|
J Biol Chem, Vol. 274, Issue 12, 8123-8128, March 19, 1999
RIN ZF, a Novel Zinc Finger Gene, Encodes Proteins
That Bind to the CACC Element of the Gastrin Promoter*
Loyal G.
Tillotson
From the Division of Digestive Diseases and Nutrition, Department
of Medicine, University of North Carolina, Chapel Hill,
North Carolina 27599
 |
ABSTRACT |
Expression of gastrin, a gut hormone and growth
factor, has tissue-specific transcriptional regulation and can be
induced in some tumors. Previous studies have shown that a CACC
cis-regulatory element is important for transcriptional
activation in pancreatic insulinoma cells. To identify CACC-binding
proteins, a phage cDNA library derived from a rat insulinoma
cell line, RIN 38A, was screened by a Southwestern method. A novel
member of the Cys2-His2 zinc finger gene family
was cloned and designated RIN ZF, having a cDNA
sequence of 3.8 kilobases. One full-length and a shorter splice variant
were sequenced and had predicted protein masses of 91.6 and 88.7 kDa.
Expression of both splice forms were ubiquitous in fetal and adult rat
tissues. Recombinant RIN ZF protein exhibited sequence-specific binding
to the gastrin CACC element in a gel mobility shift assay. In transient
transfections, both splice variants appeared to have only weak
activating effects on gastrin-luciferase reporter gene transcription.
Furthermore, RIN ZF coexpression with Sp1 appeared to block the
strongly activating effects of Sp1 mediated through the CACC element.
These findings suggest that a novel set of zinc finger proteins may
help regulate gastrin gene expression by interfering with Sp1 transactivation.
 |
INTRODUCTION |
Gastrin, a peptide hormone and growth factor of the
gastrointestinal tract, is expressed in a developmental and
tissue-specific manner. In development, gastrin is highly expressed in
fetal pancreatic islet precursor cells and in the fetal colon (1, 2).
After birth, expression greatly diminishes in those sites and shifts to
expression in the stomach and proximal small intestine. Gastrin expression occurs in adenocarcinoma of the colon (3) and pancreas (4)
and in some pancreatic endocrine tumors. In these neoplastic tissues,
gastrin functions as a tumor growth factor. Therefore, elucidation of
transcriptional control mechanisms may provide insights into induction
of oncofetal gene expression in neoplasia.
Transgenic studies with rat-human gastrin gene hybrids demonstrate
appropriate tissue-specific and developmental expression as long as the
promoter contains proximal 5'-flanking sequence joined to the first
exon (5). Further studies have shown that gastrin transcriptional
regulation is in large part mediated through trans-factor
interactions along the proximal 5'-flanking sequence (5, 6). Multiple
cis-regulatory elements have been identified in the gastrin
promoter, including Sp1 sites (7, 8), homeodomain-like elements (8), a
negative element (9), E-box binding sites (10), an epidermal growth
factor-regulated protein binding site (11), and a CACC element (6).
Systematic scanning mutagenesis of the proximal gastrin promoter
suggests that the CACC element, located approximately 110 bp1 from the transcriptional
start site, is necessary for promoter activity in rat insulinoma (8)
and human colon cancer cell lines (12). Mutational analysis of the CACC
element showed a close correlation between DNA binding by protein
complexes and transcriptional activation of gastrin-luciferase reporter
genes in insulinoma cell lines. Efforts to purify DNA-binding proteins by sequence-specific affinity chromatography (13) were successful, but
the yield was too low for peptide sequencing (6). Therefore, a
different approach was followed by probing electrophoretic blots of
insulinoma cell extracts with multimerized CACC element DNA probes.
These Southwestern blots revealed several DNA-binding protein bands
from 70-110 kDa in size (6). Sequence specificity of the DNA binding
was verified by probing with a multimerized analog of the CACC element
containing two base mutations. The same mutations rendered a
gastrin-luciferase reporter gene functionally inactive, and hence, when
used as a southwestern probe, clearly differentiated specific from
nonspecific binding. In the current study, a Southwestern binding
approach was employed to screen a phage, insulinoma cDNA
expression library for CACC-binding proteins.
 |
EXPERIMENTAL PROCEDURES |
cDNA Library Construction and Screening--
RIN 38A cell
total RNA preparation and two rounds of poly(A) selection
(oligo(dT)-cellulose spin column; Amersham Pharmacia Biotech) were
accomplished by established methods (14). A gt11 cDNA library
was then commercially prepared (Stratagene, La Jolla, CA). Subsequent
screening of the library for CACC DNA binding employed the Southwestern
blot method of Singh and co-workers (15). The unamplified library
(106 plaque-forming units) was plated with Y1090 bacteria
and induced with isopropyl-1-thio- -galactoside-coated nitrocellulose
filters for 6 h. Filters were then treated and probed as described
previously (6). Nick-translated, double-stranded DNA probes were
prepared from concatamers of CACC element containing sequences
(CCCCACCCCAT)6 (wild type minimal CACC element),
(CCCCACCCCATTCCTCTCGCCTGGA)4 (wild type), and
(CCACACCACATTCCTCTCGCCTGGA)4 (mutant
gastrin promoter elements). After four rounds of plaque isolation,
those phage positive for wild type binding and negative for the mutant probe were amplified and prepared (lambda kit, Qiagen, Valencia, CA).
Phage cDNA inserts were subcloned into pGem 7 vectors (Promega, Madison, WI) and sequenced by dideoxy sequencing methods (Sequenase; