|
J Biol Chem, Vol. 274, Issue 12, 8002-8011, March 19, 1999
Lack of Enhancer Function in Mammals Is Unique to Oocytes and
Fertilized Eggs*
Patrick
Lawinger ,
Luca
Rastelli ,
Zhaoyang
Zhao , and
Sadhan
Majumder§
From the University of Texas M. D. Anderson Cancer Center,
Houston, Texas 77030
 |
ABSTRACT |
Previous studies have shown that the lack of
novel coactivator activity in mouse oocytes and one-cell embryos
(fertilized eggs) renders them incapable of utilizing
Gal4:VP16-dependent enhancers (distal elements) but not
promoters (proximal elements) in regulating transcription. This
coactivator activity first appears in two- to four-cell embryos
coincident with the major activation of zygotic gene expression. Here
we show that whereas oocytes and fertilized eggs could utilize
Sp1-dependent promoters, they could not utilize
Sp1-dependent enhancers, although they showed promoter
repression, which is a requirement for delineating enhancer function.
In contrast, both Sp1-dependent promoters and enhancers were functional in two- to four-cell embryos. Furthermore, the same
embryonic stem cell mRNA that provided the coactivator activity for
Gal4:VP16-dependent enhancer function also provided
Sp1-dependent enhancer function in oocytes. Therefore, the
coactivator activity appears to be a requirement for general enhancer
function. To determine whether the absence of enhancer function is a
unique property of oocytes or a general property of other terminally differentiated cells, transcription was examined in terminally differentiated hNT neurons and their precursors, undifferentiated NT2
stem cells. The results showed that both cell types could utilize
enhancers and promoters. Thus, in mammals, the lack of enhancer
function appears to be unique to oocytes and fertilized eggs,
suggesting that it provides a safeguard against premature activation of
genes prior to zygotic gene expression during development.
 |
INTRODUCTION |
Transcription factors can activate RNA polymerase II transcription
mainly in the capacity of a promoter or enhancer. The promoter determines the site of transcriptional initiation, which is carried out
when transcription factors bind to the DNA sequence close to and
upstream from the start site. The enhancer stimulates weak promoters in
a tissue-specific manner, which is carried out when transcription
factors bind to their specific sequences distal to and either upstream
or downstream from the start site.
Fertilization of a mammalian egg by a sperm triggers a complex
developmental program involving cell division, growth, and differentiation that ultimately leads to the formation of the animal.
This process requires expression of genes in a tissue- and
time-specific manner. One of the important mechanisms by which multicellular organisms achieve such a goal is to regulate
transcription with enhancers. It is believed that enhancers stimulate
weak promoters by relieving chromatin-mediated repression of promoters
(1-7), a process that may involve histone acetylation (4, 5, 7-10). Enhancers can also function in stimulating DNA replication (11-13). However, it is not clear how transcriptional enhancers regulate the
development of a one cell embryo (fertilized egg) into an animal. This
is primarily due to the lack of availability of sufficient number of
embryos to carry out biochemical studies. Only recently techniques have
been developed that allow the study of transcription and replication in
mammalian oocytes, embryos as early as a fertilized egg, and even a
single embryo using microinjection techniques (14-18). Such techniques
have shown that DNA replication and transcription from the injected DNA
are carried out in mammalian system only when appropriate eukaryotic
regulatory sequences and competent cell types are present. For example,
expression of genes from microinjected plasmids in mammalian oocytes
and embryos requires the presence of valid promoter elements. Likewise,
expression of genes from plasmids injected into morphologically
arrested fertilized eggs begins only 40 h after fertilization,
when the expression of genes from the embryonic genome also begins (see below). This suggests that gene expression from injected plasmids is
under the same control as that from the embryonic genome. Furthermore, the injected embryos can be transplanted into the womb of a
pseudopregnant female mouse, where they develop into mice (19).
Therefore, results obtained with the microinjection system are not an
artifact of the experimental protocol and provide an opportunity to
study transcriptional regulation, including enhancer function, in the context of a living animal.
In sexually mature female mice, oocytes undergo the first meiotic
reductive division to become mature unfertilized eggs. These eggs when
fertilized by sperm go through the second meiotic division to produce a
fertilized egg containing both a paternal and maternal haploid
pronucleus. Each pronucleus undergoes DNA replication; they then fuse
together during the first mitosis to generate a two-cell embryo
containing one zygotic diploid nucleus per cell. The major
transcription of zygotic genes begins about 40 h after fertilization, which corresponds to the two-cell stage of normal development. However, in morphologically arrested fertilized eggs, the
major gene expression begins at the same time. Thus, this function
appears to be regulated by a time-dependent biological clock (zygotic clock) (14, 16, 20, 21). In all of these embryos,
minor transcription of genes occurs during the late one-cell stage
(22-30). Prior to that stage, survival of the embryos is continuously
regulated by the translation of maternally inherited mRNA present
in mature and fertilized eggs (31-33). The process of translation
itself is regulated mostly through post-transcriptional modification
(34-38).
By using the microinjection system, it has been found that although
transcription can be regulated from the proximal promoter site in
oocytes, fertilized eggs, and two-cell embryos, it cannot be regulated
from the distal enhancer sites prior to the formation of a two-cell
embryo (15, 16, 21, 28, 39, 40). Previously, we observed that the
exogenous transcription factor Gal4:VP16 can stimulate transcription
from the proximal promoter site but not from the distal enhancer site
in terminally differentiated mouse oocytes or maternal and paternal
pronuclei of fertilized eggs. In contrast, Gal4:VP16 was found to
stimulate transcription from both promoter and enhancer sites in
undifferentiated two- to four-cell mouse embryos (15, 41). A lack of
enhancer activity in the paternal pronuclei of fertilized eggs was
found to be caused by the absence of chromatin-mediated promoter
repression, a prerequisite for delineating enhancer function (25-27,
41-46). On the other hand, the lack of enhancer activity in oocytes
and the maternal pronuclei of fertilized eggs was found to be caused
not by the absence of chromatin repression or functional enhancer
activation protein (Gal4:VP16) but rather by the absence of
enhancer-specific coactivator activity. This coactivator activity first
appears in two-cell mouse embryos during development
concurrent with the major onset of zygotic gene expression
(ZGE)1 (15). Furthermore, the
coactivator activity missing in oocytes could be provided to oocytes by
microinjection of mRNA obtained from undifferentiated embryonic
stem (ES) cells. This mRNA had no effect in two- to four-cell
embryos presumably because of its presence in these cells at saturating
levels (15).
To determine whether the lack of the enhancer-specific coactivator
activity in oocytes and the maternal pronuclei of fertilized eggs was
responsible for the inability of these cells to use enhancers driven by
transcription factors other than those containing the acidic activation
domains, like Gal4:VP16, here we examined Sp1-dependent promoter and enhancer function in these cell types and control two- to
four-cell embryos. Sp1 is a transcription factor that contains a
glutamine-rich activation domain. We found that, just like with
Gal4:VP16, oocytes and the maternal pronuclei of fertilized eggs can
use Sp1-dependent promoters but not
Sp1-dependent enhancers. In contrast,
Sp1-dependent promoters and enhancers were both active in
two- to four-cell embryos. Furthermore, the same ES cell mRNA that
provided the missing coactivator activity for
Gal4:VP16-dependent enhancer function also provided
Sp1-dependent enhancer function in oocytes. Thus,
enhancer-specific coactivator activity, which is absent prior to the
formation of a two-cell embryo, is a requirement for general enhancer
function. In addition, to determine whether the absence of the enhancer
function is a general property of terminally differentiated cells or is
only limited to oocytes, we examined both Gal4:VP16- and
Sp1-dependent promoter and enhancer activity in terminally
differentiated hNT neurons and their precursors, NT2 neuronal stem
cells. NT2 cells can be differentiated into mature hNT neurons in the
presence of retinoic acid under well established cell culture
conditions; both hNT neurons and NT2 cells have been extensively
characterized (47, 48). We found that both hNT neurons and NT2 cells
used Gal4:VP16- and Sp1-dependent promoters and enhancers.
Thus, in mammals, the absence of the enhancer-specific coactivator, and
therefore the inability to use enhancers, appears to be unique to
oocytes and fertilized eggs prior to ZGE.
 |
EXPERIMENTAL PROCEDURES |
Mouse Oocytes and Embryos--
Isolation, culture and injection
of CD-1 mouse oocytes and embryos were carried out as described
previously (15, 17, 49). Growing oocytes were obtained from 13- to
14-day-old females and were cultured in the presence of 100 µg/ml
dibutyryl cAMP to prevent meiotic maturation. Growing oocytes obtained
from 2- to 3-week-old prepubertal mice are more transcriptionally
active than mature oocytes obtained from older mice (50). Fertilized
eggs were isolated from 8- to 10-week-old pregnant females 17 h
after human chorionic gonadotrophin hormone (hCG) is injected and
cultured in the presence of 4 µg/ml aphidicolin (Boehringer Mannheim)
to arrest their development at the beginning of S-phase. Since the first S-phase had not yet begun at the time of isolation of fertilized eggs, aphidicolin causes them to retain their two pronuclei, male and
female, throughout the experiment. Two-cell embryos were isolated 40-42 h post-hCG injection, at which time they had completed S-phase. Since two-cell embryos are isolated after they had undergone DNA replication, aphidicolin would cause them usually to cleave into four
cells and then get arrested at the beginning of S-phase. In the absence
of aphidicolin, most injected two-cell embryos develop into morula by
44 h. For butyrate treatment, oocytes and embryos were cultured in
the presence of 2.5 mM sodium butyrate (51).
Plasmids--
Various plasmid DNA containing the firefly
luciferase gene (pluc) linked to the basal promoter (TATA box, pTluc),
Sp1-dependent promoter (pS6Tluc), or the herpes
simplex virus thymidine kinase promoter (ptkluc), coupled to the
Gal4-dependent enhancer (pG9(E)tkluc) placed
600 bp upstream of the promoter were previously described (15, 41). The
expression vector for GAL4:VP16 (pSGVP) has been described previously
(52), and the Gal4-dependent promoter expressing CAT
reporter gene (pG5TCAT) has been described (15). pS6(E)Tluc and pS6(E)tkluc were created by
inserting the HpaI/SmaI promoter fragment from
p1873 (53) containing six Sp1 sites into the HindIII sites
of pTluc and ptkluc, after ligating a HindIII linker to the
fragment. This places the Sp1 sites 600 bp upstream of either the basal
or the tk promoter, respectively. All constructs were sequenced to
identify the plasmids with the right orientation.
Plasmid DNA is prepared in 10 mM Tris-HCl (pH 7.6) and 0.25 mM EDTA (15) to the desired concentration, and ~2 pl is
injected into oocytes about 2 h after collection and into either
two-cell embryos between 44 and 48 h post-hCG. Oocytes and embryos
that survived injection were assayed for reporter gene activity as described below.
Firefly Luciferase Assay--
Firefly luciferase activity was
assayed in individual embryos as described previously (15, 49). For
each data point the mean value of 40-150 oocytes or embryos are used,
and the variation among individual embryos is expressed as ± S.E.
of the mean. Although the range of luciferase activities among
individual embryos could vary as much as 1000-fold (15), the mean
values obtained from several independent experiments are reproducible
to within 13-25%. Moreover, the relative activity between different
types of embryos and different promoters are always reproducible, even
when DNA injection is performed by different people.
Chloramphenicol Acetyltransferase (CAT) Assay--
About 50 injected embryos were incubated for 44 h, harvested in 250 mM Tris (pH 8.0) at a concentration of 0.5 embryo per µl,
lysed by freezing and thawing three times using dry ice/ethanol and
37 °C baths, and centrifuged at 16,000 × g for 5 min at 4 °C, and the supernatant was assayed for CAT activity as
described by Sambrook et al. (54). The fraction of
[14C]acetylchloramphenicol was measured by using a
Betascope 603 (Betagen) to collect at least 100,000 emissions. These
numbers were then normalized to the average total
[14C]chloramphenicol present in lane of the chromatograph
and expressed as cph/embryo.
NT2 and hNT Cells and Their Characterization--
NTera 2 (NT2)
cells are derived from a human teratocarcinoma and show characteristics
of neuronal stem cells. These cells can differentiate in the presence
of retinoic acid into terminally differentiated mature neurons (hNT
cells) under cell culture conditions (47, 48). NT2 cells were purchased
from Stratagene (catalog number 204101) and cultured on Falcon
plasticware in medium (Dulbecco's modified Eagle's medium/F12 1:1
(Life Technologies, Inc., catalog number 11330-02) with 10% serum
(HyClone catalog number A-6166-1), containing an additional 2 mM glutamine (Life Technologies, Inc., catalog number
25030-032), as well as penicillin and streptomycin (Life Technologies,
Inc., catalog number 15140-122)). Cells were fed every 2 days with
fresh media and were trypsinized for splitting when confluent. hNT
neurons were either purchased from Stratagene (catalog number 204104)
or differentiated from the NT2 precursor cells with retinoic acid
treatment followed by growth in media containing mitotic inhibitors as
described (48).
To characterize these cells morphologically, they were examined by
phase contrast microscopy. Biochemical characterization was done by
RT-PCR and by Western blot assays to determine the pattern of expressed
genes. Total mRNA was prepared from 5 × 106 NT2
cells and 3 × 105 hNT cells using the RNA isolation
kit from Stratagene. First strand cDNA was prepared with the
Superscript preamplification kit from Life Technologies, Inc.
Expression of neural genes was examined by RT-PCR as follows: 5 min at
95 °C followed by 40 cycles of 45 s 95 °C, 45 s
60 °C, and 45 s 72 °C, followed by 7 min at 72 °C. The
primers were CCAGCTGCTACTGGATC and AGCCAGAAGGCTCAGCA for Nestin,
AACCTGCAGAACCGCAAG and GCTTGATGAGCAGGTCTATGC for glutamate receptor,
and ACGGATTTGGTCGTATTGGG and TGATTTTGGAGGGATCTCGC for glyceraldehyde-3-phosphate dehydrogenase. For Western blot analysis, total protein extracts were prepared, electrophoresed, and blotted as
described (55), and the signal was revealed using the ECL kit from
Amersham Pharmacia Biotech. The antibodies used were mouse
anti-vimentin (Zymed Laboratories Inc.), rabbit
anti-synapsin (Chemicon International), and mouse anti-actin (Amersham
Pharmacia Biotech).
Transfection and Assays of Promoter and Enhancer Activity in NT2
and hNT Cells--
Transfection of both NT2 and hNT cells was
accomplished using the Stratagene MBS transfection kit (catalog number
200388) that employs the calcium phosphate precipitation method. Other methods of transfection, like electroporation and lipofection, were
found to be less effective. Transfection efficiency was determined by
transfection of the plasmid, pEGFPC-1 (CLONTECH),
encoding the green fluorescent protein (GFP) reporter gene. DNA
mixtures were created by the manufacturer's instructions with a
maximum limit of 10 µg of DNA per ml of suspension mix. Cells were
covered with Opti-MEM I (Life Technologies, Inc., catalog number
31985-070) with 6% MBS. One milliliter of DNA suspension was added per
100-mm plate by slowly adding drops in a circular motion. Plates were swirled once and then allowed to stand at 37 °C for 2-3 h in 5% carbon dioxide. Following incubation, the cells were washed 4-5 times
with phosphate-buffered saline and fed with fresh media. For the assay
of GFP expression, cells were observed under the microscope using UV
light (360-400 nm) as well as visible light and were photographed. For
the assay of promoter/enhancer activity, cells were harvested 48 h
after the removal of the DNA suspension and assayed for reporter gene
activity (luciferase, CAT, or -galactosidase).
Luciferase assays were done on 50 µl of cell extract prepared in CEB
(0.1 M sodium phosphate (pH 7.8), 1 mM
dithiothreitol, and 0.1% Triton X-100) under the same conditions used
for extracts of mouse oocytes and embryos as described above. Cell
extracts were assayed for -galactosidase activity using a
Galacto-Light kit from Tropix, Inc., following the manufacturer's
instructions. Both assays produce a signal that is read with a
Monolight 2010 machine from Analytical Luminescence Laboratory.
Chloramphenicol acetyltransferase (CAT) assays also were done on 50 µl of cell extract prepared in 100 mM Tris (pH 7.6).
These extracts were incubated with 4 mM acetyl coenzyme A,
0.05 µCi of [14C]chloramphenicol (Amersham Pharmacia
Biotech), 0.5 M Tris-HCl (pH 8.0) at 37 °C for 1 h,
and then extracted with 900 µl of ethyl acetate and lyophilized. The
pellet was dissolved in 25 µl of ethyl acetate, chromatographed on
silica gel, and analyzed by autoradiography (54).
Embryonic Stem Cells--
Embryonic stem (ES) cells were
generated from mouse blastocysts as described (56). ES cells were grown
on lysed primary mouse embryonic fibroblast cells as feeder layer in
Dulbecco's modified Eagle's medium (Specialty Media) plus 15%
heat-inactivated fetal bovine serum and in the presence of 1000 units/ml ESGRO murine leukemia inhibitory factor (Life Technologies,
Inc.) to prevent them from differentiating. mRNA from ES cells for
initial experiments were carried out using a commercially
available RNA isolation kit (Stratagene).
 |
RESULTS |
Sp1 Can Activate a Promoter but Not an Enhancer Prior to Formation
of a Mouse Two-cell Embryo--
To determine the relative activity of
Sp1-dependent promoters and Sp1-dependent
enhancers at the beginning of mouse development, plasmids containing a
reporter gene linked to the appropriate regulatory sequences (Fig.
1) were injected into mouse oocytes, fertilized eggs, and two-cell embryos. The activity of each regulatory sequence was quantified by measuring the amount of luciferase activity
produced several hours after injection.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Plasmid constructs containing promoter and
enhancer elements driving a reporter gene used in the experiments
described in this paper.
|
|
The Sp1-dependent promoter consisted of a tandem series of
six Sp1 DNA-binding sites placed 10 base pairs upstream from the adenovirus late gene promoter (a strong TATA box) driving a firefly luciferase (luc) reporter gene (pS6Tluc) (41). The
Sp1-dependent enhancer consisted of six Sp1 DNA-binding
sites placed 600 bp upstream from either the adenovirus late gene
promoter TATA box (pS6(E)Tluc) or the herpes simplex virus
thymidine kinase (tk) promoter (Sp1-CAAT-Sp1-TATA) driving a firefly
luciferase reporter gene (pS6(E)tkluc). The tk promoter
responds to stimulation by various enhancers and transactivators (41,
57-59) and thus serves as a model promoter for assessing enhancer
stimulation. The level of luciferase produced in the absence of a
promoter was determined by injecting pluc, a plasmid containing only
the firefly luciferase gene. The level of luciferase produced by a
basal promoter (TATA box) was determined by injecting pTluc.
Transcriptionally active mouse oocytes were isolated and cultured in
the presence of dibutyryl cAMP to prevent meiotic maturation. Mouse
fertilized eggs and two-cell embryos were isolated and cultured in the
presence of aphidicolin to arrest the development of fertilized eggs as
they entered S-phase and two-cell embryos at S-phase of the four-cell
stage (15). Plasmid DNA was injected into the germinal vesicle of
oocytes, the maternal pronucleus of fertilized eggs, and one of the two
zygotic nuclei of two-cell embryos. The amount of luciferase activity
was quantified when each cell type had produced the maximum activity as
described previously (15). The amount of luciferase activity observed
was dependent on the amount of DNA injected, although the promoter
activity in general was found to be severalfold lower in oocytes and
maternal pronuclei than in two-cell embryos (15). The optimal
concentration of injected plasmid DNA solution was found to be 600 µg/ml for oocytes, 150 µg/ml for fertilized eggs, and 300 µg/ml
for two-cell embryos.
Although Sp1-dependent promoters were fully active in both
oocytes and S-phase-arrested fertilized eggs, the
Sp1-dependent enhancers were not active under the same
conditions (Fig. 2). The level of basal
promoter pTluc activity in oocytes was about 7-fold greater than the
background pluc. The Sp1 promoter, pS6Tluc, stimulated this
basal level activity 22-fold, and the tk promoter stimulated it
31-fold. Site-specific mutations have demonstrated that the tk promoter
depends on Sp1 transcription factor activity in mouse oocytes and
cleavage-stage embryos (59). These results confirmed previous studies
showing that oocytes contained Sp1 transcription factor activity (41,
60). However, in the present study, the Sp1-dependent
enhancer stimulated the basal promoter contained in
pS6(E)Tluc only 1.7-fold, and had no effect on the tk
promoter present in pS6(E)tkluc.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 2.
Sp1 DNA-binding sites can function as
promoters in oocytes, the maternal pronuclei of fertilized eggs, and
the zygotic nuclei of two-cell embryos, but they cannot function as
enhancers until formation of a two-cell embryo. CD-1 mouse oocytes
were cultured in dibutyryl cAMP to prevent meiotic maturation, and
two-cell embryos were cultured in aphidicolin to arrest development at
the beginning of S-phase in 4-cell embryos. Plasmid DNA (~2 pl) was
injected into the germinal vesicles of oocytes or one of the two
zygotic nuclei of two-cell embryos using DNA solutions containing 550, 150, and 300 µg/ml plasmid DNA, respectively. The promoter plasmids
carried the firefly luciferase gene (luc) under the control of the
basal TATA box promoter (pTluc), Sp1 promoter containing six Sp1 sites
placed 30 bp upstream of the TATA box (pS6Tluc), or the
HSV-tk promoter (ptkluc). The Sp1 enhancer plasmids carried, in
addition to the promoter, six Sp1 sites placed 600 bp upstream of the
basal promoter (pS6(E)Tluc) or the tk promoter
(pS6(E)tkluc). A promoterless control (pluc) was also
tested. After injection, oocytes were cultured for 20 h, and
embryos were cultured for 42 h before the extracts were prepared,
and luciferase activity was measured quantitatively in individual
embryos or oocytes and expressed as light units (37). Each data point
indicates the mean value ± S.E. for 40-60 successfully injected
oocytes or embryos.
|
|
Similar results were obtained with fertilized eggs. In these cell
types, pTluc was 13-fold more active than pluc. pS6Tluc stimulated this basal level activity 19-fold, and ptkluc stimulated it
by 33-fold. Nevertheless, the Sp1-dependent enhancer failed to stimulate either the basal promoter, pS6(E)Tluc, or the tk promoter,
pS6(E)tkluc, in fertilized eggs. Thus, even in the presence of functional endogenous Sp1, as measured by Sp1-dependent
promoter activity, oocytes and fertilized eggs cannot utilize
Sp1-dependent enhancers (Fig. 2).
In contrast, two- to four-cell embryos utilized both
Sp1-dependent promoters and Sp1-dependent
enhancers. In these embryos, the tk promoter was 40-fold more active
than the basal level promoter (Fig. 2), indicating the presence of
functional Sp1. As expected (41), the weaker basal promoter, as in
pS6(E)Tluc, was stimulated more strongly (51-fold) by the
Sp1-dependent enhancer than the stronger tk promoter, as in
pS6(E)tkluc (16.5-fold). These results are similar to
previous findings with Gal4:VP16-dependent promoters and
enhancers in the presence of exogenously expressed Gal4:VP16 protein
(15). Therefore, the inability of oocytes and fertilized eggs to use
enhancers was not because of the lack of functional enhancer-specific
transcription factors and whether the transcription factor was
naturally present in these cells or was provided artificially by an
expression vector.
Promoter Repression by Oocytes, Maternal Pronuclei of Fertilized
Eggs, and Two- to Four-cell Embryos--
To determine if the lack of
enhancer stimulation of promoters in oocytes and the maternal pronuclei
of fertilized eggs was caused by the absence of chromatin-mediated
promoter repression, which is necessary to delineate enhancer function,
we treated these cell types with sodium butyrate. Sodium butyrate
inhibits histone deacetylase, which increases the degree of acetylation of core histones. This in turn stimulates both cellular- and
plasmid-encoded mammalian genes by destabilization of chromatin
repression (61, 62). Sodium butyrate treatment has also been found to
destabilize chromatin repression and to cause stimulation of promoter
activity in oocytes and cleavage-stage mouse embryos (15, 26, 41, 42).
In the present study, we extended those findings to the Sp1 enhancer
construct, pS6(E)tkluc, and its corresponding promoter, ptkluc (Fig. 3). Sodium butyrate
stimulated the tk promoter 11.7-fold in oocytes, 7-fold in maternal
pronuclei of fertilized eggs, and 18.5-fold in two- to four-cell
embryos. This also indicated the approximate degree of promoter
repression in these cell types that, under our experimental conditions,
can be potentially relieved, and therefore stimulated, by enhancers
(41, 42). Previously we found that once a promoter is stimulated by an
enhancer, it cannot be further stimulated by sodium butyrate;
stimulation by sodium butyrate is specific for promoters unstimulated
by enhancers (12, 31, 32). Accordingly, pS6(E)tkluc, which
is already stimulated by the Sp1-dependent enhancers in
two- to four-cell embryos, could not be further stimulated by sodium
butyrate (0.91-fold). In contrast, because the
Sp1-dependent enhancer was inactive in oocytes and
fertilized eggs, the pS6(E)tkluc construct could be stimulated by sodium butyrate 12.5-fold in oocytes and 6.3-fold in
fertilized eggs. Taken together, these experiments showed that, even in
the presence of promoter repression and functional endogenous Sp1,
oocytes and the maternal pronuclei of fertilized eggs can support only
Sp1-dependent promoter activity and not
Sp1-dependent enhancer activity. In contrast, two- to
four-cell embryos can support both Sp1-dependent promoter
and enhancer activity.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
Butyrate can stimulate promoters in oocytes,
the maternal pronuclei of fertilized eggs and the zygotic nuclei of
two-cell embryos, whereas Sp1-dependent enhancers can
stimulate promoters only in two-cell embryos. The injection and
assay of promoter and enhancer activities were carried out as described
in Fig. 2, except that some of the oocytes and embryos were cultured in
the presence of 2.5 mM sodium butyrate. The tk promoter can
be stimulated by butyrate (+/ butyrate) 11.7-fold in oocytes, 7-fold
in fertilized eggs, and 18.5-fold in two-cell embryos. However, the tk
promoter cannot be stimulated by Sp1 enhancer (pS6(E)tk/tk) in oocytes
and fertilized eggs but can be stimulated 19-fold in two-cell embryos.
The unstimulated tk promoter present in the enhancer construct pS6(E)tk
can be stimulated 12.5-fold in oocytes and 6.3-fold in fertilized eggs.
Since the Sp1-enhancer already stimulates the tk promoter in two-cell
embryos, butyrate cannot stimulate it any further. The
horizontal line across the figure in the
bottom panel denotes the stimulation of 1-fold.
|
|
Sp1-dependent Enhancer Function Can Be Provided to
Oocytes by ES Cell mRNA--
Previously, we found that injection
of mRNA obtained from ES cells that used enhancer function
efficiently (63) could restore Gal4:VP16-dependent enhancer
activity in oocytes. However, the ES cell mRNA could stimulate the
enhancer function only partially. The suboptimal nature of enhancer
stimulation in oocytes was also demonstrated when the mRNA level
was decreased to half of its concentration by adding tRNA, which also
decreased the enhancer stimulation by half. The enhancer activity could
not be restored to the maximum level because a higher concentration of
injected mRNA was toxic to oocytes. Thus, these experiments
indicated that ES cell mRNA contained one or more factors required
for Gal4:VP16-dependent enhancers (15).
To determine if the same ES cell mRNA could cause
Sp1-dependent enhancers to function, about 0.5 pg of
mRNA in a volume of about 2 pl was injected into the cytoplasm of
oocytes, which were then kept for an hour in the 37 °C incubator to
recover. The surviving oocytes were injected with either the promoter
plasmid ptkluc or the enhancer plasmid pS6(E)tkluc. Similar
experiments were also carried out with two- to four-cell embryos. As
shown in Fig. 4, ES cell mRNA had no
effect on tk promoter activity in oocytes. In contrast, it did cause
about 4-fold stimulation of the tk promoter by the
Sp1-dependent enhancer. The degree of stimulation was
similar to that observed for Gal4:VP16-dependent enhancer
(15). ES cell mRNA also had no effect on the tk promoter alone or
the tk promoter plus the the Sp1-dependent enhancer in two-
to four-cell embryos, indicating that these embryos already contained
promoter- and enhancer-specific factors at a saturating level. Taken
together, these experiments indicated that ES cell mRNA contained a
coactivator activity that is specifically required for both Gal4:VP16-
and Sp1-dependent enhancer function. This activity was not
present in oocytes and was present in two- to four-cell embryos.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4.
Enhancers can be activated in mouse oocytes
by preinjection of ES cell mRNA. Oocytes or two-cell embryos
were injected with either ptkluc or pS6(E)tkluc as
described in Fig. 2. In some experiments, about 2 pl of 500 µg/ml ES
cell mRNA was preinjected into the cytoplasm of oocytes or two-cell
embryos (both blastomeres) 1 h before either of the plasmid DNAs
was injected into one of the nuclei of these cells. Stimulation by
Sp1-dependent enhancer in oocytes was marginal when
mRNA and luciferase expression vectors were coinjected into the
nuclei. ES cells were generated from mouse blastocysts and propagated
on lysed primary mouse embryonic fibroblast cells as feeder layer in
Dulbecco's modified Eagle's medium (Specialty Media) plus 15%
heat-inactivated fetal bovine serum and in the presence of 1000 units/ml ESGRO murine leukemia inhibitory factor (Life Technologies,
Inc.) to prevent them from differentiating (44). mRNA from ES cells
was isolated using an RNA isolation kit from Stratagene.
|
|
Use of Gal4:VP16- and Sp1-dependent Promoters and
Enhancers by NT2 Stem Cells and hNT Neurons--
To determine if the
lack of enhancer function in terminally differentiated oocytes caused
by the absence of enhancer-specific coactivator activity was restricted
to oocytes or was a general property of terminally differentiated cell
types, we examined the promoter and enhancer function in
undifferentiated NT2 neuronal stem cells and terminally differentiated
hNT neurons. NT2 cells can be differentiated into hNT neurons in the
presence of retinoic acid under tissue culture conditions (48). Before
testing the transcriptional property of these cells, we wanted to
characterize them at both the cellular and molecular levels (Fig.
5). The morphological features of these
cells were examined by phase-contrast microscopy. As expected, cell
division arrested hNT neurons (Fig. 5B), and dividing NT2
cells (Fig. 5A) showed characteristic morphology. More than
99% of the NT2 cells can be converted into hNT neurons by this
procedure. To determine the expression of cell type-specific markers in
these cells at the RNA level, an RT-PCR assay using primers against
nestin, a marker for neuronal stem cells (48), was carried out (Fig.
5C). It generated a positive signal for NT2 cells and a
negative one for hNT neurons. Likewise, an RT-PCR assay using primers
against a glutamate receptor, a marker for terminally differentiated
neurons (64), was negative for NT2 cells but positive for hNT neurons.
In these experiments, primers against glyceraldehyde-3-phosphate
dehydrogenase, a housekeeping gene that is expressed in both cell
types, were used as controls. Because RT-PCR is a very sensitive method
of detecting the presence of RNA for assayed markers, this experiment
also underscored the fact that most, if not all, of the cells in a
given population were of a single type.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 5.
Characterization and transfection of
undifferentiated NT2 stem cells and differentiated hNT neurons.
NT2 and hNT cells were grown and cultured as described under
"Experimental Procedures." Morphological features were examined by
phase-contrast micrographs of undifferentiated NT2 cells without any
processes (A), and differentiated hNT neurons showing
characteristic neurite outgrowths (B). Biochemical
characterization was done by RT-PCR (C) and by Western blot
assays (D). RT-PCR analysis was carried out as described
under "Experimental Procedures." Amplication of total mRNA
shows expression of stem cell marker, nestin, in NT2 cells and not in
hNT cells. In contrast, marker for terminally differentiated neurons,
glutamate receptor, was expressed in hNT neurons and not in NT2 cells.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is
expressed in both cell types, was used as a control. W
denotes an experiment containing water instead of mRNA and was
carried out as a negative control. Western blot analysis was carried
out as described under "Experimental Procedures." NT2 cells were
found to express vimentin, a stem cell marker, whereas hNT cells
expressed synapsin, a marker for postmitotic neurons. Detection of
actin was used as an internal control. Transfection of both NT2 and hNT
cells was carried out using calcium phosphate precipitation method and
a plasmid, pEGFPC-1 (CLONTECH), encoding the green
fluorescent protein (GFP) reporter gene as described under
"Experimental Procedures." In order to determine if the reporter
gene activity obtained from transfected hNT cell population was
generated actually by terminally differentiated neurons, these cells
were examined under UV light (360-400 nm) (E) as well as
visible light (F), and photographed. Arrows
points to hNT cells positive for GFP expression. Note that these cells
have neurite outgrowths typical of differentiated neurons.
|
|
To determine further the expression of specific markers in these cells
at the protein level, cell extracts were subjected to Western blot
analysis using anti-vimentin, a stem cell marker, and anti-synapsin, a
neuronal marker (48). Anti-actin was used as a control because the
housekeeping actin gene is expressed in both cell types. As shown in
Fig. 5D, vimentin was detected in NT2 cells but not in hNT
neurons, whereas synapsin was detected in hNT neurons but not in NT2
cells. Taken together, these experiments showed that NT2 cells
exhibited the characteristics of neuronal stem cells, whereas hNT
neurons exhibited those of terminally differentiated neurons.
The transcriptional properties of NT2 cells and hNT neurons were
examined by transient transfection assay. Usually, terminally differentiated neurons are not amenable to transfection with high efficiency. In the present study, transfection methods employing electroporation or lipofection did not yield measurable transfected reporter gene activity. A calcium phosphate transfection method using a
commercially available kit was found to be more useful. Transfection of
the plasmid, pEGFP-C1, encoding the green fluorescent protein (GFP),
was carried out to determine transfection efficiency. Under the
experiment conditions, 40% of NT2 cells and about 1% of hNT neurons
expressed GFP. Although more than 99% of the hNT population consisted
of neurons exhibiting neurite outgrowths, and the hNT neurons did not
express stem cell markers in the RT-PCR assay (indicating that most, if
not all, of the cells in hNT population were postmitotic neurons), we
wanted to ascertain that the reporter gene activity obtained from
transfected hNT neurons was actually generated by differentiated
neurons. For this purpose, cells were photographed under both
ultraviolet light (360 to 400 nm) and visible light after transfection
with pEGFP-C1. All transfected cells expressing GFP were found to be
differentiated postmitotic neurons (Fig. 5, E and
F). Thus, these experiments indicated that the expression of
transfected reporter gene activity in the hNT neurons was actually
contributed by differentiated neurons, not by possible contamination of
NT2 stem cells.
Under these experiment conditions, the promoter and enhancer activity
was then quantitatively evaluated in NT2 cells and hNT neurons by their
ability to express the reporter gene. Before examining the Sp1- and
Gal4:VP16-dependent enhancer activity in these cells, we
wanted to ensure that, under the conditions of the experiment, these
cells contained functionally active Sp1 and Gal4:VP16. The activity of
endogenous Sp1 was tested by comparing the promoter activity of the
basal promoter, pTluc, and the Sp1-dependent promoter,
pS6Tluc. Similarly, the activity of exogenous Gal4:VP16 was tested by
comparing the activity of Gal4:VP16-dependent promoter, pG5TCAT, in the absence and presence of pSGVP, an
expression vector for Gal4:VP16 protein (41). The plasmid pRSV- -gal
encoding the -galactosidase reporter gene was cotransfected in each
of the individual transfection assays as an internal standard. The total amount of plasmid transfected was kept constant in each experiment by adding the vector plasmid pBR322. The cell extract from
each individual experiment was assayed for luciferase and -galactosidase activity. Each luciferase activity was then
normalized to the -galactosidase activity. The mean values for two
or more such experiments are plotted in Figs.
6 (NT2 cells) and
7 (hNT neurons).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
Sp1 and Gal4:VP16 can activate promoters as
well as enhancers in NT2 stem cells. NT2 cells were grown as
described under "Experimental Procedures." Sp1- and
Gal4:VP16-dependent promoter (A) and enhancer
plasmids (B) expressing either luciferase or CAT reporter
gene were transfected into these cells utilizing calcium phosphate
precipitation method. Gal4:VP16-dependent constructs were
cotransfected with an expression vector, pSGVP. pTluc was used to
monitor the basal promoter activity. The plasmid pRSV- -gal
expressing -galactosidase as a reporter gene was cotransfected as an
internal control in each transfection experiment. The total amount of
the transfected plasmid DNA was maintained at 10 µg per transfection.
Cells were harvested 48 h after transfection, and the cell
extracts were assayed for luciferase or CAT and -galactosidase
activities. Each luciferase or CAT activity was then normalized
to -gal activity, and the mean value for two or more such
experiments was plotted. The enhancer stimulation of the tk promoter by
Sp1 and Gal4:VP16 (C) was calculated from the values
(pS6(E)tkluc/ptkluc) and (pG9(E)tkluc/ptkluc),
respectively.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Sp1 and Gal4:VP16 can activate promoters as
well as enhancers in hNT differentiated neurons. NT2 cells were
differentiated into mature neurons as described under "Experimental
Procedures." Promoter (A) and enhancer (B)
activities in these cells were determined as described in the legend to
Fig. 6. The enhancer stimulation of the tk promoter by Sp1 and
Gal4:VP16 (C) was calculated from the values
(pS6(E)tkluc/ptkluc) and (pG9(E)tkluc/ptkluc),
respectively.
|
|
The Sp1-dependent promoter, as compared with the basal
promoter, produced 15- and 7-fold higher promoter activity in NT2 cells and hNT neurons, respectively, indicating that, under these conditions, endogenous Sp1 can function from the proximal promoter site in both of
these cells. Likewise, the Gal4:VP16-dependent promoter alone was inactive in both NT2 cells and hNT neurons, but
cotransfection with pSGVP stimulated the promoter activity 22-fold in
NT2 cells and 9-fold in hNT neurons, again indicating that, under these conditions, these cells expressed functional Gal4:VP16 protein. The
Sp1- and Gal4:VP16-dependent enhancer activity in these
cells was then determined by comparing the activity of ptkluc with that of pG9(E)tkluc and pS6(E)tkluc (driven by
Gal4:VP16- and Sp1-dependent enhancers, respectively).
pG9(E)tkluc contains nine Gal4 DNA-binding sites 600 bp
upstream from the tk promoter (15). To determine the level of
Gal4:VP16-induced enhancer function, pG9(E)tkluc was
cotransfected with pSGVP. Pluc, without a promoter or enhancer, was
used to determine the background luciferase level. The
Sp1-dependent enhancer stimulated the tk promoter about
5-fold in NT2 cells and about 9-fold in hNT neurons. Similarly, the
Gal4:VP16-dependent enhancer stimulated the tk promoter
100-fold in NT2 cells and 20-fold in hNT neurons. Thus, both Sp1- and
Gal4:VP16-dependent enhancers were active in both NT2 cells
and hNT neurons, indicating that all the components of enhancer
function, including the enhancer-specific coactivator activity, are
present in both cell types.
 |
DISCUSSION |
We drew two conclusions from our present studies of gene
expression in mammalian system, namely terminally differentiated oocytes, fertilized eggs, and two- to four-cell embryos on one hand and
terminally differentiated hNT neurons and their precursor, NT2 stem
cells on the other. First, the enhancer-specific coactivator activity
is required for enhancers driven by both Gal4:VP16 (acidic activation
domain) and Sp1 (glutamine-rich activation domain), suggesting that the
coactivator activity is a requirement for general enhancer function.
Second, the lack of coactivator activity, and therefore enhancer
function, is unique to oocytes and fertilized eggs. This coactivator
activity first appears in two- to four-cell embryos, suggesting that
this mechanism provides a safeguard against premature activation of
zygotic genes prior to ZGE. Various aspects of enhancer function during
mouse embryonic development are discussed below.
Lack of Enhancer-specific Coactivator Activity in Terminally
Differentiated Mouse Oocytes--
Multicellular organisms, as opposed
to their unicellular counterparts, face a unique problem in carrying
out life-sustaining functions. Whereas in unicellular organisms the
same cell performs all the necessary functions, in multicellular
organisms there is a division of labor: specific cell types carry out
specific functions in a spatial and temporal manner. During the
mammalian life cycle, multipotent progenitor stem cells undergo
differentiation at various levels, eventually giving rise to specific
cell types. Whereas the stem cells maintain the potential for cell
division, giving rise to either their own kind or a differentiated
form, the terminally differentiated cells lose such potential. In fact, oocytes and neurons are two examples of terminally differentiated cell
types that lose the ability to undergo division completely. Although
these non-dividing cells are presumed to perform restricted tasks, the
strategies they adopt to regulate transcription is unknown. In the
present study, we used differentiated oocytes and undifferentiated two-
to four-cell embryos to examine such strategies and to compare them
with undifferentiated neuronal NT2 stem cells and differentiated hNT neurons.
Previously, we found that transcription in mouse oocytes is regulated
by an exogenously added Gal4:VP16-dependent promoter activity but not Gal4:VP16-dependent enhancer activity. In
contrast, both promoter and enhancer activity were observed in two- to
four-cell embryos. Enhancers are believed to stimulate promoters by
relieving chromatin-mediated repression. However, the lack of
enhancer-mediated transcription in oocytes, as compared with two- to
four-cell embryos, was found to be caused not by the absence of
promoter repression or functional enhancer activation protein.
Accordingly, the efficiency of chromatin assembly on the microinjected
DNA in mouse oocytes and two-cell embryos by assaying the degree of
superhelicity was found to be equal in these cell types (~70%) (39,
65). Furthermore, this degree of chromosome assembly on the
microinjected plasmid DNA was found to correlate directly with the
level of repression of promoters present on these plasmids. The
repression could be relieved in both oocytes and two- to four-cell
embryos by histone deacetylase inhibitors like sodium butyrate or
trichostatin A (41, 42, 51, 66). In contrast, the lack of enhancer
function was found to be caused by the absence of an enhancer-specific coactivator activity. The missing coactivator activity could be supplied to oocytes by microinjection of mRNA from undifferentiated ES
cells (15). In the present study, we examined the question of whether
the coactivator activity is also required for enhancers regulated by
transcription factors other than those containing an acidic activation
domain like Gal4:VP16. This was determined by testing the endogenously
present Sp1-dependent promoter and enhancer activity in
oocytes. We found that oocytes show Sp1-dependent promoter
activity but not Sp1-dependent enhancer activity,
suggesting that the coactivator activity is a general requirement for
enhancers driven by various classes of transcription factors.
To determine if the lack of enhancer-mediated transcription is a
general phenomenon of terminal differentiation, we further examined
promoter- and enhancer-mediated transcription in NT2 stem cells and
terminally differentiated hNT neurons. We found that both cell types
are capable of promoter- and enhancer-mediated transcription.
Therefore, neurons, but not oocytes, utilize enhancer-mediated transcription and provide evidence that different terminally
differentiated cell types can regulate transcription using distinct strategies.
Lack of Enhancer-specific Coactivator Activity in Fertilized Mouse
Eggs Prior to ZGE--
As mentioned above, the major expression of
zygotic genes takes place about 40 h after fertilization and is
regulated by a time-dependent zygotic clock. This mechanism
presumably involves the destruction of an inhibitor or production of a
functional activator of general transcription. What is the importance
of the zygotic clock that delays the onset of embryonic transcription until a defined time after fertilization? The paternal genome in sperm
comes with protamines, whereas the maternal genome in eggs comes with a
normal complement of core histones (67, 68). After fertilization, their
genomes undergo chromatin remodeling to establish the zygotic genome at
the two-cell stage. In the male pronuclei, this process of remodeling
might generate DNA that is not complexed with either histones or
protamines (69) or might produce a chromatin state that exposes
promoters to transcription factors. Thus, the zygotic clock may provide
a mechanism to ensure no spurious transcription occurs during the
remodeling period. On the other hand, after zygotic remodeling, the
chromatin-mediated repression of most promoters in two-cell embryos may
provide a mechanism for enhancer-mediated tissue-specific transcription of genes during development and growth. Delaying expression of the
enhancer-specific coactivator prior to ZGE may provide an additional
mechanism for preventing inappropriate transcription of genes during
this critical period of development.
The same mechanisms that regulate the beginning of ZGE during mouse
embryonic development also seem to occur in other animals. In other
mammals, transcription is delayed until the two-cell or 16-cell stage,
presumably by the same zygotic clock mechanism. For example, ZGE begins
at the two-cell stage in hamsters, the four-cell stage in pigs, the
four- to eight-cell stage in humans, and the eight- to 16-cell stage in
sheep, rabbits, and cows (21, 70, 71). Whether enhancer-specific
coactivator activity appears during the two-cell stage of embryonic
development in these mammals or is delayed until the same stage when
zygotic transcription begins remains to be seen.
Special Features of DNA Replication and Transcription at the
Beginning of Mammalian Development--
Our present knowledge of the
principles that regulate the early development of vertebrate embryos
comes mainly from the Xenopus system (7, 72). During the
last few years, elegant experiments have uncovered clues in diverse
areas from how DNA replication and chromatin structure affects gene
expression to the role of post-transcriptional modification on the
expression of maternal mRNAs (10, 73, 74). Although similar in many
respects, the mammalian system, as exemplified by the mouse
development, appears to be mechanistically different from
Xenopus in some other aspects. For example, In
Xenopus oocytes, the majority of RNA polymerase II
transcripts frequently are initiated at incorrect sites (75), and
transcriptional regulatory components that are required by cells at
later stages in development are dispensable in oocytes (76, 77). Even
more striking is the fact that although bidirectional DNA replication
is initiated at specific sites in the chromosomes of differentiated
mammalian cells (11, 12, 78), virtually any DNA injected into
non-mammalian eggs undergoes semiconservative replication, and early
embryos of amphibians and flies recognize at least 5 times more
initiation sites than do differentiated cells from the same animals
(79). Earlier studies showed that the activity of promoter/enhancer
sequences injected into Xenopus eggs is generally delayed
until the midblastula transition (MBT) (80, 81), although they appear
to exhibit a low but constant rate of gene expression per cell prior to
the MBT (82). Thus, the MBT in Xenopus development appeared
to be equivalent to ZGE in the mouse. However, more recent studies
showed that hormone-dependent transcriptional activation
can be observed in Xenopus oocytes (83, 84). Another such
difference between Xenopus and mouse is that histone
deacetylase inhibitors do not cause accumulation of hyperacetylated
histone H4 until the MBT, whereas in the mouse, histone H4 acetylation
patterns are observed both in one-cell and two-cell embryos (44, 66).
One possible reason for the difference in DNA replication and
transcription at the beginning of development between
Xenopus and mouse is that Xenopus oocytes contain
exceptionally high concentrations of maternally inherited mRNA and
proteins that permit rapid cell cleavage in the absence of
transcription (85). For example, a fertilized Xenopus egg undergoes 11 cleavages to produce ~4000 cells in 6 h to reach the MBT, whereas a fertilized mouse egg undergoes only one cleavage event in the first 24 h to reach the two-cell stage. Thus, it appears that the transcriptional regulations observed prior to the MBT
stage of frog development do not necessarily correspond to those found
prior to the two-cell stage of mouse development.
Role of DNA Replication in Enhancer Function--
In this paper,
we observe enhancer-mediated stimulation of transcription to be present
in all mammalian cell types, except oocytes and fertilized eggs. It has
been previously shown that the absence of enhancer function in mouse
oocytes was neither due to the absence of enhancer activation protein
nor due to chromatin-mediated promoter repression. Rather, the lack of
enhancer function in oocytes was due to the absence of an
enhancer-specific coactivator activity, and this activity can be
supplied to oocytes by coinjection of embryonic stem cell mRNA
(15). However, experiments described in those studies and in the
present study utilized non-replicating microinjected plasmid DNA as a
transcriptional template in various mammalian cell types. So, the
question arises whether the use of non-replicative plasmid DNA, as
opposed to replicative DNA, could explain the lack of enhancer function
in mammalian oocytes and fertilized eggs, because the non-replicative
DNA may have different chromatin assembly as compared with replicative
DNA. It has been found in Xenopus oocytes that DNA
replication-coupled chromatin assembly is required for the efficient
repression of basal transcription (86, 87). However, these authors
showed that enhancer-mediated transcription through the transcription factor Gal4:VP16 is independent of DNA replication. Since promoter repression is stronger in DNA replication coupled templates, Gal4:VP16 could stimulate the promoter to a higher extent from these templates than non-replicating templates. However, the final level of promoter stimulation by Gal4:VP16 from both templates was approximately the same
(86). Since we are studying here the overall stimulation of
transcription by enhancers, irrespective of the level of repression of
the basal promoter, the replication status of the template should not
affect the results. This view is supported by the fact that the
enhancer function in mouse embryos was observed from both replicating
and non-replicating DNA templates when tested in a permissible
cell type (see below).
Mouse oocytes are arrested in meiosis and therefore do not replicate
their own DNA. Accordingly, it has been found that mouse oocytes do not
replicate plasmid DNA injected into their nucleus, even if the injected
DNA contains a viral origin and is provided with the appropriate viral
replication protein (65, 88). This is in direct contrast to
Xenopus oocytes (see above). However, mouse oocytes do
express some of their own genes, and they also can express genes
encoded by plasmids if an appropriate promoter is present (38, 89, 90,
106). Mouse fertilized eggs do replicate their own DNA. Accordingly,
they were found to replicate microinjected plasmid DNA when the DNA
template contained a polyoma virus origin "core" sequence in cis
and was provided with the polyoma virus replication protein, large T
antigen. Even from these replicating DNA templates, enhancer function
was not observed in mouse fertilized eggs (91). Thus, utilization of a
replicating plasmid DNA, as opposed to non-replicating DNA, cannot be
used to explain the lack of enhancer function in mouse fertilized eggs. Furthermore, mouse two-cell embryos that replicate their own DNA also
replicate microinjected DNA under conditions as described for
fertilized eggs above. However, in these embryos, enhancer function was
observed from both replicating as well as non-replicating plasmid DNA
(39, 91). Thus, the replication status of the DNA template appears not
to affect the final level of promoter stimulation in mouse embryos.
Whether the chromatin-mediated repression of the basal promoter is more
efficient on a replicating DNA template as compared with a
non-replicating DNA template in mouse two-cell embryos is not yet known.
The Nature of Enhancer-specific Coactivator Activity--
The
coactivator activity discussed here is mandatory for enhancer function
but dispensable for promoter activity. Because both Sp1 and Gal4:VP16
can function from proximal promoter sites but not distal enhancer sites
in oocytes and fertilized eggs, proximal and distal interactions that
regulate transcription appear to involve distinct interactions engaging
distinct coactivators. This hypothesis is supported by the fact that
activation domains of some transcription factors have been found to
function only from proximal sites, whereas others have been found to
function from both proximal and distal sites (92-95). Furthermore, the
C-terminal domain of RNA polymerase II has been found to be required
for distal interactions, whereas the N-terminal domain of TATA-binding protein is required for proximal interactions (96-98). Such distinct interactions were also observed during our previous studies of tk
promoter activity during mouse development (59). Stimulation of the
promoter by either an enhancer or transactivator operated through the
TATA box of the promoter in differentiated cells but switched to the
distal Sp1 site of the promoter in undifferentiated cleavage-stage
embryos and ES cells.
Enhancer-specific interactions have also been found in the regulation
of the T cell receptor -chain gene by its 3' enhancer in an in
vitro system (99, 100), where DNA topology and an architectural
factor (HMG I/Y) are critical. General coactivators like PC4 (p15) that
are not required for RNA polymerase basal level transcription but are
obligatory for activated transcription from a promoter site have been
discovered (101, 102). Whether such coactivators can also stimulate
transcription from enhancer sites is not known. The molecule(s)
responsible for the coactivator activity has not yet been identified.
Whether this activity is brought about by a single molecule or a family
of molecules is also not known. Presumably the coactivator activity
mediates protein-protein interaction between factors bound at the
enhancer site and the transcription complex bound at the promoter site.
Whether this interaction involves DNA topology, DNA tracking, and/or a
DNA looping mechanism is not yet clear. However, because the chromatin structure and enhancer function are intimately connected, the coactivator activity very likely acts by remodeling the chromatin structure. Recently, several factors such as the SWI·SNF complex, RSC
(STH1), NURF (ISWI), MOT1, ACF, FACT, and others that modulate the
chromatin structure either directly or indirectly have been identified
(103-107). The actual chromatin destabilization process may involve
histone acetylation or other modifications (4, 5, 7-9). Whether
enhancer-specific coactivator activity is represented by any or all of
these complexes is not clear. However, our preliminary experiments
showed that a fraction of the nuclear extract from HeLa cells can
restore enhancer activity in
oocytes.2 The identification
of the protein or the protein complex that provides the
enhancer-specific coactivator activity would further our understanding
of transcriptional regulation through enhancers.
 |
ACKNOWLEDGEMENT |
We are very thankful to Mel DePamphilis for
critical review of this paper.
 |
FOOTNOTES |
*
This work was supported in part by grants (to S. M.) from
the Pediatric Brain Tumor Foundation of the U. S., the Association for
Research of Childhood Cancer, and National Institutes of Health Grant
GM53454.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this work.
§
To whom correspondence should be addressed: The University of Texas
M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Box 100, Houston,
TX 77030. Tel.: 713-792-8920; Fax: 713-792-6054; E-mail:
majumder{at}audumla.mdacc.tmc.edu.
2
L. Rastelli, Z. Zhao, and S. Majumder,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
ZGE, zygotic gene
expression;
ES, embryonic stem;
NT2, NTera 2;
hNT, human NT;
bp, base
pairs;
RT-PCR, reverse-transcriptase-polymerase chain reaction;
GFP, green fluorescent protein;
CAT, chloramphenicol acetyltransferase;
tk, thymidine kinase;
MBT, midblastula transition;
hCG, human chorionic
gonadotrophin.
 |
REFERENCES |
-
Felsenfeld, G.
(1996)
Cell
86,
13-19[CrossRef][Medline]
[Order article via Infotrieve]
-
Kingston, R. E.,
Bunker, C. A.,
and Imbalzano, A. N.
(1996)
Genes Dev.
10,
905-920[Abstract/Free Full Text]
-
Steger, D. J.,
and Workman, J. L.
(1996)
BioEssays
18,
875-884[CrossRef][Medline]
[Order article via Infotrieve]
-
Pazin, M. J.,
and Kadonaga, J. T.
(1997)
Cell
89,
325-328[CrossRef][Medline]
[Order article via Infotrieve]
-
Grunstein, M.
(1997)
Nature
389,
349-352[CrossRef][Medline]
[Order article via Infotrieve]
-
Struhl, K.
(1998)
Genes Dev.
12,
599-606[Free Full Text]
-
Vermaak, D.,
and Wolffe, A. P.
(1998)
Dev. Genet.
22,
1-6[CrossRef][Medline]
[Order article via Infotrieve]
-
Roth, S. Y.,
and Allis, C. D.
(1996)
Cell
87,
5-8[CrossRef][Medline]
[Order article via Infotrieve]
-
Wolffe, A. P.,
and Pruss, D.
(1996)
Cell
84,
817-819[CrossRef][Medline]
[Order article via Infotrieve]
-
Imhof, A.,
and Wolffe, A. P.
(1998)
Curr. Biol.
8,
R422-R424[CrossRef][Medline]
[Order article via Infotrieve]
-
DePamphilis, M. L.
(1988)
Cell
52,
635-638[CrossRef][Medline]
[Order article via Infotrieve]
-
DePamphilis, M. L.
(1997)
Methods
13,
211-219[CrossRef][Medline]
[Order article via Infotrieve]
-
Kobayashi, T.,
Rein, T.,
and DePamphilis, M. L.
(1998)
Mol. Cell. Biol.
18,
3266-3277[Abstract/Free Full Text]
-
Majumder, S.,
and DePamphilis, M. L.
(1995)
BioEssays
17,
879-889[CrossRef][Medline]
[Order article via Infotrieve]
-
Majumder, S.,
Zhao, Z.,
Kaneko, K.,
and DePamphilis, M. L.
(1997)
EMBO J.
16,
1721-1731[CrossRef][Medline]
[Order article via Infotrieve]
-
Kaneko, K. J.,
and DePamphilis, M. L.
(1998)
Dev. Genet.
22,
43-55[CrossRef][Medline]
[Order article via Infotrieve]
-
Majumder, S.
(1997)
in
Microinjection and Transgenesis: Strategies and Protocols (Cid-Arregui, A., and Garcia-Carranca, A., eds), pp. 323-349, Springer-Verlag, Heidelberg
-
Rastelli, L.,
and Majumder, S.
(1998)
in
Gene Therapy and Molecular Biology (Boulikas, ed), Gene Therapy Press, Palo Alto
-
Hogan, B.,
Constantini, F.,
and Lacy, E.
(1986)
Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Schultz, G. A.,
and Heyner, S.
(1992)
Mutat. Res.
296,
17-31[Medline]
[Order article via Infotrieve]
-
Schultz, R. M.
(1993)
BioEssays
15,
531-538[CrossRef][Medline]
[Order article via Infotrieve]
-
Conover, J. C.,
Temeles, G. L.,
Zimmermann, J. W.,
Burke, B.,
and Schultz, R. M.
(1991)
Dev. Biol.
144,
392-404[CrossRef][Medline]
[Order article via Infotrieve]
-
Latham, K. E.,
Solter, D.,
and Schulz, R.
(1992)
Dev. Biol.
149,
457-462[CrossRef][Medline]
[Order article via Infotrieve]
-
Christians, E.,
Campion, E.,
Thompson, E. M.,
and Renard, J. P.
(1995)
Development
121,
113-122[Abstract]
-
Nothias, J. Y.,
Miranda, M.,
and DePamphilis, M. L.
(1996)
EMBO J.
15,
5715-5725[Medline]
[Order article via Infotrieve]
-
Wiekowski, M., Miranda, M., Nothias, J. Y., Turner, B. M.,
and DePamphilis, M. L. (1999) J. Cell Sci., in
press
-
Kaneko, K. J.,
Cullinan, E. B.,
Latham, K. E.,
and DePamphilis, M. L.
(1997)
Development
124,
65-73[Abstract]
-
Aoki, F.,
Worrad, D. M.,
and Schulz, R.
(1997)
Dev. Biol.
181,
296-307[CrossRef][Medline]
[Order article via Infotrieve]
-
Bellier, S.,
Chastant, S.,
Adenot, P.,
Vincent, M.,
Renard, J. P.,
and Bensaude, O.
(1997)
EMBO J.
16,
6250-6262[CrossRef][Medline]
[Order article via Infotrieve]
-
Thompson, E. M.,
Legouy, E.,
and Renard, J. P.
(1998)
Dev. Genet.
22,
31-42[CrossRef][Medline]
[Order article via Infotrieve]
-
Xu, W.,
Edmondson, D. G.,
and Roth, S. Y.
(1998)
Mol. Cell. Biol.
18,
5659-5669[Abstract/Free Full Text]
-
Oh, B.,
Hwang, S. Y.,
Solter, D.,
and Knowles, B. B.
(1997)
Development
124,
493-503[Abstract]
-
Wang, Q.,
and Latham, K. E.
(1997)
Mol. Reprod. Dev.
47,
265-270[CrossRef][Medline]
[Order article via Infotrieve]
-
Richter, J. D.
(1991)
BioEssays
13,
179-183[CrossRef][Medline]
[Order article via Infotrieve]
-
Bachvarova, R. F.
(1992)
Cell
69,
895-897[CrossRef][Medline]
[Order article via Infotrieve]
-
Manley, J. L.,
and Proudfoot, N. J.
(1994)
Genes Dev.
8,
259-264[Free Full Text]
-
Temeles, G. L.,
and Schultz, R. M.
(1997)
J. Reprod. Fertil.
109,
223-228[Abstract/Free Full Text]
-
De Sousa, P. A.,
Watson, A. J.,
and Schultz, R. M.
(1998)
Biol. Reprod.
59,
969-977[Abstract/Free Full Text]
-
Martinez-Salas, E.,
Linney, E.,
Hassell, J.,
and DePamphilis, M. L.
(1989)
Genes Dev.
3,
1493-1506[Abstract/Free Full Text]
-
Adenot, P. G.,
Mercier, Y.,
Renard, J. P.,
and Thompson, E. M.
(1997)
Development
124,
4615-4625[Abstract]
-
Majumder, S.,
Miranda, M.,
and DePamphilis, M. L.
(1993)
EMBO J.
12,
1131-1140[Medline]
[Order article via Infotrieve]
-
Wiekowski, M.,
Miranda, M.,
and DePamphilis, M. L.
(1993)
Dev. Biol.
159,
366-378[CrossRef][Medline]
[Order article via Infotrieve]
-
Henery, C. C.,
Miranda, M.,
Wiekowski, M.,
Wilmut, I.,
and DePamphilis, M. L.
(1995)
Dev. Biol.
169,
448-460[CrossRef][Medline]
[Order article via Infotrieve]
-
Thompson, E. M.,
Legouy, E.,
Christians, E.,
and Renard, J. P.
(1995)
Development
121,
3425-3437[Abstract]
-
LeGouy, E.,
Thompson, E. M.,
Muchardt, C.,
and Renard, J. P.
(1998)
Dev. Dyn.
212,
38-48[CrossRef][Medline]
[Order article via Infotrieve]
-
Stein, P.,
Worrad, D. M.,
Belyaev, N. D.,
Turner, B. M.,
and Schultz, R. M.
(1997)
Mol. Reprod. Dev.
47,
421-429[CrossRef][Medline]
[Order article via Infotrieve]
-
Pleasure, S. J.,
Page, C.,
and Lee, V. M.
(1992)
J. Neurosci.
12,
1802-1815[Abstract]
-
Pleasure, S. J.,
and Lee, V. M.
(1993)
J. Neurosci. Res.
35,
585-602[CrossRef][Medline]
[Order article via Infotrieve]
-
Miranda, M.,
Majumder, S.,
Wiekowski, M.,
and DePamphilis, M. L.
(1993)
Methods Enzymol.
225,
412-433[Medline]
[Order article via Infotrieve]
-
Worrad, D. M.,
Ram, P. T.,
and Schultz, R. M.
(1994)
Development
120,
2347-2357[Abstract]
-
Wiekowski, M.,
Miranda, M.,
and DePamphilis, M. L.
(1991)
Dev. Biol.
147,
403-414[CrossRef][Medline]
[Order article via Infotrieve]
-
Sadowski, I.,
Ma, J.,
Triezenberg, S.,
and Ptashne, M.
(1988)
Nature
335,
563-564[CrossRef][Medline]
[Order article via Infotrieve]
-
Smale, S. T.,
and Baltimore, D.
(1989)
Cell
57,
103-113[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Rastelli, L.,
Chan, C. S.,
and Pirrotta, V.
(1993)
EMBO J.
12,
1513-1522[Medline]
[Order article via Infotrieve]
-
Abbondanzo, S. J.,
Gadi, I.,
and Stewart, C. L.
(1993)
Methods Enzymol.
225,
803-823[Medline]
[Order article via Infotrieve]
-
Stow, N. D.,
and Stow, E. C.
(1986)
J Gen. Virol.
67,
2571-2585[Abstract/Free Full Text]
-
Boni, J.,
and Coen, D. M.
(1989)
J. Virol.
63,
4088-4092[Abstract/Free Full Text]
-
Majumder, S.,
and DePamphilis, M. L.
(1994)
Mol. Cell. Biol.
14,
4258-4268[Abstract/Free Full Text]
-
Worrad, D. M.,
and Schultz, R. M.
(1997)
Mol. Reprod. Dev.
46,
268-277[CrossRef][Medline]
[Order article via Infotrieve]
-
Turner, B. M.,
and O'Neill, L. P.
(1995)
Semin. Cell Biol.
6,
229-236[Medline]
[Order article via Infotrieve]
-
Keohane, A. M.,
Lavender, J. S.,
O'Neill, L. P.,
and Turner, B. M.
(1998)
Dev. Genet.
22,
65-73[CrossRef][Medline]
[Order article via Infotrieve]
-
Melin, F.,
Miranada, M.,
Montreau, N.,
DePamphilis, M. L.,
and Blangy, D.
(1993)
EMBO J.
12,
4657-4666[Medline]
[Order article via Infotrieve]
-
Younkin, D. P.,
Tang, C. M.,
Hardy, M.,
Reddy, U. R.,
Shi, Q. Y.,
Pleasure, S. J.,
Lee, V. M.,
and Pleasure, D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2174-2178[Abstract/Free Full Text]
-
Chalifour, L. E.,
Wirak, D. O.,
Wassarman, P. M.,
and DePamphilis, M. L.
(1986)
J. Virol.
59,
619-627[Abstract/Free Full Text]
-
Worrad, D. M.,
Turner, B. M.,
and Schultz, R. M.
(1995)
Development
121,
2949-2959[Abstract]
-
Zirkin, B. R.,
and Perreault, S. D.
