Text]
  38. Mason, P., Enver, T., Wilkinson, D., and Williams, J. (1993) in Gene Transcription: A Practical Approach (Hames, B., and Higgins, S., eds), pp. 47-54, IRL Press, Oxford
  39. Crossley, M., Whitelaw, E., Perkins, A., Williams, G., Fujiwara, Y., and Orkin, S. H. (1996) Mol. Cell. Biol. 16, 1695-1705[Abstract]
  40. Miller, I. J., and Bieker, J. J. (1993) Mol. Cell. Biol. 13, 2776-2786[Abstract/Free Full Text]
  41. Gallagher, P. G., and Forget, B. G. (1998) J. Biol. Chem. 273, 1339-1348[Abstract/Free Full Text]
  42. Hogan, B., Constantini, F., and Lacey, E. (1986) Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  43. Sabatino, D. E., Cline, A. P., Gallagher, P. G., Garrett, L. J., Stamatoyannopoulos, G., Forget, B. G., and Bodine, D. M. (1998) Mol. Cell. Biol. 18, 6634-6640[Abstract/Free Full Text]
  44. Genetics Computer Group. (1994) The GCG Sequence Analysis Software Package, version 8, Genetics Computer Group, Inc., Madison, WI
  45. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410[CrossRef][Medline] [Order article via Infotrieve]
  46. Javahery, R., Khachi, A., Lo, K., Zenzie-Gregory, B., and Smale, S. T. (1994) Mol. Cell. Biol. 14, 116-127[Abstract/Free Full Text]
  47. Mignotte, V., Wall, L., deBoer, E., Grosveld, F., and Romeo, P. H. (1989) Nucleic Acids Res. 17, 37-54[Abstract/Free Full Text]
  48. Hartzog, G. A., and Myers, R. M. (1993) Mol. Cell. Biol. 13, 44-56[Abstract/Free Full Text]
  49. Orkin, S. H. (1995) Curr. Opin. Cell. Biol. 7, 870-877[CrossRef][Medline] [Order article via Infotrieve]
  50. Treisman, R., Orkin, S. H., and Maniatis, T. (1983) Nature 302, 591-596[CrossRef][Medline] [Order article via Infotrieve]
  51. Kadonaga, J., Jones, K., and Tjian, R. (1986) Trends Biochem. Sci. 11, 20-23
  52. Crossley, M., Tsang, A. P., Bieker, J. J., and Orkin, S. H. (1994) J. Biol. Chem. 269, 15440-15444[Abstract/Free Full Text]
  53. Colin, Y., Joulin, V., Le Van Kim, C., Romeo, P. H., and Cartron, J. P. (1990) J. Biol. Chem. 265, 16729-16732[Abstract/Free Full Text]
  54. Gallagher, P., Romana, M., Tse, W., Eber, S., Lux, S., and Forget, B. (1994) Blood 84, 361 (abstr.)
  55. Rahuel, C., Vinit, M. A., Lemarchandel, V., Cartron, J. P., and Romeo, P. H. (1992) EMBO. J. 11, 4095-4102[Medline] [Order article via Infotrieve]
  56. Sahr, K. E., Daniels, B. P., and Hanspal, M. (1996) Blood 88, 4500-4509[Abstract/Free Full Text]
  57. Vignal, A., London, J., Rahuel, C., and Cartron, J. P. (1990) Gene (Amst.) 95, 289-293[CrossRef][Medline] [Order article via Infotrieve]
  58. Orkin, S. H. (1995) Eur. J. Biochem. 231, 271-281[Medline] [Order article via Infotrieve]
  59. Orkin, S. H. (1995) J. Biol. Chem. 270, 4955-4958[Free Full Text]
  60. Weiss, M. J., and Orkin, S. H. (1995) Exp. Hematol. 23, 99-107[Medline] [Order article via Infotrieve]
  61. Eleouet, J. F., and Romeo, P. H. (1993) Eur. J. Biochem. 212, 763-770[Medline] [Order article via Infotrieve]
  62. Frampton, J., Walker, M., Plumb, M., and Harrison, P. R. (1990) Mol. Cell. Biol. 10, 3838-3842[Abstract/Free Full Text]
  63. Gregory, R. C., Taxman, D. J., Seshasayee, D., Kensinger, M. H., Bieker, J. J., and Wojchowski, D. M. (1996) Blood 87, 1793-1801[Abstract/Free Full Text]
  64. Max-Audit, I., Eleouet, J. F., and Romeo, P. H. (1993) J. Biol. Chem. 268, 5431-5437[Abstract/Free Full Text]
  65. Tsai, S. F., Strauss, E., and Orkin, S. H. (1991) Genes Dev. 5, 919-931[Abstract/Free Full Text]
  66. Walters, M., and Martin, D. I. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10444-10448[Abstract/Free Full Text]
  67. Fischer, K. D., Haese, A., and Nowock, J. (1993) J. Biol. Chem. 268, 23915-23923[Abstract/Free Full Text]
  68. Merika, M., and Orkin, S. H. (1995) Mol. Cell. Biol. 15, 2437-2447[Abstract]
  69. Surinya, K. H., Cox, T. C., and May, B. K. (1997) J. Biol. Chem. 272, 26585-26594[Abstract/Free Full Text]
  70. Ahn, A. H., and Kunkel, L. M. (1993) Nat. Genet. 3, 283-291[CrossRef][Medline] [Order article via Infotrieve]
  71. Cox, K. H., Adair-Kirk, T. L., and Cox, J. V. (1995) J. Biol. Chem. 270, 19752-19760[Abstract/Free Full Text]
  72. Kopito, R. R., Andersson, M. A., and Lodish, H. F. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7149-7153[Abstract/Free Full Text]
  73. Kudrycki, K. E., and Shull, G. E. (1993) Am. J. Physiol. 264, F540-F547[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
P. G. Gallagher, D. G. Nilson, L. A. Steiner, Y. D. Maksimova, J. Y. Lin, and D. M. Bodine
An insulator with barrier-element activity promotes {alpha}-spectrin gene expression in erythroid cells
Blood, February 12, 2009; 113(7): 1547 - 1554.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. G. Gallagher, R. I. Liem, E. Wong, M. J. Weiss, and D. M. Bodine
GATA-1 and Oct-1 Are Required for Expression of the Human {alpha}-Hemoglobin-stabilizing Protein Gene
J. Biol. Chem., November 25, 2005; 280(47): 39016 - 39023.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Y. Wong, J. Lin, B. G. Forget, D. M. Bodine, and P. G. Gallagher
Sequences Downstream of the Erythroid Promoter Are Required for High Level Expression of the Human {alpha}-Spectrin Gene
J. Biol. Chem., December 31, 2004; 279(53): 55024 - 55033.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhou, Q. Zhao, R. Sutton, H. Cumming, X. Wang, L. Cerruti, M. Hall, R. Wu, J. M. Cunningham, and S. M. Jane
The Role of p22 NF-E4 in Human Globin Gene Switching
J. Biol. Chem., June 18, 2004; 279(25): 26227 - 26232.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. E. Richard, M. Weinreich, K.-H. Chang, J. Ieremia, M. M. Stevenson, and C. A. Blau
Modulating erythrocyte chimerism in a mouse model of pyruvate kinase deficiency
Blood, June 15, 2004; 103(12): 4432 - 4439.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. F. Frazar, J. L. Weisbein, S. M. Anderson, A. P. Cline, L. J. Garrett, G. Felsenfeld, P. G. Gallagher, and D. M. Bodine
Variegated Expression from the Murine Band 3 (AE1) Promoter in Transgenic Mice Is Associated with mRNA Transcript Initiation at Upstream Start Sites and Can Be Suppressed by the Addition of the Chicken {beta}-Globin 5' HS4 Insulator Element
Mol. Cell. Biol., July 15, 2003; 23(14): 4753 - 4763.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. A. Persons, P. W. Hargrove, E. R. Allay, H. Hanawa, and A. W. Nienhuis
The degree of phenotypic correction of murine beta -thalassemia intermedia following lentiviral-mediated transfer of a human gamma -globin gene is influenced by chromosomal position effects and vector copy number
Blood, March 15, 2003; 101(6): 2175 - 2183.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Boulanger, D. E. Sabatino, E. Y. Wong, A. P. Cline, L. J. Garrett, M. Garbarz, D. Dhermy, D. M. Bodine, and P. G. Gallagher
Erythroid Expression of the Human alpha -Spectrin Gene Promoter Is Mediated by GATA-1- and NF-E2-binding Proteins
J. Biol. Chem., October 25, 2002; 277(44): 41563 - 41570.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. E. Lyons, N. D. Lawson, L. Lei, P. E. Bennett, B. M. Weinstein, and P. P. Liu
A nonsense mutation in zebrafish gata1 causes the bloodless phenotype in vlad tepes
PNAS, April 16, 2002; 99(8): 5454 - 5459.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. G. Gallagher, D. E. Sabatino, D. S. Basseres, D. M. Nilson, C. Wong, A. P. Cline, L. J. Garrett, and D. M. Bodine
Erythrocyte Ankyrin Promoter Mutations Associated with Recessive Hereditary Spherocytosis Cause Significant Abnormalities in Ankyrin Expression
J. Biol. Chem., November 2, 2001; 276(45): 41683 - 41689.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Moreau-Gaudry, P. Xia, G. Jiang, N. P. Perelman, G. Bauer, J. Ellis, K. H. Surinya, F. Mavilio, C.-K. Shen, and P. Malik
High-level erythroid-specific gene expression in primary human and murine hematopoietic cells with self-inactivating lentiviral vectors
Blood, November 1, 2001; 98(9): 2664 - 2672.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. G. Gallagher, M. Romana, W. T. Tse, S. E. Lux, and B. G. Forget
The human ankyrin-1 gene is selectively transcribed in erythroid cell lines despite the presence of a housekeeping-like promoter
Blood, August 1, 2000; 96(3): 1136 - 1143.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. G. Sargent, C. C. DuBois, A. M. Buller, and J. A. Lloyd
The Roles of 5'-HS2, 5'-HS3, and the gamma -Globin TATA, CACCC, and Stage Selector Elements in Suppression of beta -Globin Expression in Early Development
J. Biol. Chem., April 16, 1999; 274(16): 11229 - 11236.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. E. Sabatino, C. Wong, A. P. Cline, L. Pyle, L. J. Garrett, P. G. Gallagher, and D. M. Bodine
A Minimal Ankyrin Promoter Linked to a Human gamma -Globin Gene Demonstrates Erythroid Specific Copy Number Dependent Expression with Minimal Position or Enhancer Dependence in Transgenic Mice
J. Biol. Chem., September 8, 2000; 275(37): 28549 - 28554.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gallagher, P. G.
Right arrow Articles by Forget, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gallagher, P. G.
Right arrow Articles by Forget, B. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement