![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 12, 7857-7864, March 19, 1999
1,3-Glucuronosyltransferases*
,From the Division of Cellular and Molecular Medicine, Glycobiology Research and Training Program, University of California at San Diego, La Jolla, California 92093-0687
| |
ABSTRACT |
|---|
|
|
|---|
While expression-cloning
enzymes involved in heparan sulfate biosynthesis, we isolated a
cDNA that encodes a protein 65% identical to the
UDP-GlcUA:glycoprotein Glucuronic acid has been found in several types of complex
carbohydrates expressed by vertebrate and invertebrate cells, including the sulfated glycosaminoglycan chains of proteoglycans and HNK-1 carbohydrate epitopes (3OSO3GlcUA Much information is available about the enzymes involved in the
addition of GlcUA to these glycans. Assembly of HNK-1 occurs by the
transfer of GlcUA from the high energy donor UDP-GlcUA to a terminal
galactose residue linked Glycosaminoglycan biosynthesis begins by the formation of the
tetrasaccharide linkage intermediate
-GlcUA These findings raised the question of whether formation of the
linkage region and HNK-1 determinants is catalyzed by the same enzyme.
Curenton et al. (17) provided evidence that GlcUAT-I is
distinct from the enzyme involved in HNK-1 formation based on partial
separation of the activities and substrate competition studies. The
cloning of a cDNA for GlcUAT-P confirmed that at east two
enzymes exist, but detailed analysis of substrate specificity was not
done. In the present report, we isolated a cDNA encoding a hamster
glucuronosyltransferase that is 65% identical to GlcUAT-P (10) and
95% identical to human GlcUAT-I (18), which was cloned while these
experiments were under way. Analysis of the recombinant enzymes showed
significant overlap in substrate specificity, and transfection
experiments revealed that both enzymes will produce HNK-1 carbohydrate
epitopes and facilitate glycosaminoglycan biosynthesis.
Cell Cultures--
Chinese hamster ovary (CHO-K1, ATCC CCL-61),
COS-7 (ATCC CRL-1651), and Lec2 (ATCC CRL-1736) cells were obtained
from the American Type Culture Collection (Manassas, VA). Mutants
pgsG-110, -114, and -224 were isolated by direct selection of
glycosaminoglycan-deficient CHO-K1 cells and will be described in
greater detail elsewhere.2
Lec2-GlcUAT-P is a subclone of Lec2 stably expressing HNK-1 GlcUAT-P and was kindly provided by E. Ong and M. Fukuda (Burnham Institute, La
Jolla, CA). All of the cell lines were grown under an atmosphere of 5%
CO2 in air and 100% relative humidity. CHO cells and the various transfectants were maintained in Ham's F-12 growth medium (Hyclone Laboratories) supplemented with 7.5% (v/v) fetal bovine serum
(Hyclone Laboratories), 100 µg/ml streptomycin sulfate, and 100 units/ml penicillin G. Sulfate-free medium was prepared from individual
components (19), substituting chloride salts for sulfate and fetal
bovine serum that had been dialyzed exhaustively against
phosphate-buffered saline (20). COS-7 cells were maintained in
Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum and antibiotics. Lec2 cells
were maintained in Cloning of a Novel Glucuronosyltransferase from Chinese Hamster
Ovary Cells--
pgsD-H661, a CHO mutant defective in heparan sulfate
biosynthesis (14), was stably transfected with a CHO-K1 cDNA
library in pcDNA1 (Invitrogen) and screened for restoration of
heparan sulfate
biosynthesis.3 A PCR fragment
was prepared using the genomic DNA from the correctant as a template
and the SP6 and T7 flanking sequences of the integrated vector as
primers. PCRs were carried out with Taq DNA polymerase (Life
Technologies, Inc.) in a Perkin-Elmer Model 2400 thermal cycler (35 cycles at 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 3 min, with a final incubation at 72 °C for 10 min). The PCR fragment
was cloned into pGEM-T (Promega), and the sequence was determined on
both strands by the dideoxy chain termination method using
Taq polymerase (dye terminator cycle sequencing, Perkin-Elmer) with a DNA automatic sequencer (ABI PRISM genetic analyzer).
cDNA Library Screening and Hybridization--
Approximately
6 × 105 colonies from a CHO-K1 cDNA library in
pcDNA1 were transferred to Duralon-UVTM membranes
(Stratagene) and fixed by alkaline lysis as recommended by the
manufacturer. The filters were prehybridized in a solution containing
0.02 M PIPES, 0.8 M NaCl, 50% (v/v) deionized
formamide, 0.5% SDS, and 100 µg/ml denatured salmon sperm DNA for
2 h at 42 °C. The PCR product described above was labeled with
[32P]dCTP by random oligonucleotide priming (Prime-IT II
labeling kit, Stratagene) and purified with an Elute-tip (Schleicher & Schüll). Hybridization was carried out for ~16 h at 42 °C in the same buffer containing ~1 × 106 cpm/ml
32P-labeled probe, and positive clones were detected by
conventional autoradiography. One of the plasmids obtained in this way
(1B-2) contained the full-length sequence and was named
pcDNA1-GlcUAT-X in initial experiments. This was later shown to
encode a section of GlcUAT-I and therefore was renamed GenBankTM/EBI
accession number AF113703.
Mouse multiple-tissue poly(A)+ RNA
(CLONTECH) was hybridized using gel-purified
full-length cDNA for GlcUAT-I as a probe essentially according to
the manufacturer's recommendation. Briefly, the solution was prewarmed
to 68 °C, and the blot was prehybridized for 30 min. The Expresshyb
solution was replaced with fresh solution containing 1-2 × 106 cpm/ml 32P-labeled probe and hybridized at
68 °C for 1 h. The blot was rinsed and washed for 30-40 min at
room temperature in 2× SSC containing 0.05% SDS with several changes
of buffer and then for 40 min at 50 °C in 0.1× SSC containing 0.1%
SDS, with one change of solution. Hybridization was detected with a
PhosphorImager (Storm 860, Molecular Dynamics, Inc.).
Expression of the Protein A-GlcUAT-I and Protein A-GlcUAT-P
Fusion Proteins--
The cDNA fragment encoding amino acids
30-335 of GlcUAT-I (the putative stem region and catalytic domain) was
prepared by PCR using pcDNA1-GlcUAT-I as a template. The fragment
was fused in frame to the C terminus of protein A in pRK5-F10-PROTA
(21). The 5'-primer for PCR was
GGCGAATTCACCATGTGACTGCCTCCTCC, and the 3'-primer
was GGCGAATTCCAGTCCCACAAGGTATGTGCC (the EcoRI site is shown in boldface letters, and the coding
sequence of GlcUAT-I is underlined). PCR was carried out with
Pfu polymerase (CLONTECH; 25 cycles at
94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min,
followed by a final incubation at 72 °C for 7 min). The PCR products
were cloned into pCR-Script Amp SK(+) (Stratagene), and the sequences
were determined. The clone with the correct sequence was digested by
EcoRI and ligated into the EcoRI site of
pRK5-F10-PROTA to yield pPROTA-GlcUAT-I.
The cDNA fragment encoding amino acids 39-347 of rat GlcUAT-P
(GenBankTM/EBI accession number D88035) (10) was prepared
by PCR using pcDNA3-GlcUAT-P as a template (kindly provided by M. Fukuda). The 5'-primer was
TCCGGAATTCCCAGAGCAGCCTCGCACCT, and the 3'-primer was GCCCTCGAGTGTGTAGTTTCAGATCTCCAC
(the EcoRI and XhoI sites are shown in
boldface letters). Expression of soluble recombinant enzyme was
measured after transfection of COS-7 cells using LipofectAMINE (Life
Technologies, Inc.) according to the manufacturer's instructions. The
supernatant was centrifuged for 5 min at top speed in an IEC clinical
centrifuge at 4 °C to sediment cell debris. The supernatant was
collected and incubated with rabbit IgG-agarose beads (10 µl of
beads/ml of sample; Sigma) with end-over-end mixing at 4 °C for
24-48 h. The samples were centrifuged for 5 min, and the supernatant
was aspirated. The beads were washed twice with 10 ml of 20% (v/v)
glycerol and 50 mM Tris-Cl, pH 7.4, and resuspended in the
same buffer containing protease inhibitors (10 mM
phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml
pepstatin) to achieve an ~50% (v/v) slurry. The immobilized enzyme
was stable at 4 °C for at least 4 months.
Isolation of Cell Lines Stably Expressing GlcUAT-I and
GlcUAT-P--
The cDNA insert of pcDNA1-GlcUAT-I was digested
by HindIII and XhoI and cloned into pcDNA3
(Invitrogen), yielding pcDNA3-GlcUAT-I. Lec2, wild-type CHO-K1, and
pgsG mutant cells were transfected with pcDNA3-GlcUAT-I or
pcDNA3-GlcUAT-P using LipofectAMINE, and stable transfectants were
selected using 0.4 mg/ml (active) G418. Individual colonies were
screened for HNK-1 expression or glycosaminoglycan production, and
positive ones were isolated with glass cloning rings and expanded.
Immunofluorescence Staining of Cells by Anti-HNK-1
Antibody--
Cells were transfected with pcDNA3-GlcUAT-I and/or
pcDNA3-HNK-1 3OST (where 3OST is 3-O-sulfotransferase;
M. Fukuda). Two days later, the monolayers were washed twice with cold
PBS and fixed at 4 °C for 15 min with 4% (v/v) paraformaldehyde.
Cells were washed twice with PBS, blocked at room temperature for 10 min with 2% (w/v) bovine serum albumin in PBS, and incubated at room
temperature for 30-40 min with mouse monoclonal anti-HNK-1 antibody
(Becton Dickinson Advanced Cellular Biology) diluted 1:100 in buffer.
Primary antibody was removed, and the cells were incubated at room
temperature for 20-30 min with fluorescein
isothiocyanate-conjugated goat anti-mouse IgM antibody (Sigma) diluted
1:100 with buffer. Cells were washed again with PBS, mounted with
antifade reagent (Molecular Probes, Inc.), and examined by fluorescence
microscopy using a Zeiss epifluorescence microscope equipped with
a fluorescein isothiocyanate filter.
Western Analysis of Transfected Cells Expressing HNK-1
Carbohydrate Epitopes--
Cells were transiently transfected with
pcDNA3-HNK-1 3OST. Two days later, they were scraped from the dishes,
and 100 µg of cell protein was separated by electrophoresis on a 10%
SDS-polyacrylamide gel. After transfer onto nitrocellulose membranes
(Bio-Rad), the blot was blocked at 4 °C overnight with 4% (w/v)
skim milk in PBS and then incubated at room temperature for 4 h
with anti-HNK-1 antibody diluted 1:500 and for 1 h with
peroxidase-conjugated goat anti-mouse IgM antibody (Sigma) diluted
1:500. Bound antibody was visualized with diaminobenzidine reagent
(Aldrich). Some samples were digested with peptide
N-glycosidase F (22).
Synthesis of
UDP-[3H]GlcUA--
UDP-[3H]GlcUA was
synthesized as described previously with slight modification (23). All
of the enzymes were purchased from Boehringer Mannheim.
D-[1-3H]Glucose (10 Ci/mmol; NEN Life Science
Products) was dried (3.5 mCi, ~180 nmol) and dissolved in a solution
(500 µl) containing 10 mM MgCl2, 1 mM ATP, 4 mM UTP, 2 mM
NAD+, 10 mM D-glucose 1,6 diphosphate, 2 units/ml hexokinase, 4 units/ml inorganic
pyrophosphatase, 1 unit/ml UDP-glucose pyrophosphorylase, 0.3 units/ml
UDP-glucose dehydrogenase, and 50 mM Tris-HCl, pH 8.35. After overnight incubation at 25 °C, the samples were boiled for 5 min and centrifuged to remove precipitated protein. The products in the
supernatant were separated for 10 h by descending paper
chromatography using ethanol and 1 M sodium acetate in
water (7:3, v/v) as the solvent. Material that comigrated with the
authentic UDP-GlcUA was eluted from the paper with 10% (v/v)
ethanol/water, lyophilized, and dissolved in 100 µl of buffer
containing 10 units of calf intestinal phosphatase (Life Technologies,
Inc.). After 45 min at 37 °C, the sample was heated to 75 °C for
10 min, diluted with 1 ml of 0.1 N
NH4HCO3, and loaded onto a 0.5-ml column of AG
1-X2 acetate resin (Bio-Rad). The column was washed with 3 ml of water
and 5 ml of 0.25 N NH4HCO3, and
UDP-GlcUA was eluted with 3 ml of 1 M
NH4HCO3. Enough Dowex 50-X8 (H+
form, Bio-Rad) was added to neutralize the sample. After
centrifugation, the supernatant was dried by lyophilization, dissolved
in deionized water, and dried again. The final product was dissolved in
70% ethanol/water and stored at In Vitro Assay of GlcUAT-I, GlcUAT-P, and HNK-1
3-O-Sulfotransferase--
Gal
GlcUAT-I and GlcUAT-P activities were assayed under optimized condition
using Gal Purification of Glycosaminoglycan Chains--
Cells were labeled
for 24 h with 10 µCi/ml
H235SO4 (1600 Ci/mmol; NEN Life
Science Products) in sulfate-free medium. 35S-Labeled
glycosaminoglycan chains were isolated by anion-exchange chromatography
as described previously (26) and analyzed by anion-exchange HPLC using
a 7.5 mm (inner diameter) × 7.5-cm column of DEAE-3SW (TosoHaas,
Montgomeryville, PA). The column was equilibrated in 10 mM
KH2PO4 buffer, pH 6.0, containing 0.2% (w/v)
Zwittergent 3-12 and 0.2 M NaCl. The glycosaminoglycans
were eluted with a linear gradient of NaCl (0.2-1 M) in
the same buffer using a flow rate of 1 ml/min and by increasing the
NaCl concentration by 10 mM/min. The effluent from the
column was monitored for radioactivity with an in-line radioactivity
detector (Radiomatic Flo One/beta, Packard Instrument Co.) with
sampling rates every 6 s. The data were averaged over 1-min intervals.
Isolation of a cDNA Clone for a Glucuronosyltransferase from
Chinese Hamster Ovary Cells--
During a series of experiments to
identify genes involved in glycosaminoglycan synthesis (see
"Experimental Procedures"), we found a cDNA clone that showed
high homology to the recently cloned rat glycoprotein
glucuronosyltransferase involved in the assembly of HNK-1
epitopes (GlcUAT-P) (10). This clone, originally designated
GlcUAT-X, contained sequence homologous to the C-terminal ectodomain of GlcUAT-P, but lacked an ATG start codon. Using the insert
as a probe, we screened a commercial CHO-K1 cDNA library and
isolated six different clones. Two of the longest cDNAs were potentially full-length based on the presence of putative start and
stop codons. DNA sequencing revealed a single open reading frame with a
potential Kozak consensus sequence for ribosome recognition just
upstream from the ATG start codon and a polyadenylation signal located
close to a poly(A) run (Fig. 1). The open
reading frame encoded a 335-amino acid protein. Kyte-Doolittle
hydropathy analysis (38) indicated one potential transmembrane domain
consisting of 18 hydrophobic amino acid residues located 7 amino acids
from the initiating Met residue. A relatively proline-rich segment followed the hydrophobic section, and one potential
N-glycosylation site in the putative ectodomain was present
at Asn-299 (NCT, marked by an asterisk). These
characteristics are common to type II transmembrane proteins and to
many known Golgi glycosyltransferases (27). Overall, the sequence
exhibited 65% identity to rat GlcUAT-P, and therefore, we tentatively
characterized the cDNA as a homologue of this enzyme.
GlcUAT-X was expressed in various adult mouse tissues as measured by
Northern blot analysis using the full-length cDNA as a probe. As
shown in Fig. 2, a single transcript of
~1.8 kilobase pairs was obvious in adult liver, brain, and heart; was
moderately expressed in lung, skeletal muscle, kidney, and testis; and
was barely present in spleen. This distribution differs significantly from the expression of GlcUAT-P, which has two transcripts, one at 4.0 kilobase pairs and a minor one at 9.0 kilobase pairs, expressed strongly in brain (10). Furthermore, most non-neural tissues do not
normally express HNK-1 epitopes, suggesting that GlcUAT-X might not
participate in HNK-1 formation. As these studies were under way,
Kitagawa et al. (18) cloned a GlcUA-transferase cDNA from a human placenta cDNA library using PCR and degenerate primers based on the sequence of GlcUAT-P. Comparing its sequence
(GenBankTM/EBI accession number AB009598) with that of
GlcUAT-X showed that they were 95% identical at the amino acid level
(Fig. 3), suggesting that they most
likely represent the same enzyme from different species. Based on the
ability of the transferase to attach GlcUA to
Gal GlcUAT-I Can Generate HNK-1 Determinants in COS-7 and Lec2
Cells--
To test if GlcUAT-I can produce HNK-1 epitopes, we
cotransfected the cDNA encoding CHO GlcUAT-I and the human HNK-1
3-O-sulfotransferase (25) into COS-7 and Lec2 cells. Lec2
cells lack the Golgi CMP-sialic acid transporter, and therefore, the
cells accumulate oligosaccharides that terminate with Gal residues that
can serve as acceptors for GlcUA addition (10, 28). Like wild-type CHO
cells, Lec2 also does not express HNK-1
3-O-sulfotransferase. Therefore, control Lec2 cells and
those transfected with only GlcUAT-I or HNK-1
3-O-sulfotransferase did not stain with anti-HNK-1 antibody
(Fig. 4, A, C, and
D, respectively). However, when Lec2 cells were
cotransfected with both GlcUAT-I and HNK-1
3-O-sulfotransferase, the cells stained with anti-HNK-1 antibody, suggesting that GlcUAT-I induces HNK-1 expression on cell-surface glycoconjugates (Fig. 4B). GlcUAT-I was also
introduced into COS-7 cells, which have endogenous HNK-1
3-O-sulfotransferase (25). Therefore, transfection with
GlcUAT-I with or without sulfotransferase resulted in HNK-1 expression
(Fig. 4, F and H). In this regard, GlcUAT-I
behaved exactly the same as GlcUAT-P (25), but the staining of cells
transfected with GlcUAT-I was somewhat weaker (data not shown).
Nevertheless, these findings showed that GlcUAT-I can produce HNK-1
epitopes in vivo in different cell lines.
Conceivably, GlcUAT-I and GlcUAT-P may form HNK-1 determinants on
different glycoproteins or glycolipids. To test this idea, we analyzed
HNK-1-reactive glycoconjugates in Lec2 cell lines stably expressing
GlcUAT-I or GlcUAT-P and transiently transfected with HNK-1
3-O-sulfotransferase. Analysis of the glycolipid fraction by
thin-layer chromatography did not reveal any reactive lipids in either
cell type (data not shown). In contrast, HNK-1-reactive proteins were
present in both cell lines based on Western blotting of
SDS-polyacrylamide gels of total cell extracts (Fig.
5). Several prominent bands ranging from
65 to 100 kDa were present in cells stably transfected with GlcUAT-P,
whereas only a minor band at ~110 kDa was seen in cells containing
GlcUAT-I. The difference in reactivity was not due to variation in the
level of expression of the enzymes since in vitro assays
indicated that they did not vary significantly (7.2 ± 0.2 pmol/min/mg of cell protein for GlcUAT-P, 7.9 ± 2.2 pmol/min/mg for GlcUAT-I, and 0.42 ± 0.01 pmol/min/mg for
3-O-sulfotransferase activity). All of the bands were
peptide N-glycosidase F-sensitive, indicating that the
epitope was assembled on N-linked oligosaccharides found on
glycoproteins. Further characterization of the reactive bands has not
yet been done.
Comparison of Substrate Specificity of GlcUAT-I and
GlcUAT-P--
To further analyze the substrate specificity of
these GlcUA-transferases, the ectodomains of GlcUAT-I and
GlcUAT-P were fused to the IgG-binding domain of protein A, and
the chimeras were expressed in COS-7 cells. The secreted enzymes were
absorbed to IgG-agarose, washed, and assayed with various acceptors and
UDP-[3H]GlcUA. As shown in Table
I, both glucuronosyltransferases can act
on a variety of synthetic substrates containing terminal
Kinetic analysis of GlcUAT-I activity showed that the recombinant
enzyme formed products in proportion to time for up to 5 h with
all of the tested substrates (Fig.
6A). The apparent
Km values for Gal Restoration of Glycosaminoglycan Synthesis by Both
Glucuronosyltransferases in a Glycosaminoglycan-deficient
Mutant--
The high reactivity of GlcUAT-I with
Gal In this report, we have described the isolation and
characterization of a cDNA clone encoding a novel hamster
glucuronosyltransferase (GlcUAT-I). Our initial characterization of the
enzyme suggested that it might be a homologue of GlcUAT-P based on the
high degree of homology (65% identity) (Fig. 3) and its ability to
produce HNK-1-reactive material in the presence of HNK-1
3-O-sulfotransferase (Fig. 4). However, Northern blot
analysis showed that the enzyme had a markedly different tissue
distribution from HNK-1, with expression in virtually all tissues
tested (Fig. 2). In contrast, HNK-1 (and GlcUAT-P) is restricted to
brain and neurons (10). Furthermore, much less material contained
HNK-1 determinants in cells transfected with hamster GlcUAT-I compared
with GlcUAT-P (Fig. 5). These findings suggested that hamster
GlcUAT-I might be involved in the formation of another type of
GlcUA-containing glycoconjugate. To test this hypothesis, we examined a
number of synthetic and modified natural substrates as acceptors using recombinant forms of the enzymes. Hamster GlcUAT-I transferred GlcUA
efficiently to compounds containing Gal The substrate specificity of GlcUAT-I has been debated ever since the
enzyme activity was first described in cartilage and brain extracts
(11, 12). In these early studies, relatively crude enzyme preparations
were found to catalyze the transfer of GlcUA not only to
glycosaminoglycan linkage region fragments (Gal Given the apparent overlap in behavior of the enzymes, especially
GlcUAT-P, what can we say about their relative contribution to
glycosaminoglycan and HNK-1 synthesis? Under normal conditions, GlcUAT-I probably does not give rise to HNK-1 determinants since the
enzyme reacts relatively poorly with precursor glycoproteins, glycolipids, and synthetic disaccharides related to HNK-1 (Table I).
Furthermore, transfection of wild-type CHO or COS-7 cells with only
HNK-1 3-O-sulfotransferase does not result in expression of
glycoproteins reactive with HNK-1 antibodies, yet these cells express
endogenous GlcUAT-I activity. The inability of GlcUAT-I to form HNK-1
under these conditions might be due to differences in subcellular
location of the enzyme and macromolecular precursors of HNK-1. However,
Sugumaran et al. (29, 30) have suggested that GlcUAT-I may
be located in medial- and trans-Golgi fractions based on sucrose density gradient fractionation of chondrocytes. HNK-1
precursors are also likely to arise in these compartments of the Golgi
since the terminal Gal residue on glycoprotein substrates is attached
by How do we explain the expression of HNK-1 epitopes after introduction
of GlcUAT-I into cells (Figs. 4 and 5)? Expression of HNK-1
determinants in CHO and COS-7 cells under these conditions may merely
reflect the high level of enzyme activity achieved by plasmid
amplification and strong expression from the cytomegalovirus promoter,
which overpowers the weak activity of the enzyme with glycoprotein
substrates. Analysis of the enzyme activity in extracts prepared from
stable transfectants indicates that the enzyme is enhanced, but not in
all cases (Table II). Curiously, SDS-PAGE analysis of modified proteins
indicates that those bearing HNK-1 determinants differ in cells
transfected with GlcUAT-I and GlcUAT-P. Perhaps this reflects
differences in protein substrate recognition or subcellular
localization of the transfected enzyme and substrates. Identification
of the reactive glycoproteins and more precise localization studies of
the transferases may shed light on this issue.
The fact that GlcUAT-P can bypass a mutation in glycosaminoglycan
biosynthesis (Table II) presumably reflects the promiscuous behavior of
this enzyme with respect to acceptor substrates (Table I). These
findings suggest that GlcUAT-P may actually catalyze glycosaminoglycan
assembly in tissues expressing the enzyme, most notably brain (10).
Perhaps, GlcUAT-P has two roles: one to generate HNK-1 determinants on
glycoproteins and another to act as a failsafe system to ensure
completion of glycosaminoglycan chains on proteoglycans that have
somehow escaped the action of GlcUAT-I.
The similarity of GlcUAT-I and GlcUAT-P suggests an evolutionary
relationship between the genes. However, it is difficult to determine
which enzyme came first since glycosaminoglycans arose at about the
same time as the nervous system in metazoan evolution (cf.
Hydra). Furthermore, it is difficult to know if the more
promiscuous enzyme (GlcUAT-P) arose from the more specific one
(GlcUAT-I) or vice versa. Other members of the GlcUA-transferase family
need to be analyzed to complete the comparison. Other family members
include the transferases involved in elongation of heparan sulfate and
chondroitin sulfate (15, 30); hyaluronan synthases (32); GlcUAT-L, the
enzyme involved in forming HNK-1 determinants on glycolipids (7,
8); and possibly other enzymes inferred from GlcUA-containing
products isolated from cells (33, 34). Overall, GlcUAT-P and GlcUAT-I
do not show any homology to the hyaluronan synthases and the putative
heparan sulfate copolymerase recently reported by Lind et
al. (35).
The difference in substrate selectivity of GlcUAT-I and
GlcUAT-P presumably reflects variation in the acceptor
substrate-binding sites of the proteins. Unfortunately, >40% of the
residues differ between the two enzymes, making it difficult to
pinpoint specific residues that impart selectivity by merely comparing
sequences. However, it should be possible to study the enzyme structure
by swapping contiguous blocks of residues. This approach helped define sites in lysosomal enzymes that are recognized by the
phosphotransferase that adds GlcNAc-P to terminal mannose residues only
on lysosomal enzymes (36, 37). A similar strategy applied to GlcUAT-I
and GlcUAT-P might provide insight into active-site residues as well as
features of the proteins that confer substrate specificity.
1,3-glucuronosyltransferase (GlcUAT-P) involved in forming HNK-1 carbohydrate epitopes
(3OSO3GlcUA
1,3Gal-) on glycoproteins. The
cDNA contains an open reading frame coding for a protein of 335 amino acids with a predicted type II transmembrane protein orientation.
Cotransfection of the cDNA with HNK-1
3-O-sulfotransferase produced HNK-1 carbohydrate epitopes
in Chinese hamster ovary (CHO) cells and COS-7 cells. In
vitro, a soluble recombinant form of the enzyme transferred GlcUA
in
-linkage to
Gal
1,3/4GlcNAc
-O-naphthalenemethanol, which resembles
the core oligosaccharide on which the HNK-1 epitope is assembled.
However, the enzyme greatly preferred
Gal
1,3Gal
-O-naphthalenemethanol, a disaccharide
component found in the linkage region tetrasaccharide in chondroitin
sulfate and heparan sulfate. During the course of this study, a human
cDNA clone was described that was thought to encode
UDP-GlcUA:Gal
1,3Gal-R glucuronosyltransferase (GlcUAT-I), involved
in the formation of the linkage region of glycosaminoglycans (Kitagawa,
H., Tone, Y., Tamura, J., Neumann, K. W., Ogawa, T., Oka, S.,
Kawasaki, T., and Sugahara, K. (1998) J. Biol. Chem. 273, 6615-6618). The deduced amino acid sequences of the CHO and human
cDNAs are 95% identical, suggesting that they are in fact homologues of the same gene. Transfection of a CHO cell mutant defective in GlcUAT-I with the hamster cDNA restored
glycosaminoglycan assembly in vivo, confirming its
identity. Interestingly, transfection of the mutant with GlcUAT-P also
restored glycosaminoglycan synthesis. Thus, both GlcUAT-P and GlcUAT-I
have overlapping substrate specificities. However, the expression of
the two genes was entirely different, with GlcUAT-I expressed in all
tissues tested and GlcUAT-P expressed only in brain. These findings
suggest that, in neural tissues, GlcUAT-P may participate in both HNK-1
and glycosaminoglycan production.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES
1,3Gal-R). HNK-1
(human natural killer cell
carbohydrate antigen-1) was originally described on human
natural killer cells (1), but later studies showed that it was present
in greatest abundance in the nervous system on subsets of glycolipids
(2, 3), glycoproteins (4), and proteoglycans (5). In contrast,
glycosaminoglycans are ubiquitously distributed among tissues, usually
in covalent linkage to proteoglycan core proteins (6). Both HNK-1 and
glycosaminoglycans can bind a variety of proteins that participate in
cell-cell, cell-extracellular matrix, and cell signaling during
development (4, 6). The presence of GlcUA in both types of glycans and
the partial overlap in their ligand binding properties suggest the
possibility that their synthesis may be coordinated as well.
1,4 to GlcNAc, followed by sulfation of the
GlcUA residue at C-3. The glucuronosyltransferase associated with HNK-1
was first demonstrated in embryonic chick brain extracts using
neolactotetraosylceramide as acceptor (7). The same activity was found
later in rat brain using both neolactotetraosylceramide and
asialoorosomucoid as substrates (7-9). By partially purifying the
enzymes and noting differences in phospholipid activation and pH
dependence, Oka et al. (9) concluded that the
glucuronosyltransferase involved in the synthesis of HNK-1 epitopes on
glycoproteins (GlcUAT-P)1
differs from the one that acts on glycolipids (GlcUAT-L). This hypothesis was confirmed recently in studies of recombinant GlcUAT-P, which selectively adds GlcUA to glycoprotein substrates (10). The gene
and cDNA encoding GlcUAT-L have not yet been identified.
1,3Gal
1,3Gal
1,4Xyl
-O-Ser. This
intermediate serves as the primer for heparan sulfate and chondroitin
sulfate assembly, which arises from the alternating addition of
-GlcNAc and
-GlcUA or
-GalNAc and
-GlcUA residues, respectively, to the linkage tetrasaccharide. Three GlcUA-transferases are thought to catalyze the addition of GlcUA: one involved in the
formation of the linkage region tetrasaccharide (GlcUAT-I) (11, 12) and
two that polymerize the different chains (13). The latter activities
may be part of bifunctional enzymes in which the same protein catalyzes
the alternating addition of a HexNAc residue and GlcUA (14, 15).
GlcUAT-I, in contrast, is much like GlcUAT-P in that it transfers GlcUA
from UDP-GlcUA to a
-linked Gal residue. The enzyme was first
described in embryonic chick cartilage (12) and partially purified from
embryonic chick brain (11) and a mouse mastocytoma (16). Interestingly,
these early studies showed that crude enzyme preparations transferred
GlcUA not only to substrates derived from the linkage region, such as Gal
1,3Gal and Gal
1,3Gal
1,4Xyl, but also to lactose
(Gal
1,4Glc) and N-acetyllactosamine (Gal
1,4GlcNAc),
the precursor of HNK-1.
![]()
EXPERIMENTAL PROCEDURES
-minimal essential medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum and antibiotics. Lec2-GlcUAT-P cells were maintained in complete medium with
0.2 mg/ml (active) G418 (Life Technologies, Inc.).
20 °C for future use.
1,4Glc
-O-naphthalenemethanol
(NM), Gal
1,4GlcNAc
-O-NM,
Gal
1,3GlcNAc
-O-NM, Gal
1,3GalNAc
-O-NM,
Gal
1,3Gal
-O-NM, and Gal
1,3Gal
-O-benzyl were chemically synthesized from
individual monosaccharide units using standard orthogonal blocking
chemistry, coupling, and deblocking strategies. The details of their
synthesis, purification, and chemical characterization will be
published elsewhere.4 All
compounds were >98% pure by 1H NMR, 13C NMR,
and thin-layer chromatography. Gal
1,3GalNAc
-O-benzyl, monosaccharide glycosides, phosphatidylinositol, phosphatidylserine, asialofetuin (type II), and asialomucin were purchased from Sigma. N-Acetylheparosan oligosaccharides were prepared previously
from Escherichia coli K5 capsular polysaccharide (24).
Neolactotetraosylceramide was kindly provided by F. Jungalwala (Harvard
Medical School), and neolactohexaose was provided by M. Fukuda. Unless
otherwise indicated, the standard reaction (25 µl) contained 10 µl
of IgG bead slurry (50%) containing immobilized enzyme, 0.1 µCi of
UDP-[3H]GlcUA, 100 µM UDP-GlcUA, 0.03-10
mM acceptor, 100 mM HEPES, pH 6.5, 10 mM MnCl2, and 2.5 mM ATP. For
substrates containing Gal
1,3Gal
-O-NM, only 2 µl of
the beads was used, and the reaction time was reduced to 1 h in
order to work in the linear range (GlcUAT-I only). Assays for GlcUAT-P
also contained only 2 µl of enzyme immobilized on beads. In
repetitions of the experiments when different batches of the enzyme
were used, an aliquot was first analyzed by SDS-PAGE and silver
staining to obtain comparable amounts of enzyme. After incubation at
37 °C, the reaction products were diluted with 1 ml of 0.5 M NaCl and applied to a Sep-Pak C18 cartridge (100 mg; Waters). After washing the cartridge with 2 ml of water, the
product was eluted with 50% methanol, dried, and counted by liquid
scintillation. Glycoprotein acceptors were precipitated with 10% (w/v)
trichloroacetic acid, and the pellets were washed twice with 5%
trichloroacetic acid. Transferase activity using N-acetylheparosan acceptors was assayed using anion-exchange
chromatography as described previously (24).
1,3Gal
-O-NM as a substrate.2
HNK-1 3-O-sulfotransferase activity was measured essentially according the method of Ong et al. (25), but using 2 mM GlcUA
1,3Gal
-O-NM as an acceptor.
-Glucuronidase Digestion--
Radioactive product was dried
and dissolved in 60 µl of solution containing 1.33 µg/µl sodium
taurodeoxycholate, 0.1 M sodium acetate, pH 5.0, and 2.5 units/µl
-glucuronidase from limpets or Helix pomatia
(Sigma), and the mixture was incubated overnight at 37 °C. The
sample was diluted with 1 ml of 0.5 M NaCl and separated on
a Sep-Pak C18 cartridge as described above. The
flow-through fraction, wash, and eluant were collected, and
radioactivity was measured by liquid scintillation spectrometry.
![]()
RESULTS

View larger version (63K):
[in a new window]
Fig. 1.
Nucleotide and deduced amino acid sequences
of the hamster GlcUAT-I cDNA. The putative transmembrane
domain is underlined, and the asterisk indicates
a potential N-glycosylation site. The polyadenylation
consensus sequence and the putative Kozak sequence are
double-underlined.
1,3Gal
1,4Xyl
-O-Ser and its lack of activity with
glycoprotein substrates, Kitagawa et al. concluded that the enzyme was involved in forming the linkage tetrasaccharide present in
glycosaminoglycans, such as heparan sulfate and chondroitin sulfate.
This enzyme is known as GlcUA-transferase I (GlcUAT-I) to distinguish
it from other GlcUA-transferases involved in polymerization of
glycosaminoglycans (13). The high homology of GlcUAT-X (which is
designated GlcUAT-I below) and GlcUAT-P raised the question of whether
these transferases might participate in both HNK-1 synthesis as well as
glycosaminoglycan formation.

View larger version (67K):
[in a new window]
Fig. 2.
Northern analysis of GlcUAT-I in mouse adult
tissues. Each lane contained 2 µg of poly(A)+ RNA.
A shows the results using the 32P-labeled
full-length cDNA probe. B shows hybridization with the
human
-actin probe provided by the manufacturer (CLONTECH).
Kb, kilobase pairs; GlcAT-I, GlcUAT-I.

View larger version (111K):
[in a new window]
Fig. 3.
Comparison of the predicted amino acid
sequences of hamster GlcUAT-I, human GlcUAT-I, and rat
GlcUAT-P. The shaded regions represent identical
amino acids, and the dashed regions represent gaps inserted
to improve the alignment. The GenBankTM accession numbers
for the various clones are as follows: hamster (hm) GlcUAT-I
(GlcAT-I): AF113703; human (hu) GlcUAT-I,
AB009598; and rat GlcUAT-P (GlcAT-P), D88035.

View larger version (102K):
[in a new window]
Fig. 4.
HNK-1 immunofluorescence of transfected Lec2
and COS-7 cells. Lec2 cells were mock-transfected
(A) or transiently transfected with both pcDNA3-GlcUAT-I
and pcDNA3-HNK-1 3OST (B), with pcDNA3-HNK-1 3OST
alone (C), or with pcDNA3-GlcUAT-I alone (D).
COS-7 cells were transfected in the same way (E-H).
Transfected cells were incubated with mouse monoclonal anti-HNK-1
antibody followed by fluorescein isothiocyanate-conjugated goat
anti-mouse IgM antibody.

View larger version (90K):
[in a new window]
Fig. 5.
Western blot analysis of HNK-1-containing
glycoproteins. Cell lines stably expressing GlcUAT-I
(GlcAT-I) or GlcUAT-P (GlcAT-P) and transiently
transfected with pcDNA3-HNK-1 3OST were solubilized, and an aliquot
of cell protein was analyzed by SDS-PAGE. The gel was blotted onto
nitrocellulose, and HNK-1-containing bands were detected with mouse
anti-HNK-1 antibody followed by peroxidase-conjugated goat anti-mouse
IgM antibody (see "Experimental Procedures"). ST,
3-O-sulfotransferase; PNGase F, peptide
N-glycosidase F.
-linked galactose residues. In general, disaccharides were better substrates than monosaccharides, but the individual enzymes showed strong differences in substrate utilization. As expected, GlcUAT-P could transfer GlcUA to asialofetuin and asialomucin containing terminal Gal
residues, whereas GlcUAT-I had no detectable activity toward asialoglycoproteins and negligible activity with
asialoglycosphingolipid substrates with or without added phospholipids
(8). GlcUAT-I had the highest activity with
Gal
1,3Gal
-O-R (where R = naphthalenemethanol or benzyl alcohol), which resembles the linkage region of
glycosaminoglycans. In contrast, GlcUAT-P was highly reactive with
all disaccharides, including Gal
1,4GlcNAc
-O-NM, the
acceptor sequence in glycoproteins, as well as those related to the
linkage region. In addition, GlcUAT-P had high activity with naphthol
-galactosides, but reacted poorly with substrates containing
-linked galactose residue.
Acceptor specificity of protein A-GlcUAt-I and protein A-GlcUAT-P
chimeras
1,4GlcNAc
-O-naphthalenemethanol,
Gal
1,3GalNAc
-O-benzyl, and
Gal
1,3Gal
-O-naphthalenemethanol were 97-98%
sensitive to
-glucuronidase. The data represent single point
determinations. Repetition of the experiments at different times
generally varied by <10%.
1,4GlcNAc
-O-NM,
Gal
1,3GlcNAc
-O-NM, and
Gal
1,3GalNAc
-O-NM were 1.8, 2.9. and 3.2 mM, respectively, whereas the Km for
Gal
1,3Gal
-O-NM was significantly lower (0.67 mM) (Fig. 6B). Furthermore, the apparent
Vmax was much greater for
Gal
1,3Gal
-O-NM (>10-fold) than for the other
substrates, suggesting that GlcUAT-I is much less reactive with
substrates related to glycoproteins and is more reactive with those
involved in glycosaminoglycan assembly. In contrast, GlcUAT-P was much
more promiscuous, reacting with many substrates.

View larger version (25K):
[in a new window]
Fig. 6.
Dependence of GlcUAT-I activity on time and
acceptor concentration. Four synthetic substrates,
Gal
1,3Gal
-O-NM (
),
Gal
1,3GalNAc
-O-NM (
),
Gal
1,3GlcNAc
-O-NM (
), and
Gal
1,4GlcNAc
-O-NM (
), were tested as substrates
with recombinant GlcUAT-I (see "Experimental Procedures"). Data are
single point determinations. A, dependence of enzyme
activity on time; B, dependence of enzyme activity on
acceptor concentration.
1,3Gal-containing disaccharides supported the idea that this
enzyme is involved glycosaminoglycan biosynthesis (18). To test this
hypothesis directly, we transfected a pair of
glycosaminoglycan-deficient mutants of CHO cells defective in
GlcUAT-I.2 Introduction of the cDNA for GlcUAT-I
resulted in restoration of glycosaminoglycan biosynthesis as
measured by the incorporation of 35SO4 (Table
II). Analysis of the radioactive material
by anion-exchange HPLC confirmed that it consisted of a mixture of
heparan sulfate and chondroitin sulfate chains (Fig.
7). Interestingly, transfection by
GlcUAT-P also corrected the deficiency in the mutant (Table II). The
relative level of the transfected GlcUA-transferases varied from 0.3 to
70 times of the endogenous value for GlcUAT-I in the wild-type, but
glycosaminoglycan synthesis was restored under all conditions. These
results suggested that both enzymes could facilitate formation of
glycosaminoglycan chains.
GlcUAT-I and GlcUAT-P restore glycosaminoglycan synthesis in pgsG
mutants
1,3Gal
-O-NM as substrate (see
"Experimental Procedures").

View larger version (18K):
[in a new window]
Fig. 7.
Anion-exchange HPLC of
glycosaminoglycans. CHO mutant cells were transiently
transfected with GlcUAT-I and labeled with
35SO4. The radioactive glycosaminoglycans were
isolated and analyzed by anion-exchange HPLC (see "Experimental
Procedures").
, wild type;
, mock-transfected CHO mutant;
,
GlcUAT-I-transfected CHO mutant.
![]()
DISCUSSION
1,3Gal, which resembles the
linkage tetrasaccharide found in heparan sulfate and chondroitin sulfate (Table I). As these studies were under way, Kitagawa et
al. (18) reported a cDNA encoding an enzyme thought to be GlcUAT-I, which is involved in glycosaminoglycan biosynthesis. Hamster
GlcUAT-I shows 95% identity to human GlcUAT-I (Fig. 3), suggesting
that it most likely represents the same gene, but from a different
species. Correction of a mutant defective in GlcUAT-I by transfection
with hamster GlcUAT-I supported this idea (Fig. 7 and Table II).
Interestingly, GlcUAT-P also corrected the mutant, suggesting that it
might work equally well in forming HNK-1 determinants as well as the
linkage region of glycosaminoglycans.
1,3Gal), but also to
related compounds terminating in galactose, such as lactose
(Gal
1,4Glc) and Gal
1,4GlcNAc, the precursor of HNK-1. HNK-1 had
not yet been described when these studies were done (1), and therefore,
it was not appreciated that the apparent reactivity with
Gal
1,4GlcNAc was most likely due to another GlcUA-transferase in the
crude tissue extracts (GlcUAT-P). Several years ago, Curenton et
al. (17) studied whether the glucuronosyltransferases for making
HNK-1 epitopes and the glycosaminoglycan linkage region were the same
enzyme using embryonic chick brain as an enzyme source. They found that
the activity related to glycosaminoglycan assembly was firmly
membrane-associated, whereas the activity related to HNK-1 formation
was readily solubilized, suggesting that they were separate entities.
Furthermore, no activity toward Gal
1,4GlcNAc acceptors was detected
in embryonic chick cartilage extract, which is a rich source of
GlcUAT-I, but not GlcUAT-P. Based on these results, they concluded that
two different enzymes catalyze the formation of linkage region
fragments and HNK-1 determinants. More recent molecular cloning
experiments support the idea that multiple enzymes exist, but the data
presented here using recombinant forms of the enzymes suggest that they
may be more promiscuous with respect to substrate utilization than
previously appreciated.
1,4-galactosyltransferase (lactose synthase), which has been
immunocytochemically located in the medial- and trans-aspects of the Golgi (31). Thus, it is more likely
that the poor reactivity of GlcUAT-I with precursors of HNK-1 explains why the endogenous enzyme does not give rise to HNK-1 determinants under normal conditions.
| |
ACKNOWLEDGEMENTS |
|---|
We thank H. Freeze (Burnham Institute, La Jolla, CA) for many helpful conversations, M. Fukuda for providing several reagents, and K. Sugahara for sharing data while our experiments were under way.
| |
FOOTNOTES |
|---|
* This work was supported by Grants GM33063 and CA46462 from the National Institutes of Health (to J. D. E.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF113703.
On leave from the Department of Biochemistry and Molecular
Genetics, University of Alabama at Birmingham, Birmingham, AL 35294.
§ Present address: North American Vaccine, Inc., 10150 Old Columbia Rd., Columbia, MD 21044.
¶ To whom correspondence should be addressed: Div. of Cellular and Molecular Medicine, University of California at San Diego, 9500 Gilman Dr., CMM-East 1055, La Jolla, CA 92093-0687. Tel.: 619-822-1100; Fax: 619-534-5611; E-mail: jesko{at}ucsd.edu.
2 These mutants lack endogenous GlcUA-transferase I activity (X. Bai, G. Wei, A. Sinha, and J. D. Esko, submitted for publication).
3 G. Wei, X. Bai, and J. D. Esko, unpublished results.
4 A. K. Sarkar and J. D. Esko, manuscript in preparation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
GlcUAT-P, UDP-GlcUA:glycoprotein
1,3-glucuronosyltransferase;
GlcUAT-L, UDP-GlcUA:glycolipid
1,3-glucuronosyltransferase;
GlcUAT-I, UDP-GlcUA:Gal
1,3Gal-R glucuronosyltransferase;
CHO, Chinese hamster
ovary;
PCR, polymerase chain reaction;
PIPES, 1,4-piperazinediethanesulfonic acid;
PBS, phosphate-buffered saline;
NM, naphthalenemethanol;
HPLC, high pressure liquid
chromatography.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Fondeur-Gelinotte, V. Lattard, S. Gulberti, R. Oriol, G. Mulliert, M. W. Coughtrie, J. Magdalou, P. Netter, M. Ouzzine, and S. Fournel-Gigleux Molecular basis for acceptor substrate specificity of the human {beta}1,3-glucuronosyltransferases GlcAT-I and GlcAT-P involved in glycosaminoglycan and HNK-1 carbohydrate epitope biosynthesis, respectively Glycobiology, August 1, 2007; 17(8): 857 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Elson-Schwab, O. B. Garner, M. Schuksz, B. E. Crawford, J. D. Esko, and Y. Tor Guanidinylated Neomycin Delivers Large, Bioactive Cargo into Cells through a Heparan Sulfate-dependent Pathway J. Biol. Chem., May 4, 2007; 282(18): 13585 - 13591. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wei, X. Bai, and J. D. Esko Temperature-sensitive Glycosaminoglycan Biosynthesis in a Chinese Hamster Ovary Cell Mutant Containing a Point Mutation in Glucuronyltransferase I J. Biol. Chem., February 13, 2004; 279(7): 5693 - 5698. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yada, T. Sato, H. Kaseyama, M. Gotoh, H. Iwasaki, N. Kikuchi, Y.-D. Kwon, A. Togayachi, T. Kudo, H. Watanabe, et al. Chondroitin Sulfate Synthase-3: MOLECULAR CLONING AND CHARACTERIZATION J. Biol. Chem., October 10, 2003; 278(41): 39711 - 39725. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yada, M. Gotoh, T. Sato, M. Shionyu, M. Go, H. Kaseyama, H. Iwasaki, N. Kikuchi, Y.-D. Kwon, A. Togayachi, et al. Chondroitin Sulfate Synthase-2: MOLECULAR CLONING AND CHARACTERIZATION OF A NOVEL HUMAN GLYCOSYLTRANSFERASE HOMOLOGOUS TO CHONDROITIN SULFATE GLUCURONYLTRANSFERASE, WHICH HAS DUAL ENZYMATIC ACTIVITIES J. Biol. Chem., August 8, 2003; 278(32): 30235 - 30247. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-T. Kim, K. Tsuchida, J. Lincecum, H. Kitagawa, M. Bernfield, and K. Sugahara Identification and Characterization of Three Drosophila melanogaster Glucuronyltransferases Responsible for the Synthesis of the Conserved Glycosaminoglycan-Protein Linkage Region of Proteoglycans. TWO NOVEL HOMOLOGS EXHIBIT BROAD SPECIFICITY TOWARD OLIGOSACCHARIDES FROM PROTEOGLYCANS, GLYCOPROTEINS, AND GLYCOSPHINGOLIPIDS J. Biol. Chem., March 7, 2003; 278(11): 9116 - 9124. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, N. Haines, J. Chen, T. Okajima, K. Furukawa, T. Urano, P. Stanley, K. D. Irvine, and K. Furukawa Identification of a Drosophila Gene Encoding Xylosylprotein beta 4-Galactosyltransferase That Is Essential for the Synthesis of Glycosaminoglycans and for Morphogenesis J. Biol. Chem., November 22, 2002; 277(48): 46280 - 46288. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bai, D. Zhou, J. R. Brown, B. E. Crawford, T. Hennet, and J. D. Esko Biosynthesis of the Linkage Region of Glycosaminoglycans. CLONING AND ACTIVITY OF GALACTOSYLTRANSFERASE II, THE SIXTH MEMBER OF THE beta 1,3-GALACTOSYLTRANSFERASE FAMILY (beta 3GalT6) J. Biol. Chem., December 14, 2001; 276(51): 48189 - 48195. [Abstract] [Full Text] [PDF] |
||||