|
J Biol Chem, Vol. 274, Issue 10, 6783-6789, March 5, 1999
Platelet-derived Growth Factor Induces Interleukin-6
Transcription in Osteoblasts through the Activator Protein-1 Complex
and Activating Transcription Factor-2*
Nathalie
Franchimont §,
Deena
Durant ,
Sheila
Rydziel , and
Ernesto
Canalis ¶
From the Departments of Research and Medicine, Saint
Francis Hospital and Medical Center, Hartford, Connecticut 06105 and
the ¶ University of Connecticut School of Medicine,
Farmington, Connecticut 06030
 |
ABSTRACT |
Platelet-derived growth factor (PDGF) BB, a
mitogen that stimulates bone resorption, increases the expression of
interleukin-6 (IL-6), a cytokine that induces osteoclast recruitment.
The mechanisms involved in IL-6 induction by PDGF BB are poorly
understood. We examined the effect of PDGF BB on IL-6 expression in
cultures of osteoblasts from fetal rat calvariae (Ob cells). PDGF BB
increased IL-6 mRNA and heterogeneous nuclear RNA levels, the rate
of transcription, and the activity of base pairs (bp) 2906 to +20
IL-6 promoter fragments transiently transfected into Ob cells. Deletion
analysis revealed two responsive regions, one containing an activator
protein-1 (AP-1) site located between bp 276 and 257, and a second,
less well defined, downstream of 257. Targeted mutations of a cyclic AMP-responsive element (CRE), and nuclear factor-IL-6 and nuclear factor- B binding sites in a bp 257 to +20 IL-6 construct that was
transfected into Ob cells, revealed that the CRE also contributed to
IL-6 promoter induction by PDGF BB. Electrophoretic mobility shift
assay revealed AP-1 and CRE nuclear protein complexes that were
enhanced by PDGF BB. Supershift assays revealed binding of Jun and Fos
to AP-1 and CRE sequences and binding of activating transcription
factor-2 to CRE. In conclusion, PDGF BB induces IL-6 transcription in
osteoblasts by regulating nuclear proteins of the AP-1 complex and
activating transcription factor-2.
 |
INTRODUCTION |
Skeletal cells synthesize growth factors with important effects on
the replication and the differentiated function of cells of the
osteoblast and osteoclast lineages. Platelet-derived growth factor
(PDGF)1 is released by
platelets following aggregation and is synthesized by osteoblasts and
osteosarcoma cells (1-4). PDGF is the product of two genes, PDGF A and
B, encoding two distinct chains, which form PDGF AA and BB homodimers
or PDGF AB heterodimers (1, 5, 6). Cells of the osteoblast lineage
express the PDGF A gene and, to a lesser extent, the PDGF B gene,
although PDGF BB has the greatest activity and has been studied more
extensively for its biological properties (2, 3, 7). In bone, PDGF stimulates the replication of cells of the osteoblastic lineage, and it
does not acutely enhance the differentiated function of the osteoblast
(8, 9). PDGF also increases bone resorption, most likely by increasing
the number of osteoclasts, an effect associated with an increase in the
bone eroded surface (10, 11).
Although PDGF may act directly on skeletal cells, some effects may be
mediated by other cytokines present in the bone microenvironment. Interleukin-6 (IL-6) is a multifunctional cytokine that enhances bone
resorption by increasing osteoclast formation and recruitment (12, 13).
Hormones that increase bone resorption, such as parathyroid hormone,
1,25-dihydroxyvitamin D3, and IL-1 enhance IL-6 production
in skeletal cells, indicating that it may be an important intermediary
in their effects on bone resorption (14-17). Furthermore, IL-6 and
IL-1 play an important role in the osteoporosis of the estrogen
deficient state, and levels of IL-6 and its soluble receptor are
elevated in conditions of increased bone resorption, such as multiple
myeloma and estrogen deficiency (13, 18-21). Recently, we demonstrated
that PDGF BB increases IL-6 synthesis in osteoblast cultures by
activating protein kinase C (PKC) and calcium-dependent
pathways (22). The mechanisms involved were not determined, and the
induction of IL-6 by PDGF BB may play a central role in the effects of
PDGF on bone remodeling.
In the present study, we examined the mechanisms involved in the
induction of IL-6 expression by PDGF BB in cultures of osteoblast enriched cells from 22-day fetal rat calvariae (Ob cells). We also
determined the regulatory elements of the rat IL-6 gene promoter responsible for the stimulatory effect of PDGF BB on IL-6 expression.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
The culture method used was described in
detail previously (23). Parietal bones were obtained from 22-day old
fetal rats immediately after the mothers were sacrificed by blunt
trauma to the nuchal area. This project was approved by the Animal Care and Use Committee of Saint Francis Hospital and Medical Center. Cells
were obtained by five sequential digestions of the parietal bone, using
bacterial collagenase (CLS II, Worthington Biochemical Corp., Freehold,
NJ). Cell populations harvested from the third to the fifth digestions
were previously shown to express osteoblastic characteristics and were
cultured as a pool (23). Ob cells were plated at a density of
8000-12,000 cells/cm2 and cultured in a humidified 5%
CO2 incubator at 37 °C, maintaining a pH of 7.5. Cells
were cultured in Dulbecco's modified Eagle's medium (DMEM)
supplemented with nonessential amino acids (Life Technologies, Inc.),
and 10% fetal bovine serum (Summit, Fort Collins, CO). For RNA and
nuclear protein analyses, cells were grown to confluence (~50,000
cells/cm2), transferred to serum-free medium for 20-24 h,
and then exposed to test agents in serum-free medium for 30 min to
4 h as indicated in the text and figure legends. For the nuclear
run-on experiment, subconfluent cultures of Ob cells were trypsinized,
subcultured at a 1:8 dilution, and grown to confluence in DMEM
supplemented with 10% fetal bovine serum. Cells were serum-deprived
for 24 h and treated for 15 and 30 min in serum-free DMEM. For
transient transfections, cells were grown to 70% confluence,
transfected in 10% fetal bovine serum, serum-deprived, and treated.
Recombinant human PDGF BB (Austral, San Ramon, CA) was added directly
to the culture medium. Cycloheximide (Sigma) was dissolved in ethanol and diluted 1:1000 in culture medium; an equal amount of ethanol was
added to control cultures.
Northern Blot Analysis--
Total cellular RNA was extracted
with the RNeasy Kit per the manufacturer's instructions (Qiagen,
Chatsworth, CA). The RNA recovered was quantitated by
spectrophotometry, and equal amounts of RNA from control or test
samples were loaded on a formaldehyde agarose gel following
denaturation. The gel was stained with ethidium bromide to visualize
ribosomal RNA (rRNA), documenting equal RNA loading of the various
experimental samples. RNA was then blotted onto Gene Screen Plus
charged nylon membrane (DuPont), and the uniformity of transfer was
documented by revisualization of rRNA. A 900-base pair (bp)
BamHI-PstI restriction fragment of rat IL-6 cDNA, and a 700-bp BamHI-SphI fragment of a
mouse 18 S rRNA cDNA clone (both from ATCC, Rockville, MD) were
purified by agarose gel electrophoresis (24). IL-6 and 18 S rRNA
cDNAs were labeled with [ -32P]dATP and
[ -32P]dCTP (50 µCi each at a specific activity of
3000 Ci/mmol; DuPont) using the random hexanucleotide primed second
strand synthesis method (25). Hybridizations were carried out at
42 °C for 16-48 h, and posthybridization washes were performed at
65 °C in 1× SSC for IL-6 and 0.1× SSC for 18 S. The bound
radioactive material was visualized by autoradiography on Kodak X-AR5
film (Eastman Kodak), employing Cronex Lightning Plus intensifying
screens (DuPont).
Heterogeneous Nuclear RNA (hnRNA)--
To examine changes in
IL-6 hnRNA, a sense strand intron 2-specific amplimer,
5'-GAATTGGGAATTCTCTGCTG-3' and an antisense strand intron 2 amplimer,
5'-GAAGGCCAAGAGATCTTACT-3', were synthesized in accordance with
published sequences (24). IL-6 hnRNA levels were determined by reverse
transcription-PCR (26). For this purpose, total RNA from control and
test samples was prepared as described for Northern analysis. One µg
of RNA was treated with amplification grade DNase I and
reverse-transcribed in the presence of the IL-6 intron 2 specific
antisense primer at 42 °C for 30 min with Moloney murine leukemia
virus reverse transcriptase (Life Technologies, Inc.). The newly
transcribed cDNA was amplified by 22 PCR cycles of 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min in the presence of the
IL-6 intron 2-specific sense primer described, Taq DNA
polymerase, and 5 µCi of [ -32P]dATP (3000 Ci/mmol,
DuPont). The PCR products were fractionated by electrophoresis on a 6%
polyacrylamide denaturing gel and visualized by autoradiography. An
internal DNA standard at a concentration of 20 fg was included in the
PCR to correct for variations in amplification. The standard was
obtained by amplification of SV40 promoter sequences in the pGL2-Basic
plasmid DNA (Promega, Madison, WI) using the composite sense primer
5'-GAATTGGGAATTCTCTGCTGattagtcagcaaccatagtc-3' and the antisense
primer 5'-GAAGGCCAAGAGATCTTACTggttccatcctctagaggat-3'. The uppercase
letters indicate IL-6 sequences, and the lowercase letters represent
pGL2-Basic plasmid sequences.
Nuclear Run-on Assay--
To examine changes in the rate of
transcription, nuclei were isolated by Dounce homogenization in a Tris
buffer, pH 7.4, containing 0.5% Nonidet P-40 (27). Nascent transcripts
were labeled by incubation of nuclei in a reaction buffer containing
500 µµ each adenosine, cytidine, and guanosine
triphosphates, 150 units of RNasin (Promega), and 250 µCi
[ -32P]UTP (800 Ci/mmol, DuPont) (27). RNA was isolated
by treatment with DNase I and proteinase K, followed by
phenol-chloroform extraction and ethanol precipitation. Linearized
plasmid DNA containing 1 µg of cDNA was immobilized onto
GeneScreen Plus by slot blotting according to the manufacturer's
directions (DuPont). The plasmid vector pGL2-Basic (Promega) was used
as a control for nonspecific hybridization, and a mouse 18 S rRNA
cDNA clone was used to estimate uniformity of the loading. Equal
counts per min of [32P]RNA from each sample were
hybridized to cDNAs at 42 °C for 72 h and washed in 1× SSC
at 58 °C for 30 min. Hybridized cDNAs were visualized by autoradiography.
Transient Transfections--
To determine changes in promoter
activity, chimeric constructs of the 5' flanking region of the IL-6
promoter and a luciferase reporter gene (kindly provided by Dr. G. Fey,
Erlanghen, Germany) were tested (28, 29). Ob cells were cultured to
approximately 70% confluence and transiently transfected by calcium
phosphate-DNA co-precipitation as described (29). Cotransfection with a
construct containing the cytomegalovirus promoter-driven
-galactosidase gene (CLONTECH, Palo Alto, CA)
was used to control for transfection efficiency. After 4 h, cells
were exposed for 3 min to 10% glycerol. Ob cells were allowed to
recover in serum-containing DMEM for 24 h, serum-deprived for
20-24 h, and exposed to control or test medium for 1-4 h as described
in the text and figure legends. Cells were washed with phosphate
buffered saline and harvested in reporter lysis buffer (Promega).
Luciferase activity was measured using a luciferase assay kit
(Promega), and -galactosidase activity was measured using Galacton
reagent (Tropix, Bedford, MA), both in accordance with manufacturer's
instructions. Luciferase activity was corrected for -galactosidase
activity, and data are expressed as treated:control ratios.
Site-directed Mutagenesis--
Site-directed mutagenesis was
performed by using the method of gene splicing by overlap extension or
using the Morph Mutagenesis kit (5 Prime 3 Prime, Inc., Boulder,
CO) (30). The Morph Mutagenesis kit was used in accordance with the
manufacturer's instructions to create targeted mutations of the cyclic
AMP-responsive element (CRE), within the multiple response element
(MRE), and of the nuclear factor for IL-6 (NF-IL-6) binding site. Gene
splicing by overlap extension was used to create mutations of the
nuclear factor- B (NF- B) site. For this purpose, wild-type and
mutant constructs were generated by PCR using a 5' primer containing a
sequence corresponding to bp 257 to 249 of the rat IL-6 promoter (5'-AGGCGAGCTCAAAGAAAGA-3') and a 3' primer that included bp +6 to +20
of the rat IL-6 gene (5'-CCGCTCGAGACAGAATGA-3'). A chimeric construct
containing bp 257 to + 20 of the IL-6 promoter was used as a
template. Mutant sense and antisense primers, used to synthesize the
intermediate products, contained two or three altered bases, creating
the desired targeted mutations (29). Newly synthesized wild-type and
mutated IL-6 promoter fragments were cloned into the plasmid pGL3-Basic
(Promega), containing the luciferase reporter gene. Sequences of the
wild-type and mutated constructs generated either by the Morph
Mutagenesis kit or by PCR were confirmed by DNA sequence analysis using
the Sequenase Version 2.0 DNA sequencing kit (United States Biochemical
Corp., Cleveland, OH).
Electrophoretic Mobility Shift Assay (EMSA)--
For gel shift
assays, nuclear extracts from control and treated cultures were
prepared as described (31). Cells were washed with phosphate buffered
saline, suspended in Hepes/KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol
buffer, allowed to swell on ice for 15 min, and lysed with 10% Nonidet
P-40 (Sigma). Following centrifugation, the nuclear pellet was
resuspended in a Hepes/KOH buffer in the presence of protease
inhibitors at 4 °C, incubated for 30 min, and centrifuged, and the
supernatant stored at 70 °C. Protein concentrations were
determined by DC protein assay in accordance with the manufacturer's
instructions (Bio-Rad). Synthetic oligonucleotides (Life Technologies,
Inc., or National Biosciences Inc., Plymouth, MN) were labeled with [ -32P]ATP using polynucleotide kinase. Nuclear
extracts and labeled oligonucleotides were incubated for 20 min at room
temperature in a 10 mM Tris buffer (pH 7.5), containing 1 µg of poly(dI-dC). The specificity of binding was determined by the
addition of homologous or mutated unlabeled synthetic oligonucleotides
in 100-fold excess (31). DNA-protein complexes were resolved on
nondenaturing, nonreducing 4% polyacrylamide gels, and the complexes
were visualized by autoradiography. For gel supershift assays, rabbit
affinity purified antibodies to Fos and Jun family of nuclear factors, activating transcription factor-2 (ATF-2), and other cyclic AMP response element-binding proteins (CREB-1, CREM-1, ATF-1, ATF-3, and
ATF-4) (Santa Cruz Biotechnology, Santa Cruz, CA) were incubated for
1 h with nuclear extracts at room temperature, prior to the addition of synthetic oligonucleotides and electrophoretic resolution.
Statistical Methods--
Data are presented as means ± S.E. Statistical differences were determined by analysis of variance
and post hoc examination by the Ryan-Einot-Gabriel-Welch F
test (32).
 |
RESULTS |
Northern blot analysis of total RNA from serum-deprived confluent
Ob cells revealed limited expression of IL-6 transcripts. Confirming
our initial observation, PDGF BB at 3.3 nM caused a marked
time-dependent stimulation of IL-6 mRNA levels, which
was maximal after 60 min (Fig. 1). To
determine whether the induction of IL-6 was dependent on protein
synthesis, Ob cells were treated with PDGF BB in the presence or
absence of the protein synthesis inhibitor, cycloheximide at 3.6 µM. Cycloheximide did not prevent the effect of PDGF BB
(Fig. 2). To analyze the mechanisms
involved in the regulation of IL-6, we examined the effects of PDGF BB on IL-6 hnRNA and on the rate of transcription of the IL-6 gene. PDGF
BB markedly increased IL-6 hnRNA after 30 min, and the effect was
sustained for 120 min (Fig. 3). PDGF BB
at 3.3 nM increased the rate of IL-6 transcription, as
determined by a nuclear run-on assay on nuclei from Ob cells, by
2-3-fold after 15 min (not shown) and by 6-fold after 30 min (Fig.
4).

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 1.
Effect of PDGF BB at 3.3 nM on
IL-6 mRNA levels in cultures of Ob cells treated for 30-180
min. Total RNA from control (C) or PDGF BB-treated
(BB) cells was subjected to Northern blot analysis and
hybridized with an -32P-labeled IL-6 cDNA. IL-6
transcripts of 1.2 and 2.4 kilobase pairs were visualized by
autoradiography. Blots were stripped and rehybridized with an
-32P-labeled 18 S rRNA cDNA. IL-6 transcripts are
shown in the upper panel, and 18 S rRNA transcripts are
shown in the lower panel.
|
|

View larger version (104K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of PDGF BB at 3.3 nM on
IL-6 mRNA levels, in the presence or absence of cycloheximide
(Cx) at 3.6 µM, in
cultures of Ob cells treated for 1 h. Total RNA from control
(C) or PDGF BB-treated (BB) cells was subjected
to Northern blot analysis and hybridized with an
-32P-labeled IL-6 cDNA. IL-6 transcripts of 1.2 and
2.4 kilobase pairs were visualized by autoradiography. Blots were
stripped and rehybridized with an -32P-labeled 18 S rRNA
cDNA. IL-6 transcripts are shown in the upper panel, and 18 S rRNA
transcripts are shown in the lower panel.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of PDGF BB at 3.3 nM on
IL-6 hnRNA levels in cultures of Ob cells treated for 30-240 min.
Total RNA from control (C) or PDGF BB-treated
(BB) cells was extracted, and 1 µg was subjected to
reverse transcription-PCR in the presence of IL-6 sense and antisense
intron 2 primers and -32P-dATP. Reverse
transcription-PCR products were fractionated by polyacrylamide gel
electrophoresis and visualized by autoradiography. Internal standard
(std) is shown at the top of the blot and IL-6
hnRNA at the bottom.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of PDGF BB at 3.3 nM on
IL-6 transcription rates in cultures of Ob cells treated for 30 min. Nascent transcripts from control (C) or PDGF BB
(BB)-treated cultures were labeled in vitro with
[ -32P]UTP, and the labeled RNA was hybridized to
immobilized cDNA for IL-6. 18 S rRNA cDNA was used to
demonstrate loading, and pGL2-Basic (pGL2-B) vector DNA was
used as a control for nonspecific hybridization.
|
|
To define gene elements responsible for the PDGF BB effect, Ob cells
were transiently transfected with chimeric constructs containing
fragments of the IL-6 promoter linked to the luciferase reporter gene.
The effects of PDGF BB at 3.3 nM were tested initially for
1-4 h on a bp 276 to +20 fragment of the rat IL-6 promoter. After
2 h, PDGF BB caused a 3.5-fold increase in promoter activity, an
effect sustained for 4 h (Fig. 5).
To characterize the regulatory elements involved, 5' deletion
constructs of the IL-6 promoter ranging from bp 2906 to +20 to bp
34 to +20 were tested in six independent experiments. 5' Deletions
from bp 2906 to bp 276 of the IL-6 promoter resulted in a decrease
in basal activity (not shown) but did not preclude the response to PDGF
BB, which induced the bp 276 to +20 promoter construct by about
3-fold (Fig. 6). Deletion to bp 257,
with the consequent removal of an AP-1 site, resulted in a partial loss
of the stimulatory effect by PDGF BB, so that it increased the activity
of the bp 257 to +20 IL-6 construct 2-fold (Fig. 6). These results
suggest that the AP-1 site between 276 and 257 is in part
responsible for the effect of PDGF BB, and that additional sequences
contained in the bp 257 to +20 region of the IL-6 promoter play a
role in the response to PDGF BB. To define additional elements
responsible for the regulation of IL-6 by PDGF BB, a bp 257 to +20
fragment of the IL-6 promoter was cloned into pGL3-Basic, and targeted mutations of the known consensus sequences of CRE, NF-IL-6, and NF- B
binding sites were made and tested. PDGF BB at 3.3 nM
increased the activity of the bp 257 to +20 wild-type IL-6 construct
by 1.5-2-fold (Fig. 7). Targeted
mutations of NF-IL-6 and NF- B did not result in a change in the
response to PDGF BB. In contrast, a mutation of the CRE resulted in a
total loss of the IL-6 promoter response to PDGF BB (Fig. 7).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of PDGF BB on IL-6 promoter activity
in transiently transfected Ob cells. Ob cells were transfected by
calcium phosphate-DNA co-precipitation with a chimeric construct
spanning bp 276 to +20 of the rat IL-6 promoter sequence linked to a
luciferase reporter gene. To control for transfection efficiency, a
cytomegalovirus- -galactosidase expression vector was co-transfected.
24 h after transfection, Ob cells were serum-deprived for 20-24 h
and exposed to control medium (white bars) or PDGF BB at 3.3 nM (black bars) for the indicated periods of
time. Cells were harvested, and luciferase activity was corrected for
-galactosidase activity and expressed as treated:control ratios for
each time point studied, following normalization of control values to
100%. Values are means ± S.E. of three observations. *,
significantly different from the respective control (p < 0.05).
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of PDGF BB on IL-6 promoter activity
in transiently transfected Ob cells. Ob cells were transfected by
calcium phosphate-DNA co-precipitation with chimeric constructs
containing fragments spanning the 2906 to +20 region of the rat IL-6
promoter sequence linked to a luciferase reporter gene. The 5' deletion
end points of the IL-6 promoter are indicated immediately under the
columns, and a diagram with selected putative
cis-regulatory elements present in the 276 to +20 region
of the IL-6 promoter is depicted at the bottom. To control
for transfection efficiency, a cytomegalovirus- -galactosidase
expression vector was co-transfected. 24 h after transfection, Ob
cells were serum-deprived for 20-24 h and exposed to control medium
(white columns) or PDGF BB at 3.3 nM
(black columns) for 4 h. Cells were harvested, and
luciferase activity was corrected for -galactosidase activity and
expressed as treated:control ratios for each construct, following
normalization of control values to 100%. Values are means ± S.E.
of 12-21 observations, pooled from six independent experiments. *,
significantly different from the respective control (p < 0.05).
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of PDGF BB on IL-6 promoter activity
in transiently transfected Ob cells. Ob cells were transfected by
calcium phosphate-DNA co-precipitation, with a chimeric construct
containing a bp 257 to +20 fragment of the IL-6 promoter, without
(wild-type (WT)) or with mutations of CRE, NF-IL-6, and
NF- B as indicated under the columns. A diagram of the
257 to +20 region of the IL-6 promoter outlining the location and
sequence of the three binding sites examined is depicted at the
bottom. Arrows point to mutations used to alter
CRE, NF-IL-6, and NF- B consensus sequences. Constructs were linked
to a luciferase reporter gene. To control for transfection efficiency,
a cytomegalovirus- -galactosidase expression vector was
co-transfected. 24 h after transfection, Ob cells were
serum-deprived for 20-24 h and exposed to control medium (white
columns) or PDGF BB at 3.3 nM (black
columns) for 4 h. Cells were harvested, and luciferase
activity was corrected for -galactosidase activity and expressed as
treated:control ratios for each construct following normalization of
control values to 100%. Values are means ± S.E. of 12 observations pooled from two experiments. *, significantly different
from the respective control (p < 0.05).
|
|
To confirm the functional data, nuclear extracts, obtained from control
and PDGF BB-treated cells, were incubated with radiolabeled oligonucleotides containing AP-1 and CRE/MRE sequences in the context
of the IL-6 promoter. Binding studies revealed increased protein
binding to AP-1 sequences in nuclear extracts from PDGF BB-treated
cultures (Fig. 8). Unlabeled homologous
oligonucleotides prevented, whereas mutated oligonucleotides did not
prevent, the binding of the 32P-labeled sequences to
nuclear proteins. Labeling was modestly increased with mutated
oligonucleotides, possibly due to a carrier effect of the
oligonucleotides in excess with a consequent increase in available
radiolabeled oligonucleotides for binding to nuclear proteins.
Antibodies to the Jun and Fos family of transcription factors decreased
and shifted the binding of nuclear proteins from PDGF BB-treated Ob
cells to the AP-1 consensus sequence, whereas antibodies to ATF-2 did
not (Fig. 9a). Supershift
assays using antibodies to specific members of the Fos and Jun families of transcription factors revealed that antibodies to Jun D, c-Fos, and,
to a lesser extent, Fra-2 decreased and shifted the binding of nuclear
proteins to AP-1 sequences in PDGF BB-treated Ob cells (Fig.
9b). Nuclear extracts from Ob cells bound to MRE sequences containing the CRE in the context of the IL-6 promoter. This binding was intensified in extracts from PDGF BB-treated cells, although the
effect was more modest than the one observed using AP-1 consensus sequences (Fig. 10). Homologous
unlabeled oligonucleotides competed for binding, whereas mutated
oligonucleotides did not. Antibodies to ATF-2 or to the Fos and Jun
family of transcription factors shifted the binding of nuclear proteins
from PDGF BB-treated cultures to MRE sequences containing the CRE (Fig.
11a). Antibodies known to
react with CREB-1, CREM-1, and ATF-1 (Fig. 11a) or with
CREB-2, ATF-3, and ATF-4 (not shown) did not alter the DNA protein
complex. Supershift assays using antibodies to specific members of the Jun and Fos families of transcription factors revealed that antibodies to c-Jun, Jun D, and c-Fos shifted the binding of MRE to nuclear proteins from PDGF BB-treated cells (Fig. 11b).

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of PDGF BB on nuclear proteins binding
to AP-1 sequences in the context of the IL-6 gene promoter.
Nuclear extracts from Ob cells exposed to control medium (C)
or PDGF BB (BB) at 3.3 nM for 30 min were
incubated with -32P-labeled oligonucleotides.
Incubations were performed in the absence or presence of a 100-fold
excess unlabeled homologous (TGCTGAGTCACTTTTA) (wild-type) or mutated
(TGCTGTATTGCTTTTA) (mutant) oligonucleotides as
indicated. DNA-protein complexes were fractionated by polyacrylamide
gel electrophoresis and visualized by autoradiography. The specific
DNA-protein complex is indicated by the arrow.
|
|

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of PDGF BB on nuclear proteins binding
to AP-1 sequences in the context of the IL-6 gene promoter.
Nuclear extracts from Ob cells exposed to control medium (C)
or PDGF BB (BB) at 3.3 nM for 30 min were
incubated with -32P-labeled oligonucleotides. In
a, incubations were performed in the absence ( ) or
presence of nonspecific (NS) antibodies or antibodies to
ATF-2 or to Jun or Fos family of nuclear proteins. In b,
incubations were performed in the absence ( ) or presence of
antibodies to specific members of the Fos and Jun family of
transcription factors. DNA-protein complexes were fractionated by
polyacrylamide gel electrophoresis and visualized by autoradiography.
The specific DNA-protein complex is indicated by the
arrow.
|
|

View larger version (104K):
[in this window]
[in a new window]
|
Fig. 10.
Effect of PDGF BB on nuclear proteins
binding to the MRE containing the cyclic AMP-responsive
element in the context of the IL-6 gene promoter. Nuclear extracts
from Ob cells exposed to control medium or PDGF BB at 3.3 nM for 30 min were incubated with
-32P-labeled oligonucleotides. Incubations were
performed in the absence or presence of a 100-fold excess of unlabeled
homologous (GATGCTAAATGACGTCACATTGTGCA) wild-type (WT) or
mutated (GATGCTAAATCCTGTCACATTGTGCA) (Mut)
oligonucleotides as indicated. DNA-protein complexes were fractionated
by polyacrylamide gel electrophoresis and visualized by
autoradiography. The specific DNA-protein complex is indicated by the
arrows.
|
|

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 11.
Effect of PDGF BB on nuclear proteins
binding to the MRE containing the cyclic AMP-responsive element in the
context of the IL-6 gene promoter. Nuclear extracts from Ob cells
exposed to control medium (C) or PDGF BB (BB) at
3.3 nM for 30 min were incubated with
-32P-labeled oligonucleotides. In a,
incubations were performed in the absence or presence of nonspecific
antibodies (NS); antibodies to ATF-2; an antibody (CREB-1)
that reacts with CREB-1, CREM-1, and ATF-1 (Experiment A (left
panel)); or antibodies to the Jun or Fos family of nuclear
proteins (Experiment B (right panel)). In b,
incubations were performed in the presence of nonspecific antibodies or
antibodies to specific members of the Fos or Jun family of
transcription factors. DNA-protein complexes were fractionated by
polyacrylamide gel electrophoresis and visualized by autoradiography.
The specific DNA-protein complex is indicated by the
arrow.
|
|
 |
DISCUSSION |
The present studies confirm that PDGF BB induces IL-6 expression
in Ob cells and demonstrate that PDGF BB acts by transcriptional mechanisms, because it increased IL-6 hnRNA, enhanced the rate of IL-6
transcription and IL-6 promoter activity (22). Using 5' deletion
constructs, we demonstrated that a bp 276 to +20 fragment of the IL-6
promoter is responsive to PDGF BB, and deletion of a region containing
an AP-1 binding site resulted in loss of activity. A second, less well
defined region of the IL-6 promoter spanning bp 257 to +20 also was
responsive to PDGF BB. This region contains important regulatory
sequences including a CRE within the MRE, and NF-IL-6 and NF- B
binding sites. These consensus sequences are necessary for the response
of IL-6 to IL-1, to IL-6 itself, and to tumor necrosis factor (29,
33, 34). In previous studies, we found that CRE/MRE, NF-IL-6, and
NF- B, but not the AP-1 binding site between 276 and 257, were
responsible for the autoinduction of IL-6 in osteoblasts (29). The
elements utilized by PDGF BB are distinct and include the AP-1 site in the bp 276 to 257 region, as well as the CRE within the MRE, because mutations of the CRE, but not of other sites in the bp 257 to
+20 region, prevented the activation of the IL-6 promoter by PDGF BB in
osteoblasts. EMSA confirmed the functional studies and indicated that
PDGF BB increased or activated nuclear proteins interacting with AP-1
and CRE sequences in the context of the IL-6 gene. Because the effect
of PDGF BB on IL-6 transcripts was not modified by cycloheximide, it is
probable that the mechanism involves activation and not de
novo protein synthesis of nuclear factors. This is also
substantiated by the almost immediate response of the IL-6 gene to PDGF BB.
The results presented reveal that classic members of the Fos and Jun
families of transcription factors interact with AP-1, as well as with
CRE sequences in the IL-6 gene, whereas the related ATF-2 interacts
only with CRE sequences, the known target sequence for this
transcription factor (35). ATF-2 is known to form heterodimers with
members of the Jun family of proteins, and our data suggest that this
may also be the case in osteoblasts exposed to PDGF BB (36, 37). It is
not surprising that PDGF BB activates a CRE by acting on ATF-2, because
PDGF does not increase cyclic AMP in osteoblasts and ATF-2 is not
dependent on cyclic AMP pathway activation (22, 35). Mice lacking c-Fos
develop osteopetrosis and decreased bone remodeling, and c-Fos appears
to be essential for osteoclast differentiation (38, 39). Consequently,
its involvement in IL-6 transcriptional regulation is not unexpected in
view of the role of IL-6 on osteoclast recruitment and bone resorption
(12, 13). The induction or activation of Fos and Jun by PDGF BB also is
consistent with the mitogenic activity of the growth factor in skeletal
cells (40). Furthermore, maximal expression of members of the AP-1
family of nuclear factors occurs during replication of cells of the
osteoblastic lineage and declines as the cells differentiate, a
function decreased by PDGF BB (11, 41). The importance in skeletal
physiology of ATF-2 is substantiated by the wide distribution of ATF-2
consensus sequences among genes expressed by osteoblasts and by recent
studies in ATF-2-deficient mice demonstrating that this nuclear factor
is required for skeletal and neurological development (42).
PDGF is known to act through different signaling systems and may use
PKC, protein kinase A (PKA), and intracellular
calcium-dependent pathways (43, 44). The different signal
transduction pathways involved in the response to PDGF BB depend not
only on the cell type but also on the gene regulated. Our previous
studies demonstrated that PDGF BB induced IL-6 in osteoblasts by PKC
and intracellular calcium-dependent pathways (22).
PKA-dependent pathways do not play a role in the effects of
PDGF BB in Ob cells, because the growth factor does not increase cyclic
AMP levels in these cells (22). The current studies are in agreement
with our earlier observations and confirm the relevance of
PKC-dependent pathways, utilized to activate members of the
AP-1 complex, in the IL-6 induction by PDGF BB. Changes in
intracellular calcium, as well as PKA pathways, can activate the CRE,
and calcium-dependent pathways induced by PDGF BB may
activate this site independently of ATF-2 (35).
PKA-dependent pathways may be relevant to the effect of other agents on IL-6 expression, such as parathyroid hormone, which
acts through PKA and intracellular calcium-dependent
pathways and stimulates IL-6 synthesis in osteoblasts (14, 15, 22, 45-47). The elements utilized by parathyroid hormone to regulate IL-6
transcription have not been reported, but despite different signaling
pathways, they might be similar to those utilized by PDGF. Cyclic
AMP-dependent pathways are utilized by parathyroid hormone
to induce c-Fos in osteoblastic cells and c-Fos plays a role in IL-6
transcription and binds to CRE as well as to AP-1 consensus sequences
(48).
In conclusion, the present studies demonstrate that PDGF BB increases
IL-6 transcription in osteoblastic cells by activating or inducing
members of the AP-1 complex and ATF-2. The stimulation of IL-6 by PDGF
BB may play a central role in the effects of PDGF on bone resorption
and remodeling.
 |
ACKNOWLEDGEMENTS |
We thank Dr. G. Fey for providing IL-6
promoter constructs, Cathy Boucher and Kris Sasala for technical
assistance, and Charlene Gobeli for secretarial help.
 |
FOOTNOTES |
*
This work was supported by Grant AR21707 from NIAMS,
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by fellowship awards from the Catherine Weldon
Donaghue Foundation and the Belgian Bone Club.
To whom correspondence should be addressed: Dept. of Research,
Saint Francis Hospital and Medical Center, 114 Woodland St., Hartford,
CT 06105-1299. Tel.: 860-714-4068; Fax: 860-714-8053; E-mail:
ecanalis{at}stfranciscare.org.
 |
ABBREVIATIONS |
The abbreviations used are:
PDGF, platelet-derived growth factor;
MRE, multiple response element;
PKC, protein kinase C;
PKA, protein kinase A;
IL, interleukin;
AP, activator
protein;
bp, base pair(s);
DMEM, Dulbecco's modified Eagle's medium;
CRE, cyclic AMP-responsive element;
CREB, CRE-binding protein;
NF, nuclear factor;
ATF, activating transcription factor;
hnRNA, heterogeneous nuclear RNA;
PCR, polymerase chain reaction.
 |
REFERENCES |
-
Hart, C. E.,
Mason, B.,
Curtis, D. A.,
Osborn, S.,
Raines, E.,
Ross, R.,
and Forstrom, J. W.
(1990)
Biochemistry
29,
166-172[CrossRef][Medline]
[Order article via Infotrieve]
-
Rydziel, S.,
Ladd, C.,
McCarthy, T. L.,
Centrella, M.,
and Canalis, E.
(1992)
Endocrinology
130,
1916-1922[Abstract/Free Full Text]
-
Rydziel, S.,
and Canalis, E.
(1996)
Endocrinology
137,
4115-4119[Abstract]
-
Graves, D. T.,
Owen, A. J.,
Barth, R. K.,
Tempst, P.,
Winoto, A.,
Fors, L.,
Hood, L. E.,
and Antoniades, H. N.
(1984)
Science
226,
972-974[Abstract/Free Full Text]
-
Heldin, C. H.,
and Westermark, B.
(1987)
J. Cell. Physiol. Suppl.
5,
S31-S34
-
Claesson-Welsh, L.,
and Heldin, C. H.
(1989)
Acta Oncol.
28,
331-334[Medline]
[Order article via Infotrieve]
-
Centrella, M.,
McCarthy, T. L.,
Kusmik, W. F.,
and Canalis, E.
(1991)
J. Cell. Physiol.
147,
420-426[CrossRef][Medline]
[Order article via Infotrieve]
-
Canalis, E.,
McCarthy, T. L.,
and Centrella, M.
(1989)
J. Cell. Physiol.
140,
530-537[CrossRef][Medline]
[Order article via Infotrieve]
-
Centrella, M.,
McCarthy, T. L.,
and Canalis, E.
(1989)
Endocrinology
125,
13-19[Abstract/Free Full Text]
-
Cochran, D. L.,
Rouse, C. A.,
Lynch, S. E.,
and Graves, D. T.
(1993)
Bone
14,
53-58[Medline]
[Order article via Infotrieve]
-
Hock, J. M.,
and Canalis, E.
(1994)
Endocrinology
134,
1423-1428[Abstract/Free Full Text]
-
Roodman, G. D.
(1992)
J. Bone Miner. Res.
7,
475-478[Medline]
[Order article via Infotrieve]
-
Jilka, R. L.,
Hangoc, G.,
Girasole, G.,
Passeri, G.,
Williams, D. C.,
Abrams, J. S.,
Boyce, B.,
Broxmeyer, H.,
and Manolagas, S. C.
(1992)
Science
257,
88-91[Abstract/Free Full Text]
-
Feyen, J. H.,
Elford, P.,
Di Padova, F. E.,
and Trechsel, U.
(1989)
J. Bone Miner. Res.
4,
633-638[Medline]
[Order article via Infotrieve]
-
Franchimont, N.,
Vrindts, Y.,
Gaspar, S.,
Lopez, M.,
Gathy, R.,
DeGroote, D.,
Reginster, J. Y.,
and Franchimont, P.
(1993)
in
Proceedings 1993: Fourth International Symposium on Osteoporosis and Consensus Development Conference (Christiansen, C., and Riis, B., eds), pp. 249-250, Handelstrykkeriet Aalborg ApS/Aalborg, Denmark
-
Helle, M.,
Brakenhoff, J. P. J.,
DeGroot, E. R.,
and Aarden, L. A.
(1988)
Eur. J. Immunol.
18,
957-959[Medline]
[Order article via Infotrieve]
-
Littlewood, A. J.,
Russell, J.,
Harvey, G. R.,
Hughes, D. E.,
Russell, R. G. G.,
and Gowen, M.
(1991)
Endocrinology
129,
1513-1520[Abstract/Free Full Text]
-
Lorenzo, J. A.,
Naprta, A.,
Rao, Y.,
Alander, C.,
Glaccum, M.,
Widmer, M.,
Gronowicz, G.,
Kalinowski, J.,
and Pilbeam, C. C.
(1998)
Endocrinology
139,
3022-3025[Abstract/Free Full Text]
-
Pacifici, R.
(1998)
Endocrinology
139,
2659-2660[Free Full Text]
-
Frieling, J. T. M.,
Sauerwein, R. W.,
Wijdenes, J.,
Hendriks, T.,
and van der Linden, C. J.
(1994)
Cytokine
6,
376-381[CrossRef][Medline]
[Order article via Infotrieve]
-
Girasole, G.,
Pedrazzoni, M.,
Giuliani, N.,
Passeri, G.,
and Passeri, M.
(1995)
J. Bone Miner. Res.
10,
S160
-
Franchimont, N.,
and Canalis, E.
(1995)
Endocrinology
136,
5469-5475[Abstract]
-
McCarthy, T. L.,
Centrella, M.,
and Canalis, E.
(1988)
J. Bone Miner. Res.
3,
401-408[Medline]
[Order article via Infotrieve]
-
Northemann, W.,
Braciak, T. A.,
Hattori, M.,
Lee, F.,
and Fey, G. H.
(1989)
J. Biol. Chem.
264,
16072-16082[Abstract/Free Full Text]
-
Feinberg, A. P.,
and Vogelstein, B.
(1984)
Anal. Biochem.
137,
266-267[CrossRef][Medline]
[Order article via Infotrieve]
-
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1995)
Current Protocols in Molecular Biology: Preparation and Analysis of RNA, pp. 4.10.5-4.10.9, John Wiley and Sons Inc., New York
-
Greenberg, M. E.,
and Ziff, E. B.
(1984)
Nature
311,
433-438[CrossRef][Medline]
[Order article via Infotrieve]
-
Baffet, G.,
Braciak, T. A.,
Fletcher, R. G.,
Gauldie, J.,
Fey, G. H.,
and Northemann, W.
(1991)
Mol. Biol. Med.
8,
141-156[Medline]
[Order article via Infotrieve]
-
Franchimont, N.,
Rydziel, S.,
and Canalis, E.
(1997)
J. Clin. Invest.
100,
1797-1803[Medline]
[Order article via Infotrieve]
-
Horton, R. M.
(1993)
in
Methods in Molecular Biology (White, B. A., ed), Vol. 15, pp. 251-261, Humana Press Inc., Totowa, NJ
-
Scott, V.,
Clark, A. R.,
and Docherty, K.
(1994)
in
Methods in Molecular Biology (Harwood, A. J., ed), Vol. 31, pp. 339-347, Humana Press Inc., Totowa, NJ
-
Wall, F. J.
(1986)
Statistical Data Analysis Handbook, 1st Ed, McGraw-Hill, New York
-
Seghal, P. B.
(1992)
Res. Immunol.
143,
724-734[CrossRef][Medline]
[Order article via Infotrieve]
-
Akira, S.,
Isshiki, H.,
Nakajima, T.,
Kinoshita, S.,
Nishio, Y.,
Hashimoto, S.,
Natsuka, S.,
and Kishimoto, T.
(1992)
in
Interleukins: Molecular Biology and Immunology (Kishimoto, T., ed), Vol. 51, pp. 299-322, Karger, Basel, Switzerland
-
Meyer, T. E.,
and Habener, J. F.
(1993)
Endocr. Rev.
14,
269-290[Abstract/Free Full Text]
-
Hai, I.,
and Curran, T.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3720-3724[Abstract/Free Full Text]
-
Morooka, H.,
Bonventre, J. V.,
Pombo, C. M.,
Kyriakis, J. M.,
and Force, T.
(1995)
J. Biol. Chem.
270,
30084-30092[Abstract/Free Full Text]
-
Wang, Z. Q.,
Ovitt, C.,
Grigoriadis, A. E.,
Möhle-Steinlein, U.,
Rüther, U.,
and Wagner, E. F.
(1992)
Nature
360,
471-745[CrossRef][Medline]
[Order article via Infotrieve]
-
Grigoriadia, A. E.,
Wang, Z. Q.,
Cecchini, M. G.,
Hofstetter, W.,
Felix, R.,
Fleisch, H. A.,
and Wagner, E. F.
(1994)
Science
266,
443-447[Abstract/Free Full Text]
-
Angel, P.,
and Karin, M.
(1990)
Biochim. Biophys. Acta
1072,
129-157
-
McCabe, L. R.,
Banerjee, C.,
Kundu, R.,
Harrison, R. J.,
Dobner, P. R.,
Stein, J. L.,
Lian, J. B.,
and Stein, G. S.
(1996)
Endocrinology
137,
4398-4408[Abstract]
-
Reimold, A. M.,
Grusby, M. J.,
Kosaras, B.,
Fries, J. W. U.,
Mori, R.,
Maniwa, S.,
Glauss, R. M.,
Collins, T.,
Sidman, R. L.,
Glimcher, M. J.,
and Glimcher, L. H.
(1996)
Nature
379,
262-265[CrossRef][Medline]
[Order article via Infotrieve]
-
Claesson-Welsh, L.
(1994)
J. Biol. Chem.
269,
32023-32026[Free Full Text]
-
Rothman, A.,
Wolner, B.,
Button, D.,
and Taylor, P.
(1994)
J. Biol. Chem.
269,
6399-6404[Abstract/Free Full Text]
-
Chase, L.,
and Aurbach, G. D.
(1970)
J. Biol. Chem.
245,
1520-1526[Abstract/Free Full Text]
-
Partridge, N. C.,
Bloch, S. R.,
and Pearman, A. T.
(1994)
J. Cell. Biochem.
55,
321-327[CrossRef][Medline]
[Order article via Infotrieve]
-
Greenfield, E. M.,
Gornik, S. A.,
Horowitz, M. C.,
Donahue, H. J.,
and Shaw, S. M.
(1993)
J. Bone Miner. Res.
8,
1163-1171[Medline]
[Order article via Infotrieve]
-
Pearman, A. T.,
Chou, W. Y.,
Bergman, K. D.,
Pulumati, M. R.,
and Partridge, N. C.
(1996)
J. Biol. Chem.
271,
25715-25721[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C W Li, W Cheung, Z B Lin, T Y Li, J T Lim, and D Y Wang
Oral steroids enhance epithelial repair in nasal polyposis via upregulation of the AP-1 gene network
Thorax,
April 1, 2009;
64(4):
306 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Fukaya, H. Shimada, L.-C. Wang, E. Zandi, and Y. A. DeClerck
Identification of Galectin-3-binding Protein as a Factor Secreted by Tumor Cells That Stimulates Interleukin-6 Expression in the Bone Marrow Stroma
J. Biol. Chem.,
July 4, 2008;
283(27):
18573 - 18581.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. O. Hollinger, C. E. Hart, S. N. Hirsch, S. Lynch, and G. E. Friedlaender
Recombinant Human Platelet-Derived Growth Factor: Biology and Clinical Applications
J. Bone Joint Surg. Am.,
February 1, 2008;
90(Supplement_1):
48 - 54.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Inouye, M. Fujimoto, T. Nakamura, E. Takaki, N. Hayashida, T. Hai, and A. Nakai
Heat Shock Transcription Factor 1 Opens Chromatin Structure of Interleukin-6 Promoter to Facilitate Binding of an Activator or a Repressor
J. Biol. Chem.,
November 9, 2007;
282(45):
33210 - 33217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Broderick, T. Zhang, H. Rangaswami, Y. Zeng, X. Zhao, G. R. Boss, and R. B. Pilz
Guanosine 3',5'-Cyclic Monophosphate (cGMP)/cGMP-Dependent Protein Kinase Induce Interleukin-6 Transcription in Osteoblasts
Mol. Endocrinol.,
May 1, 2007;
21(5):
1148 - 1162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Takanaga, T. Yoshitake, S. Hara, C. Yamasaki, and M. Kunimoto
cAMP-induced Astrocytic Differentiation of C6 Glioma Cells Is Mediated by Autocrine Interleukin-6
J. Biol. Chem.,
April 9, 2004;
279(15):
15441 - 15447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Monje, M. J. Marinissen, and J. S. Gutkind
Phosphorylation of the Carboxyl-Terminal Transactivation Domain of c-Fos by Extracellular Signal-Regulated Kinase Mediates the Transcriptional Activation of AP-1 and Cellular Transformation Induced by Platelet-Derived Growth Factor
Mol. Cell. Biol.,
October 1, 2003;
23(19):
7030 - 7043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. J. Elenitoba-Johnson, S. D. Jenson, R. T. Abbott, R. A. Palais, S. D. Bohling, Z. Lin, S. Tripp, P. J. Shami, L. Y. Wang, R. W. Coupland, et al.
Involvement of multiple signaling pathways in follicular lymphoma transformation: p38-mitogen-activated protein kinase as a target for therapy
PNAS,
June 10, 2003;
100(12):
7259 - 7264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-J. Ventura, N. J. Kennedy, J. A. Lamb, R. A. Flavell, and R. J. Davis
c-Jun NH2-Terminal Kinase Is Essential for the Regulation of AP-1 by Tumor Necrosis Factor
Mol. Cell. Biol.,
April 15, 2003;
23(8):
2871 - 2882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Guillen, P. Martinez, A. R. de Gortazar, M. E. Martinez, and P. Esbrit
Both N- and C-terminal Domains of Parathyroid Hormone-related Protein Increase Interleukin-6 by Nuclear Factor-kappa B Activation in Osteoblastic Cells
J. Biol. Chem.,
July 26, 2002;
277(31):
28109 - 28117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mann, F. Oakley, P. W. M. Johnson, and D. A. Mann
CD40 Induces Interleukin-6 Gene Transcription in Dendritic Cells. REGULATION BY TRAF2, AP-1, NF-kappa B, AND CBF1
J. Biol. Chem.,
May 3, 2002;
277(19):
17125 - 17138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Kosmidou, T. Vassilakopoulos, A. Xagorari, S. Zakynthinos, A. Papapetropoulos, and C. Roussos
Production of Interleukin-6 by Skeletal Myotubes . Role of Reactive Oxygen Species
Am. J. Respir. Cell Mol. Biol.,
May 1, 2002;
26(5):
587 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.J. Webb, J.R. McPherson, K. Pahan, and S. Koka
Regulation of TNF-{alpha}-induced IL-6 Production in MG-63 Human Osteoblast-like Cells
Journal of Dental Research,
January 1, 2002;
81(1):
17 - 22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Ellington, A. Elhofy, K. L. Bost, and M. C. Hudson
Involvement of Mitogen-Activated Protein Kinase Pathways in Staphylococcus aureus Invasion of Normal Osteoblasts
Infect. Immun.,
September 1, 2001;
69(9):
5235 - 5242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Reimold, J. Kim, R. Finberg, and L. H. Glimcher
Decreased immediate inflammatory gene induction in activating transcription factor-2 mutant mice
Int. Immunol.,
February 1, 2001;
13(2):
241 - 248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. R. Pela, M. E. S. Ferreira, M. C. C. Melo, C. A. A. Silva, M. M. Coelho, and C. F. Valenzuela
Evidence that platelet-derived growth factor may be a novel endogenous pyrogen in the central nervous system
Am J Physiol Regulatory Integrative Comp Physiol,
May 1, 2000;
278(5):
R1275 - R1281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Manolagas
Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis
Endocr. Rev.,
April 1, 2000;
21(2):
115 - 137.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. Durante, K. J. Peyton, and A. I. Schafer
Platelet-Derived Growth Factor Stimulates Heme Oxygenase-1 Gene Expression and Carbon Monoxide Production in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol.,
November 1, 1999;
19(11):
2666 - 2672.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mesri and D. C. Altieri
Leukocyte Microparticles Stimulate Endothelial Cell Cytokine Release and Tissue Factor Induction in a JNK1 Signaling Pathway
J. Biol. Chem.,
August 13, 1999;
274(33):
23111 - 23118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Smart, K. J. Vincent, M. J. P. Arthur, O. Eickelberg, M. Castellazzi, J. Mann, and D. A. Mann
JunD Regulates Transcription of the Tissue Inhibitor of Metalloproteinases-1 and Interleukin-6 Genes in Activated Hepatic Stellate Cells
J. Biol. Chem.,
June 22, 2001;
276(26):
24414 - 24421.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|