|
J Biol Chem, Vol. 274, Issue 12, 8068-8076, March 19, 1999
A Mutation in the C-terminal Putative Zn2+ Finger
Motif of UL52 Severely Affects the Biochemical Activities of
the HSV-1 Helicase-Primase Subcomplex*
Nilima
Biswas and
Sandra K.
Weller
From the Department of Microbiology, University of Connecticut
Health Center, Farmington, Connecticut 06030
 |
ABSTRACT |
Herpes simplex virus type 1 encodes a
heterotrimeric helicase-primase complex that is composed of the
products of the UL5, UL52, and UL8
genes. A subcomplex consisting of the UL5 and UL52 proteins retains all
the enzymatic activities exhibited by the holoenzyme in
vitro. The UL52 protein contains a putative zinc finger at its C
terminus which is highly conserved among both prokaryotic and
eukaryotic primases. We constructed a mutation in which two highly
conserved cysteine residues in the zinc finger motif were replaced with
alanine residues. A UL52 expression plasmid containing the
mutation in the zinc finger region is unable to support the growth of a
UL52 mutant virus in a transient complementation assay.
Wild type and mutant UL5·UL52 subcomplexes were purified from insect
cells infected with recombinant baculoviruses. Surprisingly, the mutant
protein was severely affected in all biochemical activities tested; no
helicase or primase activities could be detected, and the mutant
protein retains only about 9% of wild type levels of single-stranded
DNA-dependent ATPase activity. Gel mobility shift assays
showed that DNA binding is severely affected as well; the mutant
subcomplex only retains approximately 8% of wild type levels of
binding to a forked substrate. On the other hand, the mutant protein
retains its ability to interact with UL5 as indicated by copurification
and with UL8 as indicated by a supershifted band in the gel mobility
shift assay. In addition, the ability of individual subunits to bind
single-stranded DNA was examined by photo cross-linking. In the wild
type UL5·UL52 subcomplex, both subunits are able to bind an 18-mer of
oligo(dT). The mutant subcomplex was severely compromised in the
ability of both UL5 and UL52 to bind the oligonucleotide; total
cross-linking was only 2% of wild type levels. These results are
consistent with the proposal that the putative zinc binding motif of
UL52 is required not only for binding of the UL52 subunit to DNA and
for primase activity but also for optimal binding of UL5 to DNA and for
the subsequent ATPase and helicase activities.
 |
INTRODUCTION |
Herpes simplex virus type 1 (HSV-1)1 encodes a
heterotrimeric DNA helicase-primase complex composed of the products of
the UL5, UL52, and UL8 genes (1, 2). All three
genes are essential for viral DNA replication (3-7). This protein
complex has been shown to possess ssDNA-dependent NTPase,
5' to 3' DNA helicase, and DNA primase activities (1, 2, 8-10). The
HSV-1 helicase-primase complex can be isolated from insect cells that
have been simultaneously infected with recombinant baculoviruses that
express each of the three subunits (8). A subassembly consisting of the
UL5 and UL52 gene products also exhibits all the enzymatic activities of the holoenzyme (11). The UL5 protein contains seven conserved motifs
found in all members of helicase Superfamily I which comprises DNA and
RNA helicases from bacteria, viruses, and eukaryotes (12). Mutations in
conserved residues in the helicase motifs have been shown to abolish
the ability of mutant UL5 to support DNA replication in vivo
(13). Furthermore, these mutations abolish helicase but not primase
activity in vitro (14). The UL52 protein contains several
conserved motifs found in other primases including a DXD motif associated with the catalytic activity in other primases (15,
16). Mutations in the DXD motif specifically abolished primase but not ATPase or helicase activities (15, 16). The UL8 gene
product has not been associated with any enzymatic activities (9, 11)
but can stimulate both the helicase and primase activities of the
helicase-primase complex (8, 17-20). UL8 may also be responsible for
mediating protein-protein interactions required at the replication fork
(20-23). Taken together, these results suggest that UL5
encodes the helicase subunit and that UL52 encodes the
primase subunit of the helicase-primase complex; however, neither UL5
nor UL52 appears to possess any of these activities when expressed and
purified alone (8, 11). Thus it is not clear whether UL52 contributes a
specific function to helicase activity or whether UL5 contributes a
function to primase activity. It is also possible that amino acid
residues from both polypeptides actually contribute to
the catalytic activities of the complex or that each polypeptide
needs the other for proper folding and conformation.
Unwinding of duplex DNA by a helicase is an essential step in many
biological processes such as DNA replication, DNA repair, recombination, and transcription. Although the precise mechanism of
unwinding is unknown for any helicase, it is clear that the unwinding
reaction requires the coupling of several simpler events such as ATP
binding, ATP hydrolysis, single strand and double strand DNA binding,
and translocation along the DNA. One model for helicase activity poses
that helicases must utilize at least two distinct DNA-binding sites
(24). It is believed that helicases achieve this by forming oligomeric
structures, either dimer, hexamer, or multiprotein complexes. The Rep
protein of Escherichia coli, also a member of Superfamily I,
is believed to form a dimer (25, 26) at the replication fork, whereas
the helicases of T4 and T7 bacteriophages (27, 28) and SV40
(29, 30) apparently form hexamers or higher order structures. The
stoichiometry of the UL5·UL52·UL8 heterotrimeric complex at the
replication fork is not known nor is it known which proteins or domains
within each protein are capable of contacting the DNA substrate. It is possible that the UL5 subunit itself contains all the DNA binding regions required for helicase activity and that the UL52 subunit has a
DNA binding region associated with primase activity. However, it is
also possible that the UL52 protein contains a DNA binding domain
required for helicase activity. In this paper we developed a photo
cross-linking assay and used it to demonstrate that both UL5 and UL52
subunits of the helicase-primase subcomplex are capable of contacting DNA.
The UL52 protein contains a putative zinc finger motif at its C
terminus that is highly conserved among herpesviruses and also other
primases such as the bacteriophage primases, mouse, and yeast primases
(31, 32). Zinc finger motifs have been implicated in sequence-specific
DNA recognition by several proteins including transcription factors
(33-37). Specifically, the zinc finger motif in the bacteriophage T7
primase has been shown to be responsible for template recognition (32).
In the present study, we performed mutational analysis of the putative
zinc finger region of UL52 to assess the role of this motif in the
DNA-binding properties of the helicase-primase complex. We found that
substitution of two highly conserved cysteine residues within the motif
with alanine abolishes the in vivo DNA replication activity
of UL52, indicating that this motif is essential in vivo.
The mutant protein subcomplex exhibits severe defects in DNA binding,
ATPase, helicase, and primase activities. These results suggest the
essential role of the putative zinc finger motif in the biochemical
activities of the helicase-primase subcomplex.
 |
EXPERIMENTAL PROCEDURES |
Reagents
Supplemented Graces's medium, 10% Pluronic®F-68 and the
Bac-to-BacTM recombinant baculovirus kit were purchased
from Life Technologies, Inc. Fetal calf serum was obtained from Atlanta
Biologicals. Penicillin/streptomycin solution, ampicillin,
phenylmethylsulfonyl fluoride, leupeptin, and pepstatin were purchased
from Sigma. The 20-ml HiLoad 16/10 SP Sepharose Fast Flow column was
from Amersham Pharmacia Biotech. The 12-ml Uno Q (Q-12) column was from
Bio-Rad. Radiolabeled nucleotides were purchased from Amersham
Pharmacia Biotech. Oligonucleotides were synthesized by Life
Technologies, Inc. The oligonucleotide substituted with 5-iodo
deoxyuridine was synthesized by Cruachem (Dulles, VA). Long
RangerTM 50% acrylamide was obtained from J. T. Baker
Inc. All restriction enzymes were purchased from New England Biolabs. A
polyclonal antibody (1248) directed against the C-terminal 10 amino
acids of UL52 was a kind gift from Dr. Mark Challberg (National
Institutes of Health, Bethesda). M13mp18 single-stranded DNA was
purified according to standard procedures (38).
Buffers
Buffer A consists of 20 mM HEPES, pH 7.6, 1.0 mM dithiothreitol (DTT), 10 mM sodium
bisulfite, 5 mM MgCl2, 0.5 mM
phenylmethylsulfonyl fluoride, 0.5 µg/ml leupeptin, 1 µg/ml
pepstatin, and 2 µg/ml aprotinin. Buffer B contains 20 mM
HEPES, pH 7.6, 1.0 mM DTT, 10% (V/V) glycerol, and 0.5 mM EDTA. All buffers were passed through a 0.22-µm filter
and degassed before use.
Cells and Viruses
Spodoptera frugiperda (Sf9) cells were
maintained at 27 °C in Graces's insect medium containing 10%
fetal calf serum, 0.33% lactalbumin hydrolysate, 0.33% yeastolate,
0.1 mg/ml streptomycin, and 100 units/ml penicillin. Recombinant
Autographa californica nuclear polyhedrosis baculovirus
expressing HSV-1 UL5, AcmNPV/UL5, was a kind gift from Dr. Robert
Lehman (Stanford University School of Medicine, Stanford), and
recombinant baculovirus expressing UL52, AcUL52, was a kind gift from
Dr. Nigel D. Stow (Medical Research Council Virology Unit, Glasgow,
UK). Viral stocks were amplified in Sf9 cells grown in
suspension as described previously (14). Stocks were titered by
determining the volume of viral stock that gave the maximum level of
recombinant protein expression on 1 × 106 Sf9
cells at 48 h postinfection. African green monkey kidney cells
(Vero, American Type Culture Collection, Rockville, MD) were propagated
as described previously (39). The BL-1 cell line which is permissive
for UL52 mutants and the UL52 mutant virus,
hr114, containing a lacZ insertion were described in Ref. 6.
Plasmids
The plasmid pcDNA1-UL52 containing the UL52 gene
under the control of the CMV promoter was described previously (40).
The amplicon vector plasmid pF1'-CMV was generously provided by Ann D. Kwong (see Ref. 41). In order to generate an amplicon vector capable of
expressing UL52 (pF1'-UL52), pcDNA1-UL52 was digested with
BamHI and HpaI, and the 3.5-kb fragment was
subcloned into pF1'-CMV digested with EcoRV and
BglII.
Construction of Point Mutation
Mutations were constructed by a two-step polymerase chain
reaction method (42). The outside primers were OZnFM3 (5'
GCATCGAAACCCACTTTCCCGAACA 3') and OZnM4 (5' GCGGCCGAGACGAGCGAGTTAGACA
3'). The mutagenic primers were as follows: OZnM1 (5'
CAGCAGGCATTCGCCGCCAAAGCAGACAGCAACC 3') and OZnM2 (5'
TTGCTGTCTGCTTTGGCGGCGAATGCCTGCTGACACAAGGA
3'). The mutations resulting in coding changes are underlined; a
silent change resulting in the introduction of a BsmI site
is indicated by a double underline. The mutated polymerase chain
reaction products were digested with Blp1 and HindIII, and
the 603-base pair fragment was subcloned into pF1'-UL52. The clone was
confirmed by the presence of the new BsmI restriction site.
Sequencing of the 603-base pair region confirmed that no spontaneous
mutations were introduced by polymerase chain reaction. The mutant
plasmid was designated as pF1'-UL52(CC3,4AA).
Construction of the Baculovirus Recombinant Harboring the UL52
Mutant Gene
pF1'-UL52(CC3,4AA) was digested with HindIII and
NotI, and the resulting 3.7-kb fragment containing the
UL52(CC3,4AA) gene was cloned into pFastBac1, a baculovirus
transfer vector (4.8 kb, Life Technologies, Inc.), to generate
UL52(CC3,4AA)FastBac. This transfer vector was then used to generate a
baculoviral stock, AcUL52(CC3,4AA), capable of expressing the mutant
UL52 protein as described previously (14).
Protein Expression and Purification
Two liters of Sf9 cells were grown in suspension at
27 °C in Graces' insect medium as described previously (14). The
wild type UL5·UL52 and the UL5·UL52(CC3,4AA) subcomplexes were
purified essentially as described earlier except that a UnoQ (Bio-Rad) column was used in place of the Mono Q column (14). Cells were Dounced
using 15 strokes of a tight-fitting pestle in buffer A, and the
cytosolic extracts were clarified by centrifugation at 35,000 × g for 30 min. The UL5·UL52 subcomplexes were fractionated from the cytosolic extract by adding equal volume of buffer B containing 0.2 M NaCl and 2 M ammonium sulfate
on ice for 4 h. The resultant protein pellets were resuspended in
buffer B containing 0.1 M NaCl and dialyzed against the
same buffer. The dialyzed sample was loaded onto a 20-ml SP-Sepharose
column equilibrated with buffer B containing 0.1 M NaCl,
and the column was washed with 5 column volumes of the equilibration
buffer. Fractions containing the UL5·UL52 subcomplex were identified
by both ATPase assay and SDS-polyacrylamide gel electrophoresis. The
UL5·UL52 subcomplex elutes from the column in the void volume. Pooled
fractions from SP-Sepharose were loaded onto a 12-ml Uno Q column
equilibrated with buffer B containing 0.1 M NaCl. The
column was washed with 60 ml of buffer B containing 0.1 M
NaCl, and the protein was eluted using a 185-ml linear gradient of
buffer B containing 0.1-1 M NaCl.
Enzyme Assays
ATPase Assay--
ATPase assays (50 µl) were performed using 5 mM ATP, 5 mM MgCl2, 0.1 mM ssM13mp18 DNA (nucleotides), and 0.45 pmol of UL5·UL52 subcomplex (4.5 pmol in the absence of ssDNA) as described previously (14). Nanomoles of inorganic phosphate released per reaction were
determined from a standard curve. Kinetic parameters for ATPase
activity were calculated as described previously (43).
Helicase Assay--
Reaction mixtures (50 µl) contained 20 mM Na+ HEPES, pH 7.6, 1 mM DTT, 5 mM MgCl2, 7 mM ATP, 0.1 mg/ml
bovine serum albumin, 10% glycerol, and 0.64 pmol of the forked DNA
substrate as described previously (14). The forked DNA substrate was
constructed by heat denaturing and annealing 80 pmol of the
helicase 48FS oligo (5'
CAGTCACGACGTTGTAGAGCGACGGCCAGTCGGTTATTGCATGAAAGC 3')
radiolabeled at its 5' end with [ -32P]ATP and 80 pmol
of the unlabeled 48C/FS oligo (5'
CGAAAGTACGTTATTGCGACTGGCCGTCGCTCTACAACGTCGTGACTG 3').
The underlined residues are complementary and create a duplex region of the molecule. After annealing, the products were subjected to
electrophoresis on an 8% nondenaturing polyacrylamide gel, and the
forked substrate was purified by electroelution and ethanol precipitation. Reactions containing varying amounts (1-8 pmol) of the
UL5·UL52 subcomplex (wild type or mutant) were allowed to proceed for
30 min at 37 °C and were analyzed as described previously (14).
Direct Primase Assay--
RNA primer synthesis reactions (25 µl) were performed as described previously using 1 pmol (molecules)
of a 50-base DNA oligonucleotide template containing a preferred
primase initiation site and various amounts (1 and 2 pmol) of wild type
or mutant protein (14).
Gel Mobility Shift Assay
Gel mobility shift assays were essentially performed as
described previously (14). The reaction mixture (25 µl) contained 20 mM Na+ HEPES, pH 7.6, 1 mM DTT, 0.1 mg/ml bovine serum albumin, 10% glycerol, 1 mM EDTA, 1 pmol (molecules) of the forked DNA substrate labeled at its 5' end with
[ -32P]ATP, and 4 pmol of the UL5·UL52 subcomplex
(wild type or mutant) with or without 12 pmol of the UL8 protein. The
reaction was allowed to proceed for 10 min on ice and was terminated by
the addition of 0.1 volume of stop solution (80% glycerol, 0.1%
bromphenol blue). Reaction products were analyzed on a 4%
nondenaturing acrylamide, 0.11% Bis-gel at 150 V at 4 °C. The gel
was dried and exposed to film at 70 °C.
Transient Complementation Assay
The transient complementation assay was performed as described
previously (44). Freshly trypsinized exponentially growing Vero cells
(1 × 106) were transfected in solution with 8 µg of
either pF1'-CMV, pF1'-UL52, or pF1'-UL52(CC3,4AA). At 24 h
post-transfection, the cells were superinfected with hr114 at a
multiplicity of infection of 3 pfu per cell. At 16 h
post-infection at 34 °C, progeny viruses were harvested and titered
on the complementing BL-1 cell line.
Transfection and Immunoblot
Vero cells (1 × 106) were transfected as
described above and superinfected with hr114 at a multiplicity of
infection of 10 pfu per cell at 24 h post-transfection. At 16 h post-infection at 34 °C, the cells were collected by
centrifugation at 2000 rpm for 10 min in a Beckman TJ-6 centrifuge. For
infection, 1.5 × 10 6 Vero cells in 60-mm plates were
infected with KOS or with hr114 at a multiplicity of infection of 10 pfu per cell. Cell pellets were rinsed with PBS (137 mM
NaCl, 2.7 mM KCl, 4.3 mM
Na2HPO4·7H2O, 1.4 mM
KH2PO4, pH 7.3) and resuspended in 50 µl of
sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE)
loading buffer (50 mM Tris-HCl, pH 6.8, 5%
-mercaptoethanol, 2% SDS, 0.1% bromphenol blue, 10% glycerol).
The samples were analyzed by 8% SDS-PAGE, and proteins were blotted
onto ECL nitrocellulose membrane (Amersham Corp., Buckinghamshire, UK).
ECL (enhanced chemiluminescence) Western blotting analysis was
performed according to the manufacturer's (Amersham Pharmacia Biotech)
instructions. An antibody detected against the C-terminal 10 amino
acids of UL52, 1248 (generously provided by Dr. Mark Challberg) was
used as primary antibody at a dilution of 1:250.
Photo Cross-linking
A photo cross-linking experiment was performed with
oligo(dT)18 in which the 5th thymidine residue from the 5'
end was substituted with 5-iododeoxyuridine; the substituted oligo was
labeled at its 5' end with [ -32P]ATP. A 4-pmol aliquot
of UL5·UL52 subcomplex (wild type or mutant) was incubated with 1.0 pmol of the labeled substituted oligo in 20 mM
Na+ HEPES, pH 7.6, 1 mM DTT, 0.1 mg/ml bovine
serum albumin, 10% glycerol, and 1 mM EDTA for 10 min on
ice before irradiation. An IK series He-Cd laser (IK 3302R-E, KIMMON,
Kimmon Electric Co., Ltd.) was used to achieve monochromatic 325 nm
light. The laser beam output was 34 milliwatts measured with a power
meter, Mentor MA10, Scientech® (Scientech, Inc., Boulder, CO). Sample volumes of 200 µl were irradiated in a methacrylate cuvette (Fisher brand, catalog number 14-385-938) at room temperature. At different time points 40-µl aliquots were withdrawn, boiled for 5 min in SDS-PAGE loading buffer, and subjected to SDS-PAGE on an 8% gel. The
gels were dried and exposed to film at 70 °C.
 |
RESULTS |
Site-directed Mutagenesis of the Zinc Finger Motif of
UL52--
Site-directed mutagenesis was used to explore the functional
significance of the putative zinc finger region of the UL52 protein. The sequence of the HSV-1 UL52 gene product was compared
with its homologs from 10 other herpesviruses, and a putative zinc finger was identified beginning at Cys988
(Cys-X4-His-X29-Cys-X4-Cys).
Three cysteine residues, Cys988, Cys1023, and
Cys1028 within this region are totally conserved among all
UL52 homologs and are designated as C1, C3, and C4, respectively (Fig.
1). Histidine 993 (designated as H2) was
also conserved in 9 out of 10 UL52 homologs. A similar potential
metal-binding site was also highly conserved in DNA
primases of bacteriophages, other eukaryotic viruses,
prokaryotes, and eukaryotes (31, 32). Sequence-specific recognition of DNA by proteins containing this type of zinc binding motif has been studied in many systems (33-37). In this study, the
third and fourth cysteine residues of the zinc finger motif (C3 and C4)
were substituted with alanine residues. The mutant gene was cloned into
an amplicon expression vector under the control of the CMV promoter
[pF1'-UL52(CC3,4AA)]. To analyze the ability of the UL52 mutant to
support DNA synthesis, Vero cells were transfected with
pF1'-UL52(CC3,4AA) and subsequently superinfected with the UL52 mutant virus, hr114. After 16 h of infection the
supernatant was titered for virus production on the permissive BL-1
cell line. The wild type plasmid, pF1'-UL52, complemented hr114 very
efficiently (complementation index of 256, Table
I). The mutant construct, however, was
unable to support the growth of the UL52 insertion mutant
(complementation index less than 1, Table I). Vero cells were
transfected with wild type and mutant constructs, and cell lysates were
examined by Western blot analysis to determine steady state levels of
the UL52 protein. Although the polyclonal antibody used to detect the
UL52 peptide cross-reacts with many proteins in mock-infected cell
extracts, it is clear that a band corresponding to UL52 is present in
cells transfected with plasmids expressing wild type and mutant
proteins but absent in cells transfected with vector alone (Fig.
2, compare lanes 2 and
3 with lane 1). Furthermore, the UL52 band is
present in Vero cells infected with KOS but not in cells mock-infected
or infected with the null virus hr114 (Fig. 2, compare lane
5 with lanes 4 and 6). We conclude that
cells transfected with plasmid expressing the mutant version of
UL52 (pF1'-UL52(CC3,4AA) are able to express full-length
UL52 protein at wild type levels. This result indicates that the mutant protein did not exhibit any gross conformational changes that affected
the stability of the protein in Vero cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Alignment of the conserved putative zinc
finger motif among herpesviruses. The HSV-1 UL52 primase and its
homologs in 10 other -herpesviruses are shown. The sequence
alignment was performed using PILEUP, a component of the GCG program
(Wisconsin Package version 9.1, Genetics Computer Group, Madison, WI).
Consensus regions were generated with the PRETTY program. Targeted
amino acids are indicated in boldface. The bottom two
lines show the position and numbering of invariant CHCC residues
and the amino acid substitutions in the mutant CC3,4AA. Abbreviations
are as follows: HSV1, herpes simplex virus type 1;
HSV2, herpes simplex virus type 2; EBV,
Ebstein-Barr virus; HHV6, human herpesvirus type 6;
HHV7, human herpesvirus type 7; VZV,
Varicella-Zoster virus; MCMV, murine cytomegalovirus;
HVS, Herpesvirus saimiri; HCMV, human
cytomegalovirus; EHV, equine herpesvirus type 1;
BHV, bovine herpesvirus type 1.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Transient complementation assay
Vero cells were transfected with pF1'CMV, pF1'-UL52, or
pF1'-UL52(CC3,4AA) and superinfected with UL52 mutant virus, hr114. The
progeny of the transfected cells were assayed on permissive BL-1 cells.
The results represent the average of three independent experiments. The
complementation index is measured as pfu of hr114 from cultures
transfected with the indicated plasmid/pfu from cultures transfected
with vector alone, pF1'CMV.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
Detection of UL52 by transient transfection
assay. Vero cells were transfected with plasmids pF1'-CMV,
pF1'-UL52, or pF1'-UL52(CC3,4AA) and superinfected with UL52
mutant virus. Cells were harvested at 16 h post-infection, lysed
in 1× SDS-PAGE loading buffer, and subjected to electrophoresis in an
8% SDS-polyacrylamide gel. Following electrophoresis, proteins were
transferred onto nitrocellulose, and UL52 was detected with polyclonal
antibody 1248. Lanes 1-3 represent extracts from
transfected cells, and lanes 4-6 represent infected cell
extracts.
|
|
Generation of Recombinant Baculovirus and Purification of Both Wild
Type and Mutant UL5·UL52 Subcomplexes--
To examine the
contribution of Cys1023 and Cys1028 in the
putative zinc finger motif of UL52 toward the biochemical activities of the UL5·UL52 subcomplex in vitro, a recombinant
baculovirus containing the UL52(CC3,4AA) gene was
constructed [AcUL52(CC3,4AA)]. Sf9 cells infected with
AcUL52(CC3,4AA) expressed full-length UL52 that reacted with the
mono-specific polyclonal antibody (1248) in a Western blot (data not
shown). A subcomplex consisting of wild type UL5 and mutant UL52 was
obtained by infecting Sf9 cells with the appropriate recombinant
baculoviruses, and the subcomplex was purified to approximately 80%
homogeneity (Fig. 3, lane 2). The same purification scheme was used to purify the wild type UL5·UL52 subcomplex and resulted in approximately 95% homogeneity (Fig. 3, lane 1). The ability of the mutant UL52 to copurify
with UL5 indicates that the mutant protein is still able to interact with UL5 and suggests that no gross alterations in conformation have
occurred. The purification scheme, however, resulted in a lower level
of purity for mutant as compared with wild type subcomplex, indicating
that the mutant protein may tend to aggregate more than the wild type
version.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
Purified UL5·UL52 subcomplexes from insect
cells infected with recombinant baculoviruses carrying wild type
UL5 and either wild type or mutant versions of
UL52. An aliquot (3 µg) of purified wild type
or mutant UL5·UL52 subcomplex was subjected to electrophoresis by 8%
SDS-PAGE and subsequently stained with Coomassie Blue.
|
|
The Zinc Finger Mutation Abolishes Helicase Activity of the
UL5·UL52 Subcomplex--
Mutations in the conserved DXD
primase motif of UL52 were shown to abolish primase but not ATPase or
helicase activities of the heterotrimeric complex in vitro
(15, 16). Although this result indicated that primase activity was
likely specified at least in part by the UL52 subunit itself, it
remained a possibility that UL52 also contributes to the helicase
activity of the helicase-primase complex. In order to address this
question, the zinc finger mutant was assayed for its ability to
displace a short strand of DNA from a forked substrate. Various
concentrations of wild type and mutant proteins were incubated with the
32P-labeled forked substrate in the presence of ATP and
MgCl2, and the reaction products were analyzed by native
gel electrophoresis. Fig. 4 indicates
that helicase activity was present in all four protein concentrations
of wild type UL5·UL52 subcomplex, but no strand displacement was
observed in reactions containing the mutant complex. Thus,
surprisingly, the CC3,4AA mutation in the zinc finger motif abolished
helicase activity. This result suggests that UL52 may contribute an
activity that is essential for helicase function.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 4.
The CC3,4AA mutation in the putative zinc
finger motif abolishes the ability of UL5·UL52 to unwind a forked DNA
substrate. DNA helicase assays were performed using varying
amounts (1-8 pmol) of the UL5·UL52 subcomplex (wild type and mutant)
and 0.64 pmol (molecules) of the radiolabeled forked helicase
substrate; reaction products were analyzed by 8% native polyacrylamide
gel electrophoresis as described under "Experimental Procedures."
Lane 1 contained no enzyme. Lanes 2-9 show
reactions catalyzed by different concentrations of protein (wild type
and mutant). Lane 10 shows a sample of the substrate which
was boiled for 5 min to separate the DNA strands before loading.
|
|
The Intrinsic and ssDNA-dependent ATPase Activity of
the Mutant Subcomplex Is Severely Compromised--
The HSV-1
helicase-primase possesses both intrinsic and
ssDNA-dependent ATPase activity (2, 8, 9). In order to test the role of the zinc finger motif of UL52 in ATP hydrolysis, ATPase activity of UL5·UL52(CC3,4AA) was compared with the wild type subcomplex both in the presence and absence of ssM13mp18 DNA (Fig. 5 and Table II). ATP hydrolysis followed
a linear time course up to 40 min under these assay conditions for both
wild type and mutant UL5·UL52 subcomplexes. The mutant protein was
severely compromised in both intrinsic and ssDNA-dependent
ATPase activities, exhibiting a 7.8-fold decrease in turnover rate
(Kcat) for DNA-independent ATPase activity and
an 11.6-fold decrease in Kcat for
ssDNA-dependent ATPase activity as compared with wild type.
The severity of this defect was unexpected and suggests that UL52
contributes to the ATPase activity of the complex. Whether the zinc
finger mutation has affected the conformation of the subcomplex in a
way that severely affects the hydrolysis of ATP or whether the zinc
finger itself is required for some aspect of the hydrolysis reaction remains to be determined. In order to determine whether the mutation has affected binding of ATP and DNA to the subcomplex, the
Km values for ssDNA and ATP were also determined for
wild type and mutant helicase-primase subcomplexes (Table
II). The values for Km
(DNA and ATP) are not significantly different for the wild type and
mutant proteins and are consistent with the previously reported values
(43, 45, 46); the UL5·UL52(CC3,4AA) subcomplex showed a 1.3-fold
increase in the values for Km for ssM13mp18 DNA and
1.1-fold increase in the Km for ATP. This result
indicates that the ability to bind ATP and ssDNA as measured in the
ATPase assay is not compromised in the mutant subcomplex containing a
zinc finger mutation.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Time course of ssDNA-dependent
and -independent ATP hydrolysis by the wild type and mutant UL5·UL52
subcomplex. ATPase assays were carried out in the presence or the
absence of saturating levels of ssM13mp18 DNA (0.1 mM
nucleotides), ATP (5 mM), and MgCl2 (5 mM) as described under "Experimental Procedures." The
open squares represent the reaction catalyzed by 0.45 pmol
of wild type UL5·UL52 subcomplex in the presence of DNA. The
open diamonds represent the reaction catalyzed by 4 pmol of
the wild type UL5·UL52 subcomplex in the absence of DNA. The
open circles represent the reaction catalyzed by 0.9 pmol of
mutant UL5·UL52 subcomplex in presence of DNA, and the open
triangles represent the reaction catalyzed by 4 pmol of mutant
UL5·UL52 subcomplex in the absence of DNA. The values represent the
mean of three independent experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Kinetic parameters for ssDNA-dependent and DNA-independent
ATP hydrolysis for wild type and mutant UL5 · UL52 subcomplex
ATPase reactions were performed at 37 °C for 30 min as described
under "Experimental Procedures." Km values were
calculated from assays using a fixed concentration of one substrate (5 mM ATP and 5 mM MgCl2 or 0.1 mM ssM13mp 18 DNA in nucleotides) and varying the
concentration of the other substrate. Each value represents the average
of three independent experiments.
|
|
The Zinc Finger Mutation Abolishes Primase Activity--
To
determine if the putative zinc finger motif is required for primase
activity, both the wild type and the mutant UL5·UL52 subcomplexes
were assayed for primer synthesis using a template containing a
preferred primase initiation site mapped from pBS plasmid DNA (14, 43).
As shown in Fig. 6, wild type can
synthesize short (8-9 nucleotide) primers in the absence of the UL8
protein, but no primer synthesis was detected for the mutant protein
complex.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6.
Comparison of the abilities of UL5·UL52 and
UL5·UL52(CC3,4AA) to carry out RNA primer synthesis. RNA primase
activity on a preferred primase initiation site template catalyzed by
wild type and mutant UL5·UL52 subcomplex was measured as described
under "Experimental Procedures" and analyzed by electrophoresis on
a 18% urea gel. Lane 1 represents the reaction in absence
of enzyme. Lanes 2 and 3 represent reactions
containing 1 and 2 pmol of wild type enzyme, respectively. Lanes
4 and 5 represent reactions containing 1 and 2 pmol of
mutant protein, respectively.
|
|
The Zinc Finger Mutant Binds to a Forked Helicase Substrate and Can
Interact with UL8--
One possible explanation for the lack of DNA
helicase and primase activities of the mutant subcomplex is that this
mutation alters binding to DNA. The ability of the mutant and wild type UL5·UL52 subcomplexes to bind to the forked helicase substrate was
tested using a gel mobility shift assay (Fig.
7). The wild type UL5·UL52 subcomplex
can efficiently shift the substrate as previously reported (Fig. 7,
lane 3) (14). Furthermore, as seen previously, addition of
UL8 to the binding reaction resulted in a supershift to a slower
migrating species (Fig. 7, lane 4). The mutant UL5·UL52
subcomplex was also able to shift the forked substrate but with much
lower efficiency (8.3% of wild type levels, Fig. 7, lane
5). Addition of UL8 resulted in the disappearance of the UL5·UL52 shifted species and the appearance of a faint diffused supershifted band (Fig. 7, lane 6). A darker exposure of
lanes 5 and 6 is shown in lanes 7 and
8, respectively. The disappearance of the UL5·UL52 shifted
species in the presence of UL8 suggests that the interaction of the
UL5·UL52 subcomplex with UL8 has not been compromised.

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 7.
The CC3,4AA mutation reduces the ability of
the UL5·UL52 subcomplex to gel shift the forked DNA substrate.
DNA gel shift reactions were performed using 1 pmol of the radiolabeled
forked DNA substrate, 4 pmol of the UL5·UL52 subcomplex (wild type or
mutant) in the presence or absence of 12 pmol of the UL8 protein. The
samples were incubated for 10 min on ice and analyzed by 4%
nondenaturing polyacrylamide gel electrophoresis as described under
"Experimental Procedures." Lane 1 represents the
reaction in absence of any protein. Lane 2 shows the
reaction that contained only the UL8 protein. Lanes 3 and
4 represent reactions that contained the wild type
UL5·UL52 subcomplex alone and in the presence of UL8, respectively.
Lanes 5 and 6 represent similar reactions that
contained mutant UL5·UL52 subcomplexes alone and in the presence of
UL8, respectively. Lanes 7 and 8 represent a
darker exposure of lanes 5 and 6,
respectively.
|
|
Both UL5 and UL52 Subunits of Wild Type Helicase-Primase Complex
Can be Efficiently Cross-linked to a Short DNA
Oligonucleotide--
The DNA-binding sites within helicase-primase
complex have not been mapped. The previous methods for analyzing
protein-DNA interactions such as filter binding and gel shift
experiments have not been able to determine whether UL5 or UL52 or both
subunits contact DNA. In order to test the contribution of individual
subunits in DNA binding, a photo cross-linking assay was performed
using a 5-iododeoxyuridine-substituted oligonucleotide and a He-Cd
laser as a light source. In previous studies, substituted
oligonucleotides have been cross-linked to associated proteins using
UV-mediated cross-linking (47-49); however, UV light sources (which
emit 254 nm light) result in inefficient cross-linking and considerable degradation of both protein and nucleic acid. More recent studies show
that higher yields of protein cross-linked to DNA or RNA can be
obtained using higher wave lengths of light (308-325 nm) which result
in much less degradation of both protein and nucleic acid (50, 51). In
this study a He-Cd light source that emits at 325 nm was used to photo
cross-link the UL5·UL52 subcomplex to a 32P-end-labeled
18-mer oligo(dT) molecule in which 5-iododeoxyuridine was substituted
for one of the thymidine residues. Wild type and mutant subcomplexes
were irradiated at room temperature for various periods with the He-Cd
laser. SDS-PAGE and subsequent autoradiography of the wild type
subcomplex revealed two major bands that migrate at positions that
correspond to UL5 and UL52 (Fig. 8,
lanes 1-5). The identity of these two major bands as UL5
and UL52 was confirmed by Western blot analysis (data not shown). At
the 2-, 4-, and 10-min time points, the intensity of the UL52 band was
stronger (2-2.5 fold) than that of the UL5 band; however, by 60 min,
the intensities of the two labeled bands were almost similar. The mutant UL5·UL52 subcomplex exhibited very little cross-linking to
either full-length UL5 or UL52 (Fig. 8, lanes 6-10). Both
wild type and mutant subcomplexes were subjected to SDS-PAGE and
Coomassie staining after cross-linking to confirm that equivalent
amounts of proteins in the subcomplexes were present in both
preparations (data not shown). Quantification of counts cross-linked to
full-length UL5 and UL52 for both mutant and wild type is shown in Fig.
9, A and B,
respectively. In the wild type subcomplex, cross-linking to UL52
appeared to be slightly more efficient than to UL5. The total number of
counts cross-linked to both UL5 and UL52 in the mutant subcomplex was
only 2% of wild type levels. In this case, however, the number of
counts cross-linked to UL5 was higher than to UL52. This suggests that
binding to UL52 was more severely compromised than binding to UL5,
although both were severely affected.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 8.
SDS-PAGE analysis of the cross-linked
UL5·UL52 subcomplex. Cross-linking reactions were carried out in
a methacrylate cuvette (light path 10 mm) at room temperature with an
He-Cd laser emitting 34 milliwatts at 325 nm. Samples were removed
after 0, 2, 4, 10, and 60 min of irradiation (lanes 1-5,
respectively, for wild type protein; lanes 6-10,
respectively, for mutant protein), boiled for 5 min in 1× SDS-PAGE
loading buffer, and subjected to electrophoresis on a 8% SDS-PAGE gel
which was then dried and exposed overnight at 70 °C.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 9.
Quantification of cross-linking data.
Data from the Fig. 8 quantified using a PhosphorImager, and the total
counts were plotted against the time of irradiation. Panel A
shows the wild type subcomplex (UL5, and UL52, ); panel
B shows the mutant subcomplex (UL5, and UL52, ).
|
|
In addition to the two major bands corresponding to UL5 and UL52, both
wild type and mutant preparations contained labeled bands that migrated
faster than full-length UL5 and UL52. In the case of wild type, a band
of 47 kDa was seen at the 60-min time point (Fig. 8, lane
5), and in the mutant preparation, predominant bands corresponding
to 47 and 60 kDa were observed at all time points (Fig. 8, lanes
7-10). These smaller bands may represent degradation product of
UL5 or UL52; however, these forms do not react with several different
polyclonal and monoclonal UL5 and UL52
antibodies.2 Alternatively,
it is possible that the mutant preparation contains one or more
contaminating proteins that can cross-link to DNA very efficiently; as
mentioned above, the purity of the mutant preparation is lower than
that of wild type.
In summary, we have developed a cross-linking assay that indicates that
both UL5 and UL52 can contact DNA. The mutant subcomplex is severely
compromised in the ability of both UL52 and UL5 to bind to DNA. These
results will be discussed further below.
 |
DISCUSSION |
In this report the putative zinc binding domain
(Cys988-X4-His993-X29-Cys1023-X4-Cys1028)
of the UL52 subunit was analyzed by site-directed mutagenesis. Several
observations have been made. 1) The replacement of Cys1023
and Cys1028 with alanine residues completely abolished the
growth of UL52 mutant virus in a transient complementation
assay, suggesting that this motif is important for the growth of the
virus. 2) Biochemical analysis of a purified UL5·UL52 subcomplex
expressed in insect cells infected with recombinant baculoviruses
revealed several defects: the mutant subcomplex fails to exhibit
helicase and primase activities and only retains about 9% wild type
levels of ssDNA-dependent ATPase activity. 3) Overall DNA
binding activity as measured by gel mobility shift analysis also
indicates that the UL5·UL52 subcomplex is severely compromised (8.3%
of wild type levels). 4) A newly developed photo cross-linking assay
demonstrates that both UL5 and UL52 can be cross-linked to an 18-mer of
oligo(dT) indicating that both subunits in the wild type subcomplex can
contact DNA. In the wild type preparation, UL52 can be cross-linked
slightly more efficiently than UL5. 5) Both subunits of the mutant
UL5·UL52 subcomplex exhibit significant defects in their ability to
bind DNA (total cross-linking at 2% of wild type levels), and UL52 binding is decreased even more than UL5 binding.
Previous reports indicated that the DXD motif in UL52
(located between residues 610 and 636), which is also found in other primases, is probably required for the catalytic activity of the primase (15, 16). Until this report, no other important regions of the
UL52 protein had been identified experimentally. We have replaced two
invariant cysteine residues in a putative zinc binding region of UL52,
and our results indicate that amino acids 1023 and 1028 are indeed
important for UL52 function. It is possible that by mutating these two
amino acids, changes in the overall conformation of UL52 have occurred
that result in the observed defects in the UL5·UL52 subcomplex.
However, several observations suggest that gross conformational changes
have not occurred. 1) The mutant UL52 can be detected in transfected
Vero cells at wild type levels suggesting that no gross alterations in
stability have occurred. 2) The mutant subcomplex still copurifies from insect cells infected with recombinant baculoviruses expressing wild
type UL5 and mutant UL52, indicating that mutant UL52 can still
interact with UL5. 3) The purified UL5·UL52 subcomplex containing the
mutant version of the UL52 gene can still interact with UL8 as detected
in the gel mobility shift assay; this may indicate that the C terminus
of UL52 is not necessary for its interaction with either UL5 or UL8. 4)
The purified mutant UL5·UL52 complex exhibits similar
Km values for ATP and ssDNA for ATP hydrolysis,
indicating that the binding of these cofactors is not altered with
respect to the ATPase assay. This result may seem contradictory to the
observation that DNA binding of the subcomplex as determined by gel
shift and photo cross-linking assays is severely compromised. This
apparent discrepancy may be due to different substrates used in each
assay. The gel shift assays were performed using a 48-mer synthetic
forked substrate, and cross-linking assays were carried out using an
18-mer oligo(dT) substrate, whereas the kinetic parameters were
determined using m13mp18 single-stranded DNA. It has been reported that
the kinetic parameters of the ATPase activity of the UL5·UL52
subcomplex are affected by the length of the oligonucleotide coeffector
(52). It is also possible that other differences in the assay
conditions such as the presence or absence of ATP may affect the
DNA-binding properties of the mutant protein subcomplex. In any case,
our results taken together suggest that it is unlikely that the overall conformation of the protein is significantly altered by these amino
acid substitutions. However, it is possible that subtle conformational
changes have occurred especially within the putative zinc finger domain
itself. In fact, since other similar zinc fingers whose structures are
known have been shown to fold into discrete domains capable of binding
zinc and DNA (33, 53-56), it is possible that the mutation in
UL52 results in a local alteration of conformation in the C
terminus of UL52 which does not affect its global conformation and that
this alteration in the C terminus is responsible for the observed
changes in activity. Further experiments will be needed to clarify
these points. At this point, we can only say that the alteration of two
C-terminal cysteine residues of UL52 has profound effects on the
function of the UL5·UL52 subcomplex. Interestingly, in the case of
the T7 helicase-primase encoded by the T7 gene 4, a mutation
in the zinc motif of the primase has been shown to affect both primase
and helicase activities (32). In that example, however, the mutant
helicase-primase exhibits wild type levels of nucleotide hydrolysis activity.
The precise mechanism of helicase action is not known in detail, but it
can be imagined that the entire process requires the coupling of
subreactions such as ATP binding, ATP hydrolysis, single- and
double-stranded DNA binding, translocation along DNA, and coupling
between ATP hydrolysis and DNA unwinding. ATP binding and hydrolysis
are an intrinsic property of all DNA and RNA helicases, and the UL5
protein contains the conserved Walker A and Walker B motifs that are
found in ATP-binding proteins (57). Our observation that a mutation in
the putative zinc binding region of UL52 exhibited severe defects in
both intrinsic and ssDNA-dependent ATPase activities was
therefore unexpected. Although UL5 and UL52 have been considered as the
helicase and primase subunits of the complex, respectively, our results
indicate that the UL52 subunit may be required for optimal ATPase
activity. It is possible that the subcomplex that forms in the presence
of the mutant UL52 protein exhibits subtle conformational changes that
directly affect ATPase activity. Alternatively, the putative zinc
binding region of UL52 may contribute amino acid residues that play a
direct role in ATPase catalysis or, as discussed below, the putative
zinc binding region may be involved in DNA binding that is required for
optimal ATPase activity.
The DNA binding domains on the UL5·UL52·UL8 helicase-primase have
not been mapped. The UL5 subunit itself may contain all the DNA binding
regions required for helicase activity, and the UL52 subunit would be
expected to specify its own DNA binding region for primase activity.
However, it remains a possibility that UL52 contributes a DNA-binding
site to the unwinding process. Previous attempts to map the DNA binding
domains in UL5 were frustrating because of our inability to distinguish
between the individual contributions of the two subunits toward DNA
binding. By analogy with other superfamily helicases, especially those
for which structural information is available (58), it was anticipated
that some of the conserved motifs of UL5 (especially motif IA, motif
III, and motif V) may be involved in contacting DNA. However, mutations in these motifs were still able to gel-shift a forked substrate at wild
type or higher levels (14). The gel mobility shift assay, however,
measures total subcomplex binding, and it seemed likely that binding by
UL52 may mask any defect in binding by UL5. Therefore, a photo
cross-linking assay was developed that can distinguish the individual
contributions toward DNA binding. In this study we have shown that both
UL5 and UL52 subunits of the helicase-primase complex can bind DNA.
Furthermore, we have shown that the mutant protein subcomplex is
defective in both UL52 and UL5 binding. The defect in UL52 binding is
consistent with the observation that a similar zinc binding motif in
the T7 DNA primase is involved in template recognition (32). The defect
in UL5 binding was unexpected however. One explanation for these
results is that the mutation in the putative zinc binding domain
affects the DNA-binding properties of UL52 which in turn affects the
DNA-binding properties of the UL5 component of the UL5·UL52 complex.
Alternatively, it is possible that both subunits together form a
DNA-binding site and that binding to both subunits are required for
optimal DNA binding of the complex.
In summary, we have demonstrated that the conserved cysteine residues
(Cys1023 and Cys1028) in the putative zinc
finger motif of UL52 are essential for its biological activity. We show
that the overall DNA-binding properties of the mutant protein as
measured by gel mobility shift and photo cross-linking are severely
compromised. The simplest explanation for our results is that the lack
of helicase and primase activities in the mutant protein is the
consequence of reduced affinity of the UL52 subunit for DNA. Thus the
putative zinc finger motif of UL52 may be important not only for the
DNA-binding property of the primase subunit but also for the complex as
a whole. In any case, the results reported in this paper suggest that
it would be unwise to assign helicase function to the UL5 subunit and
primase function to the UL52 subunit; it is clear that we must consider these two polypeptides together and that they have a more complex relationship than was originally anticipated.
 |
ACKNOWLEDGEMENTS |
We thank the members of our laboratory and
Dr. Mark Challberg (National Institutes of Health) for helpful
discussions on this manuscript. We also thank Dr. Karen A LeCuyer in
the Department of Biochemistry, University of Connecticut Health
Center, for help with photo cross-linking and for helpful comments in
the preparation of this manuscript. We thank Dr. Karen Graves-Woodword for providing purified UL8 protein.
 |
FOOTNOTES |
*
This investigation was supported by Public Health Service
Grant A121747.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 860-679-2310;
Fax: 860-679-1239; E-mail: Weller{at}nso2.uchc.edu.
2
N. Biswas and S. K. Weller, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
HSV, herpes simplex
virus;
PAGE, polyacrylamide gel electrophoresis;
CMV, cytomegalovirus;
ss, single-stranded;
DTT, dithiothreitol;
pfu, plaque-forming units;
kb, kilobase pairs.
 |
REFERENCES |
-
Crute, J. J.,
Mocarski, E. S.,
and Lehman, I. R.
(1988)
Nucleic Acids Res.
16,
6585-6596[Abstract/Free Full Text]
-
Crute, J. J.,
Tsurumi, T.,
Zhu, L.,
Weller, S. K.,
Olivo, P. D.,
Challberg, M. D.,
Mocarski, E. S.,
and Lehman, I. R.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
2186-2189[Abstract/Free Full Text]
-
Weller, S. K.
(1990)
in
Herpesvirus Transcription and Its Regulation (Wagner, E., ed), pp. 105-135, CRC Press, Inc., Boca Raton, FL
-
Olivo, P. D.,
and Challberg, M. D.
(1990)
in
Herpesvirus Transcription and Its Regulation (Wagner, E., ed), CRC Press, Inc., Boca Raton, FL
-
Carmichael, E. P.,
and Weller, S. K.
(1989)
J. Virol.
63,
591-599[Abstract/Free Full Text]
-
Goldstein, D. J.,
and Weller, S. K.
(1988)
J. Virol.
62,
2970-2977[Abstract/Free Full Text]
-
Zhu, L.,
and Weller, S. K.
(1992)
J. Virol.
66,
458-468[Abstract/Free Full Text]
-
Dodson, M. S.,
Crute, J. J.,
Bruckner, R. C.,
and Lehman, I. R.
(1989)
J. Biol. Chem.
264,
20835-20838[Abstract/Free Full Text]
-
Calder, J. M.,
and Stow, N. D.
(1990)
Nucleic Acids Res.
18,
3573-3578[Abstract/Free Full Text]
-
Crute, J. J.,
and Lehman, I. R.
(1991)
J. Biol. Chem.
266,
4484-4488[Abstract/Free Full Text]
-
Dodson, M. S.,
and Lehman, I. R.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
1105-1109[Abstract/Free Full Text]
-
Gorbalenya, A. E.,
and Koonin, E. V.
(1993)
Curr. Opin. Struct. Biol.
3,
419-429
-
Zhu, L.,
and Weller, S. K.
(1992)
J. Virol.
66,
469-479[Abstract/Free Full Text]
-
Graves-Woodward, K. L.,
Gottlieb, J.,
Challberg, M. D.,
and Weller, S. K.
(1997)
J. Biol. Chem.
272,
4623-4630[Abstract/Free Full Text]
-
Klinedinst, D. K.,
and Challberg, M. D.
(1994)
J. Virol.
68,
3693-3701[Abstract/Free Full Text]
-
Dracheva, S.,
Koonin, E. V.,
and Crute, J. J.
(1995)
J. Biol. Chem.
270,
14148-14153[Abstract/Free Full Text]
-
Gac, N. T. L.,
Villani, G.,
Hoffmann, J. S.,
and Boehmer, P. E.
(1996)
J. Biol. Chem.
271,
21645-21651[Abstract/Free Full Text]
-
Sherman, G.,
Gottlieb, J.,
and Challberg, M. D.
(1992)
J. Virol.
66,
4884-4892[Abstract/Free Full Text]
-
Tenney, D. J.,
Hurlburt, W. W.,
Micheletti, P. A.,
Bifano, M.,
and Hamatake, R. K.
(1994)
J. Biol. Chem.
269,
5030-5035[Abstract/Free Full Text]
-
Hamatake, R. K.,
Bifano, M.,
Hurlburt, W. W.,
and Tenney, D. J.
(1997)
J. Gen. Virol.
78,
857-865[Abstract]
-
Calder, J. M.,
Stow, E. C.,
and Stow, N. D.
(1992)
J. Gen. Virol.
73,
531-538[Abstract/Free Full Text]
-
Marsden, H. S.,
McLean, G. W.,
Barnard, E. C.,
Francis, G. J.,
MacEachran, K.,
Murphy, M.,
McVey, G.,
Cross, A.,
Abbotts, A. P.,
and Stow, N. D.
(1997)
J. Virol.
71,
6390-6397[Abstract]
-
Falkenberg, M.,
Bushnell, D. A.,
Elias, P.,
and Lehman, I. R.
(1997)
J. Biol. Chem.
272,
22766-22770[Abstract/Free Full Text]
-
Lohman, T. M.
(1993)
J. Biol. Chem.
268,
2269-2272[Abstract/Free Full Text]
-
Wong, I.,
Chao, K. L.,
Bujalowski, W.,
and Lohman, T. M.
(1992)
J. Biol. Chem.
267,
7596-7610[Abstract/Free Full Text]
-
Wong, I.,
and Lohman, T. M.
(1992)
Science
256,
350-355[Abstract/Free Full Text]
-
Patel, S. S.,
and Hingorani, M. M.
(1993)
J. Biol. Chem.
268,
10668-10675[Abstract/Free Full Text]
-
Dong, F.,
and von Hippel, P. H.
(1996)
J. Biol. Chem.
271,
19625-19631[Abstract/Free Full Text]
-
Joo, W. S.,
Kim, H. Y.,
Purviance, J. D.,
Sreekumar, K. R.,
and Bullock, P. A.
(1998)
Mol. Cell. Biol.
18,
2677-2687[Abstract/Free Full Text]
-
Smelkova, N. V.,
and Borowiec, J. A.
(1997)
J. Virol.
71,
8766-8773[Abstract]
-
Ilyina, T. V.,
Gorbaleyna, A. E.,
and Koonin, E. V.
(1992)
J. Mol. Evol.
34,
351-357[CrossRef][Medline]
[Order article via Infotrieve]
-
Mendelman, L. V.,
Beauchamp, B. B.,
and Richardson, C. C.
(1994)
EMBO J.
13,
3909-3916[Medline]
[Order article via Infotrieve]
-
Pavletich, N. P.,
and Pabo, C. O.
(1991)
Science
252,
809-817[Abstract/Free Full Text]
-
Pavletich, N. P.,
and Pabo, C. O.
(1993)
Science
261,
1701-1707[Abstract/Free Full Text]
-
Qian, X.,
Gozani, S. N.,
Yoon, H.,
Jeon, C. J.,
Agarwal, K.,
and Weiss, M. A.
(1993)
Biochemistry
32,
9944-9959[CrossRef][Medline]
[Order article via Infotrieve]
-
Witte, M. M.,
and Dickson, R. C.
(1988)
Mol. Cell. Biol.
8,
3726-3733[Abstract/Free Full Text]
-
Agarwal, K.,
Baek, K. H.,
Jeon, C. J.,
Miyamoto, K.,
Ueno, A.,
and Yoon, H. S.
(1991)
Biochemistry
30,
7842-7851[CrossRef][Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Weller, S. K.,
Lee, K. J.,
Sabourin, D. J.,
and Schaffer, P. A.
(1983)
J. Virol.
45,
354-366[Abstract/Free Full Text]
-
Lukonis, C. J.,
and Weller, S. K.
(1997)
J. Virol.
71,
2390-2399[Abstract]
-
Hong, Z.,
Ferrari, E.,
Wright-Minogue, J.,
Chase, R.,
Risano, C.,
Seelig, G.,
Lee, C. G.,
and Kwong, A. D.
(1996)
J. Virol.
70,
4261-4268[Abstract]
-
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1990)
in
Current Protocols in Molecular Biology (Janssen, K., ed), Sections 8.5.7-8.5.9, John Wiley & Sons, Inc., New York
-
Graves-Woodward, K.,
and Weller, S. K.
(1996)
J. Biol. Chem.
271,
13629-13635[Abstract/Free Full Text]
-
Martinez, R.,
Shao, L.,
and Weller, S. K.
(1992)
J. Virol.
66,
6735-6746[Abstract/Free Full Text]
-
Crute, J. J.,
Bruckner, R. C.,
Dodson, M. S.,
and Lehman, I. R.
(1991)
J. Biol. Chem.
266,
21252-21256[Abstract/Free Full Text]
-
Earnshaw, D. L.,
and Jarvest, R. L.
(1994)
Biochem. Biophys. Res. Commun.
199,
1333-1340[CrossRef][Medline]
[Order article via Infotrieve]
-
Ogata, R.,
and Gilbert, W.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
4973-4976[Abstract/Free Full Text]
-
Blatter, E. E.,
Ebright, Y. W.,
and Ebright, R. H.
(1992)
Nature
359,
650-265[CrossRef][Medline]
[Order article via Infotrieve]
-
Catalano, C. E.,
Allen, D. J.,
and Benkovic, S. J.
(1990)
Biochemistry
29,
3612-3621[CrossRef][Medline]
[Order article via Infotrieve]
-
Willis, M. C.,
LeCuyer, K. A.,
Meisenheimer, K. M.,
Uhlenbeck, O. C.,
and Koch, T. H.
(1994)
Nucleic Acids Res.
22,
4947-4952[Abstract/Free Full Text]
-
Meisenheimer, K. M.,
Meisenheimer, P. L.,
Willis, M. C.,
and Koch, T. H.
(1996)
Nucleic Acids Res.
24,
981-982[Free Full Text]
-
Healy, S.,
You, X.,
and Dodson, M.
(1997)
J. Biol. Chem.
272,
3411-3415[Abstract/Free Full Text]
-
Schwabe, J. W.,
Neuhaus, D.,
and Rhodes, D.
(1990)
Nature
348,
458-461[CrossRef][Medline]
[Order article via Infotrieve]
-
Schwabe, J. W.,
and Rhodes, D.
(1991)
Trends Biochem. Sci.
16,
291-296[CrossRef][Medline]
[Order article via Infotrieve]
-
Klug, A.,
and Rhodes, D.
(1987)
Cold Spring Harbor Symp. Quant. Biol.
52,
473-482[Abstract/Free Full Text]
-
Rhodes, D.,
and Klug, A.
(1993)
Sci. Am.
268,
56-65
-
Walker, J. E.,
Saraste, M.,
Runswick, M. J.,
and Gay, N. J.
(1982)
EMBO J.
1,
945-951[Medline]
[Order article via Infotrieve]
-
Korolev, S.,
Hsieh, J.,
Gauss, G. H.,
Lohman, T. M.,
and Waksman, G.
(1997)
Cell
90,
635-647[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. A. Cavanaugh and R. D. Kuchta
Initiation of New DNA Strands by the Herpes Simplex Virus-1 Primase-Helicase Complex and Either Herpes DNA Polymerase or Human DNA Polymerase {alpha}
J. Biol. Chem.,
January 16, 2009;
284(3):
1523 - 1532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sompallae, S. Gastaldello, S. Hildebrand, N. Zinin, G. Hassink, K. Lindsten, J. Haas, B. Persson, and M. G. Masucci
Epstein-Barr Virus Encodes Three Bona Fide Ubiquitin-Specific Proteases
J. Virol.,
November 1, 2008;
82(21):
10477 - 10486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, C. M. Livingston, S. D. Carrington-Lawrence, P. Bai, and S. K. Weller
A Mutation in the Human Herpes Simplex Virus Type 1 UL52 Zinc Finger Motif Results in Defective Primase Activity but Can Recruit Viral Polymerase and Support Viral Replication Efficiently
J. Virol.,
August 15, 2007;
81(16):
8742 - 8751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Slanina, S. Weger, N. D. Stow, A. Kuhrs, and R. Heilbronn
Role of the Herpes Simplex Virus Helicase-Primase Complex during Adeno-Associated Virus DNA Replication.
J. Virol.,
June 1, 2006;
80(11):
5241 - 5250.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, S. D. Carrington-Lawrence, P. Bai, and S. K. Weller
Mutations in the Putative Zinc-Binding Motif of UL52 Demonstrate a Complex Interdependence between the UL5 and UL52 Subunits of the Human Herpes Simplex Virus Type 1 Helicase/Primase Complex
J. Virol.,
July 15, 2005;
79(14):
9088 - 9096.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Seybert, C. C. Posthuma, L. C. van Dinten, E. J. Snijder, A. E. Gorbalenya, and J. Ziebuhr
A Complex Zinc Finger Controls the Enzymatic Activities of Nidovirus Helicases
J. Virol.,
January 15, 2005;
79(2):
696 - 704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. H. Stracker, G. D. Cassell, P. Ward, Y.-M. Loo, B. van Breukelen, S. D. Carrington-Lawrence, R. K. Hamatake, P. C. van der Vliet, S. K. Weller, T. Melendy, et al.
The Rep Protein of Adeno-Associated Virus Type 2 Interacts with Single-Stranded DNA-Binding Proteins That Enhance Viral Replication
J. Virol.,
January 1, 2004;
78(1):
441 - 453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Carrington-Lawrence and S. K. Weller
Recruitment of Polymerase to Herpes Simplex Virus Type 1 Replication Foci in Cells Expressing Mutant Primase (UL52) Proteins
J. Virol.,
April 1, 2003;
77(7):
4237 - 4247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Carastro, C.-K. Tan, M. Selg, H.-M. Jack, A. G. So, and K. M. Downey
Identification of delta helicase as the bovine homolog of HUPF1: demonstration of an interaction with the third subunit of DNA polymerase delta
Nucleic Acids Res.,
May 15, 2002;
30(10):
2232 - 2243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Sampson, M. E. Arana, and P. E. Boehmer
Cysteine 111 Affects Coupling of Single-stranded DNA Binding to ATP Hydrolysis in the Herpes Simplex Virus Type-1 Origin-binding Protein
J. Biol. Chem.,
January 28, 2000;
275(4):
2931 - 2937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Biswas and S. K. Weller
The UL5 and UL52 Subunits of the Herpes Simplex Virus Type 1 Helicase-Primase Subcomplex Exhibit a Complex Interdependence for DNA Binding
J. Biol. Chem.,
May 11, 2001;
276(20):
17610 - 17619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Poplawski, B. Grabowski, S. E. Long, and Z. Kelman
The Zinc Finger Domain of the Archaeal Minichromosome Maintenance Protein Is Required for Helicase Activity
J. Biol. Chem.,
December 21, 2001;
276(52):
49371 - 49377.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|