Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asano, S.
Right arrow Articles by Takeguchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asano, S.
Right arrow Articles by Takeguchi, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 11, 6848-6854, March 12, 1999


A Chimeric Gastric H+,K+-ATPase Inhibitable with Both Ouabain and SCH 28080*

Shinji AsanoDagger , Saiko Matsuda§, Satomi Hoshina§, Shinya Sakamoto§, and Noriaki Takeguchi§

From the Molecular Genetics Research Center and the § Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, 2630 Sugitani, Toyama 930-0194, Japan

    ABSTRACT
Top
Abstract
Introduction
References

2-Methyl-8-(phenylmethoxy)imidazo(1,2-a)pyridine-3acetonitrile (SCH 28080) is a K+ site inhibitor specific for gastric H+,K+-ATPase and seems to be a counterpart of ouabain for Na+,K+-ATPase from the viewpoint of reaction pattern (i.e. reversible binding, K+ antagonism, and binding on the extracellular side). In this study, we constructed several chimeric molecules between H+,K+-ATPase and Na+,K+-ATPase alpha -subunits by using rabbit H+,K+-ATPase as a parental molecule. We found that the entire extracellular loop 1 segment between the first and second transmembrane segments (M1 and M2) and the luminal half of the M1 transmembrane segment of H+,K+-ATPase alpha -subunit were exchangeable with those of Na+,K+-ATPase, respectively, preserving H+,K+-ATPase activity, and that these segments are not essential for SCH 28080 binding. We found that several amino acid residues, including Glu-822, Thr-825, and Pro-829 in the M6 segment of H+,K+-ATPase alpha -subunit are involved in determining the affinity for this inhibitor. Furthermore, we found that a chimeric H+,K+-ATPase acquired ouabain sensitivity and maintained SCH 28080 sensitivity when the loop 1 segment and Cys-815 in the loop 3 segment of the H+,K+-ATPase alpha -subunit were simultaneously replaced by the corresponding segment and amino acid residue (Thr) of Na+,K+-ATPase, respectively, indicating that the binding sites of ouabain and SCH 28080 are separate. In this H+,K+-ATPase chimera, 12 amino acid residues in M1, M4, and loop 1-4 that have been suggested to be involved in ouabain binding of Na+,K+-ATPase alpha -subunit are present; however, the low ouabain sensitivity indicates the possibility that the sensitivity may be increased by additional amino acid substitutions, which shift the overall structural integrity of this chimeric H+,K+-ATPase toward that of Na+,K+-ATPase.

    INTRODUCTION
Top
Abstract
Introduction
References

H+,K+-ATPase, the proton pump responsible for gastric acid secretion (1), is the target molecule for proton pump inhibitors such as omeprazole (2), rabeprazole (E3810) (3), and SCH 280801 (4). SCH 28080 is a reversible inhibitor of gastric H+,K+-ATPase, which competitively binds to the luminal K+ high affinity site of the enzyme (5). This inhibitor discriminates the K+ site of H+,K+-ATPase from that of Na+,K+-ATPase, because it has little effect on Na+,K+-ATPase activity (6). H+,K+-ATPase isoforms found in rat and guinea pig distal colons are resistant to SCH 28080 (7, 8). The binding site of SCH 28080 in the gastric H+,K+-ATPase was previously studied by using a photoaffinity derivative of this inhibitor, 8-[(4-azidophenyl)-methoxy]-1-tritiomethyl-2,3-dimethylamidazo (1,2-a)pyridinium iodide, and it was reported that the binding site was in loop 1 between the transmembrane segments M1 and M2 of H+,K+-ATPase alpha -subunit (9). Furthermore, the binding site was hypothesized to be Phe-126 and Asp-138, at the edge of the loop 1 segment from the computer-generated model (9). The corresponding loop in Na+,K+-ATPase is known to be involved in determining the affinity for ouabain (10). Recently, we examined the SCH 28080 binding site by site-directed mutagenesis and found that the putative binding sites of SCH 28080, Phe-126 and Asp-138, are not involved in the interaction with SCH 28080, and we proposed that Glu-822 in the transmembrane segment M6 is involved in determining the affinity for this inhibitor (11). Lyu and Farley (12) found that when the luminal half of the M1 transmembrane segment of Na+,K+-ATPase alpha -subunit (Ile99-Ile110) was replaced by the counterpart of gastric H+,K+-ATPase (Val115-Ile126), this chimeric Na+,K+-ATPase showed high affinity for SCH 28080. Here, we newly prepared the opposite chimera, in which the loop 1 segment or the luminal half of the M1 segment of rabbit H+,K+-ATPase alpha -subunit was replaced by the counterparts of sheep Na+,K+-ATPase, respectively, and we also prepared several mutants in the M6 transmembrane segment and studied their sensitivity to the inhibitor.

The amino acid residues in Na+,K+-ATPase involved in determining the affinity for ouabain have been proposed to be located on the M1 segment (13-15), which is close to or on the first extracellular loop (10), and on the second, third, and fourth extracellular loops of the alpha -subunit (16-20). Here, we introduced these amino acid residues into the corresponding positions of gastric H+,K+-ATPase and studied the sensitivity of this chimeric H+,K+-ATPase to ouabain.

    EXPERIMENTAL PROCEDURES

Materials-- HEK-293 cells (human embryonic kidney cell line) were a kind gift from Dr. Jonathan Lytton (Brigham & Women's Hospital, Harvard Medical School, Boston, MA). pcDNA3 vector was obtained from Invitrogen Co. (San Diego, CA). Pfu DNA polymerase was obtained from Stratagene. Restriction enzymes and other DNA and RNA modifying enzymes were from Toyobo (Osaka, Japan), New England Biolabs, Life Technologies, Inc., or Amersham Pharmacia Biotech Inc. (Tokyo, Japan). SCH 28080 was obtained from Schering Co.(Keniworth, NJ). All other reagents were of molecular biology grade or the highest grade of purity available.

Na+,K+-ATPase preparation purified with deoxycholate from pig kidney was a kind gift from Dr. K. Taniguchi (Hokkaido University, Japan). cDNAs of the alpha - and beta -subunits of rat Na+,K+-ATPase in pBluescript SK(+) vector were kind gifts from Dr. M. J. Caplan (Yale University, New Haven, CT).

cDNAs of the alpha - and beta -subunits of H+,K+-ATPase were prepared from rabbit gastric mucosae and subcloned into pcDNA3 expression vector as described previously (21).

Site-directed Mutagenesis and Chimera Construction-- Introduction of site-directed mutations in the loop 1 domain and M1 segment of the H+,K+-ATPase alpha -subunit was carried out by sequential PCR steps as described elsewhere (11), in which appropriately mutated alpha -subunit cDNAs (segments between the EcoRI site (nucleotide -28) and the BstEII site (nucleotide 456)) were prepared. The 5'-flanking sense and 3'-flanking antisense primers were 5'-CCGAATTCAAGGAGGGCAGCGCAGCGAG-3' (nucleotides -28 to -9) (the EcoRI site is underlined) and 5'-GCCTCGAGCTCGGATCACCGTGGCTTGC-3' (nucleotides 534-553) (the XhoI site is underlined), respectively. Sense and antisense synthetic oligonucleotides, each 21-24 bases long, containing one to five mutated bases near the center, were designed. The cDNA of H+,K+-ATPase alpha -subunit in pBluescript SK(-) was used as a PCR template. PCR was routinely carried out in the presence of 200 µM each dNTP, 500 nM primers, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 20 mM Tris-HCl, pH 8.8, 0.1% Triton X-100, 100 µg/ml bovine serum albumin, and 2.5 units of Pfu DNA polymerase for 30 cycles. DNA sequencing was done by the dideoxy chain termination method using an Autoread DNA sequencing kit and an ALFexpress DNA sequencer (Amersham Pharmacia Biotech). After sequencing, the fragment amplified in the final PCR was digested with EcoRI and BstEII and ligated back into the relevant position of the wild-type H+,K+-ATPase alpha -subunit construct. Construction of chimeric H+,K+-ATPase cDNAs were carried out by two or three repetitions of site-directed mutagenesis.

Construction of chimeric Na+,K+-ATPase cDNA was carried out by sequential PCR steps as described above, in which appropriately mutated alpha -subunit cDNAs (segments between the ClaI site (attached to nucleotide -81) and the Csp45I site (nucleotide 515)) were prepared. The 5'-flanking sense and 3'-flanking antisense primers used were GGATCGATACTCTCCCAGCCGGGAGCTGC (nucleotides -81 to -61) (the ClaI site is underlined) and CGTTGATGCTCATCTTCTCTCC (nucleotides 523-543), respectively. Sense and antisense chimeric primers were 50 bases long: CTGCCATCTGCCTCATCGCCTTTGCCATCC-GAAGTGCTACAGAAGAGGAA and GCGATGAGGCAGATGGCAGCCGCCACCCACAGTAACATGGAGAAGCCACC, respectively (H+,K+ATPase portions are underlined). The cDNA of rat Na+,K+-ATPase alpha -subunit in pBluescript SK(+) vector was used as a PCR template. After sequencing, the fragment amplified in the final PCR was digested with ScaI (site in the vector) and Csp45I and ligated back into the relevant position of the wild-type Na+,K+-ATPase alpha -subunit cDNA construct. The chimeric Na+,K+-ATPase cDNA was digested with XbaI and HincII. The obtained fragment was ligated into pcDNA3 vector treated with XbaI and EcoRV.

Cell Culture, Transfection, and Preparation of Membrane Fractions-- Cell culture of HEK-293 was carried out as described previously (21). alpha - and beta -subunit cDNA transfection was performed by the calcium phosphate method with 10 µg of cesium chloride-purified DNA per 10-cm dish. Cells were harvested 2 days after the DNA transfection. Membrane fractions of HEK cells were prepared as described previously (21).

SDS-Polyacrylamide Gel Electrophoresis and Immunoblot-- SDS-polyacrylamide gel electrophoresis was carried out as described elsewhere (22). Membrane preparations (30 µg protein) were incubated in a sample buffer containing 2% SDS, 2% beta -mercaptoethanol, 10% glycerol, and 10 mM Tris-HCl, pH 6.8, at room temperature for 2 min and applied to the SDS-polyacrylamide gel. Immunoblot was carried out as described previously (21).

Antibody Ab1024 was previously raised against the carboxyl-terminal peptide (residues 1024-1034) of the H+,K+-ATPase alpha -subunit (PGSWWDQELYY) (23).

Assay of H+,K+-ATPase Activity-- ATPase activity was assayed in 1 ml of a solution containing 50 µg of membrane protein, 3 mM MgCl2, 3 mM ATP, 5 mM NaN3, 2 mM ouabain, and 40 mM Tris-HCl, pH 7.4, in the presence and absence of 15 mM KCl. After incubation at 37 °C for 30 min, the reaction was terminated by the addition of ice-cold stop solution containing 12% perchloric acid and 3.6% ammonium molybdate. Inorganic phosphate released was measured from the absorbance at the wavelength of 320 nm as described elsewhere (24). The K+-ATPase activity was calculated as the difference between activities in the presence and absence of KCl. In experiments measuring the ouabain sensitivity of the K+-ATPase, we used 0.5 µM oligomycin instead of NaN3, and measured the K+-ATPase activity in the absence of Na+ and in the presence of various concentrations of ouabain. When indicated, inhibitors, such as SCH 28080, ouabain, or digoxin, were added, and the enzyme activity was measured as a function of the inhibitor concentration. The value of IC50 was determined from a smoothly fitting curve that was drawn using the KaleidaGraph program (Synergy Software, Reading, PA).

Assay of Na+,K+-ATPase Activity-- ATPase activity was assayed in 1 ml of a solution containing 10 µg of membrane protein or 1 µg of pig kidney Na+,K+-ATPase preparation, 3 mM MgCl2, 3 mM ATP, 5 mM NaN3, 120 mM NaCl, and 40 mM Tris-HCl, pH 7.4, in the presence of various concentrations of ouabain and in the presence and absence of 15 mM KCl. Inorganic phosphate released from ATP at 37 °C for 30 min (for membrane preparation) or 10 min (for Na+,K+-ATPase preparation) was measured as described in the assay of H+,K+-ATPase activity. Na+,K+-ATPase activity was calculated as the difference between ATPase activities in the presence and absence of KCl.

Protein was measured using the BCA protein assay kit from Pierce with bovine serum albumin as a standard.

    RESULTS

SCH 28080 Sensitivity of H+,K+-ATPases with Mutations in the Loop 1 Segment-- Here, we prepared chimeras between gastric H+,K+-ATPase and Na+,K+-ATPase alpha -subunits, in which 3 or 8 consecutive amino acid residues of the loop 1 segment of the H+,K+-ATPase alpha -subunit were replaced by the counterparts of Na+,K+-ATPase or colonic H+,K+-ATPase alpha -subunit. Fig. 1 shows the alignment of amino acid sequences around the loop 1 of the wild-type rabbit H+,K+-ATPase and sheep Na+,K+-ATPase alpha -subunits, and the chimeric H+,K+-ATPases (Chimeras 1, 2, and 3). In Chimera 1, three amino acids (131SEG133) at the amino-terminal portion of the loop 1 of H+,K+-ATPase were replaced by the counterpart (ATE) of Na+,K+-ATPase. In Chimera 2, eight amino acids (from Ser-131 to Asp-138) in the entire loop 1 of H+,K+-ATPase were replaced by the counterpart of Na+,K+-ATPase. In Chimera 3, three amino acids (135LTT137) at the carboxyl-terminal portion of the loop 1 of H+,K+-ATPase were replaced by the counterpart (SAS) of rat colonic H+,K+-ATPase, which is also insensitive to SCH 28080 (7). Expression levels of these chimeric alpha -subunits were similar to that of the wild-type enzyme, judging from the immunoblot analysis using an anti-gastric H+,K+-ATPase alpha -subunit antibody, Ab1024 (Fig. 2). Previously, we have shown that the membrane fraction obtained from mock-transfected HEK cells does not express the 95-kDa H+,K+-ATPase alpha -subunit, giving the blank activity of 0.06 ± 0.03 µmol/mg/h (n = 3) (21). The membrane fractions obtained from the present HEK cells transfected with chimeric cDNAs retained K+-ATPase activity, their average values being similar to that of the wild-type H+,K+-ATPase: 0.92, 1.02, 0.95, and 1.19 µmol/mg/h for Chimera 1, 2, and 3 and the wild-type H+,K+-ATPase, respectively, indicating that the loop 1 segment of H+,K+-ATPase alpha -subunit can be replaced with that of Na+,K+-ATPase or colonic H+,K+-ATPase, preserving the H+,K+-ATPase function. These results are in good agreement with the previous finding that the amino acids in the loop 1 segment of gastric H+,K+-ATPase are not directly involved in the ATPase function (11). Fig. 3 shows the effects of various concentrations of SCH 28080 on the K+-ATPase activity of the chimeras. IC50 values are 1.3, 5.6, 4.5 and 2.7 µM for Chimeras 1, 2, and 3 and the wild-type gastric H+,K+-ATPase, respectively. The affinity of Chimera 2 for SCH 28080 was one-half than that of the wild-type H+,K+-ATPase. However, the difference in the sensitivity to SCH 28080 between Chimera 2 and the wild-type gastric H+,K+-ATPase was much smaller than that between the wild-type gastric H+,K+- and Na+,K+-ATPases. In fact, SCH 28080 up to 300 µM did not inhibit pig kidney Na+,K+-ATPase activity; there was 2% inhibition at 100 µM and 3% inhibition at 300 µM (Fig. 3). Endogenous Na+,K+-ATPase activity of HEK cells was also hardly inhibited by SCH 28080 up to 300 µM (data not shown). These results indicate that the loop 1 segment of the H+,K+-ATPase is not directly involved in the binding or the interaction with SCH 28080. 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Alignment of amino acid sequences around the loop 1 regions of the wild-type H+,K+-ATPase, chimeras (Chimeras 1, 2, and 3) and Na+,K+-ATPase. Amino acid sequences of rabbit gastric H+,K+-ATPase alpha -subunit (Rab Gastric HKA) (32), sheep kidney Na+,K+-ATPase alpha 1-subunit (Sh alpha-1 NKA) (31), and the chimeras prepared between them are compared. Dashes indicate identity to the corresponding residues of rabbit gastric H+,K+-ATPase. M1 and M2 show the first and second transmembrane segments from the hydropathy plots, respectively.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   Immunoblotting with Ab1024 of the membrane fraction of HEK cells transfected with the chimeric alpha -subunit and wild-type beta -subunit cDNAs. HEK-293 cell membrane fractions (30 µg) transfected with wild-type alpha -subunit or Chimera 1, 2, or 3 were applied on the gel and blotted with Ab1024, which was raised against the carboxyl-terminal peptide of gastric H+,K+-ATPase alpha -subunit.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of SCH 28080 concentrations on the expressed K+-ATPase activity of the loop 1 chimeras and wild-type H+,K+-ATPase and the Na+,K+-ATPase activity. The K+-ATPase activity of the membrane fraction obtained from HEK-293 cells transfected with the wild-type (black-triangle), Chimera 1 (triangle ), Chimera 2 (), and Chimera 3 (open circle ) cDNAs and the Na+,K+-ATPase activity of pig kidney microsomes (black-diamond ) were measured as a function of the SCH 28080 concentration. The activities were expressed as the percentage of the corresponding control values measured in the absence of SCH 28080. The values are the mean ± S.E. for three observations in each of three transfections. The K+-ATPase activity in the absence of SCH 28080 was 1.19 ± 0.02 µmol/mg/h for the wild-type, 0.92 ± 0.05 µmol/mg/h for Chimera 1, 1.02 ± 0.19 µmol/mg/h for Chimera 2, and 0.95 ± 0.06 µmol/mg/h for Chimera 3. The Na+,K+-ATPase activity in the absence of SCH 28080 was 344 ± 31 µmol/mg/h.

SCH 28080 Sensitivity of H+,K+-ATPases with Mutations in the M1 Segment-- Recently, Lyu and Farley (12) reported that incorporation of the luminal half of the M1 transmembrane segment (Val-115 to Ile-126) of rat gastric H+,K+-ATPase into the corresponding part of Na+,K+-ATPase conferred high affinity for SCH 28080 to this chimeric Na+,K+-ATPase. This segment corresponds to that from Val-117 to Ile-128 of rabbit gastric H+,K+-ATPase alpha -subunit. Fig. 4 shows the alignment of amino acid sequences in the M1 transmembrane segment of the rabbit gastric H+,K+-ATPase and sheep Na+,K+-ATPase alpha -subunits. In the luminal half segment between Val-117 to Ile-128, 4 of 12 amino acid residues are conserved between the H+,K+-ATPase and the Na+,K+-ATPase. Several other substitutions are conservative. Here we prepared three mutants in which two consecutive amino acids, starting from Val-117, Ala-120, or Leu-123 of gastric H+,K+-ATPase, were replaced with the corresponding amino acids of Na+,K+-ATPase, respectively: V117I/A118G, A120V/I121L, or L123F/I124L. The K+-ATPase activity and the sensitivity to SCH 28080 of the membrane fractions obtained from HEK-293 cells transfected with these three H+,K+-ATPase mutant cDNAs were measured. The values of the K+-ATPase activity were 1.01, 0.62, and 0.87 µmol/mg/h for the V117I/A118G, A120V/I121L, and L123F/I124L mutants, respectively. The sensitivity of the K+-ATPase activity of these mutants to SCH 28080 are shown in Fig. 5. IC50 values were 4.5, 2.9, 4.7, and 3.5 µM for the V117I/A118G, A120V/I121L, and L123F/I124L mutants and the wild-type H+,K+-ATPase, respectively. Therefore, these mutants showed SCH 28080 sensitivity similar to that of the wild-type H+,K+-ATPase.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   Alignment of the amino acid sequences of the M1 segment of rabbit gastric H+,K+-ATPase, sheep Na+,K+-ATPase alpha -subunits, and Chimera 4. Amino acid sequences of rabbit gastric H+,K+-ATPase alpha -subunit (Rab Gastric HKA) (32), sheep kidney Na+,K+-ATPase alpha 1-subunit (Sh alpha-1 NKA) (31), and Chimera 4 are compared. Dashes indicate identity to the corresponding residue of rabbit gastric H+,K+-ATPase. The segment between Val-117 and Ile-128 is shown by a bracket.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of SCH 28080 concentrations on the expressed K+-ATPase activity of the M1 chimera, mutants, and wild-type H+,K+-ATPase. The K+-ATPase activity of the wild-type (black-triangle), Chimera 4 (), V117I/A118G mutant (open circle ), A120V/I121L mutant (black-square), and L123F/I124L mutant () was measured as a function of the SCH 28080 concentration. The K+-ATPase activity is expressed as the percentage of the control values measured in the absence of SCH 28080. The values are mean ± S.E. for three observations in each of three transfections. The K+-ATPase activity in the absence of SCH 28080 was 0.89 ± 0.08 µmol/mg/h for the wild-type, 0.47 ± 0.02 µmol/mg/h for Chimera 4, 1.01 ± 0.18 µmol/mg/h for the V117I/A118G mutant, 0.62 ± 0.02 µmol/mg/h for the A120V/I121L mutant, and 0.87 ± 0.02 µmol/mg/h for the L123F/I124L mutant.

Next, we prepared a chimeric H+,K+-ATPase (referred as Chimera 4) in which the segment starting from Val-117 to Ile-128 of rabbit H+,K+-ATPase alpha -subunit was replaced by the counterpart of Na+,K+-ATPase (Fig. 4). This chimera was the opposite chimera from that reported by Lyu and Farley (12); as a parental molecule, they used Na+,K+-ATPase, whereas we used H+,K+-ATPase. Expression level of Chimera 4 was also similar to that of the wild-type H+,K+-ATPase alpha -subunit judging from the immunoblot analysis using antibody Ab1024 (data not shown). The membrane fraction obtained from HEK-293 cells transfected with Chimera 4 cDNA also retained the K+-ATPase activity; however, its value was smaller than that of the wild-type H+,K+-ATPase: 0.47 and 1.19 µmol/mg/h, respectively. But, the K+-ATPase activity of Chimera 4 was still sensitive to SCH 28080. Fig. 5 shows the effects of various concentrations of SCH 28080 on the K+-ATPase activity of Chimera 4. The IC50 value was 4.5 µM, similar to that of the wild-type H+,K+-ATPase. These results indicate that the luminal half of the M1 segment of H+,K+-ATPase is not necessary for the binding with SCH 28080 in H+,K+-ATPase.

SCH 28080 Sensitivity of Na+,K+-ATPase with Mutations in the M1 Segment-- It is very difficult to explain our above results in harmony with the result shown by Lyu and Farley (12). We prepared the similar chimeric Na+,K+-ATPase alpha -subunit as the gM1/2 prepared by Lyu and Farley (12); that is, a chimeric Na+,K+-ATPase alpha -subunit in which the segment starting from Ile-101 to Ile-112 (counted from the amino terminus of the mature protein) of rat Na+,K+-ATPase alpha -subunit (25) was swapped by the counterpart of H+,K+-ATPase (NH12N chimera). This chimeric Na+,K+-ATPase alpha -subunit was co-expressed with rat Na+,K+-ATPase beta -subunit in HEK-293 cells, and the Na+,K+-ATPase activity in the membrane fraction was measured (Fig. 6). When the cells were transfected with the wild-type Na+,K+-ATPase or NH12N chimeric alpha -subunit cDNA together with the Na+,K+-ATPase beta -subunit cDNA, Na+,K+-ATPase activity resistant to 1 µM ouabain in the cell membrane fraction was significantly greater than that in the mock-transfected cells, indicating the expression of the exogenous Na+,K+-ATPase (wild-type rat Na+,K+-ATPase or chimeric Na+,K+-ATPase). These Na+,K+-ATPase activities insensitive to 1 µM ouabain were almost completely inhibited by 1 mM ouabain but were not inhibited by 50 µM SCH 28080. Therefore, Na+,K+-ATPase activity of the NH12N chimera was not sensitive to SCH 28080. 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of ouabain and SCH 28080 on the Na+,K+-ATPase activity in the membrane fractions obtained from HEK-293 cells transfected with mock, the wild-type Na+,K+-ATPase alpha -subunit, or the chimeric alpha -subunit (NH12N) cDNA together with the Na+,K+-ATPase beta -subunit cDNA. Na+,K+-stimulated ATPase activity was measured as described under "Experimental Procedures" in the absence of inhibitors (black column) or in the presence of 1 µM ouabain (gray column), 1 mM ouabain (dotted column), 50 µM SCH 28080 (open column), or 50 µM SCH 28080 plus 1 µM ouabain (hatched column). The values are the mean ± S.E. for three observations in each of three transfections.

SCH 28080 Sensitivity of H+,K+-ATPases with Mutations in the M6 Transmembrane Segment-- Previously, we reported that the aspartic acid mutant of Glu-822 in the M6 transmembrane segment (E822D) showed about 8 times lower affinity for SCH 28080 compared with the wild-type H+,K+-ATPase, whereas the affinity of this mutant for K+ was unchanged (11). It is likely that the M6 segment is involved in the interaction with SCH 28080 because several amino acids in this segment are involved in determining the affinity for K+ (11, 26) and presumably form part of the cation binding site, and also because SCH 28080 binds to the K+-high affinity site from kinetic analysis (6). We prepared gastric H+,K+-ATPases with single mutations, in which one of amino acids in the M6 segment was replaced by alanine, and examined the SCH 28080 sensitivity of the mutants. Table I shows the K+-ATPase activity, IC50 values, and Km values for K+ of the mutants, I818A, C824A, T825A, and P829A. Mutant C824A showed the SCH 28080 sensitivity similar to that of the wild-type H+,K+-ATPase; however, mutants T825A and P829A showed 5- and 4-fold lower sensitivity, respectively. We could not measure the sensitivity of mutants I821A, I823A, and D826A because they showed little or no ATPase activity (data not shown). These results suggest that Glu-822, Thr-825, and Pro-829 are involved in determining the affinity for SCH 28080. 

                              
View this table:
[in this window]
[in a new window]
 
Table I
K+-ATPase activity, IC50 value for SCH 28080 inhibition and Km value for K+ activation of M6 mutant H+, K+-ATPases

Ouabain sensitivity of Chimeric H+,K+-ATPases-- The loop 1 segment of the Na+,K+---ATPase alpha -subunit is one of the major determinants for ouabain (cardiac glycosides) binding. Fig. 7 shows the amino acid residues reported to be involved in determining the affinity for ouabain in Na+,K+-ATPase: amino acids Gln-111, Asp-121, and Asn-122 at the edges of the loop 1 segment (10); Cys-104 and Tyr-108 in the M1 transmembrane segment (13-15); Tyr-308 in the loop 2 segment between the M3 and M4 transmembrane segments (16); Phe-786 in the M5 transmembrane segment (17); Leu-793 and Thr-797 in the loop 3 segment between the M5 and M6 transmembrane segments (17-19); and Phe-863 and Arg-880 in the loop 4 segment between the M7 and M8 transmembrane segments (17, 20). In addition, it was reported that mutation of Pro-118 in the loop 1 segment changed the dissociation constant for ouabain (20). Canfield and Levenson (27) reported that multiple residues within the loop 1 contributed to the affinity for ouabain. Recently, Leu-330, Ala-331, and Thr-338 in the M4 transmembrane segment and Phe-982 in the M10 transmembrane segment were also reported to be partly involved in determining the affinity for ouabain from the random mutagenesis study (28). Our Chimera 2 conserved many of the residues that are involved in determining the affinity for ouabain described above; it did not conserve Tyr-108, Thr-338, Phe-786, Thr-797, and Phe-984 (Fig. 7). Among them Thr-797 is one of the major determinants for ouabain binding (28). Thr-797 of sheep Na+,K+-ATPase corresponds to Cys-815 of rabbit gastric H+,K+-ATPase. Starting from Chimera 2, we constructed Chimera 5, in which Cys-815 was mutated to Thr, and examined its ouabain sensitivity. The membrane fraction obtained from HEK cells transfected with Chimera 5 cDNA also retained the K+-ATPase activity, its value being smaller than that of the wild-type H+,K+-ATPase (0.64 µmol/mg/h). Fig. 8 shows the ouabain sensitivity of the K+-ATPase activity of the chimeras and the wild-type H+,K+-ATPase comparing with that of the endogenous Na+,K+-ATPase activity of HEK cells. The wild-type H+,K+-ATPase showed almost no sensitivity to ouabain up to 2 mM (less than 10% inhibition), whereas the endogenous Na+,K+-ATPase was inhibited by ouabain in a concentration-dependent manner, with an IC50 value of about 1 µM. Therefore, the K+-ATPase activity measured in the membrane fraction of the cells expressing H+,K+-ATPase in the absence of Na+ represents little Na+-independent fraction of endogenous Na+,K+-ATPase. The K+-ATPase activity of Chimera 2 also showed almost no sensitivity to ouabain up to 5 mM, whereas that of Chimera 5 was significantly inhibited by ouabain in the range higher than 1 mM, with an IC50 value of about 2 mM. The K+-ATPase activity of Chimera 5 was also inhibited by digoxin; 42% inhibition was observed with 300 µM digoxin, indicating that the inhibition of the K+-ATPase activity by ouabain is not due to a nonspecific effect. The K+-ATPase activity of Chimera 5 was also inhibited by SCH 28080, as shown in Fig. 9. Therefore, Chimera 5 is sensitive to both ouabain and SCH 28080, and Cys-815 was not directly involved in SCH 28080 binding. These results indicate that simultaneous replacement of the amino acid residues in the loop 1 segment and Cys-815 of H+,K+-ATPase with the corresponding counterparts of Na+,K+-ATPase, respectively, confers ouabain sensitivity on this chimeric H+,K+-ATPase. However, the ouabain sensitivity of Chimera 5 was much lower than that of Na+,K+-ATPase endogenously present in HEK cells.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7.   Amino acid sequences and residues of sheep Na+,K+-ATPase alpha 1-subunit reported to be important for determining the affinity for ouabain and alignments with those of Chimera 2, Chimera 5, and rabbit gastric H+,K+-ATPase. Amino acids determining the affinity for ouabain in sheep kidney Na+,K+-ATPase alpha 1-subunit (Sh alpha-1 NKA) (31) are presented (top row) with arrows and amino acid numbers. The corresponding amino acids of Chimera 2, Chimera 5, and rabbit gastric H+,K+-ATPase alpha -subunit (Rab Gastric HKA) (32) are presented. The numbers in the bottom row correspond to rabbit gastric H+,K+-ATPase alpha -subunit.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Effects of ouabain concentrations on the expressed K+-ATPase activity of wild-type H+,K+-ATPase, Chimeras 2 and 5, and the endogenous Na+,K+-ATPase activity of HEK cells. K+-ATPase activity of the wild-type (black-triangle), Chimera 2 (), and Chimera 5 (black-square) was measured as described under "Experimental Procedures" in the presence of various concentrations of ouabain. The K+-ATPase activity in the absence of ouabain was 0.96 ± 0.03 µmol/mg/h for the wild-type, 0.85 ± 0.03 µmol/mg/h for Chimera 2, and 0.64 ± 0.02 µmol/mg/h for Chimera 5. Na+,K+-ATPase activity of the mock-transfected HEK cells (black-down-triangle ) was measured in the presence of various concentrations of ouabain. The Na+,K+-ATPase activity in the absence of ouabain was 1.53 ± 0.01 µmol/mg/h. The values are the mean ± S.E. for three observations in each of three transfections.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 9.   Effects of ouabain and SCH 28080 on the K+-ATPase activity of Chimera 5. K+-ATPase activities of Chimera 5 in the presence of 50 µM SCH 28080 and in the presence of 5 mM ouabain are presented as a percentage of that in the absence of inhibitors (control). The K+-ATPase activity in the absence of inhibitors was 0.64 ± 0.02 µmol/mg/h.


    DISCUSSION

SCH 28080 is a specific inhibitor for gastric H+,K+-ATPase, which competitively binds to the K+ site on the luminal side (6). Therefore, it is a good tool to study the location and the structure of the K+ site. We have shown that a chimeric H+,K+-ATPase, Chimera 2, in which the entire loop 1 segment between the first and second transmembrane segments M1 and M2 of the rabbit H+,K+-ATPase alpha -subunit was replaced with the corresponding portion of the sheep Na+,K+-ATPase alpha 1-subunit, retains sensitivity to SCH 28080 comparable with that of the wild-type H+,K+-ATPase (Fig. 3). This result indicates that the loop 1 is not the direct binding site of SCH 28080.

We have recently proposed that Glu-822 in the M6 segment of gastric H+,K+-ATPase is one of the sites involved in determining the affinity for SCH 28080 (11). Here, we further studied the role of amino acids in the M6 segment around Glu-822 in determining the affinity for SCH 28080. Among them, the side chains of Thr-825 and Pro-829 are newly found to be involved in determining the affinity for SCH 28080. The amino acid residue corresponding to Glu-822 is Asp in Na+,K+-ATPase, whereas Thr-825 and Pro-829 are conserved between H+,K+-ATPase and Na+,K+-ATPase. These three residues are located 3 or 4 amino acids apart in the M6 helical domain. It is interesting that these three amino acids determining the affinity for SCH 28080 occupy the adjacent positions on the one side of the helix along the transmembrane direction (Fig. 10).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 10.   A helical wheel model of the M6 segment of the H+,K+-ATPase. Amino acid residues between Cys-815 and Leu-833 are plotted on the helical wheel model. Glu-822, Thr-825, and Pro-829 (underlined) are located on the same side of the helical wheel.

Recently Lyu and Farley (12) reported that the luminal half of the M1 segment of H+,K+-ATPase is a partial determinant of SCH 28080 sensitivity from the finding that when this segment (115Val-126Ile) of rat gastric H+,K+-ATPase was incorporated into the corresponding portion of Na+,K+-ATPase, the chimeric Na+,K+-ATPase showed high affinity for SCH 28080. The amino acid residues of this segment were relatively well conserved between Na+,K+-ATPase and H+,K+-ATPase; as shown in Fig. 4, 4 of 12 amino acid residues in this segment are identical between Na+,K+-ATPase and H+,K+-ATPase alpha -subunits, and several other replacements are conservative. Here, we prepared a chimeric H+,K+-ATPase alpha -subunit (Chimera 4) in which the luminal half of the M1 segment (Val117-Ile128) of H+,K+-ATPase was replaced by the corresponding segment of the Na+,K+-ATPase. Chimera 4 retained the K+-ATPase activity and showed SCH 28080 sensitivity comparable to that of the wild-type H+,K+-ATPase (Fig. 5), suggesting that the segment Val117-Ile128 is not essential for the binding with SCH 28080 in H+,K+-ATPase. Three mutant H+,K+-ATPases, in which two consecutive amino acids in the M1 segment were replaced by the corresponding amino acids of Na+,K+-ATPase (V117I/A118G, A120V/I121L, and L123F/I124L), also showed SCH 28080 sensitivity similar to that of the wild-type H+,K+-ATPase. These findings further support our present conclusion. Furthermore, we prepared a chimeric Na+,K+-ATPase alpha -subunit (NH12N) that is similar to that prepared by Lyu and Farley (12) and studied the sensitivity of expressed Na+,K+-ATPase activity of the chimeric enzyme to SCH 28080. Na+,K+-ATPase activity of the chimeric enzyme expressed in HEK cells was not inhibited by 50 µM SCH 28080 (Fig. 6), indicating again that the luminal half of the M1 segment of H+,K+-ATPase is not involved in SCH 28080 binding. At present, it is hard to explain why our results are not consistent with the previous result reported by Lyu and Farley (12). It should be pointed out that we used rat Na+,K+-ATPase alpha -subunit as a parental molecule, whereas Lyu and Farley used sheep Na+,K+-ATPase alpha -subunit, and that we transiently expressed the chimeric ATPase in HEK-293 cells, whereas they used the yeast expression system.

The present Chimera 5 contains many amino acid residues involved in determining the affinity for ouabain (Fig. 7). This chimera acquired sensitivity to ouabain at the range higher than 1 mM (Fig. 8). The K+-ATPase activity of this chimera was also sensitive to SCH 28080 (Fig. 9). Blostein et al. (29) reported that a chimeric ATPase composed of the amino-terminal half of the rat gastric H+,K+-ATPase and the carboxyl-terminal half of the rat Na+,K+-ATPase alpha 1 was bound with ouabain. (The junction between the amino- and carboxyl-terminal halves is a fluorescein isothiocyanate-binding site, a part of ATP binding site in the large cytoplasmic loop between the M4 and M5 transmembrane segments.) From this result, they proposed that the localization of determinants for ouabain binding in the Na+,K+-ATPase is not restricted in the amino-terminal half of the alpha -subunit and that multiple domains are capable of individually supporting low affinity ouabain binding. Their findings are in good agreement with our present findings. Chimera 5 has 12 amino acid residues that have been identified to be involved in ouabain binding in the wild-type Na+,K+-ATPase: Cys-104 (position numbers for sheep Na+,K+-ATPase alpha 1) in M1; Gln-111, Pro-118, Asp-121, and Asn-122 in loop 1; Tyr-308 in loop 2; Leu-330 and Ala-331 in M4; Leu-793 and Thr-797 in loop 3; and Phe-863 and Arg-880 in loop 4 (28). The present sensitivity of Chimera 5 to ouabain is, however, very low compared with that of the wild-type Na+,K+-ATPase. The low sensitivity of Chimera 5 to ouabain is comparable with that of the chimeric ATPase between Na+,K+-ATPase and SERCA (Ca2+-ATPase) reported by Ishii and Takeyasu (30). An isoform of H+,K+-ATPase cloned in rat colon (HKalpha 2) also showed low affinity for ouabain (the Ki value was 970 µM) (7). The present low sensitivity of Chimera 5 suggests that additional amino acid substitution is necessary to increase ouabain sensitivity, which may shift the overall structural integrity of chimeric H+,K+-ATPase toward that of the wild-type Na+,K+-ATPase. Tyr-108 in M1, Thr-338 in M4, Phe-786 in loop 3 (or M5), and Phe-982 in M10 are also reported to be involved in determining the affinity for ouabain by random mutagenesis experiments (28). These residues are not conserved in the wild-type H+,K+-ATPase alpha -subunit, although there has been no report for the ouabain sensitivity of the mutants in which these residues are mutated to the corresponding amino acids in the H+,K+-ATPase.

It is also noticeable that the binding site of SCH 28080 on the H+,K+-ATPase is not a counterpart of ouabain on the Na+,K+-ATPase because the K+-ATPase activity of Chimera 5 acquired ouabain sensitivity and maintained SCH 28080 sensitivity. Chimera 5 has mutations in the loop 1 segment and Cys-815, which are not involved in determining the affinity for SCH 28080 in the H+,K+-ATPase.

In conclusion, we have shown that the loop 1 and the luminal half of the M1 segments of H+,K+-ATPase alpha -subunit are not essential for the binding with the proton pump inhibitor SCH 28080. Furthermore, incorporation of the loop 1 segment of Na+,K+-ATPase alpha -subunit and replacement of Cys-815 by Thr in gastric H+,K+-ATPase confer ouabain sensitivity to this chimeric H+,K+-ATPase. This is the first report for the preparation of chimeric H+,K+-ATPase that is sensitive to both SCH 28080 and ouabain.

    ACKNOWLEDGEMENTS

We thank Nopparat Thitiwatanakarn for technical assistance. We thank Prof. Kazuya Taniguchi for providing pig kidney Na+,K+-ATPase preparation and Dr. Michael J. Caplan for the gift of rat Na+,K+-ATPase alpha - and beta -subunit cDNAs. We are also grateful Prof. Robert A. Farley for his gM1/2 clone.

    FOOTNOTES

* This study was supported in part by a grant-in-aid for encouragement of young scientists (to S. A.), and by a grant-in-aid for scientific research on priority areas (to S. A. and N. T.) from the Ministry of Education, Science, Sports and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 81-764-34-2281; Fax.: 81-764-34-5176; E-mail: shinji{at}ms.toyama-mpu.ac.jp.

    ABBREVIATIONS

The abbreviations used are: SCH 28080, 2-methyl-8-(phenylmethoxy)imidazo (1,2-a)pyridine-3-acetonitrile; PCR, polymerase chain reaction.

    REFERENCES
Top
Abstract
Introduction
References
  1. Wallmark, B., Larsson, H., and Humble, L. (1985) J. Biol. Chem. 260, 13681-13684[Abstract/Free Full Text]
  2. Morii, M., Takata, H., and Takeguchi, N. (1989) Gastroenterology 96, 1453-1461[Medline] [Order article via Infotrieve]
  3. Morii, M., Hamatani, K., and Takeguchi, N. (1995) Biochem. Pharmacol. 49, 1729-1734[CrossRef][Medline] [Order article via Infotrieve]
  4. Scott, C. K., and Sundell, E. (1985) Eur. J. Pharmacol. 112, 268-270[CrossRef][Medline] [Order article via Infotrieve]
  5. Keeling, D. J., Taylor, A. G., and Schudt, C. (1989) J. Biol. Chem. 264, 5545-5551[Abstract/Free Full Text]
  6. Beil, W., Hackbarth, I., and Sewing, K. (1986) Br. J. Pharmacol. 88, 19-23[Medline] [Order article via Infotrieve]
  7. Cougnon, M., Planelles, G., Crowson, M. S., Shull, G. E., Rossier, B. C., and Jaisser, F. (1996) J. Biol. Chem. 271, 7277-7280[Abstract/Free Full Text]
  8. Takeguchi, M., Asano, S., Tabuchi, Y., and Takeguchi, N. (1990) Gastroenterology 99, 1339-1346[Medline] [Order article via Infotrieve]
  9. Munson, K. B., Gutierrez, C., Balaji, V. N., Ramnarayan, K., and Sachs, G. (1991) J. Biol. Chem. 266, 18976-18988[Abstract/Free Full Text]
  10. Price, E. M., and Lingrel, J. B (1988) Biochemistry 27, 8400-8408[CrossRef][Medline] [Order article via Infotrieve]
  11. Asano, S., Matsuda, S., Tega, Y., Shimizu, K., Sakamoto, S., and Takeguchi, N. (1997) J. Biol. Chem. 272, 17668-17674[Abstract/Free Full Text]
  12. Lyu, R., and Farley, R. A. (1997) Am. J. Physiol. 272, C1717-C1725[Abstract/Free Full Text]
  13. Yamamoto, S., Askew, G. R., Heiny, J., Masaki, H., and Yatani, A. (1996) Am. J. Physiol. 270, C457-C464[Abstract/Free Full Text]
  14. Canessa, C. M., Horisberger, J-D., Louvard, D., and Rossier, B. C. (1992) EMBO J. 11, 1681-1687[Medline] [Order article via Infotrieve]
  15. Askew, G. R., and Lingrel, J. B (1994) J. Biol. Chem. 269, 24120-24126[Abstract/Free Full Text]
  16. Canessa, C. M., Horisberger, J-D., and Rossier, B. C. (1993) J. Biol. Chem. 268, 17722-17726[Abstract/Free Full Text]
  17. Palasis, M., Kuntzweiler, T. A., Argüello, J. M., and Lingrel, J. B (1996) J. Biol Chem. 271, 14176-14182[Abstract/Free Full Text]
  18. Burns, E. L., Nicholas, R. A., and Price, E. M. (1996) J. Biol. Chem. 271, 15879-15883[Abstract/Free Full Text]
  19. Feng, J., and Lingrel, J. B (1994) Biochemistry 33, 4218-4224[CrossRef][Medline] [Order article via Infotrieve]
  20. Schultheis, P. J., Wallick, E. T., and Lingrel, J. B (1993) J. Biol. Chem. 268, 22686-22694[Abstract/Free Full Text]
  21. Asano, S., Tega, Y., Konishi, K., Fujioka, M., and Takeguchi, N. (1996) J. Biol Chem. 271, 2740-2745[Abstract/Free Full Text]
  22. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  23. Asano, S., Arakawa, S., Hirasawa, M., Sakai, H., Ohta, M., Ohta, K., and Takeguchi, N. (1994) Biochem. J. 299, 59-64
  24. Yoda, A., and Hokin, L. E. (1970) Biochem. Biophys. Res. Commun. 40, 880-886[CrossRef][Medline] [Order article via Infotrieve]
  25. Shull, G. E., Greeb, J., and Lingrel, J. B (1986) Biochemistry 25, 8125-8132[CrossRef][Medline] [Order article via Infotrieve]
  26. Swarts, H. G., Klaassen, C. H., de Boer, M., Fransen, J. A., and De Pont, J. J. (1996) J. Biol. Chem. 271, 29764-29772[Abstract/Free Full Text]
  27. Canfield, V. A., and Levenson, R. (1998) Biochemistry 37, 7509-7516[CrossRef][Medline] [Order article via Infotrieve]
  28. Croyle, M. L., Woo, A. L., and Lingrel, J. B (1997) Eur. J. Biochem. 248, 488-495[Medline] [Order article via Infotrieve]
  29. Blostein, R., Zhang, R., Gottardi, C. J., and Caplan, M. J. (1993) J. Biol. Chem. 268, 10654-10658[Abstract/Free Full Text]
  30. Ishii, T., and Takeyasu, K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8881-8885[Abstract/Free Full Text]
  31. Shull, G. E., Schwartz, A., and Lingrel, J. B (1985) Nature 316, 691-695[CrossRef][Medline] [Order article via Infotrieve]
  32. Bamberg, K., Mercier, F., Reuben, M. A., Kobayashi, Y., Munson, K. B., and Sachs, G. (1992) Biochim. Biophys. Acta 1131, 69-77[Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Asano, A. Yoshida, H. Yashiro, Y. Kobayashi, A. Morisato, H. Ogawa, N. Takeguchi, and M. Morii
The Cavity Structure for Docking the K+-competitive Inhibitors in the Gastric Proton Pump
J. Biol. Chem., April 2, 2004; 279(14): 13968 - 13975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Y. Qiu, J. B. Koenderink, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
Phe783, Thr797, and Asp804 in Transmembrane Hairpin M5-M6 of Na+,K+-ATPase Play a Key Role in Ouabain Binding
J. Biol. Chem., November 21, 2003; 278(47): 47240 - 47244.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Codina, J. Cardwell, J. J. Gitomer, Y. Cui, B. C. Kone, and T. D. Dubose Jr.
Sch-28080 depletes intracellular ATP selectively in mIMCD-3 cells
Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1319 - C1326.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. B. Koenderink, H. P. H. Hermsen, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
High-affinity ouabain binding by a chimeric gastric H+,K+-ATPase containing transmembrane hairpins M3-M4 and M5-M6 of the alpha 1-subunit of rat Na+,K+-ATPase
PNAS, September 29, 2000; (2000) 200109597.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. A. Farley, S. Schreiber, S.-G. Wang, and G. Scheiner-Bobis
A Hybrid between Na+,K+-ATPase and H+,K+-ATPase Is Sensitive to Palytoxin, Ouabain, and SCH 28080
J. Biol. Chem., January 19, 2001; 276(4): 2608 - 2615.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. B. Koenderink, H. P. H. Hermsen, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
High-affinity ouabain binding by a chimeric gastric H+,K+-ATPase containing transmembrane hairpins M3-M4 and M5-M6 of the alpha 1-subunit of rat Na+,K+-ATPase
PNAS, October 10, 2000; 97(21): 11209 - 11214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asano, S.
Right arrow Articles by Takeguchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asano, S.
Right arrow Articles by Takeguchi, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement