Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franchimont, N.
Right arrow Articles by Canalis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franchimont, N.
Right arrow Articles by Canalis, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 10, 6783-6789, March 5, 1999


Platelet-derived Growth Factor Induces Interleukin-6 Transcription in Osteoblasts through the Activator Protein-1 Complex and Activating Transcription Factor-2*

Nathalie FranchimontDagger §, Deena DurantDagger , Sheila RydzielDagger , and Ernesto CanalisDagger parallel

From the Dagger  Departments of Research and Medicine, Saint Francis Hospital and Medical Center, Hartford, Connecticut 06105 and the  University of Connecticut School of Medicine, Farmington, Connecticut 06030

    ABSTRACT
Top
Abstract
Introduction
References

Platelet-derived growth factor (PDGF) BB, a mitogen that stimulates bone resorption, increases the expression of interleukin-6 (IL-6), a cytokine that induces osteoclast recruitment. The mechanisms involved in IL-6 induction by PDGF BB are poorly understood. We examined the effect of PDGF BB on IL-6 expression in cultures of osteoblasts from fetal rat calvariae (Ob cells). PDGF BB increased IL-6 mRNA and heterogeneous nuclear RNA levels, the rate of transcription, and the activity of base pairs (bp) -2906 to +20 IL-6 promoter fragments transiently transfected into Ob cells. Deletion analysis revealed two responsive regions, one containing an activator protein-1 (AP-1) site located between bp -276 and -257, and a second, less well defined, downstream of -257. Targeted mutations of a cyclic AMP-responsive element (CRE), and nuclear factor-IL-6 and nuclear factor-kappa B binding sites in a bp -257 to +20 IL-6 construct that was transfected into Ob cells, revealed that the CRE also contributed to IL-6 promoter induction by PDGF BB. Electrophoretic mobility shift assay revealed AP-1 and CRE nuclear protein complexes that were enhanced by PDGF BB. Supershift assays revealed binding of Jun and Fos to AP-1 and CRE sequences and binding of activating transcription factor-2 to CRE. In conclusion, PDGF BB induces IL-6 transcription in osteoblasts by regulating nuclear proteins of the AP-1 complex and activating transcription factor-2.

    INTRODUCTION
Top
Abstract
Introduction
References

Skeletal cells synthesize growth factors with important effects on the replication and the differentiated function of cells of the osteoblast and osteoclast lineages. Platelet-derived growth factor (PDGF)1 is released by platelets following aggregation and is synthesized by osteoblasts and osteosarcoma cells (1-4). PDGF is the product of two genes, PDGF A and B, encoding two distinct chains, which form PDGF AA and BB homodimers or PDGF AB heterodimers (1, 5, 6). Cells of the osteoblast lineage express the PDGF A gene and, to a lesser extent, the PDGF B gene, although PDGF BB has the greatest activity and has been studied more extensively for its biological properties (2, 3, 7). In bone, PDGF stimulates the replication of cells of the osteoblastic lineage, and it does not acutely enhance the differentiated function of the osteoblast (8, 9). PDGF also increases bone resorption, most likely by increasing the number of osteoclasts, an effect associated with an increase in the bone eroded surface (10, 11).

Although PDGF may act directly on skeletal cells, some effects may be mediated by other cytokines present in the bone microenvironment. Interleukin-6 (IL-6) is a multifunctional cytokine that enhances bone resorption by increasing osteoclast formation and recruitment (12, 13). Hormones that increase bone resorption, such as parathyroid hormone, 1,25-dihydroxyvitamin D3, and IL-1 enhance IL-6 production in skeletal cells, indicating that it may be an important intermediary in their effects on bone resorption (14-17). Furthermore, IL-6 and IL-1 play an important role in the osteoporosis of the estrogen deficient state, and levels of IL-6 and its soluble receptor are elevated in conditions of increased bone resorption, such as multiple myeloma and estrogen deficiency (13, 18-21). Recently, we demonstrated that PDGF BB increases IL-6 synthesis in osteoblast cultures by activating protein kinase C (PKC) and calcium-dependent pathways (22). The mechanisms involved were not determined, and the induction of IL-6 by PDGF BB may play a central role in the effects of PDGF on bone remodeling.

In the present study, we examined the mechanisms involved in the induction of IL-6 expression by PDGF BB in cultures of osteoblast enriched cells from 22-day fetal rat calvariae (Ob cells). We also determined the regulatory elements of the rat IL-6 gene promoter responsible for the stimulatory effect of PDGF BB on IL-6 expression.

    EXPERIMENTAL PROCEDURES

Cell Culture-- The culture method used was described in detail previously (23). Parietal bones were obtained from 22-day old fetal rats immediately after the mothers were sacrificed by blunt trauma to the nuchal area. This project was approved by the Animal Care and Use Committee of Saint Francis Hospital and Medical Center. Cells were obtained by five sequential digestions of the parietal bone, using bacterial collagenase (CLS II, Worthington Biochemical Corp., Freehold, NJ). Cell populations harvested from the third to the fifth digestions were previously shown to express osteoblastic characteristics and were cultured as a pool (23). Ob cells were plated at a density of 8000-12,000 cells/cm2 and cultured in a humidified 5% CO2 incubator at 37 °C, maintaining a pH of 7.5. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with nonessential amino acids (Life Technologies, Inc.), and 10% fetal bovine serum (Summit, Fort Collins, CO). For RNA and nuclear protein analyses, cells were grown to confluence (~50,000 cells/cm2), transferred to serum-free medium for 20-24 h, and then exposed to test agents in serum-free medium for 30 min to 4 h as indicated in the text and figure legends. For the nuclear run-on experiment, subconfluent cultures of Ob cells were trypsinized, subcultured at a 1:8 dilution, and grown to confluence in DMEM supplemented with 10% fetal bovine serum. Cells were serum-deprived for 24 h and treated for 15 and 30 min in serum-free DMEM. For transient transfections, cells were grown to 70% confluence, transfected in 10% fetal bovine serum, serum-deprived, and treated. Recombinant human PDGF BB (Austral, San Ramon, CA) was added directly to the culture medium. Cycloheximide (Sigma) was dissolved in ethanol and diluted 1:1000 in culture medium; an equal amount of ethanol was added to control cultures.

Northern Blot Analysis-- Total cellular RNA was extracted with the RNeasy Kit per the manufacturer's instructions (Qiagen, Chatsworth, CA). The RNA recovered was quantitated by spectrophotometry, and equal amounts of RNA from control or test samples were loaded on a formaldehyde agarose gel following denaturation. The gel was stained with ethidium bromide to visualize ribosomal RNA (rRNA), documenting equal RNA loading of the various experimental samples. RNA was then blotted onto Gene Screen Plus charged nylon membrane (DuPont), and the uniformity of transfer was documented by revisualization of rRNA. A 900-base pair (bp) BamHI-PstI restriction fragment of rat IL-6 cDNA, and a 700-bp BamHI-SphI fragment of a mouse 18 S rRNA cDNA clone (both from ATCC, Rockville, MD) were purified by agarose gel electrophoresis (24). IL-6 and 18 S rRNA cDNAs were labeled with [alpha -32P]dATP and [alpha -32P]dCTP (50 µCi each at a specific activity of 3000 Ci/mmol; DuPont) using the random hexanucleotide primed second strand synthesis method (25). Hybridizations were carried out at 42 °C for 16-48 h, and posthybridization washes were performed at 65 °C in 1× SSC for IL-6 and 0.1× SSC for 18 S. The bound radioactive material was visualized by autoradiography on Kodak X-AR5 film (Eastman Kodak), employing Cronex Lightning Plus intensifying screens (DuPont).

Heterogeneous Nuclear RNA (hnRNA)-- To examine changes in IL-6 hnRNA, a sense strand intron 2-specific amplimer, 5'-GAATTGGGAATTCTCTGCTG-3' and an antisense strand intron 2 amplimer, 5'-GAAGGCCAAGAGATCTTACT-3', were synthesized in accordance with published sequences (24). IL-6 hnRNA levels were determined by reverse transcription-PCR (26). For this purpose, total RNA from control and test samples was prepared as described for Northern analysis. One µg of RNA was treated with amplification grade DNase I and reverse-transcribed in the presence of the IL-6 intron 2 specific antisense primer at 42 °C for 30 min with Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). The newly transcribed cDNA was amplified by 22 PCR cycles of 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min in the presence of the IL-6 intron 2-specific sense primer described, Taq DNA polymerase, and 5 µCi of [alpha -32P]dATP (3000 Ci/mmol, DuPont). The PCR products were fractionated by electrophoresis on a 6% polyacrylamide denaturing gel and visualized by autoradiography. An internal DNA standard at a concentration of 20 fg was included in the PCR to correct for variations in amplification. The standard was obtained by amplification of SV40 promoter sequences in the pGL2-Basic plasmid DNA (Promega, Madison, WI) using the composite sense primer 5'-GAATTGGGAATTCTCTGCTGattagtcagcaaccatagtc-3' and the antisense primer 5'-GAAGGCCAAGAGATCTTACTggttccatcctctagaggat-3'. The uppercase letters indicate IL-6 sequences, and the lowercase letters represent pGL2-Basic plasmid sequences.

Nuclear Run-on Assay-- To examine changes in the rate of transcription, nuclei were isolated by Dounce homogenization in a Tris buffer, pH 7.4, containing 0.5% Nonidet P-40 (27). Nascent transcripts were labeled by incubation of nuclei in a reaction buffer containing 500 µµ each adenosine, cytidine, and guanosine triphosphates, 150 units of RNasin (Promega), and 250 µCi [alpha -32P]UTP (800 Ci/mmol, DuPont) (27). RNA was isolated by treatment with DNase I and proteinase K, followed by phenol-chloroform extraction and ethanol precipitation. Linearized plasmid DNA containing 1 µg of cDNA was immobilized onto GeneScreen Plus by slot blotting according to the manufacturer's directions (DuPont). The plasmid vector pGL2-Basic (Promega) was used as a control for nonspecific hybridization, and a mouse 18 S rRNA cDNA clone was used to estimate uniformity of the loading. Equal counts per min of [32P]RNA from each sample were hybridized to cDNAs at 42 °C for 72 h and washed in 1× SSC at 58 °C for 30 min. Hybridized cDNAs were visualized by autoradiography.

Transient Transfections-- To determine changes in promoter activity, chimeric constructs of the 5' flanking region of the IL-6 promoter and a luciferase reporter gene (kindly provided by Dr. G. Fey, Erlanghen, Germany) were tested (28, 29). Ob cells were cultured to approximately 70% confluence and transiently transfected by calcium phosphate-DNA co-precipitation as described (29). Cotransfection with a construct containing the cytomegalovirus promoter-driven beta -galactosidase gene (CLONTECH, Palo Alto, CA) was used to control for transfection efficiency. After 4 h, cells were exposed for 3 min to 10% glycerol. Ob cells were allowed to recover in serum-containing DMEM for 24 h, serum-deprived for 20-24 h, and exposed to control or test medium for 1-4 h as described in the text and figure legends. Cells were washed with phosphate buffered saline and harvested in reporter lysis buffer (Promega). Luciferase activity was measured using a luciferase assay kit (Promega), and beta -galactosidase activity was measured using Galacton reagent (Tropix, Bedford, MA), both in accordance with manufacturer's instructions. Luciferase activity was corrected for beta -galactosidase activity, and data are expressed as treated:control ratios.

Site-directed Mutagenesis-- Site-directed mutagenesis was performed by using the method of gene splicing by overlap extension or using the Morph Mutagenesis kit (5 Prime right-arrow 3 Prime, Inc., Boulder, CO) (30). The Morph Mutagenesis kit was used in accordance with the manufacturer's instructions to create targeted mutations of the cyclic AMP-responsive element (CRE), within the multiple response element (MRE), and of the nuclear factor for IL-6 (NF-IL-6) binding site. Gene splicing by overlap extension was used to create mutations of the nuclear factor-kappa B (NF-kappa B) site. For this purpose, wild-type and mutant constructs were generated by PCR using a 5' primer containing a sequence corresponding to bp -257 to -249 of the rat IL-6 promoter (5'-AGGCGAGCTCAAAGAAAGA-3') and a 3' primer that included bp +6 to +20 of the rat IL-6 gene (5'-CCGCTCGAGACAGAATGA-3'). A chimeric construct containing bp -257 to + 20 of the IL-6 promoter was used as a template. Mutant sense and antisense primers, used to synthesize the intermediate products, contained two or three altered bases, creating the desired targeted mutations (29). Newly synthesized wild-type and mutated IL-6 promoter fragments were cloned into the plasmid pGL3-Basic (Promega), containing the luciferase reporter gene. Sequences of the wild-type and mutated constructs generated either by the Morph Mutagenesis kit or by PCR were confirmed by DNA sequence analysis using the Sequenase Version 2.0 DNA sequencing kit (United States Biochemical Corp., Cleveland, OH).

Electrophoretic Mobility Shift Assay (EMSA)-- For gel shift assays, nuclear extracts from control and treated cultures were prepared as described (31). Cells were washed with phosphate buffered saline, suspended in Hepes/KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol buffer, allowed to swell on ice for 15 min, and lysed with 10% Nonidet P-40 (Sigma). Following centrifugation, the nuclear pellet was resuspended in a Hepes/KOH buffer in the presence of protease inhibitors at 4 °C, incubated for 30 min, and centrifuged, and the supernatant stored at -70 °C. Protein concentrations were determined by DC protein assay in accordance with the manufacturer's instructions (Bio-Rad). Synthetic oligonucleotides (Life Technologies, Inc., or National Biosciences Inc., Plymouth, MN) were labeled with [gamma -32P]ATP using polynucleotide kinase. Nuclear extracts and labeled oligonucleotides were incubated for 20 min at room temperature in a 10 mM Tris buffer (pH 7.5), containing 1 µg of poly(dI-dC). The specificity of binding was determined by the addition of homologous or mutated unlabeled synthetic oligonucleotides in 100-fold excess (31). DNA-protein complexes were resolved on nondenaturing, nonreducing 4% polyacrylamide gels, and the complexes were visualized by autoradiography. For gel supershift assays, rabbit affinity purified antibodies to Fos and Jun family of nuclear factors, activating transcription factor-2 (ATF-2), and other cyclic AMP response element-binding proteins (CREB-1, CREM-1, ATF-1, ATF-3, and ATF-4) (Santa Cruz Biotechnology, Santa Cruz, CA) were incubated for 1 h with nuclear extracts at room temperature, prior to the addition of synthetic oligonucleotides and electrophoretic resolution.

Statistical Methods-- Data are presented as means ± S.E. Statistical differences were determined by analysis of variance and post hoc examination by the Ryan-Einot-Gabriel-Welch F test (32).

    RESULTS

Northern blot analysis of total RNA from serum-deprived confluent Ob cells revealed limited expression of IL-6 transcripts. Confirming our initial observation, PDGF BB at 3.3 nM caused a marked time-dependent stimulation of IL-6 mRNA levels, which was maximal after 60 min (Fig. 1). To determine whether the induction of IL-6 was dependent on protein synthesis, Ob cells were treated with PDGF BB in the presence or absence of the protein synthesis inhibitor, cycloheximide at 3.6 µM. Cycloheximide did not prevent the effect of PDGF BB (Fig. 2). To analyze the mechanisms involved in the regulation of IL-6, we examined the effects of PDGF BB on IL-6 hnRNA and on the rate of transcription of the IL-6 gene. PDGF BB markedly increased IL-6 hnRNA after 30 min, and the effect was sustained for 120 min (Fig. 3). PDGF BB at 3.3 nM increased the rate of IL-6 transcription, as determined by a nuclear run-on assay on nuclei from Ob cells, by 2-3-fold after 15 min (not shown) and by 6-fold after 30 min (Fig. 4).


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of PDGF BB at 3.3 nM on IL-6 mRNA levels in cultures of Ob cells treated for 30-180 min. Total RNA from control (C) or PDGF BB-treated (BB) cells was subjected to Northern blot analysis and hybridized with an alpha -32P-labeled IL-6 cDNA. IL-6 transcripts of 1.2 and 2.4 kilobase pairs were visualized by autoradiography. Blots were stripped and rehybridized with an alpha -32P-labeled 18 S rRNA cDNA. IL-6 transcripts are shown in the upper panel, and 18 S rRNA transcripts are shown in the lower panel.


View larger version (104K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of PDGF BB at 3.3 nM on IL-6 mRNA levels, in the presence or absence of cycloheximide (Cx) at 3.6 µM, in cultures of Ob cells treated for 1 h. Total RNA from control (C) or PDGF BB-treated (BB) cells was subjected to Northern blot analysis and hybridized with an alpha -32P-labeled IL-6 cDNA. IL-6 transcripts of 1.2 and 2.4 kilobase pairs were visualized by autoradiography. Blots were stripped and rehybridized with an alpha -32P-labeled 18 S rRNA cDNA. IL-6 transcripts are shown in the upper panel, and 18 S rRNA transcripts are shown in the lower panel.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of PDGF BB at 3.3 nM on IL-6 hnRNA levels in cultures of Ob cells treated for 30-240 min. Total RNA from control (C) or PDGF BB-treated (BB) cells was extracted, and 1 µg was subjected to reverse transcription-PCR in the presence of IL-6 sense and antisense intron 2 primers and alpha -32P-dATP. Reverse transcription-PCR products were fractionated by polyacrylamide gel electrophoresis and visualized by autoradiography. Internal standard (std) is shown at the top of the blot and IL-6 hnRNA at the bottom.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of PDGF BB at 3.3 nM on IL-6 transcription rates in cultures of Ob cells treated for 30 min. Nascent transcripts from control (C) or PDGF BB (BB)-treated cultures were labeled in vitro with [alpha -32P]UTP, and the labeled RNA was hybridized to immobilized cDNA for IL-6. 18 S rRNA cDNA was used to demonstrate loading, and pGL2-Basic (pGL2-B) vector DNA was used as a control for nonspecific hybridization.

To define gene elements responsible for the PDGF BB effect, Ob cells were transiently transfected with chimeric constructs containing fragments of the IL-6 promoter linked to the luciferase reporter gene. The effects of PDGF BB at 3.3 nM were tested initially for 1-4 h on a bp -276 to +20 fragment of the rat IL-6 promoter. After 2 h, PDGF BB caused a 3.5-fold increase in promoter activity, an effect sustained for 4 h (Fig. 5). To characterize the regulatory elements involved, 5' deletion constructs of the IL-6 promoter ranging from bp -2906 to +20 to bp -34 to +20 were tested in six independent experiments. 5' Deletions from bp -2906 to bp -276 of the IL-6 promoter resulted in a decrease in basal activity (not shown) but did not preclude the response to PDGF BB, which induced the bp -276 to +20 promoter construct by about 3-fold (Fig. 6). Deletion to bp -257, with the consequent removal of an AP-1 site, resulted in a partial loss of the stimulatory effect by PDGF BB, so that it increased the activity of the bp -257 to +20 IL-6 construct 2-fold (Fig. 6). These results suggest that the AP-1 site between -276 and -257 is in part responsible for the effect of PDGF BB, and that additional sequences contained in the bp -257 to +20 region of the IL-6 promoter play a role in the response to PDGF BB. To define additional elements responsible for the regulation of IL-6 by PDGF BB, a bp -257 to +20 fragment of the IL-6 promoter was cloned into pGL3-Basic, and targeted mutations of the known consensus sequences of CRE, NF-IL-6, and NF-kappa B binding sites were made and tested. PDGF BB at 3.3 nM increased the activity of the bp -257 to +20 wild-type IL-6 construct by 1.5-2-fold (Fig. 7). Targeted mutations of NF-IL-6 and NF-kappa B did not result in a change in the response to PDGF BB. In contrast, a mutation of the CRE resulted in a total loss of the IL-6 promoter response to PDGF BB (Fig. 7).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of PDGF BB on IL-6 promoter activity in transiently transfected Ob cells. Ob cells were transfected by calcium phosphate-DNA co-precipitation with a chimeric construct spanning bp -276 to +20 of the rat IL-6 promoter sequence linked to a luciferase reporter gene. To control for transfection efficiency, a cytomegalovirus-beta -galactosidase expression vector was co-transfected. 24 h after transfection, Ob cells were serum-deprived for 20-24 h and exposed to control medium (white bars) or PDGF BB at 3.3 nM (black bars) for the indicated periods of time. Cells were harvested, and luciferase activity was corrected for beta -galactosidase activity and expressed as treated:control ratios for each time point studied, following normalization of control values to 100%. Values are means ± S.E. of three observations. *, significantly different from the respective control (p < 0.05).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of PDGF BB on IL-6 promoter activity in transiently transfected Ob cells. Ob cells were transfected by calcium phosphate-DNA co-precipitation with chimeric constructs containing fragments spanning the -2906 to +20 region of the rat IL-6 promoter sequence linked to a luciferase reporter gene. The 5' deletion end points of the IL-6 promoter are indicated immediately under the columns, and a diagram with selected putative cis-regulatory elements present in the -276 to +20 region of the IL-6 promoter is depicted at the bottom. To control for transfection efficiency, a cytomegalovirus-beta -galactosidase expression vector was co-transfected. 24 h after transfection, Ob cells were serum-deprived for 20-24 h and exposed to control medium (white columns) or PDGF BB at 3.3 nM (black columns) for 4 h. Cells were harvested, and luciferase activity was corrected for beta -galactosidase activity and expressed as treated:control ratios for each construct, following normalization of control values to 100%. Values are means ± S.E. of 12-21 observations, pooled from six independent experiments. *, significantly different from the respective control (p < 0.05).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of PDGF BB on IL-6 promoter activity in transiently transfected Ob cells. Ob cells were transfected by calcium phosphate-DNA co-precipitation, with a chimeric construct containing a bp -257 to +20 fragment of the IL-6 promoter, without (wild-type (WT)) or with mutations of CRE, NF-IL-6, and NF-kappa B as indicated under the columns. A diagram of the -257 to +20 region of the IL-6 promoter outlining the location and sequence of the three binding sites examined is depicted at the bottom. Arrows point to mutations used to alter CRE, NF-IL-6, and NF-kappa B consensus sequences. Constructs were linked to a luciferase reporter gene. To control for transfection efficiency, a cytomegalovirus-beta -galactosidase expression vector was co-transfected. 24 h after transfection, Ob cells were serum-deprived for 20-24 h and exposed to control medium (white columns) or PDGF BB at 3.3 nM (black columns) for 4 h. Cells were harvested, and luciferase activity was corrected for beta -galactosidase activity and expressed as treated:control ratios for each construct following normalization of control values to 100%. Values are means ± S.E. of 12 observations pooled from two experiments. *, significantly different from the respective control (p < 0.05).

To confirm the functional data, nuclear extracts, obtained from control and PDGF BB-treated cells, were incubated with radiolabeled oligonucleotides containing AP-1 and CRE/MRE sequences in the context of the IL-6 promoter. Binding studies revealed increased protein binding to AP-1 sequences in nuclear extracts from PDGF BB-treated cultures (Fig. 8). Unlabeled homologous oligonucleotides prevented, whereas mutated oligonucleotides did not prevent, the binding of the 32P-labeled sequences to nuclear proteins. Labeling was modestly increased with mutated oligonucleotides, possibly due to a carrier effect of the oligonucleotides in excess with a consequent increase in available radiolabeled oligonucleotides for binding to nuclear proteins. Antibodies to the Jun and Fos family of transcription factors decreased and shifted the binding of nuclear proteins from PDGF BB-treated Ob cells to the AP-1 consensus sequence, whereas antibodies to ATF-2 did not (Fig. 9a). Supershift assays using antibodies to specific members of the Fos and Jun families of transcription factors revealed that antibodies to Jun D, c-Fos, and, to a lesser extent, Fra-2 decreased and shifted the binding of nuclear proteins to AP-1 sequences in PDGF BB-treated Ob cells (Fig. 9b). Nuclear extracts from Ob cells bound to MRE sequences containing the CRE in the context of the IL-6 promoter. This binding was intensified in extracts from PDGF BB-treated cells, although the effect was more modest than the one observed using AP-1 consensus sequences (Fig. 10). Homologous unlabeled oligonucleotides competed for binding, whereas mutated oligonucleotides did not. Antibodies to ATF-2 or to the Fos and Jun family of transcription factors shifted the binding of nuclear proteins from PDGF BB-treated cultures to MRE sequences containing the CRE (Fig. 11a). Antibodies known to react with CREB-1, CREM-1, and ATF-1 (Fig. 11a) or with CREB-2, ATF-3, and ATF-4 (not shown) did not alter the DNA protein complex. Supershift assays using antibodies to specific members of the Jun and Fos families of transcription factors revealed that antibodies to c-Jun, Jun D, and c-Fos shifted the binding of MRE to nuclear proteins from PDGF BB-treated cells (Fig. 11b).


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of PDGF BB on nuclear proteins binding to AP-1 sequences in the context of the IL-6 gene promoter. Nuclear extracts from Ob cells exposed to control medium (C) or PDGF BB (BB) at 3.3 nM for 30 min were incubated with gamma -32P-labeled oligonucleotides. Incubations were performed in the absence or presence of a 100-fold excess unlabeled homologous (TGCTGAGTCACTTTTA) (wild-type) or mutated (TGCTGTATTGCTTTTA) (mutant) oligonucleotides as indicated. DNA-protein complexes were fractionated by polyacrylamide gel electrophoresis and visualized by autoradiography. The specific DNA-protein complex is indicated by the arrow.


View larger version (88K):
[in this window]
[in a new window]
 
Fig. 9.   Effect of PDGF BB on nuclear proteins binding to AP-1 sequences in the context of the IL-6 gene promoter. Nuclear extracts from Ob cells exposed to control medium (C) or PDGF BB (BB) at 3.3 nM for 30 min were incubated with gamma -32P-labeled oligonucleotides. In a, incubations were performed in the absence (-) or presence of nonspecific (NS) antibodies or antibodies to ATF-2 or to Jun or Fos family of nuclear proteins. In b, incubations were performed in the absence (-) or presence of antibodies to specific members of the Fos and Jun family of transcription factors. DNA-protein complexes were fractionated by polyacrylamide gel electrophoresis and visualized by autoradiography. The specific DNA-protein complex is indicated by the arrow.


View larger version (104K):
[in this window]
[in a new window]
 
Fig. 10.   Effect of PDGF BB on nuclear proteins binding to the MRE containing the cyclic AMP-responsive element in the context of the IL-6 gene promoter. Nuclear extracts from Ob cells exposed to control medium or PDGF BB at 3.3 nM for 30 min were incubated with gamma -32P-labeled oligonucleotides. Incubations were performed in the absence or presence of a 100-fold excess of unlabeled homologous (GATGCTAAATGACGTCACATTGTGCA) wild-type (WT) or mutated (GATGCTAAATCCTGTCACATTGTGCA) (Mut) oligonucleotides as indicated. DNA-protein complexes were fractionated by polyacrylamide gel electrophoresis and visualized by autoradiography. The specific DNA-protein complex is indicated by the arrows.


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 11.   Effect of PDGF BB on nuclear proteins binding to the MRE containing the cyclic AMP-responsive element in the context of the IL-6 gene promoter. Nuclear extracts from Ob cells exposed to control medium (C) or PDGF BB (BB) at 3.3 nM for 30 min were incubated with gamma -32P-labeled oligonucleotides. In a, incubations were performed in the absence or presence of nonspecific antibodies (NS); antibodies to ATF-2; an antibody (CREB-1) that reacts with CREB-1, CREM-1, and ATF-1 (Experiment A (left panel)); or antibodies to the Jun or Fos family of nuclear proteins (Experiment B (right panel)). In b, incubations were performed in the presence of nonspecific antibodies or antibodies to specific members of the Fos or Jun family of transcription factors. DNA-protein complexes were fractionated by polyacrylamide gel electrophoresis and visualized by autoradiography. The specific DNA-protein complex is indicated by the arrow.


    DISCUSSION

The present studies confirm that PDGF BB induces IL-6 expression in Ob cells and demonstrate that PDGF BB acts by transcriptional mechanisms, because it increased IL-6 hnRNA, enhanced the rate of IL-6 transcription and IL-6 promoter activity (22). Using 5' deletion constructs, we demonstrated that a bp -276 to +20 fragment of the IL-6 promoter is responsive to PDGF BB, and deletion of a region containing an AP-1 binding site resulted in loss of activity. A second, less well defined region of the IL-6 promoter spanning bp -257 to +20 also was responsive to PDGF BB. This region contains important regulatory sequences including a CRE within the MRE, and NF-IL-6 and NF-kappa B binding sites. These consensus sequences are necessary for the response of IL-6 to IL-1, to IL-6 itself, and to tumor necrosis factor alpha  (29, 33, 34). In previous studies, we found that CRE/MRE, NF-IL-6, and NF-kappa B, but not the AP-1 binding site between -276 and -257, were responsible for the autoinduction of IL-6 in osteoblasts (29). The elements utilized by PDGF BB are distinct and include the AP-1 site in the bp -276 to -257 region, as well as the CRE within the MRE, because mutations of the CRE, but not of other sites in the bp -257 to +20 region, prevented the activation of the IL-6 promoter by PDGF BB in osteoblasts. EMSA confirmed the functional studies and indicated that PDGF BB increased or activated nuclear proteins interacting with AP-1 and CRE sequences in the context of the IL-6 gene. Because the effect of PDGF BB on IL-6 transcripts was not modified by cycloheximide, it is probable that the mechanism involves activation and not de novo protein synthesis of nuclear factors. This is also substantiated by the almost immediate response of the IL-6 gene to PDGF BB.

The results presented reveal that classic members of the Fos and Jun families of transcription factors interact with AP-1, as well as with CRE sequences in the IL-6 gene, whereas the related ATF-2 interacts only with CRE sequences, the known target sequence for this transcription factor (35). ATF-2 is known to form heterodimers with members of the Jun family of proteins, and our data suggest that this may also be the case in osteoblasts exposed to PDGF BB (36, 37). It is not surprising that PDGF BB activates a CRE by acting on ATF-2, because PDGF does not increase cyclic AMP in osteoblasts and ATF-2 is not dependent on cyclic AMP pathway activation (22, 35). Mice lacking c-Fos develop osteopetrosis and decreased bone remodeling, and c-Fos appears to be essential for osteoclast differentiation (38, 39). Consequently, its involvement in IL-6 transcriptional regulation is not unexpected in view of the role of IL-6 on osteoclast recruitment and bone resorption (12, 13). The induction or activation of Fos and Jun by PDGF BB also is consistent with the mitogenic activity of the growth factor in skeletal cells (40). Furthermore, maximal expression of members of the AP-1 family of nuclear factors occurs during replication of cells of the osteoblastic lineage and declines as the cells differentiate, a function decreased by PDGF BB (11, 41). The importance in skeletal physiology of ATF-2 is substantiated by the wide distribution of ATF-2 consensus sequences among genes expressed by osteoblasts and by recent studies in ATF-2-deficient mice demonstrating that this nuclear factor is required for skeletal and neurological development (42).

PDGF is known to act through different signaling systems and may use PKC, protein kinase A (PKA), and intracellular calcium-dependent pathways (43, 44). The different signal transduction pathways involved in the response to PDGF BB depend not only on the cell type but also on the gene regulated. Our previous studies demonstrated that PDGF BB induced IL-6 in osteoblasts by PKC and intracellular calcium-dependent pathways (22). PKA-dependent pathways do not play a role in the effects of PDGF BB in Ob cells, because the growth factor does not increase cyclic AMP levels in these cells (22). The current studies are in agreement with our earlier observations and confirm the relevance of PKC-dependent pathways, utilized to activate members of the AP-1 complex, in the IL-6 induction by PDGF BB. Changes in intracellular calcium, as well as PKA pathways, can activate the CRE, and calcium-dependent pathways induced by PDGF BB may activate this site independently of ATF-2 (35). PKA-dependent pathways may be relevant to the effect of other agents on IL-6 expression, such as parathyroid hormone, which acts through PKA and intracellular calcium-dependent pathways and stimulates IL-6 synthesis in osteoblasts (14, 15, 22, 45-47). The elements utilized by parathyroid hormone to regulate IL-6 transcription have not been reported, but despite different signaling pathways, they might be similar to those utilized by PDGF. Cyclic AMP-dependent pathways are utilized by parathyroid hormone to induce c-Fos in osteoblastic cells and c-Fos plays a role in IL-6 transcription and binds to CRE as well as to AP-1 consensus sequences (48).

In conclusion, the present studies demonstrate that PDGF BB increases IL-6 transcription in osteoblastic cells by activating or inducing members of the AP-1 complex and ATF-2. The stimulation of IL-6 by PDGF BB may play a central role in the effects of PDGF on bone resorption and remodeling.

    ACKNOWLEDGEMENTS

We thank Dr. G. Fey for providing IL-6 promoter constructs, Cathy Boucher and Kris Sasala for technical assistance, and Charlene Gobeli for secretarial help.

    FOOTNOTES

* This work was supported by Grant AR21707 from NIAMS, National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by fellowship awards from the Catherine Weldon Donaghue Foundation and the Belgian Bone Club.

parallel To whom correspondence should be addressed: Dept. of Research, Saint Francis Hospital and Medical Center, 114 Woodland St., Hartford, CT 06105-1299. Tel.: 860-714-4068; Fax: 860-714-8053; E-mail: ecanalis{at}stfranciscare.org.

    ABBREVIATIONS

The abbreviations used are: PDGF, platelet-derived growth factor; MRE, multiple response element; PKC, protein kinase C; PKA, protein kinase A; IL, interleukin; AP, activator protein; bp, base pair(s); DMEM, Dulbecco's modified Eagle's medium; CRE, cyclic AMP-responsive element; CREB, CRE-binding protein; NF, nuclear factor; ATF, activating transcription factor; hnRNA, heterogeneous nuclear RNA; PCR, polymerase chain reaction.

    REFERENCES
Top
Abstract
Introduction
References
  1. Hart, C. E., Mason, B., Curtis, D. A., Osborn, S., Raines, E., Ross, R., and Forstrom, J. W. (1990) Biochemistry 29, 166-172[CrossRef][Medline] [Order article via Infotrieve]
  2. Rydziel, S., Ladd, C., McCarthy, T. L., Centrella, M., and Canalis, E. (1992) Endocrinology 130, 1916-1922[Abstract/Free Full Text]
  3. Rydziel, S., and Canalis, E. (1996) Endocrinology 137, 4115-4119[Abstract]
  4. Graves, D. T., Owen, A. J., Barth, R. K., Tempst, P., Winoto, A., Fors, L., Hood, L. E., and Antoniades, H. N. (1984) Science 226, 972-974[Abstract/Free Full Text]
  5. Heldin, C. H., and Westermark, B. (1987) J. Cell. Physiol. Suppl. 5, S31-S34
  6. Claesson-Welsh, L., and Heldin, C. H. (1989) Acta Oncol. 28, 331-334[Medline] [Order article via Infotrieve]
  7. Centrella, M., McCarthy, T. L., Kusmik, W. F., and Canalis, E. (1991) J. Cell. Physiol. 147, 420-426[CrossRef][Medline] [Order article via Infotrieve]
  8. Canalis, E., McCarthy, T. L., and Centrella, M. (1989) J. Cell. Physiol. 140, 530-537[CrossRef][Medline] [Order article via Infotrieve]
  9. Centrella, M., McCarthy, T. L., and Canalis, E. (1989) Endocrinology 125, 13-19[Abstract/Free Full Text]
  10. Cochran, D. L., Rouse, C. A., Lynch, S. E., and Graves, D. T. (1993) Bone 14, 53-58[Medline] [Order article via Infotrieve]
  11. Hock, J. M., and Canalis, E. (1994) Endocrinology 134, 1423-1428[Abstract/Free Full Text]
  12. Roodman, G. D. (1992) J. Bone Miner. Res. 7, 475-478[Medline] [Order article via Infotrieve]
  13. Jilka, R. L., Hangoc, G., Girasole, G., Passeri, G., Williams, D. C., Abrams, J. S., Boyce, B., Broxmeyer, H., and Manolagas, S. C. (1992) Science 257, 88-91[Abstract/Free Full Text]
  14. Feyen, J. H., Elford, P., Di Padova, F. E., and Trechsel, U. (1989) J. Bone Miner. Res. 4, 633-638[Medline] [Order article via Infotrieve]
  15. Franchimont, N., Vrindts, Y., Gaspar, S., Lopez, M., Gathy, R., DeGroote, D., Reginster, J. Y., and Franchimont, P. (1993) in Proceedings 1993: Fourth International Symposium on Osteoporosis and Consensus Development Conference (Christiansen, C., and Riis, B., eds), pp. 249-250, Handelstrykkeriet Aalborg ApS/Aalborg, Denmark
  16. Helle, M., Brakenhoff, J. P. J., DeGroot, E. R., and Aarden, L. A. (1988) Eur. J. Immunol. 18, 957-959[Medline] [Order article via Infotrieve]
  17. Littlewood, A. J., Russell, J., Harvey, G. R., Hughes, D. E., Russell, R. G. G., and Gowen, M. (1991) Endocrinology 129, 1513-1520[Abstract/Free Full Text]
  18. Lorenzo, J. A., Naprta, A., Rao, Y., Alander, C., Glaccum, M., Widmer, M., Gronowicz, G., Kalinowski, J., and Pilbeam, C. C. (1998) Endocrinology 139, 3022-3025[Abstract/Free Full Text]
  19. Pacifici, R. (1998) Endocrinology 139, 2659-2660[Free Full Text]
  20. Frieling, J. T. M., Sauerwein, R. W., Wijdenes, J., Hendriks, T., and van der Linden, C. J. (1994) Cytokine 6, 376-381[CrossRef][Medline] [Order article via Infotrieve]
  21. Girasole, G., Pedrazzoni, M., Giuliani, N., Passeri, G., and Passeri, M. (1995) J. Bone Miner. Res. 10, S160
  22. Franchimont, N., and Canalis, E. (1995) Endocrinology 136, 5469-5475[Abstract]
  23. McCarthy, T. L., Centrella, M., and Canalis, E. (1988) J. Bone Miner. Res. 3, 401-408[Medline] [Order article via Infotrieve]
  24. Northemann, W., Braciak, T. A., Hattori, M., Lee, F., and Fey, G. H. (1989) J. Biol. Chem. 264, 16072-16082[Abstract/Free Full Text]
  25. Feinberg, A. P., and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267[CrossRef][Medline] [Order article via Infotrieve]
  26. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1995) Current Protocols in Molecular Biology: Preparation and Analysis of RNA, pp. 4.10.5-4.10.9, John Wiley and Sons Inc., New York
  27. Greenberg, M. E., and Ziff, E. B. (1984) Nature 311, 433-438[CrossRef][Medline] [Order article via Infotrieve]
  28. Baffet, G., Braciak, T. A., Fletcher, R. G., Gauldie, J., Fey, G. H., and Northemann, W. (1991) Mol. Biol. Med. 8, 141-156[Medline] [Order article via Infotrieve]
  29. Franchimont, N., Rydziel, S., and Canalis, E. (1997) J. Clin. Invest. 100, 1797-1803[Medline] [Order article via Infotrieve]
  30. Horton, R. M. (1993) in Methods in Molecular Biology (White, B. A., ed), Vol. 15, pp. 251-261, Humana Press Inc., Totowa, NJ
  31. Scott, V., Clark, A. R., and Docherty, K. (1994) in Methods in Molecular Biology (Harwood, A. J., ed), Vol. 31, pp. 339-347, Humana Press Inc., Totowa, NJ
  32. Wall, F. J. (1986) Statistical Data Analysis Handbook, 1st Ed, McGraw-Hill, New York
  33. Seghal, P. B. (1992) Res. Immunol. 143, 724-734[CrossRef][Medline] [Order article via Infotrieve]
  34. Akira, S., Isshiki, H., Nakajima, T., Kinoshita, S., Nishio, Y., Hashimoto, S., Natsuka, S., and Kishimoto, T. (1992) in Interleukins: Molecular Biology and Immunology (Kishimoto, T., ed), Vol. 51, pp. 299-322, Karger, Basel, Switzerland
  35. Meyer, T. E., and Habener, J. F. (1993) Endocr. Rev. 14, 269-290[Abstract/Free Full Text]
  36. Hai, I., and Curran, T. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3720-3724[Abstract/Free Full Text]
  37. Morooka, H., Bonventre, J. V., Pombo, C. M., Kyriakis, J. M., and Force, T. (1995) J. Biol. Chem. 270, 30084-30092[Abstract/Free Full Text]
  38. Wang, Z. Q., Ovitt, C., Grigoriadis, A. E., Möhle-Steinlein, U., Rüther, U., and Wagner, E. F. (1992) Nature 360, 471-745[CrossRef][Medline] [Order article via Infotrieve]
  39. Grigoriadia, A. E., Wang, Z. Q., Cecchini, M. G., Hofstetter, W., Felix, R., Fleisch, H. A., and Wagner, E. F. (1994) Science 266, 443-447[Abstract/Free Full Text]
  40. Angel, P., and Karin, M. (1990) Biochim. Biophys. Acta 1072, 129-157
  41. McCabe, L. R., Banerjee, C., Kundu, R., Harrison, R. J., Dobner, P. R., Stein, J. L., Lian, J. B., and Stein, G. S. (1996) Endocrinology 137, 4398-4408[Abstract]
  42. Reimold, A. M., Grusby, M. J., Kosaras, B., Fries, J. W. U., Mori, R., Maniwa, S., Glauss, R. M., Collins, T., Sidman, R. L., Glimcher, M. J., and Glimcher, L. H. (1996) Nature 379, 262-265[CrossRef][Medline] [Order article via Infotrieve]
  43. Claesson-Welsh, L. (1994) J. Biol. Chem. 269, 32023-32026[Free Full Text]
  44. Rothman, A., Wolner, B., Button, D., and Taylor, P. (1994) J. Biol. Chem. 269, 6399-6404[Abstract/Free Full Text]
  45. Chase, L., and Aurbach, G. D. (1970) J. Biol. Chem. 245, 1520-1526[Abstract/Free Full Text]
  46. Partridge, N. C., Bloch, S. R., and Pearman, A. T. (1994) J. Cell. Biochem. 55, 321-327[CrossRef][Medline] [Order article via Infotrieve]
  47. Greenfield, E. M., Gornik, S. A., Horowitz, M. C., Donahue, H. J., and Shaw, S. M. (1993) J. Bone Miner. Res. 8, 1163-1171[Medline] [Order article via Infotrieve]
  48. Pearman, A. T., Chou, W. Y., Bergman, K. D., Pulumati, M. R., and Partridge, N. C. (1996) J. Biol. Chem. 271, 25715-25721[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
ThoraxHome page
C W Li, W Cheung, Z B Lin, T Y Li, J T Lim, and D Y Wang
Oral steroids enhance epithelial repair in nasal polyposis via upregulation of the AP-1 gene network
Thorax, April 1, 2009; 64(4): 306 - 312.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Fukaya, H. Shimada, L.-C. Wang, E. Zandi, and Y. A. DeClerck
Identification of Galectin-3-binding Protein as a Factor Secreted by Tumor Cells That Stimulates Interleukin-6 Expression in the Bone Marrow Stroma
J. Biol. Chem., July 4, 2008; 283(27): 18573 - 18581.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
J. O. Hollinger, C. E. Hart, S. N. Hirsch, S. Lynch, and G. E. Friedlaender
Recombinant Human Platelet-Derived Growth Factor: Biology and Clinical Applications
J. Bone Joint Surg. Am., February 1, 2008; 90(Supplement_1): 48 - 54.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Inouye, M. Fujimoto, T. Nakamura, E. Takaki, N. Hayashida, T. Hai, and A. Nakai
Heat Shock Transcription Factor 1 Opens Chromatin Structure of Interleukin-6 Promoter to Facilitate Binding of an Activator or a Repressor
J. Biol. Chem., November 9, 2007; 282(45): 33210 - 33217.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. E. Broderick, T. Zhang, H. Rangaswami, Y. Zeng, X. Zhao, G. R. Boss, and R. B. Pilz
Guanosine 3',5'-Cyclic Monophosphate (cGMP)/cGMP-Dependent Protein Kinase Induce Interleukin-6 Transcription in Osteoblasts
Mol. Endocrinol., May 1, 2007; 21(5): 1148 - 1162.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Takanaga, T. Yoshitake, S. Hara, C. Yamasaki, and M. Kunimoto
cAMP-induced Astrocytic Differentiation of C6 Glioma Cells Is Mediated by Autocrine Interleukin-6
J. Biol. Chem., April 9, 2004; 279(15): 15441 - 15447.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Monje, M. J. Marinissen, and J. S. Gutkind
Phosphorylation of the Carboxyl-Terminal Transactivation Domain of c-Fos by Extracellular Signal-Regulated Kinase Mediates the Transcriptional Activation of AP-1 and Cellular Transformation Induced by Platelet-Derived Growth Factor
Mol. Cell. Biol., October 1, 2003; 23(19): 7030 - 7043.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. S. J. Elenitoba-Johnson, S. D. Jenson, R. T. Abbott, R. A. Palais, S. D. Bohling, Z. Lin, S. Tripp, P. J. Shami, L. Y. Wang, R. W. Coupland, et al.
Involvement of multiple signaling pathways in follicular lymphoma transformation: p38-mitogen-activated protein kinase as a target for therapy
PNAS, June 10, 2003; 100(12): 7259 - 7264.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-J. Ventura, N. J. Kennedy, J. A. Lamb, R. A. Flavell, and R. J. Davis
c-Jun NH2-Terminal Kinase Is Essential for the Regulation of AP-1 by Tumor Necrosis Factor
Mol. Cell. Biol., April 15, 2003; 23(8): 2871 - 2882.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Guillen, P. Martinez, A. R. de Gortazar, M. E. Martinez, and P. Esbrit
Both N- and C-terminal Domains of Parathyroid Hormone-related Protein Increase Interleukin-6 by Nuclear Factor-kappa B Activation in Osteoblastic Cells
J. Biol. Chem., July 26, 2002; 277(31): 28109 - 28117.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Mann, F. Oakley, P. W. M. Johnson, and D. A. Mann
CD40 Induces Interleukin-6 Gene Transcription in Dendritic Cells. REGULATION BY TRAF2, AP-1, NF-kappa B, AND CBF1
J. Biol. Chem., May 3, 2002; 277(19): 17125 - 17138.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
I. Kosmidou, T. Vassilakopoulos, A. Xagorari, S. Zakynthinos, A. Papapetropoulos, and C. Roussos
Production of Interleukin-6 by Skeletal Myotubes . Role of Reactive Oxygen Species
Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 587 - 593.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
S.J. Webb, J.R. McPherson, K. Pahan, and S. Koka
Regulation of TNF-{alpha}-induced IL-6 Production in MG-63 Human Osteoblast-like Cells
Journal of Dental Research, January 1, 2002; 81(1): 17 - 22.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. K. Ellington, A. Elhofy, K. L. Bost, and M. C. Hudson
Involvement of Mitogen-Activated Protein Kinase Pathways in Staphylococcus aureus Invasion of Normal Osteoblasts
Infect. Immun., September 1, 2001; 69(9): 5235 - 5242.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A. M. Reimold, J. Kim, R. Finberg, and L. H. Glimcher
Decreased immediate inflammatory gene induction in activating transcription factor-2 mutant mice
Int. Immunol., February 1, 2001; 13(2): 241 - 248.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
I. R. Pela, M. E. S. Ferreira, M. C. C. Melo, C. A. A. Silva, M. M. Coelho, and C. F. Valenzuela
Evidence that platelet-derived growth factor may be a novel endogenous pyrogen in the central nervous system
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2000; 278(5): R1275 - R1281.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. C. Manolagas
Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis
Endocr. Rev., April 1, 2000; 21(2): 115 - 137.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
W. Durante, K. J. Peyton, and A. I. Schafer
Platelet-Derived Growth Factor Stimulates Heme Oxygenase-1 Gene Expression and Carbon Monoxide Production in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., November 1, 1999; 19(11): 2666 - 2672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Mesri and D. C. Altieri
Leukocyte Microparticles Stimulate Endothelial Cell Cytokine Release and Tissue Factor Induction in a JNK1 Signaling Pathway
J. Biol. Chem., August 13, 1999; 274(33): 23111 - 23118.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. E. Smart, K. J. Vincent, M. J. P. Arthur, O. Eickelberg, M. Castellazzi, J. Mann, and D. A. Mann
JunD Regulates Transcription of the Tissue Inhibitor of Metalloproteinases-1 and Interleukin-6 Genes in Activated Hepatic Stellate Cells
J. Biol. Chem., June 22, 2001; 276(26): 24414 - 24421.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franchimont, N.
Right arrow Articles by Canalis, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franchimont, N.
Right arrow Articles by Canalis, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement