|
J Biol Chem, Vol. 274, Issue 10, 6315-6323, March 5, 1999
The Drosophila Modifier of Variegation
modulo Gene Product Binds Specific RNA Sequences at the
Nucleolus and Interacts with DNA and Chromatin in a
Phosphorylation-dependent Manner*
Laurent
Perrin §,
Pascale
Romby¶,
Patrick
Laurenti ,
Hélène
Bérenger ,
Sacha
Kallenbach ,
Henry-Marc
Bourbon**, and
Jacques
Pradel 
From the Laboratoire de Génétique et de
Biologie du Développement, Institut de Biologie du
Développement de Marseille, Parc Scientifique de Luminy, CNRS
Case 907, 13288 Marseille cedex 9, France, the ¶ Institut de
Biologie Moléculaire et Cellulaire UPR 9002 du CNRS, 15 rue
René Descartes, 67084 Strasbourg, France, and the ** Centre de
Biologie du Développement, 118, route de Narbonne,
31062 Toulouse, France
 |
ABSTRACT |
modulo belongs to the modifier of
Position Effect Variegation class of Drosophila genes,
suggesting a role for its product in regulating chromatin structure.
Genetics assigned a second function to the gene, in protein
synthesis capacity. Bifunctionality is consistent with protein
localization in two distinct subnuclear compartments, chromatin and
nucleolus, and with its organization in modules potentially involved in
DNA and RNA binding. In this study, we examine nucleic acid
interactions established by Modulo at nucleolus and chromatin and the
mechanism that controls the distribution and balances the function of
the protein in the two compartments. Structure/function analysis and
oligomer selection/amplification experiments indicate that, in
vitro, two basic terminal domains independently contact DNA
without sequence specificity, whereas a central RNA Recognition Motif
(RRM)-containing domain allows recognition of a novel
sequence-/motif-specific RNA class. Phosphorylation moreover is shown
to down-regulate DNA binding. Evidence is provided that in
vivo nucleolar Modulo is highly phosphorylated and belongs to a
ribonucleoprotein particle, whereas chromatin-associated protein is not
modified. A functional scheme is finally proposed in which modification
by phosphorylation modulates Mod subnuclear distribution and balances
its function at the nucleolus and chromatin.
 |
INTRODUCTION |
Many eukaryotic gene products elicit remarkable functional
diversity, even those involved in basic cellular processes. In particular, increasing evidence indicates that a number of ribosomal proteins fulfill a second function apart from ribosome and protein synthesis (1). Ribosome biogenesis takes place in the nucleolus where
rDNA is transcribed in a large precursor RNA which is then processed by
nucleotide modifications and specific cleavages into mature rRNAs that
eventually assemble with ribosomal proteins into ribosomal subunits (2,
3). This process requires a number of additional factors, such as small
nucleolar RNAs (snoRNA)1 and
non-ribosomal nucleolar proteins. Our knowledge of nucleolar proteins
is limited. However, a shared structural feature is the presence of
modules thought to represent functional domains (3). Such modules
include basic and acidic stretches, which possibly interact with
ribosomal proteins (4), and the so-called RNA Recognition Motif (RRM)
(5), which could bind either rRNAs at different stages of maturation or snoRNAs.
Ribosome biogenesis is tightly regulated in a close relationship with
cell growth or differentiation. It has long been shown that changing
cell culture conditions in a way that either improves the growth rate
or induces a differentiation program results in enhanced
versus decreased ribosome biosynthesis, respectively (6).
Moreover, mutations that disrupt gene functions necessary for ribosome
assembly often result in growth defects. In yeast or mammalian cell
lines, requirement for cell growth has been demonstrated for several
snoRNAs (7) and for all the components of RNase MRP, the best
characterized snoRNP (8). In Drosophila, several classes of
mutations cause growth alteration during development, such as the
Minute class (9), widely believed to affect ribosomal protein genes (10), and mini and bobbed
mutations, which alter rRNA production (11).
The Drosophila modulo gene (mod) has first been
characterized as a dominant suppressor of Position Effect Variegation
(PEV) (12). PEV occurs in experimental strains where genes placed close
to constitutive heterochromatin are randomly turned on or off, leading
to mosaic adult structures. The products of genes that modify PEV are
believed to change the local chromatin structure, which leads, when
they are mutated, to an increased (suppression of variegation) or a
decreased (enhancement of variegation) expression of neighboring genes
(13-16). The dominant PEV suppression phenotype of mod,
therefore, suggests that its product participates in the formation of
multimeric protein complexes that package the DNA, promoting chromatin
compaction and inactivation (12). We have recently reported that
mod, apart from its role in chromatin structuration, has a
second cellular function and is required in nucleolus activity and
protein synthesis capacity (17). First, cell clones deficient for
mod express phenotypic traits characteristic of
Minute mutations. Second, the protein, while actually
associated to condensed chromatin and heterochromatin sites, is also
abundantly found at the nucleolus. Consistent with this localization,
Mod displays a modular organization which is often found in
nonribosomal nucleolar proteins, including an acidic stretch, two basic
regions located at both ends of the molecule, and four reiterated RRMs
in the remaining core portion (18, 19).
The goal of the investigation reported here was to gain insight into
the nucleic acid interactions established by Mod at the nucleolus and
chromatin and to determine the molecular mechanism that controls the
distribution and balances the function of the protein in the two
sub-nuclear compartments. The data show that the two basic domains
independently contact DNA without sequence specificity, whereas RRMs
provides a sequence-specific RNA-binding activity. We also report that
nucleolar Mod is phosphorylated and associated to an RNA moiety,
whereas the chromatin-bound Mod appears to be unmodified. A functional
scheme is finally proposed in which modification by phosphorylation
modulates Mod subnuclear distribution and balances its function at the
nucleolus and chromatin.
 |
EXPERIMENTAL PROCEDURES |
Production of Mod Variant Proteins--
Primers used to generate
by polymerase chain reaction sequences encoding the Mod variants were:
1) ACGTGGATCCGCCCAAAAGAAAGCCGTCACCG; 2)
ACGTGGATCCGGCCGTATTTATGGTACTACGCAA; 3)
ACGTGGATCCGAAGTGCCGCAGTTCAGTGAAGA; 4)
ACGTGGATCCTCAGTTTGGCTCAATAAATATAGGGGC; and 5)
ACGTGGATCCTGAAGAAGCGCCTGTAGAGAAGCC. Primers pairs (1+2), (2+3),
(1+4), (3+4), and (4+5) were used to produce full-length Mod, the
protein variants truncated from one or the two basic domains located at
the N and C termini and RRMs, respectively. Glutathione
S-transferase (GST) fusion proteins were produced from
BamHI-digested polymerase chain reaction products cloned in
pGEX-2T (Amersham Pharmacia Biotech), purified according to Smith and
Johnson (20) and stored at 20 °C in NT2 buffer (20 mM
Tris-HCl, 5 mM NaCl, 1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride, 0.05% Nonidet P-40, 10%
glycerol, pH 7.5).
SDS-PAGE, Bidimensional Gel Analysis, and Western
Blotting--
For SDS-PAGE, proteins were fractionated on 7.5% gels
and electroblotted onto nitrocellulose. Bidimensional gel analysis was performed as described in (21). Nuclear proteins from embryos (0-18 h)
were treated (30 µg) in isoelectric focusing buffer (Biolyt, pH 3.0 and pH 10, from Bio-Rad). After SDS-PAGE in the second dimension and
electrotransfer, Mod was revealed with anti-Mod monoclonal antibody
(mAb) LA9 and anti-mouse alkaline phosphatase-conjugated secondary
antibody (Promega).
Native Gel Electrophoresis--
Schneider cells nuclei were
isolated according to Bellaiche et al. (22), resuspended in
30 µl/106 cells of cold RSB buffer (10 mM
Tris-HCl, 100 mM NaCl, 2.5 mM MgCl2, 1 mM dithiothreitol, 800 unit RNasin/ml, mixture of protease inhibitors, pH 7.4), sonicated on ice 2 × 5 s and
centrifuged at 4 °C first at 14,000 × g for 10 min
and then at 105 × g for 1 h. Samples (20 µl) of the resulting extract were preincubated for 20 min at
37 °C, run on native 3-20% polyacrylamide gels in Tris-glycine, pH
8.3, and transferred on nitrocellulose in carbonate buffer (10 mM NaHCO3/Na2CO3-NaOH,
pH 9.8). When indicated, samples were supplemented during the
preincubation at 37 °C with M12 or non-selected sequence (NS) RNAs
(at final concentration ranging from 50 ng/ml to 1 µg/ml) or with
RNase A (5 µg/ml).
Gel Mobility Shift Assays--
Interactions between
32P-end-labeled RNA (1 ng) and protein were performed for
15 min at 20 °C in 20 µl final of 20 mM KCl, 150 mM NaCl, 50 mM Tris-HCl, 0.05% Nonidet P-40,
0.5 mg/ml tRNA, 50 µg/ml bovine serum albumin, 1 mM
dithiothreitol, 0.8% VRC, RNasin (400 units/ml), 5% glycerol, pH 7.4. RNA protein complexes were revealed by autoradiography after 8% PAGE
(20 mA) at 4 °C under non-denaturing conditions (5% glycerol,
0.5 × Tris-borate-EDTA). Kd values were
established from quantification at the phosphoimager in serial
experiments with increasing protein concentration and constant probe amount.
Nuclear Fractionation and Immunoprecipitation
Procedure--
Isolation and fractionation of nuclei were carried out
as described previously (23). Briefly, nuclei, purified under
conditions that prevent loss of nuclear material, were successively
extracted in 0.15 and 0.3 M NaCl, and chromatin fragments
were solubilized by sonication in 0.45 M NaCl. Western
analysis of the recovered fractions was performed with a panel of
monoclonal antibodies directed against chromatin-bound proteins like
histone 2B, nucleosoluble components (S5 and P11 antigens), and Mod
(17, 23). The Mod protein was detected in 0.15 M and
0.30-0.45 M NaCl fractions only. For Mod
immunoprecipitation assays, sub-nuclear fractions were prepared from
either 1 g of dechorionated embryos or 108 KC cells,
diluted in lysis buffer (20 mM Tris-HCl, 0.15 M, 1 mM MgCl2, 1 mM
CaCl2, 0.5% Nonidet P-40, pH 7.5) supplied with a mixture
of protease inhibitors and preincubated for 1 h at 4 °C with
protein A-Sepharose beads (Amersham Pharmacia Biotech). Depleted
samples (1 ml) were then incubated overnight at 4 °C in the same
buffer with 10 mg of protein A-Sepharose saturated with an excess mAb
LA9 (1.6 mg of IgG purified from ascitic fluid for 100 mg of protein
A-Sepharose beads). Beads were washed three times in 10 mM
Tris-HCl, 0.5 M LiCl, 0.1% SDS, 2% Nonidet P-40, pH 7.4, then in 50 mM Tris-HCl, 50 mM NaCl, pH 8.0, and
collected by centrifugation, and the pellet was prepared for
SDS-PAGE.
KC Cells 32P Labeling--
KC cells were
exponentially grown in D22 medium, centrifuged, and incubated for
1 h at 25 °C in HN buffer (50 mM Hepes, 0.15 M NaCl, pH 7.6) at a density of 106 cells/ml.
After centrifugation, cells were incubated again, 3 h at 25 °C
and 108 cells/ml, in HN buffer supplemented with 5 mM MgCl2, 2 mM
L-glutamine, 1.8 mM glucose, 1 mCi/ml
[32P]orthophosphate, and, except when specified, with
10% fetal calf serum. Nuclei were purified and fractionated as
described previously (23) but in the presence of an excess of sodium
pyrophosphate (10 mM) and of phosphatase inhibitors (2 mM sodium vanadate, 0.1 M sodium fluorure, 20 mM EDTA, and 20 mM EGTA). Mod
immunoprecipitation was also performed in the presence of sodium
pyrophosphate and phosphatase inhibitors.
DNA Binding Assays--
Purified GST fusion proteins (5 µg)
were added to dsDNA-cellulose beads (Amersham Pharmacia Biotech; 0.5 ml
in NT2 buffer supplemented with 0.1 mg/ml bovine serum albumin) and
incubated at 20 °C for 2.5 h. After centrifugation and three
washes in NT2 (0.5 ml each), bound proteins were stepwise eluted from
the beads with 0.5 ml of NT2 containing increasing amounts of NaCl.
Fractions, including the three washes, were precipitated with 5%
trichloroacetic acid, washed with acetone, and analyzed by Western
blotting. For embryonic Mod, nuclei were isolated and fractionated as
described previously (24). DNA binding assays were performed using 85 and 250 µg of nucleosoluble and chromatin-bound proteins, respectively.
SELEX Procedure--
We used the synthetic RNA pool first
described in Tsai et al. (24). SELEX procedure was
essentially as described in Ghisolfi-Nieto et al. (25), with
the following modifications. Purified GST fusion proteins (5 µg) were
incubated with 20 µl of 50% glutathione-Sepharose beads (Amersham
Pharmacia Biotech) for 30 min at 4 °C in NT2 buffer (100 µl final
volume). After three washes in 0.5 ml of NT2 buffer, beads were
suspended in 50 µl of binding buffer (20 mM KCl, 150 mM NaCl, 50 mM Tris-HCl, 0.05% Nonidet P-40,
2.5% polyvinyl alcohol, 1 mM EGTA, 100 µg/ml tRNA, 125 µg/ml bovine serum albumin, 1 mM dithiothreitol, 0.8%,
pH 7.4) and incubated with the RNA sample (0.5 µg) for 5 min at
20 °C. For the first two rounds, RNA samples were preincubated for 5 min at 20 °C with Sepharose beads without protein prior to the
selection step. After the third round, 0.5 M urea was added
in the last wash. Polymerase chain reaction products were cloned and
sequenced after seven rounds of selection/amplification.
RNA Structure Probing and Footprint--
RNAs were transcribed
in vitro by T7 RNA polymerase, 5'-end-labeled with
[ -32P]ATP and T4 polynucleotide kinase, purified on a
10% polyacrylamide, 8 M urea gel, eluted overnight, and
precipitated with ethanol. Labeled RNA (50,000 cpm) was renatured in
reaction buffer at 37 °C for 15 min and complex formation carried
out at 20 °C for 15 min in the presence of increasing amounts of
Mod. Enzymatic cleavage reactions by RNase T1 (10 2 unit),
RNase V1 (0.2 unit), RNase T2 (0.2 unit), or nuclease NC (0.2 unit)
were performed at 20 °C for 5 min in 10 µl of 50 mM
Tris-HCl, 5 mM MgCl2, 150 mM NaCl,
and 1 µg of carrier tRNA, pH 7.5. Iron-EDTA reactions were done as in
(26). Reactions were stopped by phenol/chloroform extraction, and RNA
fragments recovered by ethanol precipitation were analyzed on 20%
polyacrylamide, 8 M urea gels. RNase T1 and alkaline
ladders served for cleavage site assignments.
Polytene Chromosome Squashes and RNase Treatment--
RNase A
salivary gland treatment was as in Richter et al. (27).
Briefly, salivary glands were preincubated for 2 min in phosphate-buffered saline, 0.1% Triton X-100, and then for 8 min in
either phosphate-buffered saline alone (as a control) or
phosphate-buffered saline supplemented with 0.5 mg/ml RNase A. Polytene
chromosome squashes and staining were performed as described in Clark
et al. (28). Mod was detected by the mAb LA9 at 20 µg/ml
and Maleless (Mle) by affinity purified rabbit anti-Mle antibodies
(gift of M. Kuroda) at a dilution of 1/500. Anti-mouse-fluorescein
isothiocyanate-conjugated and anti rabbit-tetramethylrhodamine
isothiocyanate conjugated secondary antibodies (Jackson) were used at a
dilution of 1/150. Slides were examined under an Axiophot microscope (Zeiss).
 |
RESULTS |
Mod DNA-binding Is Mediated by the N- and C-terminal
Domains--
Mod has been previously shown to bind DNA both
in vitro and in vivo (12, 18).
Cross-linking/immunoprecipitation experiments moreover demonstrated
interaction with several repetitive elements, consistent with the
protein association to heterochromatin and the dominant phenotype
of PEV suppression (17).
In order to identify the domains in Mod involved in DNA binding, GST
fusions of various truncated versions of the protein were tested on
dsDNA-cellulose chromatography. The results showed that the deletion of
the two positively charged N- and C-terminal domains is required to
abolish the ability of Mod to bind DNA in this assay, whereas truncated
mutant proteins of only one of these domains still exhibit some
activity (not shown). We further develop SELECT experiments (29) to ask
the question of sequence specificity in Mod DNA binding. No obvious
consensual motif was revealed by sequence comparison of 40 clones
obtained after five rounds of selection/amplification performed using
the full-length protein. Thus, the two terminal domains in Mod likely
interact with DNA without sequence specificity.
Mod Is a Phosphoprotein--
The Mod sequence contains a number of
putative phosphorylation sites (18). Metabolic incorporation of
32P in KC cells, followed by immunoprecipitation, Western
blotting and autoradiography, reveals that Mod gives rise to a single
band of 78 kDa (Fig. 1A,
lane 2), indicating that the protein actually is
phosphorylated in vivo. Consistently, treating Western blots with alkaline phosphatase progressively reduces and finally abolishes the 32P labeling (Fig. 1A, lanes 3 and 4). Next, by comparing the 32P incorporation
in starved and serum-stimulated cells, we noticed that serum addition
raised the specific incorporation in Mod by a factor of 16, whereas the
increase in crude cell extracts and purified nuclei was only 2.7- or
4.7-fold, respectively (Fig. 1B). As internal control to
these experiments, we compared the Western signals from serial
dilutions of cell extracts grown in the presence or absence of 10%
fetal calf serum to show that the serum has no significant effect on
Mod de novo synthesis (not shown). These data strongly
suggest that serum enhances Mod phosphorylation.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Phosphorylation of Mod in
vivo. A, 32P in vivo
labeling of Mod. Immunoprecipitates obtained with mAb LA9 from nuclear
preparations of 32P metabolically labeled KC cells were
fractionated by SDS-PAGE, blotted on nitrocellulose, and revealed by
autoradiography. Lane 1, crude nuclear extract; lanes
2, 3, and 4, immunoprecipitated fractions. Prior to
autoradiography, the nitrocellulose stripes corresponding to
lanes 3 and 4 were treated with alkaline
phosphatase for 5 and 30 min, respectively. B, serum effect
on Mod phosphorylation. Ratios between 32P incorporation in
KC cells grown in the presence and in the absence of 10% fetal calf
serum: total cell extract (a), purified nuclei
(b), and immunoprecipitated Mod (c). Values from
three distinct experiments were, in cpm for 5108 KC cells,
1.8109/6.7108 (2.7) for bar a,
7.1107/1.5107 (4.7) for bar b, and
3.2105/2.0104 (16) for bar c. Serum
clearly induces increased 32P incorporation in Mod.
C, bidimensional Western analysis. Nuclear proteins from
embryos (0-18 h) were first separated by isoelectric focusing and
secondly by SDS-PAGE. Corresponding Western blots were probed with mAb
LA9. Top panel, nuclear extract prepared in the presence of
phosphatase and protease inhibitors. Bottom panel, nuclear
extract digested for 2 h with alkaline phosphatase at 37 °C.
Dephosphorylating the sample resumes the series of native Mod isoforms
into a single migrating species.
|
|
To investigate for Mod phosphorylation in vivo, protein
isoelectric variants present in embryos were analyzed by dimensional PAGE followed by a Western blot analysis. Nuclear extracts were prepared either in the presence of a mixture of phosphatase inhibitors or digested with phosphatases. Mod from phosphatase-treated extracts runs as a single spot with an apparent pI of 7.2, indicating that the
multiple isoforms differing by negative charges (pI from 7.2 to 5.2)
observed from non-digested nuclei, correspond to stepwise phosphorylation events on several amino acid residues (Fig.
1C).
Mod Differential Phosphorylation at Chromatin and
Nucleolus--
We previously reported a procedure that combines
stepwise salt extraction with low and high speed centrifugations, to
isolate distinct subnuclear fractions from purified nuclei, and a
comparative Western analysis demonstrating that nucleosoluble
proteins and components firmly bound to chromatin were recovered in
distinct subfractions; the former by extraction at low salt
concentration (0-0.15 M and then 0.15-0.3 M
NaCl) and the latter by sonication after raising NaCl concentration
from 0.30 to 0.45 M (23). Mod was detected in nucleosoluble
(0-0.15 M NaCl) and chromatin (0.30-0.45 M)
fractions only. Most significantly, the protein has never been seen in
the intermediate salt extract (0.15-0.30 M), ruling out the possibility of a cross contamination between nucleolar and chromatin Mod fractions. This led us to conclude, when considered with
immunolocalization and genetic data, that part of the protein is firmly
bound to chromatin, whereas the major fraction is nucleolar and
solubilized at low salt (17). To test whether this differential distribution could be related to different phosphorylation states of
the protein, we analyzed 32P incorporation in Mod from
sub-nuclear fractions. The protein was immunoprecipitated from
chromatin and nucleosoluble fractions of metabolically labeled KC cells
and revealed by Western blotting and autoradiography. As shown in Fig.
2A, nucleosoluble Mod is highly labeled, whereas the chromatin-bound protein does not have detectably incorporated radioactive phosphates. These data suggest that
Mod is present in two different states in the nucleus: the nucleolar
population is phosphorylated, whereas its chromatin-bound counterpart
is not or is poorly phosphorylated.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 2.
Relationship between differential
phosphorylation, DNA-binding activity and subnuclear distribution of
Mod. A, Western (lanes 1-3) and
autoradiography (lanes 4-6) analyses of immunoprecipitated
Mod from nucleolar and chromatin subnuclear fractions from
32P metabolically labeled KC cells. The same blot was
subjected to autoradiography and then probed with mAb LA9. Mod is
abundant in the nucleolus and produces a stronger signal by
autoradiography (lane 6) than by Western (lane
3). Chromatin-bound Mod, while clearly visible on Western
(lanes 1 and 2), has not detectably incorporated
32P (lanes 4 and 5). B,
DNA affinity chromatography of chromatin-bound and nucleolar Mod from
embryos. Protein samples were incubated with dsDNA cellulose, eluted by
increasing NaCl concentration, and resulting samples were analyzed by
Western blotting. Lane 1, flow-through; lanes
2-7, fractions eluted at NaCl concentrations of 0.1, 0.2, 0.3, 0.4, 0.5, and 1 M, respectively. Top panel,
chromatin fraction. Mod strongly binds DNA. Middle panel,
nucleosoluble fraction. Nucleolar Mod shows weak affinity. Bottom
panel, nucleosoluble fraction digested with alkaline phosphatase
for 2 h at 37 °C. Nucleolar Mod dephosphorylation restores
DNA-binding activity. The significant fraction of Mod reproducibly
found in the flow-through suggests that some partial denaturation has
occurred during phosphatase digestion.
|
|
Phosphorylation Down-regulates Mod DNA-binding Activity in
Vitro--
These data also suggested the hypothesis that
phosphorylation could control Mod DNA-binding activity. To test the
hypothesis, nucleolar and chromatin fractions prepared from embryos
were assayed on dsDNA-cellulose chromatography. Data in Fig.
2B indicate that Mod extracted from chromatin strongly binds
DNA and is eluted at NaCl concentrations of 0.5-1.0 M,
whereas the nucleosoluble protein shows significantly weaker affinity
and is eluted at NaCl concentrations of 0.2-0.3 M.
Significantly, Mod from a nucleolar extract digested by phosphatase
exhibits a substantially improved DNA-binding activity (elution at NaCl
concentrations of 0.3-1.0 M). We therefore conclude that
phosphorylation likely down-regulates Mod DNA-binding activity in
vitro.
Identification of RNA Aptamers of Modulo--
The presence of four
RRMs in Mod led us to investigate the RNA binding properties of the
protein. We first tested the affinity of GST-Mod or of a truncated
version consisting only of the four RRMs (GST-RRM) to homopolymeric
oligoribonucleotides. Both are able to bind poly(G) and poly(U), to a
lesser extent poly(A), but not poly(C) (not shown). Second, we used
GST-Mod and GST-RRM proteins in a selection-amplification procedure
known as SELEX (30) to look for nucleotide specificity in RNA binding.
PCR products were cloned and sequenced after seven rounds of
selection/amplification of a 25-nucleotide-long random sequence (24).
Out of 43 sequences selected from the GST-Mod, 24 obey the consensus
(UUAC(N)xGU(A/G)G(U/A)(M)x), where N and M are
complementary nucleotides putatively able to form a stem, and "x"
is comprised between 4 and 6 (Fig. 3).
The other clones lack the consensus and do not efficiently bind Mod in
gel shift controls (not shown). Their selection can originate from
unspecific interaction with the basic terminal domains present in the
full-length protein. This hypothesis is supported by the second SELEX
experiment performed with GST-RRM. 10 clones from this selection were
sequenced, and all were found to match with the consensus defined in
Fig. 3. This experiment first confirms the consensual motif derived
from the selection by GST-Mod and secondly indicates that RNA binding
specificity is only provided by the RRM-containing domain.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 3.
Selection of Mod aptamers. A,
schematic representation of the Mod variants used in Selex experiments.
Mod primary structure consists in the juxtaposition of a basic N
terminus (light gray), a large acidic region (dark
gray), a repetition of four RRMs (white) and a basic C
terminus (light gray). B, the RNA template used
in SELEX experiments, shown at the top, encompasses constant
sequences and a core consisting of 25 randomly synthesized
nucleotides. Sequences selected by GST-Mod (15) and by the
GST-RRM (9) are aligned. When one sequence was isolated several times,
occurrence is given in brackets. The derived consensus is at
the bottom. Underlined nucleotides belong to
flanking constant sequences of the RNA template. Conserved nucleotides
are in bold, and nucleotides in italic correspond
to putative stem region. N and M are complementary nucleotides.
Kd values of eight aptamers for the full-length
protein are shown.
|
|
Band shift assays were performed to confirm that selected sequences
actually interact with Mod fusion proteins and to get an estimate of
their affinities (Kd values are given in Fig. 3). M8
and M12 were found to correspond to the aptamers of highest affinity,
with Kd values of 25 nM for GST-Mod and
of 10 nM for GST-RRM. The other selected RNAs present
weaker affinities, with Kd values ranging from 100 nM to 1000 nM. Fig.
4 reports only the data obtained with M12
aptamer and the various controls done. The aptamer is actually shifted
by GST-Mod and GST-RRM, whereas a ribonucleotide lacking the consensus (non-selected sequence, NS) does not (Fig. 4A). Fig.
4B provides other controls showing that anti-Mod mAb LA9
inhibits the interaction (lane 2), GST alone is ineffective
(lane 3), and competition with unlabeled M12 progressively
abolishes the shift whereas competition with ribonucleotide NS has no
effect (lanes 4-8). Taken together these data indicate that
Mod is a sequence-specific RNA binding protein and support the idea
that the bipartite motif defined here constitutes a high affinity site
for the protein.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 4.
Gel shift controls of Mod-RNA aptamer
interactions. A, increasing GST-Mod or GST-RRM amounts
were incubated with 32P-labeled M12 (lanes 1-8)
or NS RNA (lanes 9-12), and gel shift assays done to
display the products. Protein/RNA molar ratios were 0, 10, 50, and 100 for GST-Mod and 0, 5, 10, and 50 for GST-RRM; from these assays
Kd values of 10 and 25 nM were assigned
for M12 interaction to GST-RRM and GST-Mod. The formation of two
retarded complexes in assays with M12 suggests protein dimerization.
B, GST-Mod to M12 interaction (lane 1, molar
ratio 40) is blocked by mAb LA9 (1 µg, lane 2). GST alone
does not interact with M12 (molar ratio 100, lane 3). An
excess of cold M12 displaces labeled M12 from GST-Mod (molar ratios
cold over labeled M12 are 0, 500, and 2000 in lanes 4, 5,
and 6), whereas NS RNA added to the same concentrations has
no effect (lanes 7 and 8).
|
|
Probing the RNA Aptamer Conformation and Mod Footprint--
The
conformation of M12 was investigated using several enzymatic probes
(31) such as RNase V1 (specific for paired nucleotides; Fig.
5B, lane 9), RNase
T1 (specific for unpaired guanines; Fig. 5B, lane
1), RNase T2 (preferential cut after unpaired adenines; Fig.
5B, lane 5), and nuclease from Neurospora
crassa (specific for unpaired nucleotides; Fig.
6A). The results are reported
on the secondary structure model derived from the enzymatic probing (Fig. 5C). The data support the existence of a stable
hairpin structure presenting an external loop (nucleotides G27-U31)
and two internal loops (nucleotides A13-C21/A38-A41 and A47-A55). The external loop is well defined by the presence of an RNase T1 cut at
G30 and of several RNase T2 or nuclease NC cleavages at U29 and A28
(see Fig. 5, A and B). Interestingly, G27 is not accessible to RNase T1, indicating that this peculiar guanine is either
stacked within the loop or base paired with U31. Many hairpin loops
closed by non-canonical base pairs (G-A or G-U) have been described
(32). In most of the selected aptamers, position U31 is predominantly U
or A (see Fig. 3). Other single-stranded specific RNase cleavages are
mainly located in the regions A15-U19, U48-A52, and G64-A67 (Fig. 5,
A and B). The existence of helices I and II is
supported by the presence of several RNase V1 cleavages at positions
9-11, 22-24, 36, 44-45, and 59-60 (Fig. 5B). These data
indicate that the two conserved sequences (UUAC and GU(A/G)G(U/A)) are
located likely in single-stranded regions.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 5.
Secondary structure probing of M12 and Modulo
footprint. Panels A and B provide examples
of M12 structure probing and protection by Mod. A, N. crassa RNase digestion of M12 in the absence (lane 1)
or the presence of Mod (lane 2, 10 6
M; lane 3, 10 7 M;
lane 4, 10 8 M). Mod induces strong
protection in two regions corresponding to nucleotides 18-20 and
29-32. B, digestion of M12 by RNase T1 (lanes
1-4), RNase T2 (lanes 5-8), and RNase V1 (lanes
9-12) in the absence (lanes 1, 5, and 9) or the
presence of Mod (lanes 2, 5, 6: 10 6
M; lanes 3, 7, 11: 10 7
M; lanes 4, 8, 12: 10 8
M). Lanes C and C+, incubation
controls of free or Mod-associated RNAs. Lane T1,
guanosine-specific ladder generated by RNase T1 digestion under
denaturing conditions; lane L, alkaline hydrolysis ladder.
Protection by Mod is seen at various places, especially at positions
9-24 and 29-33. C, summary of RNase and iron-EDTA
cleavages and protection by Mod on the secondary structure of
M12.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 6.
Mod belongs to a RNP at the nucleolus.
Constant amounts of soluble nuclear extracts from Schneider cells were
fractionated on a linear gradient (3-20%) native polyacrylamide gel
(pH 8, 3), blotted onto nitrocellulose, and revealed by mAb LA9.
Extracts were preincubated for 20 min at 37 °C in RBS buffer (10 mM Tris-HCl, 100 mM NaCl, 2.5 mM
MgCl2, 1 mM dithiothreitol, 800 units
RNasin/ml, mixture of protease inhibitors, pH 7.4) alone (lane
1) or supplemented with an excess of NS RNA (1 µg/ml; lane
2), M12 aptamer (250 ng/ml; lane 3), or RNase A (5 µg/ml; lane 4). Competition by M12 or digestion by RNase A
induces a faster migration of Mod, whereas NS RNA has no effect.
|
|
The Mod footprint was next studied using RNases T1, T2, V1, and
nuclease NC as enzymatic probes. We also used iron-EDTA which generates, in the presence of hydrogen peroxide, reactive hydroxyl radicals cleaving ribose moieties irrespective of secondary structure (33). Experiments are shown in Fig. 5, A and B
and summarized on the predicted secondary structure of M12 depicted in
Fig. 5C. Mod induces strong protection against
single-stranded specific RNases at positions that correspond to the two
conserved sequences, in the hairpin loop (at U28, A29, and G30) and in
one internal loop (at U18, U19 and A20). Reduced RNase V1 cleavages are
also observed on both sides of helix II and at positions 9-11, whereas significant enhancements occur at positions 44-45. Furthermore, iron-EDTA footprint experiments revealed protections at riboses 29 to
35 (Fig. 5C). It has to be noted that no information was obtained for the nucleotides A15-A20 and A59-A63 from iron-EDTA experiments, owing to the presence of several nonspecific cleavages. Mod does not induce reactivity changes in the bottom of helix I,
indicating that the two non-random oligonucleotides used for the
selection do not directly participate in the RNA binding site.
The folding program of Zuker (34) was used to generate suboptimally
folded structures for the other selected aptamers. Interestingly, M8
RNA, which binds Mod with the same affinity as M12, is predicted to
fold in a very similar structure. The hairpin loop GUGGA and the
single-stranded sequence UUAC in M8 are separated by a stem formed by
five base pairs (see Fig. 3). For the other examined RNAs which present
weaker binding affinities, helix I appears to be shorter (4 base pairs
in M19) or is prolonged by several base pairings involving the
conserved sequence UUAC (M4, M19, M29, and M37). M9 RNA is of
particular interest because this aptamer lacks the conserved motif UUAC
but efficiently binds Mod (Fig. 3). RNase probing and footprint
experiments showed that M9 can adopt two conformations and that Mod
binding to the GUGGU conserved motif stabilizes a stem-loop structure
that resembles that of M12 (not shown).
These data indicate that the essential determinants for RNA recognition
by Mod are located within the hairpin loop having the conserved
sequence GU(A/G)G(U/A). The presence of the second conserved UUAC
sequence located in a single-stranded region and at an appropriate
distance from the hairpin loop increases the efficiency of binding. Our
data also suggest that Mod makes specific contacts with nucleotides in
the hairpin loop but also with the ribose-phosphate backbone.
Mod Belongs to a Ribonucleoprotein Complex in Vivo--
We
reasoned that if Mod is involved in a ribonucleoprotein (RNP) complex,
the electrophoretic pattern in native conditions should be changed
after digestion by RNase. The question was addressed using soluble
nuclear extracts from Schneider cells. Western blot analysis of
RNase-treated and non-treated extracts run on native PAGE (Fig. 6)
actually shows that RNase treatment strongly modifies the migration of
Mod, consistent with an association to RNA molecule(s). Moreover only
one migrating species is revealed, indicating that most of the
nucleosoluble Mod protein is involved in a single complex. Noteworthy,
preincubation with an excess of M12 aptamer shifts Mod toward a faster
migrating form (Fig. 6, lane 3). Thus, M12 can displace RNA
molecule(s) associated to Mod in vivo. This effect is
clearly sequence-specific because competition with a large excess of
ribonucleotide NS does not change the Mod migration pattern (Fig. 6,
lane 2). These results suggest that M12 RNA aptamer binds to
the same or overlapping site as the in vivo cognate RNA(s). We have previously reported that Mod only from nucleolus and not the
chromatin-bound protein is recovered in soluble nuclear extracts (17).
Thus, the evidence provided here, that Mod belongs to a RNP complex
in vivo, regards the nucleolus-associated form only.
RNase Treatment Does Not Prevent Mod Association to
Chromatin--
On polytene chromosomes, Mod is associated to condensed
chromatin sites, including a majority of bands on chromosome arms, and
to the nucleolus (17). In order to test whether Mod at the chromatin
might also interact with a RNA molecule, we analyzed the Mod pattern on
polytene chromosomes from salivary glands previously digested with
RNase. As a control, we simultaneously followed the distribution of the
Mle protein, which is known to be released from the male X chromosome
by RNase A (27). Male salivary glands digested or not by RNase A were
squashed, and polytene chromosome preparations were immunostained for
both Mod and Mle. Comparison of panels A to C and
B to D in Fig. 7,
indicates RNase digestion actually induces efficient release of Mle
from the X chromosome and of Mod from the nucleolus, but does not
affect the Mod chromosomal pattern.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 7.
Mod association to polytene chromosomes is
not affected by RNase. Male salivary glands were dissected,
treated or not with RNase A, and squashed, and chromosome preparations
were simultaneously labeled for Mod and Mle proteins. On untreated
preparations, Mod stains dense chromatin bands and the nucleolus
(A) and Mle sites on the X chromosome only (B).
On digested preparations, Mod is no longer detected at nucleolus but is
still present on chromosomes (C), whereas Mle is completely
released from the male X chromosome (D).
|
|
 |
DISCUSSION |
Previous studies indicated that Mod likely fulfils two distinct
nuclear functions, because the dominant suppression of PEV (12) and
recessive Minute-like (17) phenotypes are suggestive for roles in
chromatin compaction and regulation of nucleolus activity,
respectively. The present findings provide molecular evidence
supporting first that the protein is involved in distinct networks at
nucleolus and chromatin and second that phosphorylation down-regulates
DNA-binding and therefore controls distribution and function of Mod in
the two sub-nuclear compartments.
The structure/function analysis performed using Mod truncated isoforms
has clearly identified the domains involved in nucleic-acid binding.
One major conclusion is that Mod is a sequence/motif-specific RNA
binding protein. Two lines of evidence indicate that this property is
provided by the RRM-containing domain. First, the same consensus was
derived from SELEX experiments performed with GST fusions of either the
whole protein or the RRM moiety only. Second, the two protein variants
show close Kd values for M12 aptamer association.
Structural probing and footprinting experiments predict that Mod
stabilizes a hairpin-like structure and presumably establishes direct
contacts within two single-stranded GU(A/G)G(U/A) and UUAC sequences
corresponding to the hairpin loop and part of a bulged loop and with
the ribose-phosphate backbone as well. This RNA motif appears quite
different from that of the few targets of RRM-containing proteins
identified so far, which are usually constituted of hairpin loops of 8 to 10 residues (Ref. 25, and references therein). More generally, a
search in data bases failed to reveal any significant resemblance
between the Mod cognate motif and a previously identified RNA sequence.
A second conclusion is that the two basic terminal domains of Mod are
able to bind DNA in a non-sequence-specific manner. The decreased affinity of protein variants truncated of either the N or C terminus indicates that each domain can act independently. It is, however, conceivable that the two domains function synergistically in the native
protein to improve DNA-binding activity.
Mod therefore presents unique in vitro nucleic acid binding
properties as it is able to directly contact DNA via the two tips and
bind to a specific RNA motif via the central RRM domain. This leads up
to consider three points regarding the situation in vivo. One can first wonder about the nature of the nucleic acids Mod is
interacting with at the nucleolus and chromatin. Clear evidence that
Mod is released from the nucleolus as a RNP complex is provided by the
RNase-induced modification of nucleosoluble Mod migration in native gel
electrophoresis. Also consistent with a direct interaction with a
nucleolar RNA, M12 aptamer specifically displaces the protein from the
RNP complex. This latter result in addition strongly suggests that the
Mod RNA target at nucleolus likely presents a structure similar to M12.
However, we did not find any motif related to the aptamer in the
repertoire of Drosophila rRNA or snoRNA sequences available
in data bases. Eukaryotic cells contain an extraordinarily complex
population of snoRNAs (8, 35), but only a few have been cloned in
Drosophila. It is therefore tempting to assume that the Mod
RNA target at the nucleolus corresponds to snoRNA sequences not
identified so far. As the protein was previously shown not to bind rDNA
(17), we conclude that in this compartment Mod associates to specific
RNA molecule(s) but does not contact DNA. Interactions of Mod with
nucleic acids at chromatin appear to be quite different. On one side,
it is well established that the protein directly contacts genomic DNA
(12, 17). On the other side, digestion by RNase does not affect the Mod
pattern on polytene chromosomes, while it induces efficient release of
Mle from the X chromosome and of Mod from the nucleolus. The simplest
explanation is that chromatin-associated Mod does not interact with
RNA. Alternatively, in the process of chromatin compaction, Mod may
recruit RNA together with additional protein factors to form highly
condensed structures in which the RNA moiety is protected from
digestion by RNase. Whether or not Mod requires a RNA partner in the
process of chromatin compaction obviously needs further investigation.
The second point regards the molecular mechanisms that control Mod
distribution between the two subnuclear compartments. We propose that
posttranslational modification by phosphorylation down-regulates the
DNA-binding activity and capacity of the protein to link chromatin and,
therefore, modulates the equilibrium between chromatin
versus nucleolus association. This model is supported by
several lines of evidence: i) the chromatin-bound protein does not
detectably incorporate 32P in cell culture assays; ii) the
nucleolar fraction is highly modified and cannot bind DNA in
vitro; and iii) the DNA-binding activity is restored after
digestion by phosphatase. In contrast, phosphorylation is unlikely to
affect the capability of Mod to bind RNA because competition
experiments have shown that the M12 aptamer, selected by a recombinant
protein produced in Escherichia coli (i.e.
unmodified), binds phosphorylated nucleolar Mod as well.
The third point to consider is how the molecular data reported here
correlate to, and possibly improve our understanding of, functional
data obtained from genetics. The dominant suppression of PEV phenotype
unambiguously indicates that the encoded protein participates in the
local assembly of high order chromatin structure and transcriptional
silencing of neighboring genes. This function is thus clearly related
to chromatin rather than nucleolus and to the DNA-binding activity of
Mod. The lack of sequence specificity in DNA recognition that is
exhibited by the two basic terminal domains in vitro
contrasts with the protein distribution at specific heterochromatic
sites on mitotic chromosomes (17). This suggests that Mod might
associate to unknown factors that could provide specificity and direct
the complex toward particular chromatin sites. An interesting
possibility is that the distal domains in Mod interact with sequences
lying relatively far apart from each other on the DNA fiber, which
could favor and stabilize the formation of condensed chromatin structures.
Total loss of mod function results in the expression of
several recessive phenotypes. Some have clearly been related to defect in ribosome biogenesis and protein synthesis capacity, such as the
"Minute-like" phenotype of mutant cell clones induced in a wild
type background (17) and defect in cell growth and proliferation of
mutant imaginal tissues.2
Other phenotypes, melanotic tumor formation (12) and lymph gland
hyperplasia,2 which are highly reminiscent to phenotypes
caused by mutations in the ribosomal protein S6 gene (36), are also
consistent with a role for Mod in the regulation of ribosome assembly
and cell growth. Interestingly, Mod phosphorylation is enhanced when
cell growth is stimulated in cultures supplemented with serum. As our bidimensional gel analysis revealed a multiplicity of Mod
phosphoisoforms in vivo, it is therefore tempting to assume
that modification by phosphorylation at critical sites in Mod is
required not only to prevent DNA-binding and chromatin compaction, but
also to enhance nucleolus activity. Regarding the molecular function of
Mod at the nucleolus, an involvement in rDNA transcription appears
unlikely as the protein does not bind rDNA and is released from the
organelle by low salt extraction of purified nuclei (17). Instead, it presumably participates in a subsequent step of the ribosome
biosynthesis. Like most nucleolar proteins identified so far, Mod
indeed presents a modular structure that combines four RRMs with acidic
and basic domains and suggests interaction with nucleolar components,
including ribosomal proteins, rRNA and/or snoRNAs, and possibly a
chaperone function facilitating ribosome assembly (4).
Various aspects in the molecular function of Mod remain to be resolved,
such as the nature of RNA target in vivo and its possible involvement in chromatin compaction, the identity of
kinases/phosphatases that modify the protein or the nature of
transcriptional chromatin targets. However, the results presented here,
together with previously reported molecular and genetic data, led us to
propose the following functional model for Mod. In response to
physiological stimuli, mimicked by serum in cell culture assays, the
protein becomes phosphorylated and is released from chromatin, inducing
structural relaxation and PEV suppression, moves to the nucleolus where
it associates RNA, and forms a RNP required to improve ribosome
biogenesis and protein synthesis capacity. As far as we know, among
ribosomal or nucleolar proteins thought to possess a second cellular
activity apart from ribosome assembly and function (1, 37), Mod is the
first example in which the bifunctional character is proven by genetics
and in which a regulatory molecular mechanism of how the two functions
are coordinated in vivo is proposed.
 |
ACKNOWLEDGEMENTS |
We are grateful to Chantal and Bernard
Ehresmann for enthusiastic support and fruitful discussions, to Daniel
Gautheret for search in structural data bases, and to Ute
Rothbacher for critical reading of the manuscript. We thank Mitzu
Kuroda for anti-Mle antibody and Monique Diano for help in native
electrophoresis experiments. We also thank Philippe Bouvet for
providing oligonucleotides for SELEX and helpful discussion.
 |
FOOTNOTES |
*
This work was supported by the CNRS, grants from
l'Association pour la Recherche sur le Cancer and la Ligue Contre le
Cancer (to J. P.), and le Ministère de la Recherche et de la
Technologie et la Ligue Nationale Contre le Cancer doctoral fellowships
to (L. P. and P. L.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Institut de Génétique Humaine, UPR
1142 du CNRS, 141 rue de la Cardonille, 34396 Montpellier cedex 5, France.
Present address: Laboratoire de Biologie du
Développement, Université de Paris 7, case 7077, 2 place
Jussieu, 75251 Paris cedex 5, France.

To whom correspondence should be addressed. Tel.: 33 4 91 26 96 07; Fax: 33 4 91 82 06 82; E-mail: pradel{at}lgpd.univ-mrs.fr.
2
L. Perrin, S. Kallenbach, and J. Pradel,
unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
snoRNA, small
nucleolar RNAs;
RRM, RNA Recognition Motif;
PEV, Position Effect
Variegation;
GST, glutathione S-transferase;
SELEX, selection-amplification procedure;
NS, non-selected sequence;
RNP, ribonucleoprotein;
dsDNA, double-stranded DNA;
PAGE, polyacrylamide gel
electrophoresis.
 |
REFERENCES |
-
Wool, I. G.
(1996)
Trends Biochem. Sci.
21,
164-165[CrossRef][Medline]
[Order article via Infotrieve]
-
Mélèse, T.,
and Xue, Z.
(1995)
Opin. Cell. Biol.
7,
319-324
-
Shaw, P. J.,
and Jordan, E. G.
(1995)
Annu. Rev. Cell. Dev. Biol.
11,
93-121[CrossRef][Medline]
[Order article via Infotrieve]
-
Xue, Z.,
and Mélèse, T.
(1994)
Trends Cell Biol
4,
414-417
-
Nagai, K.,
Oubridge, C.,
Jessen, T. H.,
Li, J.,
and Evans, P. R.
(1990)
Nature
348,
515-520[CrossRef][Medline]
[Order article via Infotrieve]
-
Nomura, M.
(1984)
Sci. Am.
250,
102-114[Medline]
[Order article via Infotrieve]
-
Maxwell, E. S.,
and Fournier, M. J.
(1995)
Annu. Rev. Biochem.
35,
897-934[CrossRef]
-
Tollervey, D.,
and Kiss, T.
(1997)
Curr. Opin. Cell Biol.
9,
337-342[CrossRef][Medline]
[Order article via Infotrieve]
-
Lindsley, D. T.,
and Zimm, G. G.
(1992)
The Genome of Drosophila melanogaster, pp. 433-441, Academic Press Inc., San Diego
-
Saeboe-Larssen, S.,
Lyamouri, M.,
Merriam, J.,
Oksvold, M. P.,
and Lambertsson, A.
(1998)
Genetics
148,
1215-1224[Abstract/Free Full Text]
-
Kay, M. A.,
and Jacobs-Lorena, M.
(1987)
Genetics
3,
347-351
-
Garzino, V.,
Pereira, A.,
Laurenti, P.,
Graba, Y.,
Levis, R. W.,
Le Parco, Y.,
and Pradel, J.
(1992)
EMBO J
11,
4471-4479[Medline]
[Order article via Infotrieve]
-
Elgin, S. C.
(1996)
Curr. Opin. Genet. Dev.
6,
193-202[CrossRef][Medline]
[Order article via Infotrieve]
-
Henikoff, S.
(1996)
Bioessays
18,
401-409[CrossRef][Medline]
[Order article via Infotrieve]
-
Wakimoto, B. T.
(1998)
Cell
93,
321-324[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhimulev, I.
(1998)
Adv. Genet
37,
1-566[Medline]
[Order article via Infotrieve]
-
Perrin, L.,
Demakova, O.,
Fanti, L.,
Kallenbach, S.,
Mal'ceva, N. I.,
Pimpinelli, S.,
Zhimulev, I.,
and Pradel, J.
(1998)
J. Cell Sci.
111,
2753-2761[Abstract]
-
Krejci, E.,
Garzino, V.,
Mary, C.,
Bennani, N.,
and Pradel, J.
(1989)
Nucleic Acids Res.
17,
8101-8115[Abstract/Free Full Text]
-
Birney, E.,
Kumar, S.,
and Krainer, A. R.
(1993)
Nucleic Acids Res.
21,
5803-5816[Abstract/Free Full Text]
-
Smith, D. B.,
and Johnson, K. S.
(1988)
Gene (Amst.)
67,
31-40[CrossRef][Medline]
[Order article via Infotrieve]
-
O'Farrell, P. H.
(1975)
J. Biol. Chem.
250,
4007-4021[Abstract/Free Full Text]
-
Bellaiche, Y.,
Bandyopadhyay, R.,
Desplan, C.,
and Dostatni, N.
(1996)
Development
122,
3499-3508[Abstract]
-
Garzino, V.,
Moretti, C.,
and Pradel, J..
(1987)
Biol. Cell
61,
5-13[Medline]
[Order article via Infotrieve]
-
Tsai, D. E.,
Harper, D. S.,
and Keene, J. D.
(1991)
Nucleic Acids Res.
19,
4931-4936[Abstract/Free Full Text]
-
Ghisolfi-Nieto, L.,
Joseph, G.,
Puvion-Dutilleul, F.,
Amalric, F.,
and Bouvet, P.
(1996)
J. Mol. Biol.
260,
34-53[CrossRef][Medline]
[Order article via Infotrieve]
-
Lentzen, G.,
Moine, H.,
Ehresmann, C.,
Ehresmann, B.,
and Wintermeyer, W.
(1996)
RNA
2,
244-253[Abstract]
-
Richter, L.,
Bone, J. R.,
and Kuroda, M. I.
(1996)
Genes Cells
1,
325-336[Abstract]
-
Clark, R. F.,
Wagner, C. R.,
Craig, C. A.,
and Elgin, S. C.
(1991)
Methods Cell Biol.
35,
203-227[Medline]
[Order article via Infotrieve]
-
Oliphant, A. R.,
Brandl, C. J.,
and Struhl, K.
(1989)
Mol. Cell. Biol.
9,
2944-2949[Abstract/Free Full Text]
-
Tuerk, C.,
and Gold, L.
(1990)
Science
249,
505-510[Abstract/Free Full Text]
-
Ehresmann, C.,
Baudin, F.,
Mougel, M.,
Romby, P.,
Ebel, J. P.,
and Ehresmann, B.
(1987)
Nucleic Acids Res.
15,
9109-9128[Abstract/Free Full Text]
-
Wyatt, J. R.,
and Tinoco, J. I.
(1993)
in
The RNA World (Gesteland, R. F., and Atkins, J. F., eds), pp. 465-496, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Latham, J. A.,
and Cech, T. R.
(1989)
Science
245,
276-282[Abstract/Free Full Text]
-
Zuker, M.
(1989)
Science
244,
48-52[Abstract/Free Full Text]
-
Smith, C. M.,
and Steitz, J. A.
(1997)
Cell
89,
669-672[CrossRef][Medline]
[Order article via Infotrieve]
-
Watson, K. L.,
Konrad, K. D.,
Woods, D. F.,
and Bryant, P. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11302-11306[Abstract/Free Full Text]
-
Naora, H.,
Takai, I.,
Adachi, M.,
and Naora, H.
(1998)
J. Cell Biol.
141,
741-753[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Z. Cui and P. J. DiMario
RNAi Knockdown of Nopp140 Induces Minute-like Phenotypes in Drosophila
Mol. Biol. Cell,
June 1, 2007;
18(6):
2179 - 2191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Mikhaylova, A. M. Boutanaev, and D. I. Nurminsky
Transcriptional regulation by Modulo integrates meiosis and spermatid differentiation in male germ line
PNAS,
August 8, 2006;
103(32):
11975 - 11980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Sjoberg, E. Shestakova, Z. Mansuroglu, R. B. Maccioni, and E. Bonnefoy
Tau protein binds to pericentromeric DNA: a putative role for nuclear tau in nucleolar organization
J. Cell Sci.,
May 15, 2006;
119(10):
2025 - 2034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. J. Yoon and K. L. Mowry
Xenopus Staufen is a component of a ribonucleoprotein complex containing Vg1 RNA and kinesin
Development,
July 1, 2004;
131(13):
3035 - 3045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bantignies, R. H. Goodman, and S. M. Smolik
The interaction between the coactivator dCBP and Modulo, a chromatin-associated factor, affects segmentation and melanotic tumor formation in Drosophila
PNAS,
February 14, 2002;
(2002)
52509799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. P. Wu, K.-M. Choe, Y. Lu, and K. V. Anderson
Drosophila Immunity: Genes on the Third Chromosome Required for the Response to Bacterial Infection
Genetics,
September 1, 2001;
159(1):
189 - 199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Roman, J. He, and R. L. Davis
kurtz, a Novel Nonvisual Arrestin, Is an Essential Neural Gene in Drosophila
Genetics,
July 1, 2000;
155(3):
1281 - 1295.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Satoh, V. M. Shaheen, P. N. Kao, T. Okano, M. Shaw, H. Yoshida, H. B. Richards, and W. H. Reeves
Autoantibodies Define a Family of Proteins with Conserved Double-stranded RNA-binding Domains as Well as DNA Binding Activity
J. Biol. Chem.,
December 3, 1999;
274(49):
34598 - 34604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bantignies, R. H. Goodman, and S. M. Smolik
The interaction between the coactivator dCBP and Modulo, a chromatin-associated factor, affects segmentation and melanotic tumor formation in Drosophila
PNAS,
March 5, 2002;
99(5):
2895 - 2900.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|