(1989)
in
Molecular Biology of Fertilization (Schatten, H., and Shatten, G., eds), pp. 91-114, Academic Press
-
Nonchev, S.,
and Tsanev, R.
(1990)
Mol. Reprod. Dev.
25,
72-76[CrossRef][Medline]
[Order article via Infotrieve]
-
Rodman, T. C.,
Pruslin, F. H.,
Hoffmann, H. P.,
and Allfrey, V. G.
(1981)
J. Cell Biol.
90,
351-361[Abstract/Free Full Text]
-
Telford, N. A.,
Watson, A. J.,
and Schultz, G. A.
(1990)
Mol. Reprod. Dev.
26,
90-100[CrossRef][Medline]
[Order article via Infotrieve]
-
Seshagiri, P. B.,
McKenzie, D. I.,
Bavister, B. D.,
Williamson, J. L.,
and Aiken, J. M.
(1992)
Mol. Reprod. Dev.
32,
229-235[CrossRef][Medline]
[Order article via Infotrieve]
-
Vermaak, D.,
Steinbach, O. C.,
Dimitrov, S.,
Rupp, R. A. W.,
and Wolffe, A. P.
(1998)
Curr. Biol.
8,
533-536[CrossRef][Medline]
[Order article via Infotrieve]
-
Wolffe, A. P.
(1997)
Biochem. Soc. Trans.
25,
354-358[Medline]
[Order article via Infotrieve]
-
Matsumoto, K.,
Wassarman, K. M.,
and Wolffe, A. P.
(1998)
EMBO J.
17,
2107-2121[CrossRef][Medline]
[Order article via Infotrieve]
-
Steinbeisser, H.,
Hofmann, A.,
Stutz, F.,
and Trendelenburg, M. F.
(1988)
Nucleic Acids Res.
16,
3223-3238[Abstract/Free Full Text]
-
Michaeli, T.,
and Prives, C.
(1987)
Nucleic Acids Res.
15,
1579-1594[Abstract/Free Full Text]
-
Green, J.,
Brady, J.,
and Khoury, G.
(1987)
Virology
159,
339-359[CrossRef][Medline]
[Order article via Infotrieve]
-
DePamphilis, M. L.
(1993)
J. Biol. Chem.
268,
1-4[Abstract/Free Full Text]
-
DePamphilis, M. L.
(1993)
Annu. Rev. Biochem.
62,
29-63[CrossRef][Medline]
[Order article via Infotrieve]
-
Kimelman, D.,
Kirschner, M.,
and Scherson, T.
(1987)
Cell
48,
399-407[CrossRef][Medline]
[Order article via Infotrieve]
-
Shiokawa, K.,
Misumi, Y.,
Tashiro, K.,
Nakakura, N.,
Yamana, K.,
and Oh-uchida, M.
(1989)
Cell Differ. Dev.
28,
17-25[CrossRef][Medline]
[Order article via Infotrieve]
-
Shiokawa, K.,
Yamana, K.,
Fu, Y.,
Atsuchi, Y.,
and Hosokawa, K.
(1990)
Roux's Arch. Dev. Biol.
198,
322-329[CrossRef]
-
Wong, J.,
Patterton, D.,
Imhof, A.,
Guschin, D.,
Shi, Y. B.,
and Wolffe, A. P.
(1998)
EMBO J.
17,
520-534[CrossRef][Medline]
[Order article via Infotrieve]
-
Wong, J.,
Shi, Y. B.,
and Wolffe, A. P.
(1997)
EMBO J.
16,
3158-3171[CrossRef][Medline]
[Order article via Infotrieve]
-
Davidson, E. H.
(1986)
Gene Activity in Early Development, 3rd Ed., Academic Press, New York
-
Almouzni, G.,
and Wolffe, A. P.
(1993)
Genes Dev.
7,
2033-2047[Abstract/Free Full Text]
-
Wong, J.,
Shi, Y. B.,
and Wolffe, A. P.
(1995)
Genes Dev.
9,
2696-2711[Abstract/Free Full Text]
-
Wirak, D. O.,
Chalifour, L. E.,
Wassarman, P. M.,
Muller, W. J.,
Hassell, J. A.,
and DePamphilis, M. L.
(1985)
Mol. Cell. Biol.
5,
2924-2935[Abstract/Free Full Text]
-
Chalifour, L. E.,
Wirak, D. O.,
Hansen, U.,
Wassarman, P. M.,
and DePamphilis, M. L.
(1987)
Genes Dev.
1,
1096-1106[Abstract/Free Full Text]
-
Dooley, T. P.,
Miranda, M.,
Jones, N. C.,
and DePamphilis, M. L.
(1989)
Development
107,
945-956[Abstract/Free Full Text]
-
Martinez-Salas, E.,
Cupo, D. Y.,
and DePamphilis, M. L.
(1988)
Genes Dev.
2,
1115-1126[Abstract/Free Full Text]
-
Seipel, K.,
Georgiev, O.,
and Schaffner, W.
(1992)
EMBO J.
11,
4961-4968[Medline]
[Order article via Infotrieve]
-
Hagmann, M.,
Georgiev, O.,
and Schaffner, W.
(1997)
J. Virol.
71,
5952-5962[Abstract]
-
Moosmann, P.,
Georgiev, O.,
Le Douarin, B.,
Bourquin, J. P.,
and Schaffner, W.
(1996)
Nucleic Acids Res.
24,
4859-4867[Abstract/Free Full Text]
-
Moosmann, P.,
Georgiev, O.,
Thiesen, H. J.,
Hagmann, M.,
and Schaffner, W.
(1997)
Biol. Chem.
378,
669-677[Medline]
[Order article via Infotrieve]
-
Seipel, K.,
Georgiev, O.,
Gerber, H. P.,
and Schaffner, W.
(1993)
Nucleic Acids Res.
21,
5609-5615[Abstract/Free Full Text]
-
Seipel, K.,
Georgiev, O.,
Gerber, H. P.,
and Schaffner, W.
(1994)
Mol. Reprod. Dev.
39,
215-225[CrossRef][Medline]
[Order article via Infotrieve]
-
Gerber, H. P.,
Hagmann, M.,
Seipel, K.,
Georgiev, O.,
West, M. A.,
Litingtung, Y.,
Schaffner, W.,
and Corden, J. L.
(1995)
Nature
374,
660-662[CrossRef][Medline]
[Order article via Infotrieve]
-
Barton, M. C.,
and Emerson, B. M.
(1994)
Genes Dev.
8,
2453-2465[Abstract/Free Full Text]
-
Bagga, R.,
and Emerson, B. M.
(1997)
Genes Dev.
11,
629-639[Abstract/Free Full Text]
-
Ge, H.,
and Roeder, R. G.
(1994)
Cell
78,
513-523[CrossRef][Medline]
[Order article via Infotrieve]
-
Kretzschmar, M.,
Kaiser, K.,
Lottspeich, F.,
and Meirsterernest, M.
(1994)
Cell
78,
525-534[CrossRef][Medline]
[Order article via Infotrieve]
-
Blackwood, E. M.,
and Kadonaga, J. T.
(1998)
Science
281,
61-63
-
Kadonaga, J. T.
(1998)
Cell
92,
307-313[CrossRef][Medline]
[Order article via Infotrieve]
-
Naar, A. M.,
Beaurang, P. A.,
Robinson, K. M.,
Oliner, J. D.,
Avizonis, D.,
Scheek, S.,
Zwicker, J.,
Kadonaga, J. T.,
and Tjian, R.
(1998)
Genes Dev.
12,
3020-3031[Abstract/Free Full Text]
-
Armstrong, J. A.,
and Emerson, B. M.
(1998)
Curr. Opin. Genet. Dev.
8,
165-172[CrossRef][Medline]
[Order article via Infotrieve]
-
Kim, T. K.,
Lagrange, T.,
Wang, Y. H.,
Griffith, J. D.,
Reinberg, D.,
and Ebright, R. H.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
12268-12273[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
X. Su, V. Gopalakrishnan, D. Stearns, K. Aldape, F. F. Lang, G. Fuller, E. Snyder, C. G. Eberhart, and S. Majumder
Abnormal Expression of REST/NRSF and Myc in Neural Stem/Progenitor Cells Causes Cerebellar Tumors by Blocking Neuronal Differentiation.
Mol. Cell. Biol.,
March 1, 2006;
26(5):
1666 - 1678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Su, S. Kameoka, S. Lentz, and S. Majumder
Activation of REST/NRSF Target Genes in Neural Stem Cells Is Sufficient To Cause Neuronal Differentiation
Mol. Cell. Biol.,
September 15, 2004;
24(18):
8018 - 8025.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kobayashi, K. Akasaka, M. Kawaichi, and T. Kokubo
Functional interaction between TATA and upstream CACGTG elements regulates the temporally specific expression of Otx mRNAs during early embryogenesis of the sea urchin, Hemicentrotus pulcherrimus
Nucleic Acids Res.,
July 15, 2002;
30(14):
3034 - 3044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rastelli, K. Robinson, Y. Xu, and S. Majumder
Reconstitution of Enhancer Function in Paternal Pronuclei of One-Cell Mouse Embryos
Mol. Cell. Biol.,
August 15, 2001;
21(16):
5531 - 5540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Immaneni, P. Lawinger, Z. Zhao, W. Lu, L. Rastelli, J. H. Morris, and S. Majumder
REST-VP16 activates multiple neuronal differentiation genes in human NT2 cells
Nucleic Acids Res.,
September 1, 2000;
28(17):
3403 - 3410.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|