Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Biswas, N.
Right arrow Articles by Weller, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Biswas, N.
Right arrow Articles by Weller, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 12, 8068-8076, March 19, 1999


A Mutation in the C-terminal Putative Zn2+ Finger Motif of UL52 Severely Affects the Biochemical Activities of the HSV-1 Helicase-Primase Subcomplex*

Nilima Biswas and Sandra K. WellerDagger

From the Department of Microbiology, University of Connecticut Health Center, Farmington, Connecticut 06030

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex that is composed of the products of the UL5, UL52, and UL8 genes. A subcomplex consisting of the UL5 and UL52 proteins retains all the enzymatic activities exhibited by the holoenzyme in vitro. The UL52 protein contains a putative zinc finger at its C terminus which is highly conserved among both prokaryotic and eukaryotic primases. We constructed a mutation in which two highly conserved cysteine residues in the zinc finger motif were replaced with alanine residues. A UL52 expression plasmid containing the mutation in the zinc finger region is unable to support the growth of a UL52 mutant virus in a transient complementation assay. Wild type and mutant UL5·UL52 subcomplexes were purified from insect cells infected with recombinant baculoviruses. Surprisingly, the mutant protein was severely affected in all biochemical activities tested; no helicase or primase activities could be detected, and the mutant protein retains only about 9% of wild type levels of single-stranded DNA-dependent ATPase activity. Gel mobility shift assays showed that DNA binding is severely affected as well; the mutant subcomplex only retains approximately 8% of wild type levels of binding to a forked substrate. On the other hand, the mutant protein retains its ability to interact with UL5 as indicated by copurification and with UL8 as indicated by a supershifted band in the gel mobility shift assay. In addition, the ability of individual subunits to bind single-stranded DNA was examined by photo cross-linking. In the wild type UL5·UL52 subcomplex, both subunits are able to bind an 18-mer of oligo(dT). The mutant subcomplex was severely compromised in the ability of both UL5 and UL52 to bind the oligonucleotide; total cross-linking was only 2% of wild type levels. These results are consistent with the proposal that the putative zinc binding motif of UL52 is required not only for binding of the UL52 subunit to DNA and for primase activity but also for optimal binding of UL5 to DNA and for the subsequent ATPase and helicase activities.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Herpes simplex virus type 1 (HSV-1)1 encodes a heterotrimeric DNA helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes (1, 2). All three genes are essential for viral DNA replication (3-7). This protein complex has been shown to possess ssDNA-dependent NTPase, 5' to 3' DNA helicase, and DNA primase activities (1, 2, 8-10). The HSV-1 helicase-primase complex can be isolated from insect cells that have been simultaneously infected with recombinant baculoviruses that express each of the three subunits (8). A subassembly consisting of the UL5 and UL52 gene products also exhibits all the enzymatic activities of the holoenzyme (11). The UL5 protein contains seven conserved motifs found in all members of helicase Superfamily I which comprises DNA and RNA helicases from bacteria, viruses, and eukaryotes (12). Mutations in conserved residues in the helicase motifs have been shown to abolish the ability of mutant UL5 to support DNA replication in vivo (13). Furthermore, these mutations abolish helicase but not primase activity in vitro (14). The UL52 protein contains several conserved motifs found in other primases including a DXD motif associated with the catalytic activity in other primases (15, 16). Mutations in the DXD motif specifically abolished primase but not ATPase or helicase activities (15, 16). The UL8 gene product has not been associated with any enzymatic activities (9, 11) but can stimulate both the helicase and primase activities of the helicase-primase complex (8, 17-20). UL8 may also be responsible for mediating protein-protein interactions required at the replication fork (20-23). Taken together, these results suggest that UL5 encodes the helicase subunit and that UL52 encodes the primase subunit of the helicase-primase complex; however, neither UL5 nor UL52 appears to possess any of these activities when expressed and purified alone (8, 11). Thus it is not clear whether UL52 contributes a specific function to helicase activity or whether UL5 contributes a function to primase activity. It is also possible that amino acid residues from both polypeptides actually contribute to the catalytic activities of the complex or that each polypeptide needs the other for proper folding and conformation.

Unwinding of duplex DNA by a helicase is an essential step in many biological processes such as DNA replication, DNA repair, recombination, and transcription. Although the precise mechanism of unwinding is unknown for any helicase, it is clear that the unwinding reaction requires the coupling of several simpler events such as ATP binding, ATP hydrolysis, single strand and double strand DNA binding, and translocation along the DNA. One model for helicase activity poses that helicases must utilize at least two distinct DNA-binding sites (24). It is believed that helicases achieve this by forming oligomeric structures, either dimer, hexamer, or multiprotein complexes. The Rep protein of Escherichia coli, also a member of Superfamily I, is believed to form a dimer (25, 26) at the replication fork, whereas the helicases of T4 and T7 bacteriophages (27, 28) and SV40 (29, 30) apparently form hexamers or higher order structures. The stoichiometry of the UL5·UL52·UL8 heterotrimeric complex at the replication fork is not known nor is it known which proteins or domains within each protein are capable of contacting the DNA substrate. It is possible that the UL5 subunit itself contains all the DNA binding regions required for helicase activity and that the UL52 subunit has a DNA binding region associated with primase activity. However, it is also possible that the UL52 protein contains a DNA binding domain required for helicase activity. In this paper we developed a photo cross-linking assay and used it to demonstrate that both UL5 and UL52 subunits of the helicase-primase subcomplex are capable of contacting DNA.

The UL52 protein contains a putative zinc finger motif at its C terminus that is highly conserved among herpesviruses and also other primases such as the bacteriophage primases, mouse, and yeast primases (31, 32). Zinc finger motifs have been implicated in sequence-specific DNA recognition by several proteins including transcription factors (33-37). Specifically, the zinc finger motif in the bacteriophage T7 primase has been shown to be responsible for template recognition (32). In the present study, we performed mutational analysis of the putative zinc finger region of UL52 to assess the role of this motif in the DNA-binding properties of the helicase-primase complex. We found that substitution of two highly conserved cysteine residues within the motif with alanine abolishes the in vivo DNA replication activity of UL52, indicating that this motif is essential in vivo. The mutant protein subcomplex exhibits severe defects in DNA binding, ATPase, helicase, and primase activities. These results suggest the essential role of the putative zinc finger motif in the biochemical activities of the helicase-primase subcomplex.

    EXPERIMENTAL PROCEDURES

Reagents

Supplemented Graces's medium, 10% Pluronic®F-68 and the Bac-to-BacTM recombinant baculovirus kit were purchased from Life Technologies, Inc. Fetal calf serum was obtained from Atlanta Biologicals. Penicillin/streptomycin solution, ampicillin, phenylmethylsulfonyl fluoride, leupeptin, and pepstatin were purchased from Sigma. The 20-ml HiLoad 16/10 SP Sepharose Fast Flow column was from Amersham Pharmacia Biotech. The 12-ml Uno Q (Q-12) column was from Bio-Rad. Radiolabeled nucleotides were purchased from Amersham Pharmacia Biotech. Oligonucleotides were synthesized by Life Technologies, Inc. The oligonucleotide substituted with 5-iodo deoxyuridine was synthesized by Cruachem (Dulles, VA). Long RangerTM 50% acrylamide was obtained from J. T. Baker Inc. All restriction enzymes were purchased from New England Biolabs. A polyclonal antibody (1248) directed against the C-terminal 10 amino acids of UL52 was a kind gift from Dr. Mark Challberg (National Institutes of Health, Bethesda). M13mp18 single-stranded DNA was purified according to standard procedures (38).

Buffers

Buffer A consists of 20 mM HEPES, pH 7.6, 1.0 mM dithiothreitol (DTT), 10 mM sodium bisulfite, 5 mM MgCl2, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml leupeptin, 1 µg/ml pepstatin, and 2 µg/ml aprotinin. Buffer B contains 20 mM HEPES, pH 7.6, 1.0 mM DTT, 10% (V/V) glycerol, and 0.5 mM EDTA. All buffers were passed through a 0.22-µm filter and degassed before use.

Cells and Viruses

Spodoptera frugiperda (Sf9) cells were maintained at 27 °C in Graces's insect medium containing 10% fetal calf serum, 0.33% lactalbumin hydrolysate, 0.33% yeastolate, 0.1 mg/ml streptomycin, and 100 units/ml penicillin. Recombinant Autographa californica nuclear polyhedrosis baculovirus expressing HSV-1 UL5, AcmNPV/UL5, was a kind gift from Dr. Robert Lehman (Stanford University School of Medicine, Stanford), and recombinant baculovirus expressing UL52, AcUL52, was a kind gift from Dr. Nigel D. Stow (Medical Research Council Virology Unit, Glasgow, UK). Viral stocks were amplified in Sf9 cells grown in suspension as described previously (14). Stocks were titered by determining the volume of viral stock that gave the maximum level of recombinant protein expression on 1 × 106 Sf9 cells at 48 h postinfection. African green monkey kidney cells (Vero, American Type Culture Collection, Rockville, MD) were propagated as described previously (39). The BL-1 cell line which is permissive for UL52 mutants and the UL52 mutant virus, hr114, containing a lacZ insertion were described in Ref. 6.

Plasmids

The plasmid pcDNA1-UL52 containing the UL52 gene under the control of the CMV promoter was described previously (40). The amplicon vector plasmid pF1'-CMV was generously provided by Ann D. Kwong (see Ref. 41). In order to generate an amplicon vector capable of expressing UL52 (pF1'-UL52), pcDNA1-UL52 was digested with BamHI and HpaI, and the 3.5-kb fragment was subcloned into pF1'-CMV digested with EcoRV and BglII.

Construction of Point Mutation

Mutations were constructed by a two-step polymerase chain reaction method (42). The outside primers were OZnFM3 (5' GCATCGAAACCCACTTTCCCGAACA 3') and OZnM4 (5' GCGGCCGAGACGAGCGAGTTAGACA 3'). The mutagenic primers were as follows: OZnM1 (5' CAGCAGGCATTCGCCGCCAAAGCAGACAGCAACC 3') and OZnM2 (5' TTGCTGTCTGCTTTGGCGGCGAATGCCTGCTGACACAAGGA 3'). The mutations resulting in coding changes are underlined; a silent change resulting in the introduction of a BsmI site is indicated by a double underline. The mutated polymerase chain reaction products were digested with Blp1 and HindIII, and the 603-base pair fragment was subcloned into pF1'-UL52. The clone was confirmed by the presence of the new BsmI restriction site. Sequencing of the 603-base pair region confirmed that no spontaneous mutations were introduced by polymerase chain reaction. The mutant plasmid was designated as pF1'-UL52(CC3,4AA).

Construction of the Baculovirus Recombinant Harboring the UL52 Mutant Gene

pF1'-UL52(CC3,4AA) was digested with HindIII and NotI, and the resulting 3.7-kb fragment containing the UL52(CC3,4AA) gene was cloned into pFastBac1, a baculovirus transfer vector (4.8 kb, Life Technologies, Inc.), to generate UL52(CC3,4AA)FastBac. This transfer vector was then used to generate a baculoviral stock, AcUL52(CC3,4AA), capable of expressing the mutant UL52 protein as described previously (14).

Protein Expression and Purification

Two liters of Sf9 cells were grown in suspension at 27 °C in Graces' insect medium as described previously (14). The wild type UL5·UL52 and the UL5·UL52(CC3,4AA) subcomplexes were purified essentially as described earlier except that a UnoQ (Bio-Rad) column was used in place of the Mono Q column (14). Cells were Dounced using 15 strokes of a tight-fitting pestle in buffer A, and the cytosolic extracts were clarified by centrifugation at 35,000 × g for 30 min. The UL5·UL52 subcomplexes were fractionated from the cytosolic extract by adding equal volume of buffer B containing 0.2 M NaCl and 2 M ammonium sulfate on ice for 4 h. The resultant protein pellets were resuspended in buffer B containing 0.1 M NaCl and dialyzed against the same buffer. The dialyzed sample was loaded onto a 20-ml SP-Sepharose column equilibrated with buffer B containing 0.1 M NaCl, and the column was washed with 5 column volumes of the equilibration buffer. Fractions containing the UL5·UL52 subcomplex were identified by both ATPase assay and SDS-polyacrylamide gel electrophoresis. The UL5·UL52 subcomplex elutes from the column in the void volume. Pooled fractions from SP-Sepharose were loaded onto a 12-ml Uno Q column equilibrated with buffer B containing 0.1 M NaCl. The column was washed with 60 ml of buffer B containing 0.1 M NaCl, and the protein was eluted using a 185-ml linear gradient of buffer B containing 0.1-1 M NaCl.

Enzyme Assays

ATPase Assay-- ATPase assays (50 µl) were performed using 5 mM ATP, 5 mM MgCl2, 0.1 mM ssM13mp18 DNA (nucleotides), and 0.45 pmol of UL5·UL52 subcomplex (4.5 pmol in the absence of ssDNA) as described previously (14). Nanomoles of inorganic phosphate released per reaction were determined from a standard curve. Kinetic parameters for ATPase activity were calculated as described previously (43).

Helicase Assay-- Reaction mixtures (50 µl) contained 20 mM Na+ HEPES, pH 7.6, 1 mM DTT, 5 mM MgCl2, 7 mM ATP, 0.1 mg/ml bovine serum albumin, 10% glycerol, and 0.64 pmol of the forked DNA substrate as described previously (14). The forked DNA substrate was constructed by heat denaturing and annealing 80 pmol of the helicase 48FS oligo (5' CAGTCACGACGTTGTAGAGCGACGGCCAGTCGGTTATTGCATGAAAGC 3') radiolabeled at its 5' end with [gamma -32P]ATP and 80 pmol of the unlabeled 48C/FS oligo (5' CGAAAGTACGTTATTGCGACTGGCCGTCGCTCTACAACGTCGTGACTG 3'). The underlined residues are complementary and create a duplex region of the molecule. After annealing, the products were subjected to electrophoresis on an 8% nondenaturing polyacrylamide gel, and the forked substrate was purified by electroelution and ethanol precipitation. Reactions containing varying amounts (1-8 pmol) of the UL5·UL52 subcomplex (wild type or mutant) were allowed to proceed for 30 min at 37 °C and were analyzed as described previously (14).

Direct Primase Assay-- RNA primer synthesis reactions (25 µl) were performed as described previously using 1 pmol (molecules) of a 50-base DNA oligonucleotide template containing a preferred primase initiation site and various amounts (1 and 2 pmol) of wild type or mutant protein (14).

Gel Mobility Shift Assay

Gel mobility shift assays were essentially performed as described previously (14). The reaction mixture (25 µl) contained 20 mM Na+ HEPES, pH 7.6, 1 mM DTT, 0.1 mg/ml bovine serum albumin, 10% glycerol, 1 mM EDTA, 1 pmol (molecules) of the forked DNA substrate labeled at its 5' end with [gamma -32P]ATP, and 4 pmol of the UL5·UL52 subcomplex (wild type or mutant) with or without 12 pmol of the UL8 protein. The reaction was allowed to proceed for 10 min on ice and was terminated by the addition of 0.1 volume of stop solution (80% glycerol, 0.1% bromphenol blue). Reaction products were analyzed on a 4% nondenaturing acrylamide, 0.11% Bis-gel at 150 V at 4 °C. The gel was dried and exposed to film at -70 °C.

Transient Complementation Assay

The transient complementation assay was performed as described previously (44). Freshly trypsinized exponentially growing Vero cells (1 × 106) were transfected in solution with 8 µg of either pF1'-CMV, pF1'-UL52, or pF1'-UL52(CC3,4AA). At 24 h post-transfection, the cells were superinfected with hr114 at a multiplicity of infection of 3 pfu per cell. At 16 h post-infection at 34 °C, progeny viruses were harvested and titered on the complementing BL-1 cell line.

Transfection and Immunoblot

Vero cells (1 × 106) were transfected as described above and superinfected with hr114 at a multiplicity of infection of 10 pfu per cell at 24 h post-transfection. At 16 h post-infection at 34 °C, the cells were collected by centrifugation at 2000 rpm for 10 min in a Beckman TJ-6 centrifuge. For infection, 1.5 × 10 6 Vero cells in 60-mm plates were infected with KOS or with hr114 at a multiplicity of infection of 10 pfu per cell. Cell pellets were rinsed with PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4·7H2O, 1.4 mM KH2PO4, pH 7.3) and resuspended in 50 µl of sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) loading buffer (50 mM Tris-HCl, pH 6.8, 5% beta -mercaptoethanol, 2% SDS, 0.1% bromphenol blue, 10% glycerol). The samples were analyzed by 8% SDS-PAGE, and proteins were blotted onto ECL nitrocellulose membrane (Amersham Corp., Buckinghamshire, UK). ECL (enhanced chemiluminescence) Western blotting analysis was performed according to the manufacturer's (Amersham Pharmacia Biotech) instructions. An antibody detected against the C-terminal 10 amino acids of UL52, 1248 (generously provided by Dr. Mark Challberg) was used as primary antibody at a dilution of 1:250.

Photo Cross-linking

A photo cross-linking experiment was performed with oligo(dT)18 in which the 5th thymidine residue from the 5' end was substituted with 5-iododeoxyuridine; the substituted oligo was labeled at its 5' end with [gamma -32P]ATP. A 4-pmol aliquot of UL5·UL52 subcomplex (wild type or mutant) was incubated with 1.0 pmol of the labeled substituted oligo in 20 mM Na+ HEPES, pH 7.6, 1 mM DTT, 0.1 mg/ml bovine serum albumin, 10% glycerol, and 1 mM EDTA for 10 min on ice before irradiation. An IK series He-Cd laser (IK 3302R-E, KIMMON, Kimmon Electric Co., Ltd.) was used to achieve monochromatic 325 nm light. The laser beam output was 34 milliwatts measured with a power meter, Mentor MA10, Scientech® (Scientech, Inc., Boulder, CO). Sample volumes of 200 µl were irradiated in a methacrylate cuvette (Fisher brand, catalog number 14-385-938) at room temperature. At different time points 40-µl aliquots were withdrawn, boiled for 5 min in SDS-PAGE loading buffer, and subjected to SDS-PAGE on an 8% gel. The gels were dried and exposed to film at -70 °C.

    RESULTS

Site-directed Mutagenesis of the Zinc Finger Motif of UL52-- Site-directed mutagenesis was used to explore the functional significance of the putative zinc finger region of the UL52 protein. The sequence of the HSV-1 UL52 gene product was compared with its homologs from 10 other herpesviruses, and a putative zinc finger was identified beginning at Cys988 (Cys-X4-His-X29-Cys-X4-Cys). Three cysteine residues, Cys988, Cys1023, and Cys1028 within this region are totally conserved among all UL52 homologs and are designated as C1, C3, and C4, respectively (Fig. 1). Histidine 993 (designated as H2) was also conserved in 9 out of 10 UL52 homologs. A similar potential metal-binding site was also highly conserved in DNA primases of bacteriophages, other eukaryotic viruses, prokaryotes, and eukaryotes (31, 32). Sequence-specific recognition of DNA by proteins containing this type of zinc binding motif has been studied in many systems (33-37). In this study, the third and fourth cysteine residues of the zinc finger motif (C3 and C4) were substituted with alanine residues. The mutant gene was cloned into an amplicon expression vector under the control of the CMV promoter [pF1'-UL52(CC3,4AA)]. To analyze the ability of the UL52 mutant to support DNA synthesis, Vero cells were transfected with pF1'-UL52(CC3,4AA) and subsequently superinfected with the UL52 mutant virus, hr114. After 16 h of infection the supernatant was titered for virus production on the permissive BL-1 cell line. The wild type plasmid, pF1'-UL52, complemented hr114 very efficiently (complementation index of 256, Table I). The mutant construct, however, was unable to support the growth of the UL52 insertion mutant (complementation index less than 1, Table I). Vero cells were transfected with wild type and mutant constructs, and cell lysates were examined by Western blot analysis to determine steady state levels of the UL52 protein. Although the polyclonal antibody used to detect the UL52 peptide cross-reacts with many proteins in mock-infected cell extracts, it is clear that a band corresponding to UL52 is present in cells transfected with plasmids expressing wild type and mutant proteins but absent in cells transfected with vector alone (Fig. 2, compare lanes 2 and 3 with lane 1). Furthermore, the UL52 band is present in Vero cells infected with KOS but not in cells mock-infected or infected with the null virus hr114 (Fig. 2, compare lane 5 with lanes 4 and 6). We conclude that cells transfected with plasmid expressing the mutant version of UL52 (pF1'-UL52(CC3,4AA) are able to express full-length UL52 protein at wild type levels. This result indicates that the mutant protein did not exhibit any gross conformational changes that affected the stability of the protein in Vero cells.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Alignment of the conserved putative zinc finger motif among herpesviruses. The HSV-1 UL52 primase and its homologs in 10 other alpha -herpesviruses are shown. The sequence alignment was performed using PILEUP, a component of the GCG program (Wisconsin Package version 9.1, Genetics Computer Group, Madison, WI). Consensus regions were generated with the PRETTY program. Targeted amino acids are indicated in boldface. The bottom two lines show the position and numbering of invariant CHCC residues and the amino acid substitutions in the mutant CC3,4AA. Abbreviations are as follows: HSV1, herpes simplex virus type 1; HSV2, herpes simplex virus type 2; EBV, Ebstein-Barr virus; HHV6, human herpesvirus type 6; HHV7, human herpesvirus type 7; VZV, Varicella-Zoster virus; MCMV, murine cytomegalovirus; HVS, Herpesvirus saimiri; HCMV, human cytomegalovirus; EHV, equine herpesvirus type 1; BHV, bovine herpesvirus type 1.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Transient complementation assay
Vero cells were transfected with pF1'CMV, pF1'-UL52, or pF1'-UL52(CC3,4AA) and superinfected with UL52 mutant virus, hr114. The progeny of the transfected cells were assayed on permissive BL-1 cells. The results represent the average of three independent experiments. The complementation index is measured as pfu of hr114 from cultures transfected with the indicated plasmid/pfu from cultures transfected with vector alone, pF1'CMV.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2.   Detection of UL52 by transient transfection assay. Vero cells were transfected with plasmids pF1'-CMV, pF1'-UL52, or pF1'-UL52(CC3,4AA) and superinfected with UL52 mutant virus. Cells were harvested at 16 h post-infection, lysed in 1× SDS-PAGE loading buffer, and subjected to electrophoresis in an 8% SDS-polyacrylamide gel. Following electrophoresis, proteins were transferred onto nitrocellulose, and UL52 was detected with polyclonal antibody 1248. Lanes 1-3 represent extracts from transfected cells, and lanes 4-6 represent infected cell extracts.

Generation of Recombinant Baculovirus and Purification of Both Wild Type and Mutant UL5·UL52 Subcomplexes-- To examine the contribution of Cys1023 and Cys1028 in the putative zinc finger motif of UL52 toward the biochemical activities of the UL5·UL52 subcomplex in vitro, a recombinant baculovirus containing the UL52(CC3,4AA) gene was constructed [AcUL52(CC3,4AA)]. Sf9 cells infected with AcUL52(CC3,4AA) expressed full-length UL52 that reacted with the mono-specific polyclonal antibody (1248) in a Western blot (data not shown). A subcomplex consisting of wild type UL5 and mutant UL52 was obtained by infecting Sf9 cells with the appropriate recombinant baculoviruses, and the subcomplex was purified to approximately 80% homogeneity (Fig. 3, lane 2). The same purification scheme was used to purify the wild type UL5·UL52 subcomplex and resulted in approximately 95% homogeneity (Fig. 3, lane 1). The ability of the mutant UL52 to copurify with UL5 indicates that the mutant protein is still able to interact with UL5 and suggests that no gross alterations in conformation have occurred. The purification scheme, however, resulted in a lower level of purity for mutant as compared with wild type subcomplex, indicating that the mutant protein may tend to aggregate more than the wild type version.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   Purified UL5·UL52 subcomplexes from insect cells infected with recombinant baculoviruses carrying wild type UL5 and either wild type or mutant versions of UL52. An aliquot (3 µg) of purified wild type or mutant UL5·UL52 subcomplex was subjected to electrophoresis by 8% SDS-PAGE and subsequently stained with Coomassie Blue.

The Zinc Finger Mutation Abolishes Helicase Activity of the UL5·UL52 Subcomplex-- Mutations in the conserved DXD primase motif of UL52 were shown to abolish primase but not ATPase or helicase activities of the heterotrimeric complex in vitro (15, 16). Although this result indicated that primase activity was likely specified at least in part by the UL52 subunit itself, it remained a possibility that UL52 also contributes to the helicase activity of the helicase-primase complex. In order to address this question, the zinc finger mutant was assayed for its ability to displace a short strand of DNA from a forked substrate. Various concentrations of wild type and mutant proteins were incubated with the 32P-labeled forked substrate in the presence of ATP and MgCl2, and the reaction products were analyzed by native gel electrophoresis. Fig. 4 indicates that helicase activity was present in all four protein concentrations of wild type UL5·UL52 subcomplex, but no strand displacement was observed in reactions containing the mutant complex. Thus, surprisingly, the CC3,4AA mutation in the zinc finger motif abolished helicase activity. This result suggests that UL52 may contribute an activity that is essential for helicase function.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4.   The CC3,4AA mutation in the putative zinc finger motif abolishes the ability of UL5·UL52 to unwind a forked DNA substrate. DNA helicase assays were performed using varying amounts (1-8 pmol) of the UL5·UL52 subcomplex (wild type and mutant) and 0.64 pmol (molecules) of the radiolabeled forked helicase substrate; reaction products were analyzed by 8% native polyacrylamide gel electrophoresis as described under "Experimental Procedures." Lane 1 contained no enzyme. Lanes 2-9 show reactions catalyzed by different concentrations of protein (wild type and mutant). Lane 10 shows a sample of the substrate which was boiled for 5 min to separate the DNA strands before loading.

The Intrinsic and ssDNA-dependent ATPase Activity of the Mutant Subcomplex Is Severely Compromised-- The HSV-1 helicase-primase possesses both intrinsic and ssDNA-dependent ATPase activity (2, 8, 9). In order to test the role of the zinc finger motif of UL52 in ATP hydrolysis, ATPase activity of UL5·UL52(CC3,4AA) was compared with the wild type subcomplex both in the presence and absence of ssM13mp18 DNA (Fig. 5 and Table II). ATP hydrolysis followed a linear time course up to 40 min under these assay conditions for both wild type and mutant UL5·UL52 subcomplexes. The mutant protein was severely compromised in both intrinsic and ssDNA-dependent ATPase activities, exhibiting a 7.8-fold decrease in turnover rate (Kcat) for DNA-independent ATPase activity and an 11.6-fold decrease in Kcat for ssDNA-dependent ATPase activity as compared with wild type. The severity of this defect was unexpected and suggests that UL52 contributes to the ATPase activity of the complex. Whether the zinc finger mutation has affected the conformation of the subcomplex in a way that severely affects the hydrolysis of ATP or whether the zinc finger itself is required for some aspect of the hydrolysis reaction remains to be determined. In order to determine whether the mutation has affected binding of ATP and DNA to the subcomplex, the Km values for ssDNA and ATP were also determined for wild type and mutant helicase-primase subcomplexes (Table II). The values for Km (DNA and ATP) are not significantly different for the wild type and mutant proteins and are consistent with the previously reported values (43, 45, 46); the UL5·UL52(CC3,4AA) subcomplex showed a 1.3-fold increase in the values for Km for ssM13mp18 DNA and 1.1-fold increase in the Km for ATP. This result indicates that the ability to bind ATP and ssDNA as measured in the ATPase assay is not compromised in the mutant subcomplex containing a zinc finger mutation.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Time course of ssDNA-dependent and -independent ATP hydrolysis by the wild type and mutant UL5·UL52 subcomplex. ATPase assays were carried out in the presence or the absence of saturating levels of ssM13mp18 DNA (0.1 mM nucleotides), ATP (5 mM), and MgCl2 (5 mM) as described under "Experimental Procedures." The open squares represent the reaction catalyzed by 0.45 pmol of wild type UL5·UL52 subcomplex in the presence of DNA. The open diamonds represent the reaction catalyzed by 4 pmol of the wild type UL5·UL52 subcomplex in the absence of DNA. The open circles represent the reaction catalyzed by 0.9 pmol of mutant UL5·UL52 subcomplex in presence of DNA, and the open triangles represent the reaction catalyzed by 4 pmol of mutant UL5·UL52 subcomplex in the absence of DNA. The values represent the mean of three independent experiments.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Kinetic parameters for ssDNA-dependent and DNA-independent ATP hydrolysis for wild type and mutant UL5 · UL52 subcomplex
ATPase reactions were performed at 37 °C for 30 min as described under "Experimental Procedures." Km values were calculated from assays using a fixed concentration of one substrate (5 mM ATP and 5 mM MgCl2 or 0.1 mM ssM13mp 18 DNA in nucleotides) and varying the concentration of the other substrate. Each value represents the average of three independent experiments.

The Zinc Finger Mutation Abolishes Primase Activity-- To determine if the putative zinc finger motif is required for primase activity, both the wild type and the mutant UL5·UL52 subcomplexes were assayed for primer synthesis using a template containing a preferred primase initiation site mapped from pBS plasmid DNA (14, 43). As shown in Fig. 6, wild type can synthesize short (8-9 nucleotide) primers in the absence of the UL8 protein, but no primer synthesis was detected for the mutant protein complex.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6.   Comparison of the abilities of UL5·UL52 and UL5·UL52(CC3,4AA) to carry out RNA primer synthesis. RNA primase activity on a preferred primase initiation site template catalyzed by wild type and mutant UL5·UL52 subcomplex was measured as described under "Experimental Procedures" and analyzed by electrophoresis on a 18% urea gel. Lane 1 represents the reaction in absence of enzyme. Lanes 2 and 3 represent reactions containing 1 and 2 pmol of wild type enzyme, respectively. Lanes 4 and 5 represent reactions containing 1 and 2 pmol of mutant protein, respectively.

The Zinc Finger Mutant Binds to a Forked Helicase Substrate and Can Interact with UL8-- One possible explanation for the lack of DNA helicase and primase activities of the mutant subcomplex is that this mutation alters binding to DNA. The ability of the mutant and wild type UL5·UL52 subcomplexes to bind to the forked helicase substrate was tested using a gel mobility shift assay (Fig. 7). The wild type UL5·UL52 subcomplex can efficiently shift the substrate as previously reported (Fig. 7, lane 3) (14). Furthermore, as seen previously, addition of UL8 to the binding reaction resulted in a supershift to a slower migrating species (Fig. 7, lane 4). The mutant UL5·UL52 subcomplex was also able to shift the forked substrate but with much lower efficiency (8.3% of wild type levels, Fig. 7, lane 5). Addition of UL8 resulted in the disappearance of the UL5·UL52 shifted species and the appearance of a faint diffused supershifted band (Fig. 7, lane 6). A darker exposure of lanes 5 and 6 is shown in lanes 7 and 8, respectively. The disappearance of the UL5·UL52 shifted species in the presence of UL8 suggests that the interaction of the UL5·UL52 subcomplex with UL8 has not been compromised.


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 7.   The CC3,4AA mutation reduces the ability of the UL5·UL52 subcomplex to gel shift the forked DNA substrate. DNA gel shift reactions were performed using 1 pmol of the radiolabeled forked DNA substrate, 4 pmol of the UL5·UL52 subcomplex (wild type or mutant) in the presence or absence of 12 pmol of the UL8 protein. The samples were incubated for 10 min on ice and analyzed by 4% nondenaturing polyacrylamide gel electrophoresis as described under "Experimental Procedures." Lane 1 represents the reaction in absence of any protein. Lane 2 shows the reaction that contained only the UL8 protein. Lanes 3 and 4 represent reactions that contained the wild type UL5·UL52 subcomplex alone and in the presence of UL8, respectively. Lanes 5 and 6 represent similar reactions that contained mutant UL5·UL52 subcomplexes alone and in the presence of UL8, respectively. Lanes 7 and 8 represent a darker exposure of lanes 5 and 6, respectively.

Both UL5 and UL52 Subunits of Wild Type Helicase-Primase Complex Can be Efficiently Cross-linked to a Short DNA Oligonucleotide-- The DNA-binding sites within helicase-primase complex have not been mapped. The previous methods for analyzing protein-DNA interactions such as filter binding and gel shift experiments have not been able to determine whether UL5 or UL52 or both subunits contact DNA. In order to test the contribution of individual subunits in DNA binding, a photo cross-linking assay was performed using a 5-iododeoxyuridine-substituted oligonucleotide and a He-Cd laser as a light source. In previous studies, substituted oligonucleotides have been cross-linked to associated proteins using UV-mediated cross-linking (47-49); however, UV light sources (which emit 254 nm light) result in inefficient cross-linking and considerable degradation of both protein and nucleic acid. More recent studies show that higher yields of protein cross-linked to DNA or RNA can be obtained using higher wave lengths of light (308-325 nm) which result in much less degradation of both protein and nucleic acid (50, 51). In this study a He-Cd light source that emits at 325 nm was used to photo cross-link the UL5·UL52 subcomplex to a 32P-end-labeled 18-mer oligo(dT) molecule in which 5-iododeoxyuridine was substituted for one of the thymidine residues. Wild type and mutant subcomplexes were irradiated at room temperature for various periods with the He-Cd laser. SDS-PAGE and subsequent autoradiography of the wild type subcomplex revealed two major bands that migrate at positions that correspond to UL5 and UL52 (Fig. 8, lanes 1-5). The identity of these two major bands as UL5 and UL52 was confirmed by Western blot analysis (data not shown). At the 2-, 4-, and 10-min time points, the intensity of the UL52 band was stronger (2-2.5 fold) than that of the UL5 band; however, by 60 min, the intensities of the two labeled bands were almost similar. The mutant UL5·UL52 subcomplex exhibited very little cross-linking to either full-length UL5 or UL52 (Fig. 8, lanes 6-10). Both wild type and mutant subcomplexes were subjected to SDS-PAGE and Coomassie staining after cross-linking to confirm that equivalent amounts of proteins in the subcomplexes were present in both preparations (data not shown). Quantification of counts cross-linked to full-length UL5 and UL52 for both mutant and wild type is shown in Fig. 9, A and B, respectively. In the wild type subcomplex, cross-linking to UL52 appeared to be slightly more efficient than to UL5. The total number of counts cross-linked to both UL5 and UL52 in the mutant subcomplex was only 2% of wild type levels. In this case, however, the number of counts cross-linked to UL5 was higher than to UL52. This suggests that binding to UL52 was more severely compromised than binding to UL5, although both were severely affected.


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 8.   SDS-PAGE analysis of the cross-linked UL5·UL52 subcomplex. Cross-linking reactions were carried out in a methacrylate cuvette (light path 10 mm) at room temperature with an He-Cd laser emitting 34 milliwatts at 325 nm. Samples were removed after 0, 2, 4, 10, and 60 min of irradiation (lanes 1-5, respectively, for wild type protein; lanes 6-10, respectively, for mutant protein), boiled for 5 min in 1× SDS-PAGE loading buffer, and subjected to electrophoresis on a 8% SDS-PAGE gel which was then dried and exposed overnight at -70 °C.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 9.   Quantification of cross-linking data. Data from the Fig. 8 quantified using a PhosphorImager, and the total counts were plotted against the time of irradiation. Panel A shows the wild type subcomplex (UL5, triangle  and UL52, ); panel B shows the mutant subcomplex (UL5, triangle  and UL52, ).

In addition to the two major bands corresponding to UL5 and UL52, both wild type and mutant preparations contained labeled bands that migrated faster than full-length UL5 and UL52. In the case of wild type, a band of 47 kDa was seen at the 60-min time point (Fig. 8, lane 5), and in the mutant preparation, predominant bands corresponding to 47 and 60 kDa were observed at all time points (Fig. 8, lanes 7-10). These smaller bands may represent degradation product of UL5 or UL52; however, these forms do not react with several different polyclonal and monoclonal UL5 and UL52 antibodies.2 Alternatively, it is possible that the mutant preparation contains one or more contaminating proteins that can cross-link to DNA very efficiently; as mentioned above, the purity of the mutant preparation is lower than that of wild type.

In summary, we have developed a cross-linking assay that indicates that both UL5 and UL52 can contact DNA. The mutant subcomplex is severely compromised in the ability of both UL52 and UL5 to bind to DNA. These results will be discussed further below.

    DISCUSSION

In this report the putative zinc binding domain (Cys988-X4-His993-X29-Cys1023-X4-Cys1028) of the UL52 subunit was analyzed by site-directed mutagenesis. Several observations have been made. 1) The replacement of Cys1023 and Cys1028 with alanine residues completely abolished the growth of UL52 mutant virus in a transient complementation assay, suggesting that this motif is important for the growth of the virus. 2) Biochemical analysis of a purified UL5·UL52 subcomplex expressed in insect cells infected with recombinant baculoviruses revealed several defects: the mutant subcomplex fails to exhibit helicase and primase activities and only retains about 9% wild type levels of ssDNA-dependent ATPase activity. 3) Overall DNA binding activity as measured by gel mobility shift analysis also indicates that the UL5·UL52 subcomplex is severely compromised (8.3% of wild type levels). 4) A newly developed photo cross-linking assay demonstrates that both UL5 and UL52 can be cross-linked to an 18-mer of oligo(dT) indicating that both subunits in the wild type subcomplex can contact DNA. In the wild type preparation, UL52 can be cross-linked slightly more efficiently than UL5. 5) Both subunits of the mutant UL5·UL52 subcomplex exhibit significant defects in their ability to bind DNA (total cross-linking at 2% of wild type levels), and UL52 binding is decreased even more than UL5 binding.

Previous reports indicated that the DXD motif in UL52 (located between residues 610 and 636), which is also found in other primases, is probably required for the catalytic activity of the primase (15, 16). Until this report, no other important regions of the UL52 protein had been identified experimentally. We have replaced two invariant cysteine residues in a putative zinc binding region of UL52, and our results indicate that amino acids 1023 and 1028 are indeed important for UL52 function. It is possible that by mutating these two amino acids, changes in the overall conformation of UL52 have occurred that result in the observed defects in the UL5·UL52 subcomplex. However, several observations suggest that gross conformational changes have not occurred. 1) The mutant UL52 can be detected in transfected Vero cells at wild type levels suggesting that no gross alterations in stability have occurred. 2) The mutant subcomplex still copurifies from insect cells infected with recombinant baculoviruses expressing wild type UL5 and mutant UL52, indicating that mutant UL52 can still interact with UL5. 3) The purified UL5·UL52 subcomplex containing the mutant version of the UL52 gene can still interact with UL8 as detected in the gel mobility shift assay; this may indicate that the C terminus of UL52 is not necessary for its interaction with either UL5 or UL8. 4) The purified mutant UL5·UL52 complex exhibits similar Km values for ATP and ssDNA for ATP hydrolysis, indicating that the binding of these cofactors is not altered with respect to the ATPase assay. This result may seem contradictory to the observation that DNA binding of the subcomplex as determined by gel shift and photo cross-linking assays is severely compromised. This apparent discrepancy may be due to different substrates used in each assay. The gel shift assays were performed using a 48-mer synthetic forked substrate, and cross-linking assays were carried out using an 18-mer oligo(dT) substrate, whereas the kinetic parameters were determined using m13mp18 single-stranded DNA. It has been reported that the kinetic parameters of the ATPase activity of the UL5·UL52 subcomplex are affected by the length of the oligonucleotide coeffector (52). It is also possible that other differences in the assay conditions such as the presence or absence of ATP may affect the DNA-binding properties of the mutant protein subcomplex. In any case, our results taken together suggest that it is unlikely that the overall conformation of the protein is significantly altered by these amino acid substitutions. However, it is possible that subtle conformational changes have occurred especially within the putative zinc finger domain itself. In fact, since other similar zinc fingers whose structures are known have been shown to fold into discrete domains capable of binding zinc and DNA (33, 53-56), it is possible that the mutation in UL52 results in a local alteration of conformation in the C terminus of UL52 which does not affect its global conformation and that this alteration in the C terminus is responsible for the observed changes in activity. Further experiments will be needed to clarify these points. At this point, we can only say that the alteration of two C-terminal cysteine residues of UL52 has profound effects on the function of the UL5·UL52 subcomplex. Interestingly, in the case of the T7 helicase-primase encoded by the T7 gene 4, a mutation in the zinc motif of the primase has been shown to affect both primase and helicase activities (32). In that example, however, the mutant helicase-primase exhibits wild type levels of nucleotide hydrolysis activity.

The precise mechanism of helicase action is not known in detail, but it can be imagined that the entire process requires the coupling of subreactions such as ATP binding, ATP hydrolysis, single- and double-stranded DNA binding, translocation along DNA, and coupling between ATP hydrolysis and DNA unwinding. ATP binding and hydrolysis are an intrinsic property of all DNA and RNA helicases, and the UL5 protein contains the conserved Walker A and Walker B motifs that are found in ATP-binding proteins (57). Our observation that a mutation in the putative zinc binding region of UL52 exhibited severe defects in both intrinsic and ssDNA-dependent ATPase activities was therefore unexpected. Although UL5 and UL52 have been considered as the helicase and primase subunits of the complex, respectively, our results indicate that the UL52 subunit may be required for optimal ATPase activity. It is possible that the subcomplex that forms in the presence of the mutant UL52 protein exhibits subtle conformational changes that directly affect ATPase activity. Alternatively, the putative zinc binding region of UL52 may contribute amino acid residues that play a direct role in ATPase catalysis or, as discussed below, the putative zinc binding region may be involved in DNA binding that is required for optimal ATPase activity.

The DNA binding domains on the UL5·UL52·UL8 helicase-primase have not been mapped. The UL5 subunit itself may contain all the DNA binding regions required for helicase activity, and the UL52 subunit would be expected to specify its own DNA binding region for primase activity. However, it remains a possibility that UL52 contributes a DNA-binding site to the unwinding process. Previous attempts to map the DNA binding domains in UL5 were frustrating because of our inability to distinguish between the individual contributions of the two subunits toward DNA binding. By analogy with other superfamily helicases, especially those for which structural information is available (58), it was anticipated that some of the conserved motifs of UL5 (especially motif IA, motif III, and motif V) may be involved in contacting DNA. However, mutations in these motifs were still able to gel-shift a forked substrate at wild type or higher levels (14). The gel mobility shift assay, however, measures total subcomplex binding, and it seemed likely that binding by UL52 may mask any defect in binding by UL5. Therefore, a photo cross-linking assay was developed that can distinguish the individual contributions toward DNA binding. In this study we have shown that both UL5 and UL52 subunits of the helicase-primase complex can bind DNA. Furthermore, we have shown that the mutant protein subcomplex is defective in both UL52 and UL5 binding. The defect in UL52 binding is consistent with the observation that a similar zinc binding motif in the T7 DNA primase is involved in template recognition (32). The defect in UL5 binding was unexpected however. One explanation for these results is that the mutation in the putative zinc binding domain affects the DNA-binding properties of UL52 which in turn affects the DNA-binding properties of the UL5 component of the UL5·UL52 complex. Alternatively, it is possible that both subunits together form a DNA-binding site and that binding to both subunits are required for optimal DNA binding of the complex.

In summary, we have demonstrated that the conserved cysteine residues (Cys1023 and Cys1028) in the putative zinc finger motif of UL52 are essential for its biological activity. We show that the overall DNA-binding properties of the mutant protein as measured by gel mobility shift and photo cross-linking are severely compromised. The simplest explanation for our results is that the lack of helicase and primase activities in the mutant protein is the consequence of reduced affinity of the UL52 subunit for DNA. Thus the putative zinc finger motif of UL52 may be important not only for the DNA-binding property of the primase subunit but also for the complex as a whole. In any case, the results reported in this paper suggest that it would be unwise to assign helicase function to the UL5 subunit and primase function to the UL52 subunit; it is clear that we must consider these two polypeptides together and that they have a more complex relationship than was originally anticipated.

    ACKNOWLEDGEMENTS

We thank the members of our laboratory and Dr. Mark Challberg (National Institutes of Health) for helpful discussions on this manuscript. We also thank Dr. Karen A LeCuyer in the Department of Biochemistry, University of Connecticut Health Center, for help with photo cross-linking and for helpful comments in the preparation of this manuscript. We thank Dr. Karen Graves-Woodword for providing purified UL8 protein.

    FOOTNOTES

* This investigation was supported by Public Health Service Grant A121747.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 860-679-2310; Fax: 860-679-1239; E-mail: Weller{at}nso2.uchc.edu.

2 N. Biswas and S. K. Weller, unpublished data.

    ABBREVIATIONS

The abbreviations used are: HSV, herpes simplex virus; PAGE, polyacrylamide gel electrophoresis; CMV, cytomegalovirus; ss, single-stranded; DTT, dithiothreitol; pfu, plaque-forming units; kb, kilobase pairs.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
REFERENCES
  1. Crute, J. J., Mocarski, E. S., and Lehman, I. R. (1988) Nucleic Acids Res. 16, 6585-6596[Abstract/Free Full Text]
  2. Crute, J. J., Tsurumi, T., Zhu, L., Weller, S. K., Olivo, P. D., Challberg, M. D., Mocarski, E. S., and Lehman, I. R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 2186-2189[Abstract/Free Full Text]
  3. Weller, S. K. (1990) in Herpesvirus Transcription and Its Regulation (Wagner, E., ed), pp. 105-135, CRC Press, Inc., Boca Raton, FL
  4. Olivo, P. D., and Challberg, M. D. (1990) in Herpesvirus Transcription and Its Regulation (Wagner, E., ed), CRC Press, Inc., Boca Raton, FL
  5. Carmichael, E. P., and Weller, S. K. (1989) J. Virol. 63, 591-599[Abstract/Free Full Text]
  6. Goldstein, D. J., and Weller, S. K. (1988) J. Virol. 62, 2970-2977[Abstract/Free Full Text]
  7. Zhu, L., and Weller, S. K. (1992) J. Virol. 66, 458-468[Abstract/Free Full Text]
  8. Dodson, M. S., Crute, J. J., Bruckner, R. C., and Lehman, I. R. (1989) J. Biol. Chem. 264, 20835-20838[Abstract/Free Full Text]
  9. Calder, J. M., and Stow, N. D. (1990) Nucleic Acids Res. 18, 3573-3578[Abstract/Free Full Text]
  10. Crute, J. J., and Lehman, I. R. (1991) J. Biol. Chem. 266, 4484-4488[Abstract/Free Full Text]
  11. Dodson, M. S., and Lehman, I. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1105-1109[Abstract/Free Full Text]
  12. Gorbalenya, A. E., and Koonin, E. V. (1993) Curr. Opin. Struct. Biol. 3, 419-429
  13. Zhu, L., and Weller, S. K. (1992) J. Virol. 66, 469-479[Abstract/Free Full Text]
  14. Graves-Woodward, K. L., Gottlieb, J., Challberg, M. D., and Weller, S. K. (1997) J. Biol. Chem. 272, 4623-4630[Abstract/Free Full Text]
  15. Klinedinst, D. K., and Challberg, M. D. (1994) J. Virol. 68, 3693-3701[Abstract/Free Full Text]
  16. Dracheva, S., Koonin, E. V., and Crute, J. J. (1995) J. Biol. Chem. 270, 14148-14153[Abstract/Free Full Text]
  17. Gac, N. T. L., Villani, G., Hoffmann, J. S., and Boehmer, P. E. (1996) J. Biol. Chem. 271, 21645-21651[Abstract/Free Full Text]
  18. Sherman, G., Gottlieb, J., and Challberg, M. D. (1992) J. Virol. 66, 4884-4892[Abstract/Free Full Text]
  19. Tenney, D. J., Hurlburt, W. W., Micheletti, P. A., Bifano, M., and Hamatake, R. K. (1994) J. Biol. Chem. 269, 5030-5035[Abstract/Free Full Text]
  20. Hamatake, R. K., Bifano, M., Hurlburt, W. W., and Tenney, D. J. (1997) J. Gen. Virol. 78, 857-865[Abstract]
  21. Calder, J. M., Stow, E. C., and Stow, N. D. (1992) J. Gen. Virol. 73, 531-538[Abstract/Free Full Text]
  22. Marsden, H. S., McLean, G. W., Barnard, E. C., Francis, G. J., MacEachran, K., Murphy, M., McVey, G., Cross, A., Abbotts, A. P., and Stow, N. D. (1997) J. Virol. 71, 6390-6397[Abstract]
  23. Falkenberg, M., Bushnell, D. A., Elias, P., and Lehman, I. R. (1997) J. Biol. Chem. 272, 22766-22770[Abstract/Free Full Text]
  24. Lohman, T. M. (1993) J. Biol. Chem. 268, 2269-2272[Abstract/Free Full Text]
  25. Wong, I., Chao, K. L., Bujalowski, W., and Lohman, T. M. (1992) J. Biol. Chem. 267, 7596-7610[Abstract/Free Full Text]
  26. Wong, I., and Lohman, T. M. (1992) Science 256, 350-355[Abstract/Free Full Text]
  27. Patel, S. S., and Hingorani, M. M. (1993) J. Biol. Chem. 268, 10668-10675[Abstract/Free Full Text]
  28. Dong, F., and von Hippel, P. H. (1996) J. Biol. Chem. 271, 19625-19631[Abstract/Free Full Text]
  29. Joo, W. S., Kim, H. Y., Purviance, J. D., Sreekumar, K. R., and Bullock, P. A. (1998) Mol. Cell. Biol. 18, 2677-2687[Abstract/Free Full Text]
  30. Smelkova, N. V., and Borowiec, J. A. (1997) J. Virol. 71, 8766-8773[Abstract]
  31. Ilyina, T. V., Gorbaleyna, A. E., and Koonin, E. V. (1992) J. Mol. Evol. 34, 351-357[CrossRef][Medline] [Order article via Infotrieve]
  32. Mendelman, L. V., Beauchamp, B. B., and Richardson, C. C. (1994) EMBO J. 13, 3909-3916[Medline] [Order article via Infotrieve]
  33. Pavletich, N. P., and Pabo, C. O. (1991) Science 252, 809-817[Abstract/Free Full Text]
  34. Pavletich, N. P., and Pabo, C. O. (1993) Science 261, 1701-1707[Abstract/Free Full Text]
  35. Qian, X., Gozani, S. N., Yoon, H., Jeon, C. J., Agarwal, K., and Weiss, M. A. (1993) Biochemistry 32, 9944-9959[CrossRef][Medline] [Order article via Infotrieve]
  36. Witte, M. M., and Dickson, R. C. (1988) Mol. Cell. Biol. 8, 3726-3733[Abstract/Free Full Text]
  37. Agarwal, K., Baek, K. H., Jeon, C. J., Miyamoto, K., Ueno, A., and Yoon, H. S. (1991) Biochemistry 30, 7842-7851[CrossRef][Medline] [Order article via Infotrieve]
  38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  39. Weller, S. K., Lee, K. J., Sabourin, D. J., and Schaffer, P. A. (1983) J. Virol. 45, 354-366[Abstract/Free Full Text]
  40. Lukonis, C. J., and Weller, S. K. (1997) J. Virol. 71, 2390-2399[Abstract]
  41. Hong, Z., Ferrari, E., Wright-Minogue, J., Chase, R., Risano, C., Seelig, G., Lee, C. G., and Kwong, A. D. (1996) J. Virol. 70, 4261-4268[Abstract]
  42. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1990) in Current Protocols in Molecular Biology (Janssen, K., ed), Sections 8.5.7-8.5.9, John Wiley & Sons, Inc., New York
  43. Graves-Woodward, K., and Weller, S. K. (1996) J. Biol. Chem. 271, 13629-13635[Abstract/Free Full Text]
  44. Martinez, R., Shao, L., and Weller, S. K. (1992) J. Virol. 66, 6735-6746[Abstract/Free Full Text]
  45. Crute, J. J., Bruckner, R. C., Dodson, M. S., and Lehman, I. R. (1991) J. Biol. Chem. 266, 21252-21256[Abstract/Free Full Text]
  46. Earnshaw, D. L., and Jarvest, R. L. (1994) Biochem. Biophys. Res. Commun. 199, 1333-1340[CrossRef][Medline] [Order article via Infotrieve]
  47. Ogata, R., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 4973-4976[Abstract/Free Full Text]
  48. Blatter, E. E., Ebright, Y. W., and Ebright, R. H. (1992) Nature 359, 650-265[CrossRef][Medline] [Order article via Infotrieve]
  49. Catalano, C. E., Allen, D. J., and Benkovic, S. J. (1990) Biochemistry 29, 3612-3621[CrossRef][Medline] [Order article via Infotrieve]
  50. Willis, M. C., LeCuyer, K. A., Meisenheimer, K. M., Uhlenbeck, O. C., and Koch, T. H. (1994) Nucleic Acids Res. 22, 4947-4952[Abstract/Free Full Text]
  51. Meisenheimer, K. M., Meisenheimer, P. L., Willis, M. C., and Koch, T. H. (1996) Nucleic Acids Res. 24, 981-982[Free Full Text]
  52. Healy, S., You, X., and Dodson, M. (1997) J. Biol. Chem. 272, 3411-3415[Abstract/Free Full Text]
  53. Schwabe, J. W., Neuhaus, D., and Rhodes, D. (1990) Nature 348, 458-461[CrossRef][Medline] [Order article via Infotrieve]
  54. Schwabe, J. W., and Rhodes, D. (1991) Trends Biochem. Sci. 16, 291-296[CrossRef][Medline] [Order article via Infotrieve]
  55. Klug, A., and Rhodes, D. (1987) Cold Spring Harbor Symp. Quant. Biol. 52, 473-482[Abstract/Free Full Text]
  56. Rhodes, D., and Klug, A. (1993) Sci. Am. 268, 56-65
  57. Walker, J. E., Saraste, M., Runswick, M. J., and Gay, N. J. (1982) EMBO J. 1, 945-951[Medline] [Order article via Infotrieve]
  58. Korolev, S., Hsieh, J., Gauss, G. H., Lohman, T. M., and Waksman, G. (1997) Cell 90, 635-647[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
N. A. Cavanaugh and R. D. Kuchta
Initiation of New DNA Strands by the Herpes Simplex Virus-1 Primase-Helicase Complex and Either Herpes DNA Polymerase or Human DNA Polymerase {alpha}
J. Biol. Chem., January 16, 2009; 284(3): 1523 - 1532.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Sompallae, S. Gastaldello, S. Hildebrand, N. Zinin, G. Hassink, K. Lindsten, J. Haas, B. Persson, and M. G. Masucci
Epstein-Barr Virus Encodes Three Bona Fide Ubiquitin-Specific Proteases
J. Virol., November 1, 2008; 82(21): 10477 - 10486.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Chen, C. M. Livingston, S. D. Carrington-Lawrence, P. Bai, and S. K. Weller
A Mutation in the Human Herpes Simplex Virus Type 1 UL52 Zinc Finger Motif Results in Defective Primase Activity but Can Recruit Viral Polymerase and Support Viral Replication Efficiently
J. Virol., August 15, 2007; 81(16): 8742 - 8751.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Slanina, S. Weger, N. D. Stow, A. Kuhrs, and R. Heilbronn
Role of the Herpes Simplex Virus Helicase-Primase Complex during Adeno-Associated Virus DNA Replication.
J. Virol., June 1, 2006; 80(11): 5241 - 5250.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Chen, S. D. Carrington-Lawrence, P. Bai, and S. K. Weller
Mutations in the Putative Zinc-Binding Motif of UL52 Demonstrate a Complex Interdependence between the UL5 and UL52 Subunits of the Human Herpes Simplex Virus Type 1 Helicase/Primase Complex
J. Virol., July 15, 2005; 79(14): 9088 - 9096.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Seybert, C. C. Posthuma, L. C. van Dinten, E. J. Snijder, A. E. Gorbalenya, and J. Ziebuhr
A Complex Zinc Finger Controls the Enzymatic Activities of Nidovirus Helicases
J. Virol., January 15, 2005; 79(2): 696 - 704.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. H. Stracker, G. D. Cassell, P. Ward, Y.-M. Loo, B. van Breukelen, S. D. Carrington-Lawrence, R. K. Hamatake, P. C. van der Vliet, S. K. Weller, T. Melendy, et al.
The Rep Protein of Adeno-Associated Virus Type 2 Interacts with Single-Stranded DNA-Binding Proteins That Enhance Viral Replication
J. Virol., January 1, 2004; 78(1): 441 - 453.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. D. Carrington-Lawrence and S. K. Weller
Recruitment of Polymerase to Herpes Simplex Virus Type 1 Replication Foci in Cells Expressing Mutant Primase (UL52) Proteins
J. Virol., April 1, 2003; 77(7): 4237 - 4247.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. M. Carastro, C.-K. Tan, M. Selg, H.-M. Jack, A. G. So, and K. M. Downey
Identification of delta helicase as the bovine homolog of HUPF1: demonstration of an interaction with the third subunit of DNA polymerase delta
Nucleic Acids Res., May 15, 2002; 30(10): 2232 - 2243.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Sampson, M. E. Arana, and P. E. Boehmer
Cysteine 111 Affects Coupling of Single-stranded DNA Binding to ATP Hydrolysis in the Herpes Simplex Virus Type-1 Origin-binding Protein
J. Biol. Chem., January 28, 2000; 275(4): 2931 - 2937.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Biswas and S. K. Weller
The UL5 and UL52 Subunits of the Herpes Simplex Virus Type 1 Helicase-Primase Subcomplex Exhibit a Complex Interdependence for DNA Binding
J. Biol. Chem., May 11, 2001; 276(20): 17610 - 17619.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Poplawski, B. Grabowski, S. E. Long, and Z. Kelman
The Zinc Finger Domain of the Archaeal Minichromosome Maintenance Protein Is Required for Helicase Activity
J. Biol. Chem., December 21, 2001; 276(52): 49371 - 49377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Biswas, N.
Right arrow Articles by Weller, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Biswas, N.
Right arrow Articles by Weller, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement