|
J Biol Chem, Vol. 274, Issue 11, 6848-6854, March 12, 1999
A Chimeric Gastric H+,K+-ATPase
Inhibitable with Both Ouabain and SCH 28080*
Shinji
Asano ,
Saiko
Matsuda§,
Satomi
Hoshina§,
Shinya
Sakamoto§, and
Noriaki
Takeguchi§
From the Molecular Genetics Research Center and the
§ Faculty of Pharmaceutical Sciences, Toyama Medical and
Pharmaceutical University, 2630 Sugitani, Toyama 930-0194, Japan
 |
ABSTRACT |
2-Methyl-8-(phenylmethoxy)imidazo(1,2-a)pyridine-3acetonitrile
(SCH 28080) is a K+ site inhibitor specific for
gastric H+,K+-ATPase and seems to be a
counterpart of ouabain for Na+,K+-ATPase from
the viewpoint of reaction pattern (i.e. reversible binding,
K+ antagonism, and binding on the extracellular side). In
this study, we constructed several chimeric molecules between
H+,K+-ATPase and
Na+,K+-ATPase -subunits by using rabbit
H+,K+-ATPase as a parental molecule. We found
that the entire extracellular loop 1 segment between the first and
second transmembrane segments (M1 and M2) and the luminal half of the
M1 transmembrane segment of H+,K+-ATPase
-subunit were exchangeable with those of
Na+,K+-ATPase, respectively, preserving
H+,K+-ATPase activity, and that these segments
are not essential for SCH 28080 binding. We found that several amino
acid residues, including Glu-822, Thr-825, and Pro-829 in the M6
segment of H+,K+-ATPase -subunit are
involved in determining the affinity for this inhibitor. Furthermore,
we found that a chimeric H+,K+-ATPase acquired
ouabain sensitivity and maintained SCH 28080 sensitivity when the loop
1 segment and Cys-815 in the loop 3 segment of the
H+,K+-ATPase -subunit were simultaneously
replaced by the corresponding segment and amino acid residue (Thr) of
Na+,K+-ATPase, respectively, indicating that
the binding sites of ouabain and SCH 28080 are separate. In this
H+,K+-ATPase chimera, 12 amino acid residues in
M1, M4, and loop 1-4 that have been suggested to be involved in
ouabain binding of Na+,K+-ATPase -subunit
are present; however, the low ouabain sensitivity indicates the
possibility that the sensitivity may be increased by additional amino
acid substitutions, which shift the overall structural integrity of
this chimeric H+,K+-ATPase toward that of
Na+,K+-ATPase.
 |
INTRODUCTION |
H+,K+-ATPase, the proton pump responsible
for gastric acid secretion (1), is the target molecule for proton pump
inhibitors such as omeprazole (2), rabeprazole (E3810) (3), and SCH 280801 (4). SCH 28080 is a
reversible inhibitor of gastric H+,K+-ATPase,
which competitively binds to the luminal K+ high affinity
site of the enzyme (5). This inhibitor discriminates the K+
site of H+,K+-ATPase from that of
Na+,K+-ATPase, because it has little effect on
Na+,K+-ATPase activity (6).
H+,K+-ATPase isoforms found in rat and guinea
pig distal colons are resistant to SCH 28080 (7, 8). The binding site
of SCH 28080 in the gastric H+,K+-ATPase was
previously studied by using a photoaffinity derivative of this
inhibitor,
8-[(4-azidophenyl)-methoxy]-1-tritiomethyl-2,3-dimethylamidazo (1,2-a)pyridinium iodide, and it was reported that the binding site was in loop 1 between the transmembrane segments M1 and M2 of
H+,K+-ATPase -subunit (9). Furthermore, the
binding site was hypothesized to be Phe-126 and Asp-138, at the edge of
the loop 1 segment from the computer-generated model (9). The
corresponding loop in Na+,K+-ATPase is known to
be involved in determining the affinity for ouabain (10). Recently, we
examined the SCH 28080 binding site by site-directed mutagenesis and
found that the putative binding sites of SCH 28080, Phe-126 and
Asp-138, are not involved in the interaction with SCH 28080, and we
proposed that Glu-822 in the transmembrane segment M6 is involved in
determining the affinity for this inhibitor (11). Lyu and Farley (12)
found that when the luminal half of the M1 transmembrane segment of
Na+,K+-ATPase -subunit
(Ile99-Ile110) was replaced by the counterpart
of gastric H+,K+-ATPase
(Val115-Ile126), this chimeric
Na+,K+-ATPase showed high affinity for SCH
28080. Here, we newly prepared the opposite chimera, in which the loop
1 segment or the luminal half of the M1 segment of rabbit
H+,K+-ATPase -subunit was replaced by the
counterparts of sheep Na+,K+-ATPase,
respectively, and we also prepared several mutants in the M6
transmembrane segment and studied their sensitivity to the inhibitor.
The amino acid residues in Na+,K+-ATPase
involved in determining the affinity for ouabain have been proposed to
be located on the M1 segment (13-15), which is close to or on the
first extracellular loop (10), and on the second, third, and fourth
extracellular loops of the -subunit (16-20). Here, we introduced
these amino acid residues into the corresponding positions of gastric
H+,K+-ATPase and studied the sensitivity of
this chimeric H+,K+-ATPase to ouabain.
 |
EXPERIMENTAL PROCEDURES |
Materials--
HEK-293 cells (human embryonic kidney cell line)
were a kind gift from Dr. Jonathan Lytton (Brigham & Women's Hospital,
Harvard Medical School, Boston, MA). pcDNA3 vector was obtained
from Invitrogen Co. (San Diego, CA). Pfu DNA polymerase was
obtained from Stratagene. Restriction enzymes and other DNA and RNA
modifying enzymes were from Toyobo (Osaka, Japan), New England Biolabs,
Life Technologies, Inc., or Amersham Pharmacia Biotech Inc. (Tokyo,
Japan). SCH 28080 was obtained from Schering Co.(Keniworth, NJ). All
other reagents were of molecular biology grade or the highest grade of
purity available.
Na+,K+-ATPase preparation purified with
deoxycholate from pig kidney was a kind gift from Dr. K. Taniguchi
(Hokkaido University, Japan). cDNAs of the - and -subunits of
rat Na+,K+-ATPase in pBluescript SK(+) vector
were kind gifts from Dr. M. J. Caplan (Yale University, New Haven, CT).
cDNAs of the - and -subunits of
H+,K+-ATPase were prepared from rabbit gastric
mucosae and subcloned into pcDNA3 expression vector as described
previously (21).
Site-directed Mutagenesis and Chimera
Construction--
Introduction of site-directed mutations in the loop
1 domain and M1 segment of the H+,K+-ATPase
-subunit was carried out by sequential PCR steps as described elsewhere (11), in which appropriately mutated -subunit cDNAs (segments between the EcoRI site (nucleotide 28) and the
BstEII site (nucleotide 456)) were prepared. The
5'-flanking sense and 3'-flanking antisense primers were
5'-CCGAATTCAAGGAGGGCAGCGCAGCGAG-3' (nucleotides 28 to
9) (the EcoRI site is underlined) and
5'-GCCTCGAGCTCGGATCACCGTGGCTTGC-3' (nucleotides 534-553)
(the XhoI site is underlined), respectively. Sense and
antisense synthetic oligonucleotides, each 21-24 bases long,
containing one to five mutated bases near the center, were designed.
The cDNA of H+,K+-ATPase -subunit in
pBluescript SK( ) was used as a PCR template. PCR was routinely
carried out in the presence of 200 µM each dNTP, 500 nM primers, 10 mM KCl, 10 mM
(NH4)2SO4, 2 mM
MgSO4, 20 mM Tris-HCl, pH 8.8, 0.1% Triton
X-100, 100 µg/ml bovine serum albumin, and 2.5 units of
Pfu DNA polymerase for 30 cycles. DNA sequencing was done by
the dideoxy chain termination method using an Autoread DNA
sequencing kit and an ALFexpress DNA sequencer (Amersham Pharmacia Biotech). After sequencing, the fragment amplified in the final PCR was
digested with EcoRI and BstEII and ligated back
into the relevant position of the wild-type
H+,K+-ATPase -subunit construct.
Construction of chimeric H+,K+-ATPase cDNAs
were carried out by two or three repetitions of site-directed mutagenesis.
Construction of chimeric Na+,K+-ATPase cDNA
was carried out by sequential PCR steps as described above, in which
appropriately mutated -subunit cDNAs (segments between the
ClaI site (attached to nucleotide 81) and the
Csp45I site (nucleotide 515)) were prepared. The 5'-flanking
sense and 3'-flanking antisense primers used were
GGATCGATACTCTCCCAGCCGGGAGCTGC (nucleotides 81 to 61) (the ClaI site is underlined) and CGTTGATGCTCATCTTCTCTCC
(nucleotides 523-543), respectively. Sense and antisense chimeric
primers were 50 bases long:
CTGCCATCTGCCTCATCGCCTTTGCCATCC-GAAGTGCTACAGAAGAGGAA and
GCGATGAGGCAGATGGCAGCCGCCACCCACAGTAACATGGAGAAGCCACC,
respectively (H+,K+ATPase portions are
underlined). The cDNA of rat Na+,K+-ATPase
-subunit in pBluescript SK(+) vector was used as a PCR template.
After sequencing, the fragment amplified in the final PCR was digested
with ScaI (site in the vector) and Csp45I and ligated back into the relevant position of the wild-type
Na+,K+-ATPase -subunit cDNA construct.
The chimeric Na+,K+-ATPase cDNA was
digested with XbaI and HincII. The obtained
fragment was ligated into pcDNA3 vector treated with
XbaI and EcoRV.
Cell Culture, Transfection, and Preparation of Membrane
Fractions--
Cell culture of HEK-293 was carried out as
described previously (21). - and -subunit cDNA transfection
was performed by the calcium phosphate method with 10 µg of cesium
chloride-purified DNA per 10-cm dish. Cells were harvested 2 days
after the DNA transfection. Membrane fractions of HEK cells were
prepared as described previously (21).
SDS-Polyacrylamide Gel Electrophoresis and
Immunoblot--
SDS-polyacrylamide gel electrophoresis was carried out
as described elsewhere (22). Membrane preparations (30 µg protein) were incubated in a sample buffer containing 2% SDS, 2%
-mercaptoethanol, 10% glycerol, and 10 mM Tris-HCl, pH
6.8, at room temperature for 2 min and applied to the
SDS-polyacrylamide gel. Immunoblot was carried out as described
previously (21).
Antibody Ab1024 was previously raised against the carboxyl-terminal
peptide (residues 1024-1034) of the
H+,K+-ATPase -subunit (PGSWWDQELYY)
(23).
Assay of H+,K+-ATPase
Activity--
ATPase activity was assayed in 1 ml of a solution
containing 50 µg of membrane protein, 3 mM
MgCl2, 3 mM ATP, 5 mM
NaN3, 2 mM ouabain, and 40 mM
Tris-HCl, pH 7.4, in the presence and absence of 15 mM KCl.
After incubation at 37 °C for 30 min, the reaction was terminated by
the addition of ice-cold stop solution containing 12% perchloric acid
and 3.6% ammonium molybdate. Inorganic phosphate released was measured
from the absorbance at the wavelength of 320 nm as described elsewhere
(24). The K+-ATPase activity was calculated as the
difference between activities in the presence and absence of KCl. In
experiments measuring the ouabain sensitivity of the
K+-ATPase, we used 0.5 µM oligomycin instead
of NaN3, and measured the K+-ATPase activity in
the absence of Na+ and in the presence of various
concentrations of ouabain. When indicated, inhibitors, such as SCH
28080, ouabain, or digoxin, were added, and the enzyme activity was
measured as a function of the inhibitor concentration. The value of
IC50 was determined from a smoothly fitting curve that was
drawn using the KaleidaGraph program (Synergy Software, Reading, PA).
Assay of Na+,K+-ATPase
Activity--
ATPase activity was assayed in 1 ml of a solution
containing 10 µg of membrane protein or 1 µg of pig kidney
Na+,K+-ATPase preparation, 3 mM
MgCl2, 3 mM ATP, 5 mM
NaN3, 120 mM NaCl, and 40 mM
Tris-HCl, pH 7.4, in the presence of various concentrations of ouabain
and in the presence and absence of 15 mM KCl. Inorganic phosphate released from ATP at 37 °C for 30 min (for membrane preparation) or 10 min (for Na+,K+-ATPase
preparation) was measured as described in the assay of H+,K+-ATPase activity.
Na+,K+-ATPase activity was calculated as the
difference between ATPase activities in the presence and absence of KCl.
Protein was measured using the BCA protein assay kit from Pierce with
bovine serum albumin as a standard.
 |
RESULTS |
SCH 28080 Sensitivity of
H+,K+-ATPases with Mutations in the Loop 1 Segment--
Here, we prepared chimeras between gastric
H+,K+-ATPase and
Na+,K+-ATPase -subunits, in which 3 or 8 consecutive amino acid residues of the loop 1 segment of the
H+,K+-ATPase -subunit were replaced by the
counterparts of Na+,K+-ATPase or colonic
H+,K+-ATPase -subunit. Fig.
1 shows the alignment of amino acid
sequences around the loop 1 of the wild-type rabbit
H+,K+-ATPase and sheep
Na+,K+-ATPase -subunits, and the chimeric
H+,K+-ATPases (Chimeras 1, 2, and 3). In
Chimera 1, three amino acids (131SEG133) at the
amino-terminal portion of the loop 1 of
H+,K+-ATPase were replaced by the counterpart
(ATE) of Na+,K+-ATPase. In Chimera 2, eight
amino acids (from Ser-131 to Asp-138) in the entire loop 1 of
H+,K+-ATPase were replaced by the counterpart
of Na+,K+-ATPase. In Chimera 3, three amino
acids (135LTT137) at the carboxyl-terminal
portion of the loop 1 of H+,K+-ATPase were
replaced by the counterpart (SAS) of rat colonic H+,K+-ATPase, which is also insensitive to SCH
28080 (7). Expression levels of these chimeric -subunits were
similar to that of the wild-type enzyme, judging from the immunoblot
analysis using an anti-gastric H+,K+-ATPase
-subunit antibody, Ab1024 (Fig. 2).
Previously, we have shown that the membrane fraction obtained from
mock-transfected HEK cells does not express the 95-kDa
H+,K+-ATPase -subunit, giving the blank
activity of 0.06 ± 0.03 µmol/mg/h (n = 3) (21).
The membrane fractions obtained from the present HEK cells transfected
with chimeric cDNAs retained K+-ATPase activity, their
average values being similar to that of the wild-type
H+,K+-ATPase: 0.92, 1.02, 0.95, and 1.19 µmol/mg/h for Chimera 1, 2, and 3 and the wild-type
H+,K+-ATPase, respectively, indicating that the
loop 1 segment of H+,K+-ATPase -subunit can
be replaced with that of Na+,K+-ATPase or
colonic H+,K+-ATPase, preserving the
H+,K+-ATPase function. These results are in
good agreement with the previous finding that the amino acids in the
loop 1 segment of gastric H+,K+-ATPase are not
directly involved in the ATPase function (11). Fig.
3 shows the effects of various
concentrations of SCH 28080 on the K+-ATPase activity of
the chimeras. IC50 values are 1.3, 5.6, 4.5 and 2.7 µM for Chimeras 1, 2, and 3 and the wild-type gastric H+,K+-ATPase, respectively. The affinity of
Chimera 2 for SCH 28080 was one-half than that of the wild-type
H+,K+-ATPase. However, the difference in the
sensitivity to SCH 28080 between Chimera 2 and the wild-type gastric
H+,K+-ATPase was much smaller than that between
the wild-type gastric H+,K+- and
Na+,K+-ATPases. In fact, SCH 28080 up to 300 µM did not inhibit pig kidney
Na+,K+-ATPase activity; there was 2%
inhibition at 100 µM and 3% inhibition at 300 µM (Fig. 3). Endogenous
Na+,K+-ATPase activity of HEK cells was also
hardly inhibited by SCH 28080 up to 300 µM (data not
shown). These results indicate that the loop 1 segment of the
H+,K+-ATPase is not directly involved in the
binding or the interaction with SCH 28080.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Alignment of amino acid sequences around the
loop 1 regions of the wild-type H+,K+-ATPase,
chimeras (Chimeras 1, 2, and 3) and
Na+,K+-ATPase. Amino acid sequences of
rabbit gastric H+,K+-ATPase -subunit
(Rab Gastric HKA) (32), sheep kidney
Na+,K+-ATPase 1-subunit (Sh alpha-1
NKA) (31), and the chimeras prepared between them are compared.
Dashes indicate identity to the corresponding residues of
rabbit gastric H+,K+-ATPase. M1 and
M2 show the first and second transmembrane segments from the
hydropathy plots, respectively.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
Immunoblotting with Ab1024 of the membrane
fraction of HEK cells transfected with the chimeric
-subunit and wild-type
-subunit cDNAs. HEK-293 cell membrane
fractions (30 µg) transfected with wild-type -subunit or Chimera
1, 2, or 3 were applied on the gel and blotted with Ab1024, which was
raised against the carboxyl-terminal peptide of gastric
H+,K+-ATPase -subunit.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of SCH 28080 concentrations on the
expressed K+-ATPase activity of the loop 1 chimeras and
wild-type H+,K+-ATPase and the
Na+,K+-ATPase activity. The
K+-ATPase activity of the membrane fraction obtained from
HEK-293 cells transfected with the wild-type ( ), Chimera 1 ( ),
Chimera 2 ( ), and Chimera 3 ( ) cDNAs and the
Na+,K+-ATPase activity of pig kidney microsomes
( ) were measured as a function of the SCH 28080 concentration. The
activities were expressed as the percentage of the corresponding
control values measured in the absence of SCH 28080. The values are the
mean ± S.E. for three observations in each of three
transfections. The K+-ATPase activity in the absence of SCH
28080 was 1.19 ± 0.02 µmol/mg/h for the wild-type, 0.92 ± 0.05 µmol/mg/h for Chimera 1, 1.02 ± 0.19 µmol/mg/h for
Chimera 2, and 0.95 ± 0.06 µmol/mg/h for Chimera 3. The
Na+,K+-ATPase activity in the absence of SCH
28080 was 344 ± 31 µmol/mg/h.
|
|
SCH 28080 Sensitivity of H+,K+-ATPases with
Mutations in the M1 Segment--
Recently, Lyu and Farley (12)
reported that incorporation of the luminal half of the M1 transmembrane
segment (Val-115 to Ile-126) of rat gastric
H+,K+-ATPase into the corresponding part of
Na+,K+-ATPase conferred high affinity for SCH
28080 to this chimeric Na+,K+-ATPase. This
segment corresponds to that from Val-117 to Ile-128 of rabbit gastric
H+,K+-ATPase -subunit. Fig.
4 shows the alignment of amino acid
sequences in the M1 transmembrane segment of the rabbit gastric
H+,K+-ATPase and sheep
Na+,K+-ATPase -subunits. In the luminal half
segment between Val-117 to Ile-128, 4 of 12 amino acid residues are
conserved between the H+,K+-ATPase and the
Na+,K+-ATPase. Several other substitutions are
conservative. Here we prepared three mutants in which two consecutive
amino acids, starting from Val-117, Ala-120, or Leu-123 of gastric
H+,K+-ATPase, were replaced with the
corresponding amino acids of Na+,K+-ATPase,
respectively: V117I/A118G, A120V/I121L, or L123F/I124L. The
K+-ATPase activity and the sensitivity to SCH 28080 of the
membrane fractions obtained from HEK-293 cells transfected with these
three H+,K+-ATPase mutant cDNAs were
measured. The values of the K+-ATPase activity were 1.01, 0.62, and 0.87 µmol/mg/h for the V117I/A118G, A120V/I121L, and
L123F/I124L mutants, respectively. The sensitivity of the
K+-ATPase activity of these mutants to SCH 28080 are shown
in Fig. 5. IC50 values were
4.5, 2.9, 4.7, and 3.5 µM for the V117I/A118G, A120V/I121L, and L123F/I124L mutants and the wild-type
H+,K+-ATPase, respectively. Therefore, these
mutants showed SCH 28080 sensitivity similar to that of the wild-type
H+,K+-ATPase.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
Alignment of the amino acid sequences of the
M1 segment of rabbit gastric H+,K+-ATPase,
sheep Na+,K+-ATPase
-subunits, and Chimera 4. Amino acid sequences
of rabbit gastric H+,K+-ATPase -subunit
(Rab Gastric HKA) (32), sheep kidney
Na+,K+-ATPase 1-subunit (Sh alpha-1
NKA) (31), and Chimera 4 are compared. Dashes indicate
identity to the corresponding residue of rabbit gastric
H+,K+-ATPase. The segment between Val-117 and
Ile-128 is shown by a bracket.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of SCH 28080 concentrations on the
expressed K+-ATPase activity of the M1 chimera, mutants,
and wild-type H+,K+-ATPase. The
K+-ATPase activity of the wild-type ( ), Chimera 4 ( ),
V117I/A118G mutant ( ), A120V/I121L mutant ( ), and L123F/I124L
mutant ( ) was measured as a function of the SCH 28080 concentration.
The K+-ATPase activity is expressed as the percentage of
the control values measured in the absence of SCH 28080. The values are
mean ± S.E. for three observations in each of three
transfections. The K+-ATPase activity in the absence of SCH
28080 was 0.89 ± 0.08 µmol/mg/h for the wild-type, 0.47 ± 0.02 µmol/mg/h for Chimera 4, 1.01 ± 0.18 µmol/mg/h for the
V117I/A118G mutant, 0.62 ± 0.02 µmol/mg/h for the A120V/I121L
mutant, and 0.87 ± 0.02 µmol/mg/h for the L123F/I124L
mutant.
|
|
Next, we prepared a chimeric H+,K+-ATPase
(referred as Chimera 4) in which the segment starting from Val-117 to
Ile-128 of rabbit H+,K+-ATPase -subunit was
replaced by the counterpart of Na+,K+-ATPase
(Fig. 4). This chimera was the opposite chimera from that reported by
Lyu and Farley (12); as a parental molecule, they used
Na+,K+-ATPase, whereas we used
H+,K+-ATPase. Expression level of Chimera 4 was
also similar to that of the wild-type
H+,K+-ATPase -subunit judging from the
immunoblot analysis using antibody Ab1024 (data not shown). The
membrane fraction obtained from HEK-293 cells transfected with Chimera
4 cDNA also retained the K+-ATPase activity; however,
its value was smaller than that of the wild-type
H+,K+-ATPase: 0.47 and 1.19 µmol/mg/h,
respectively. But, the K+-ATPase activity of Chimera 4 was
still sensitive to SCH 28080. Fig. 5 shows the effects of various
concentrations of SCH 28080 on the K+-ATPase activity of
Chimera 4. The IC50 value was 4.5 µM, similar to that of the wild-type H+,K+-ATPase. These
results indicate that the luminal half of the M1 segment of
H+,K+-ATPase is not necessary for the binding
with SCH 28080 in H+,K+-ATPase.
SCH 28080 Sensitivity of Na+,K+-ATPase with
Mutations in the M1 Segment--
It is very difficult to explain our
above results in harmony with the result shown by Lyu and Farley (12).
We prepared the similar chimeric Na+,K+-ATPase
-subunit as the gM1/2 prepared by Lyu and Farley (12); that
is, a chimeric Na+,K+-ATPase -subunit in
which the segment starting from Ile-101 to Ile-112 (counted from the
amino terminus of the mature protein) of rat
Na+,K+-ATPase -subunit (25) was swapped by
the counterpart of H+,K+-ATPase (NH12N
chimera). This chimeric Na+,K+-ATPase
-subunit was co-expressed with rat
Na+,K+-ATPase -subunit in HEK-293 cells, and
the Na+,K+-ATPase activity in the membrane
fraction was measured (Fig. 6). When the
cells were transfected with the wild-type
Na+,K+-ATPase or NH12N chimeric -subunit
cDNA together with the Na+,K+-ATPase
-subunit cDNA, Na+,K+-ATPase activity
resistant to 1 µM ouabain in the cell membrane fraction
was significantly greater than that in the mock-transfected cells,
indicating the expression of the exogenous
Na+,K+-ATPase (wild-type rat
Na+,K+-ATPase or chimeric
Na+,K+-ATPase). These
Na+,K+-ATPase activities insensitive to 1 µM ouabain were almost completely inhibited by 1 mM ouabain but were not inhibited by 50 µM
SCH 28080. Therefore, Na+,K+-ATPase activity of
the NH12N chimera was not sensitive to SCH 28080.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of ouabain and SCH 28080 on the
Na+,K+-ATPase activity in the membrane
fractions obtained from HEK-293 cells transfected with mock, the
wild-type Na+,K+-ATPase
-subunit, or the chimeric
-subunit (NH12N) cDNA together with the
Na+,K+-ATPase -subunit
cDNA. Na+,K+-stimulated ATPase
activity was measured as described under "Experimental Procedures"
in the absence of inhibitors (black column) or in the
presence of 1 µM ouabain (gray column), 1 mM ouabain (dotted column), 50 µM
SCH 28080 (open column), or 50 µM SCH 28080 plus 1 µM ouabain (hatched column). The values
are the mean ± S.E. for three observations in each of three
transfections.
|
|
SCH 28080 Sensitivity of H+,K+-ATPases with
Mutations in the M6 Transmembrane Segment--
Previously, we reported
that the aspartic acid mutant of Glu-822 in the M6 transmembrane
segment (E822D) showed about 8 times lower affinity for SCH 28080 compared with the wild-type H+,K+-ATPase,
whereas the affinity of this mutant for K+ was unchanged
(11). It is likely that the M6 segment is involved in the interaction
with SCH 28080 because several amino acids in this segment are involved
in determining the affinity for K+ (11, 26) and presumably
form part of the cation binding site, and also because SCH 28080 binds
to the K+-high affinity site from kinetic analysis (6). We
prepared gastric H+,K+-ATPases with single
mutations, in which one of amino acids in the M6 segment was replaced
by alanine, and examined the SCH 28080 sensitivity of the mutants.
Table I shows the K+-ATPase
activity, IC50 values, and Km values for
K+ of the mutants, I818A, C824A, T825A, and P829A. Mutant
C824A showed the SCH 28080 sensitivity similar to that of the wild-type H+,K+-ATPase; however, mutants T825A and P829A
showed 5- and 4-fold lower sensitivity, respectively. We could not
measure the sensitivity of mutants I821A, I823A, and D826A because they
showed little or no ATPase activity (data not shown). These results
suggest that Glu-822, Thr-825, and Pro-829 are involved in determining the affinity for SCH 28080.
View this table:
[in this window]
[in a new window]
|
Table I
K+-ATPase activity, IC50 value for SCH 28080 inhibition
and Km value for K+ activation of M6 mutant
H+, K+-ATPases
|
|
Ouabain sensitivity of Chimeric
H+,K+-ATPases--
The loop 1 segment of the
Na+,K+ ATPase -subunit is one of the major
determinants for ouabain (cardiac glycosides) binding. Fig.
7 shows the amino acid residues reported
to be involved in determining the affinity for ouabain in
Na+,K+-ATPase: amino acids Gln-111, Asp-121,
and Asn-122 at the edges of the loop 1 segment (10); Cys-104 and
Tyr-108 in the M1 transmembrane segment (13-15); Tyr-308 in the loop 2 segment between the M3 and M4 transmembrane segments (16); Phe-786 in
the M5 transmembrane segment (17); Leu-793 and Thr-797 in the loop 3 segment between the M5 and M6 transmembrane segments (17-19); and
Phe-863 and Arg-880 in the loop 4 segment between the M7 and M8
transmembrane segments (17, 20). In addition, it was reported that
mutation of Pro-118 in the loop 1 segment changed the dissociation
constant for ouabain (20). Canfield and Levenson (27) reported that
multiple residues within the loop 1 contributed to the affinity for
ouabain. Recently, Leu-330, Ala-331, and Thr-338 in the M4
transmembrane segment and Phe-982 in the M10 transmembrane segment were
also reported to be partly involved in determining the affinity for
ouabain from the random mutagenesis study (28). Our Chimera 2 conserved many of the residues that are involved in determining the affinity for
ouabain described above; it did not conserve Tyr-108, Thr-338, Phe-786,
Thr-797, and Phe-984 (Fig. 7). Among them Thr-797 is one of the major
determinants for ouabain binding (28). Thr-797 of sheep
Na+,K+-ATPase corresponds to Cys-815 of rabbit
gastric H+,K+-ATPase. Starting from Chimera 2, we constructed Chimera 5, in which Cys-815 was mutated to Thr, and
examined its ouabain sensitivity. The membrane fraction obtained from
HEK cells transfected with Chimera 5 cDNA also retained the
K+-ATPase activity, its value being smaller than that of
the wild-type H+,K+-ATPase (0.64 µmol/mg/h).
Fig. 8 shows the ouabain sensitivity of
the K+-ATPase activity of the chimeras and the wild-type
H+,K+-ATPase comparing with that of the
endogenous Na+,K+-ATPase activity of HEK cells.
The wild-type H+,K+-ATPase showed almost no
sensitivity to ouabain up to 2 mM (less than 10%
inhibition), whereas the endogenous
Na+,K+-ATPase was inhibited by ouabain in a
concentration-dependent manner, with an IC50
value of about 1 µM. Therefore, the K+-ATPase
activity measured in the membrane fraction of the cells expressing
H+,K+-ATPase in the absence of Na+
represents little Na+-independent fraction of endogenous
Na+,K+-ATPase. The K+-ATPase
activity of Chimera 2 also showed almost no sensitivity to ouabain up
to 5 mM, whereas that of Chimera 5 was significantly inhibited by ouabain in the range higher than 1 mM, with an
IC50 value of about 2 mM. The
K+-ATPase activity of Chimera 5 was also inhibited by
digoxin; 42% inhibition was observed with 300 µM
digoxin, indicating that the inhibition of the K+-ATPase
activity by ouabain is not due to a nonspecific effect. The
K+-ATPase activity of Chimera 5 was also inhibited by SCH
28080, as shown in Fig. 9. Therefore,
Chimera 5 is sensitive to both ouabain and SCH 28080, and Cys-815 was
not directly involved in SCH 28080 binding. These results indicate that
simultaneous replacement of the amino acid residues in the loop 1 segment and Cys-815 of H+,K+-ATPase with the
corresponding counterparts of Na+,K+-ATPase,
respectively, confers ouabain sensitivity on this chimeric H+,K+-ATPase. However, the ouabain sensitivity
of Chimera 5 was much lower than that of
Na+,K+-ATPase endogenously present in HEK
cells.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Amino acid sequences and residues of sheep
Na+,K+-ATPase
1-subunit reported to be important for determining
the affinity for ouabain and alignments with those of Chimera 2, Chimera 5, and rabbit gastric
H+,K+-ATPase. Amino acids determining the
affinity for ouabain in sheep kidney
Na+,K+-ATPase 1-subunit (Sh alpha-1
NKA) (31) are presented (top row) with
arrows and amino acid numbers. The corresponding amino acids
of Chimera 2, Chimera 5, and rabbit gastric
H+,K+-ATPase -subunit (Rab Gastric
HKA) (32) are presented. The numbers in the bottom row
correspond to rabbit gastric H+,K+-ATPase
-subunit.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 8.
Effects of ouabain concentrations on the
expressed K+-ATPase activity of wild-type
H+,K+-ATPase, Chimeras 2 and 5, and the
endogenous Na+,K+-ATPase activity of HEK
cells. K+-ATPase activity of the wild-type ( ),
Chimera 2 ( ), and Chimera 5 ( ) was measured as described under
"Experimental Procedures" in the presence of various concentrations
of ouabain. The K+-ATPase activity in the absence of
ouabain was 0.96 ± 0.03 µmol/mg/h for the wild-type, 0.85 ± 0.03 µmol/mg/h for Chimera 2, and 0.64 ± 0.02 µmol/mg/h
for Chimera 5. Na+,K+-ATPase activity of the
mock-transfected HEK cells ( ) was measured in the presence of
various concentrations of ouabain. The
Na+,K+-ATPase activity in the absence of
ouabain was 1.53 ± 0.01 µmol/mg/h. The values are the mean ± S.E. for three observations in each of three transfections.
|
|

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 9.
Effects of ouabain and SCH 28080 on the
K+-ATPase activity of Chimera 5. K+-ATPase
activities of Chimera 5 in the presence of 50 µM SCH
28080 and in the presence of 5 mM ouabain are presented as
a percentage of that in the absence of inhibitors (control).
The K+-ATPase activity in the absence of inhibitors was
0.64 ± 0.02 µmol/mg/h.
|
|
 |
DISCUSSION |
SCH 28080 is a specific inhibitor for gastric
H+,K+-ATPase, which competitively binds to the
K+ site on the luminal side (6). Therefore, it is a good
tool to study the location and the structure of the K+
site. We have shown that a chimeric
H+,K+-ATPase, Chimera 2, in which the entire
loop 1 segment between the first and second transmembrane segments M1
and M2 of the rabbit H+,K+-ATPase -subunit
was replaced with the corresponding portion of the sheep
Na+,K+-ATPase 1-subunit, retains sensitivity
to SCH 28080 comparable with that of the wild-type
H+,K+-ATPase (Fig. 3). This result indicates
that the loop 1 is not the direct binding site of SCH 28080.
We have recently proposed that Glu-822 in the M6 segment of gastric
H+,K+-ATPase is one of the sites involved in
determining the affinity for SCH 28080 (11). Here, we further studied
the role of amino acids in the M6 segment around Glu-822 in determining
the affinity for SCH 28080. Among them, the side chains of Thr-825 and
Pro-829 are newly found to be involved in determining the affinity for SCH 28080. The amino acid residue corresponding to Glu-822 is Asp in
Na+,K+-ATPase, whereas Thr-825 and Pro-829 are
conserved between H+,K+-ATPase and
Na+,K+-ATPase. These three residues are located
3 or 4 amino acids apart in the M6 helical domain. It is interesting
that these three amino acids determining the affinity for SCH 28080 occupy the adjacent positions on the one side of the helix along the
transmembrane direction (Fig. 10).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 10.
A helical wheel model of the M6 segment of
the H+,K+-ATPase. Amino acid residues
between Cys-815 and Leu-833 are plotted on the helical wheel model.
Glu-822, Thr-825, and Pro-829 (underlined) are located on
the same side of the helical wheel.
|
|
Recently Lyu and Farley (12) reported that the luminal half of the M1
segment of H+,K+-ATPase is a partial
determinant of SCH 28080 sensitivity from the finding that when this
segment (115Val-126Ile) of rat gastric
H+,K+-ATPase was incorporated into the
corresponding portion of Na+,K+-ATPase, the
chimeric Na+,K+-ATPase showed high affinity for
SCH 28080. The amino acid residues of this segment were relatively well
conserved between Na+,K+-ATPase and
H+,K+-ATPase; as shown in Fig. 4, 4 of 12 amino
acid residues in this segment are identical between
Na+,K+-ATPase and
H+,K+-ATPase -subunits, and several other
replacements are conservative. Here, we prepared a chimeric
H+,K+-ATPase -subunit (Chimera 4) in which
the luminal half of the M1 segment
(Val117-Ile128) of
H+,K+-ATPase was replaced by the corresponding
segment of the Na+,K+-ATPase. Chimera 4 retained the K+-ATPase activity and showed SCH 28080 sensitivity comparable to that of the wild-type
H+,K+-ATPase (Fig. 5), suggesting that the
segment Val117-Ile128 is not essential for the
binding with SCH 28080 in H+,K+-ATPase. Three
mutant H+,K+-ATPases, in which two consecutive
amino acids in the M1 segment were replaced by the corresponding amino
acids of Na+,K+-ATPase (V117I/A118G,
A120V/I121L, and L123F/I124L), also showed SCH 28080 sensitivity
similar to that of the wild-type H+,K+-ATPase.
These findings further support our present conclusion. Furthermore, we
prepared a chimeric Na+,K+-ATPase -subunit
(NH12N) that is similar to that prepared by Lyu and Farley (12) and
studied the sensitivity of expressed Na+,K+-ATPase activity of the chimeric enzyme
to SCH 28080. Na+,K+-ATPase activity of the
chimeric enzyme expressed in HEK cells was not inhibited by 50 µM SCH 28080 (Fig. 6), indicating again that the luminal
half of the M1 segment of H+,K+-ATPase is not
involved in SCH 28080 binding. At present, it is hard to explain why
our results are not consistent with the previous result reported by Lyu
and Farley (12). It should be pointed out that we used rat
Na+,K+-ATPase -subunit as a parental
molecule, whereas Lyu and Farley used sheep
Na+,K+-ATPase -subunit, and that we
transiently expressed the chimeric ATPase in HEK-293 cells, whereas
they used the yeast expression system.
The present Chimera 5 contains many amino acid residues involved in
determining the affinity for ouabain (Fig. 7). This chimera acquired
sensitivity to ouabain at the range higher than 1 mM (Fig.
8). The K+-ATPase activity of this chimera was also
sensitive to SCH 28080 (Fig. 9). Blostein et al. (29)
reported that a chimeric ATPase composed of the amino-terminal half of
the rat gastric H+,K+-ATPase and the
carboxyl-terminal half of the rat Na+,K+-ATPase
1 was bound with ouabain. (The junction between the amino- and
carboxyl-terminal halves is a fluorescein isothiocyanate-binding site,
a part of ATP binding site in the large cytoplasmic loop between the M4
and M5 transmembrane segments.) From this result, they proposed that
the localization of determinants for ouabain binding in the
Na+,K+-ATPase is not restricted in the
amino-terminal half of the -subunit and that multiple domains are
capable of individually supporting low affinity ouabain binding. Their
findings are in good agreement with our present findings. Chimera 5 has
12 amino acid residues that have been identified to be involved in
ouabain binding in the wild-type Na+,K+-ATPase:
Cys-104 (position numbers for sheep
Na+,K+-ATPase 1) in M1; Gln-111, Pro-118,
Asp-121, and Asn-122 in loop 1; Tyr-308 in loop 2; Leu-330 and Ala-331
in M4; Leu-793 and Thr-797 in loop 3; and Phe-863 and Arg-880 in loop 4 (28). The present sensitivity of Chimera 5 to ouabain is, however, very
low compared with that of the wild-type
Na+,K+-ATPase. The low sensitivity of Chimera 5 to ouabain is comparable with that of the chimeric ATPase between
Na+,K+-ATPase and SERCA
(Ca2+-ATPase) reported by Ishii and Takeyasu (30). An
isoform of H+,K+-ATPase cloned in rat colon
(HK 2) also showed low affinity for ouabain (the
Ki value was 970 µM) (7). The present low sensitivity of Chimera 5 suggests that additional amino acid substitution is necessary to increase ouabain sensitivity, which may
shift the overall structural integrity of chimeric
H+,K+-ATPase toward that of the wild-type
Na+,K+-ATPase. Tyr-108 in M1, Thr-338 in M4,
Phe-786 in loop 3 (or M5), and Phe-982 in M10 are also reported to be
involved in determining the affinity for ouabain by random mutagenesis
experiments (28). These residues are not conserved in the wild-type
H+,K+-ATPase -subunit, although there
has been no report for the ouabain sensitivity of the mutants in which
these residues are mutated to the corresponding amino acids in the
H+,K+-ATPase.
It is also noticeable that the binding site of SCH 28080 on the
H+,K+-ATPase is not a counterpart of ouabain on
the Na+,K+-ATPase because the
K+-ATPase activity of Chimera 5 acquired ouabain
sensitivity and maintained SCH 28080 sensitivity. Chimera 5 has
mutations in the loop 1 segment and Cys-815, which are not involved in
determining the affinity for SCH 28080 in the
H+,K+-ATPase.
In conclusion, we have shown that the loop 1 and the luminal half of
the M1 segments of H+,K+-ATPase -subunit are
not essential for the binding with the proton pump inhibitor SCH 28080. Furthermore, incorporation of the loop 1 segment of
Na+,K+-ATPase -subunit and replacement of
Cys-815 by Thr in gastric H+,K+-ATPase confer
ouabain sensitivity to this chimeric
H+,K+-ATPase. This is the first report for the
preparation of chimeric H+,K+-ATPase that is
sensitive to both SCH 28080 and ouabain.
 |
ACKNOWLEDGEMENTS |
We thank Nopparat Thitiwatanakarn for
technical assistance. We thank Prof. Kazuya Taniguchi for providing pig
kidney Na+,K+-ATPase preparation and Dr.
Michael J. Caplan for the gift of rat
Na+,K+-ATPase - and -subunit cDNAs.
We are also grateful Prof. Robert A. Farley for his gM1/2 clone.
 |
FOOTNOTES |
*
This study was supported in part by a grant-in-aid for
encouragement of young scientists (to S. A.), and by a grant-in-aid for scientific research on priority areas (to S. A. and N. T.) from
the Ministry of Education, Science, Sports and Culture of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 81-764-34-2281;
Fax.: 81-764-34-5176; E-mail: shinji{at}ms.toyama-mpu.ac.jp.
 |
ABBREVIATIONS |
The abbreviations used are:
SCH 28080, 2-methyl-8-(phenylmethoxy)imidazo (1,2-a)pyridine-3-acetonitrile;
PCR, polymerase chain reaction.
 |
REFERENCES |
-
Wallmark, B.,
Larsson, H.,
and Humble, L.
(1985)
J. Biol. Chem.
260,
13681-13684[Abstract/Free Full Text]
-
Morii, M.,
Takata, H.,
and Takeguchi, N.
(1989)
Gastroenterology
96,
1453-1461[Medline]
[Order article via Infotrieve]
-
Morii, M.,
Hamatani, K.,
and Takeguchi, N.
(1995)
Biochem. Pharmacol.
49,
1729-1734[CrossRef][Medline]
[Order article via Infotrieve]
-
Scott, C. K.,
and Sundell, E.
(1985)
Eur. J. Pharmacol.
112,
268-270[CrossRef][Medline]
[Order article via Infotrieve]
-
Keeling, D. J.,
Taylor, A. G.,
and Schudt, C.
(1989)
J. Biol. Chem.
264,
5545-5551[Abstract/Free Full Text]
-
Beil, W.,
Hackbarth, I.,
and Sewing, K.
(1986)
Br. J. Pharmacol.
88,
19-23[Medline]
[Order article via Infotrieve]
-
Cougnon, M.,
Planelles, G.,
Crowson, M. S.,
Shull, G. E.,
Rossier, B. C.,
and Jaisser, F.
(1996)
J. Biol. Chem.
271,
7277-7280[Abstract/Free Full Text]
-
Takeguchi, M.,
Asano, S.,
Tabuchi, Y.,
and Takeguchi, N.
(1990)
Gastroenterology
99,
1339-1346[Medline]
[Order article via Infotrieve]
-
Munson, K. B.,
Gutierrez, C.,
Balaji, V. N.,
Ramnarayan, K.,
and Sachs, G.
(1991)
J. Biol. Chem.
266,
18976-18988[Abstract/Free Full Text]
-
Price, E. M.,
and Lingrel, J. B
(1988)
Biochemistry
27,
8400-8408[CrossRef][Medline]
[Order article via Infotrieve]
-
Asano, S.,
Matsuda, S.,
Tega, Y.,
Shimizu, K.,
Sakamoto, S.,
and Takeguchi, N.
(1997)
J. Biol. Chem.
272,
17668-17674[Abstract/Free Full Text]
-
Lyu, R.,
and Farley, R. A.
(1997)
Am. J. Physiol.
272,
C1717-C1725[Abstract/Free Full Text]
-
Yamamoto, S.,
Askew, G. R.,
Heiny, J.,
Masaki, H.,
and Yatani, A.
(1996)
Am. J. Physiol.
270,
C457-C464[Abstract/Free Full Text]
-
Canessa, C. M.,
Horisberger, J-D.,
Louvard, D.,
and Rossier, B. C.
(1992)
EMBO J.
11,
1681-1687[Medline]
[Order article via Infotrieve]
-
Askew, G. R.,
and Lingrel, J. B
(1994)
J. Biol. Chem.
269,
24120-24126[Abstract/Free Full Text]
-
Canessa, C. M.,
Horisberger, J-D.,
and Rossier, B. C.
(1993)
J. Biol. Chem.
268,
17722-17726[Abstract/Free Full Text]
-
Palasis, M.,
Kuntzweiler, T. A.,
Argüello, J. M.,
and Lingrel, J. B
(1996)
J. Biol Chem.
271,
14176-14182[Abstract/Free Full Text]
-
Burns, E. L.,
Nicholas, R. A.,
and Price, E. M.
(1996)
J. Biol. Chem.
271,
15879-15883[Abstract/Free Full Text]
-
Feng, J.,
and Lingrel, J. B
(1994)
Biochemistry
33,
4218-4224[CrossRef][Medline]
[Order article via Infotrieve]
-
Schultheis, P. J.,
Wallick, E. T.,
and Lingrel, J. B
(1993)
J. Biol. Chem.
268,
22686-22694[Abstract/Free Full Text]
-
Asano, S.,
Tega, Y.,
Konishi, K.,
Fujioka, M.,
and Takeguchi, N.
(1996)
J. Biol Chem.
271,
2740-2745[Abstract/Free Full Text]
-
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
-
Asano, S.,
Arakawa, S.,
Hirasawa, M.,
Sakai, H.,
Ohta, M.,
Ohta, K.,
and Takeguchi, N.
(1994)
Biochem. J.
299,
59-64
-
Yoda, A.,
and Hokin, L. E.
(1970)
Biochem. Biophys. Res. Commun.
40,
880-886[CrossRef][Medline]
[Order article via Infotrieve]
-
Shull, G. E.,
Greeb, J.,
and Lingrel, J. B
(1986)
Biochemistry
25,
8125-8132[CrossRef][Medline]
[Order article via Infotrieve]
-
Swarts, H. G.,
Klaassen, C. H.,
de Boer, M.,
Fransen, J. A.,
and De Pont, J. J.
(1996)
J. Biol. Chem.
271,
29764-29772[Abstract/Free Full Text]
-
Canfield, V. A.,
and Levenson, R.
(1998)
Biochemistry
37,
7509-7516[CrossRef][Medline]
[Order article via Infotrieve]
-
Croyle, M. L.,
Woo, A. L.,
and Lingrel, J. B
(1997)
Eur. J. Biochem.
248,
488-495[Medline]
[Order article via Infotrieve]
-
Blostein, R.,
Zhang, R.,
Gottardi, C. J.,
and Caplan, M. J.
(1993)
J. Biol. Chem.
268,
10654-10658[Abstract/Free Full Text]
-
Ishii, T.,
and Takeyasu, K.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8881-8885[Abstract/Free Full Text]
-
Shull, G. E.,
Schwartz, A.,
and Lingrel, J. B
(1985)
Nature
316,
691-695[CrossRef][Medline]
[Order article via Infotrieve]
-
Bamberg, K.,
Mercier, F.,
Reuben, M. A.,
Kobayashi, Y.,
Munson, K. B.,
and Sachs, G.
(1992)
Biochim. Biophys. Acta
1131,
69-77[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Asano, A. Yoshida, H. Yashiro, Y. Kobayashi, A. Morisato, H. Ogawa, N. Takeguchi, and M. Morii
The Cavity Structure for Docking the K+-competitive Inhibitors in the Gastric Proton Pump
J. Biol. Chem.,
April 2, 2004;
279(14):
13968 - 13975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Y. Qiu, J. B. Koenderink, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
Phe783, Thr797, and Asp804 in Transmembrane Hairpin M5-M6 of Na+,K+-ATPase Play a Key Role in Ouabain Binding
J. Biol. Chem.,
November 21, 2003;
278(47):
47240 - 47244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Codina, J. Cardwell, J. J. Gitomer, Y. Cui, B. C. Kone, and T. D. Dubose Jr.
Sch-28080 depletes intracellular ATP selectively in mIMCD-3 cells
Am J Physiol Cell Physiol,
November 1, 2000;
279(5):
C1319 - C1326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Koenderink, H. P. H. Hermsen, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
High-affinity ouabain binding by a chimeric gastric H+,K+-ATPase containing transmembrane hairpins M3-M4 and M5-M6 of the alpha 1-subunit of rat Na+,K+-ATPase
PNAS,
September 29, 2000;
(2000)
200109597.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. A. Farley, S. Schreiber, S.-G. Wang, and G. Scheiner-Bobis
A Hybrid between Na+,K+-ATPase and H+,K+-ATPase Is Sensitive to Palytoxin, Ouabain, and SCH 28080
J. Biol. Chem.,
January 19, 2001;
276(4):
2608 - 2615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Koenderink, H. P. H. Hermsen, H. G. P. Swarts, P. H. G. M. Willems, and J. J. H. H. M. De Pont
High-affinity ouabain binding by a chimeric gastric H+,K+-ATPase containing transmembrane hairpins M3-M4 and M5-M6 of the alpha 1-subunit of rat Na+,K+-ATPase
PNAS,
October 10, 2000;
97(21):
11209 - 11214.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|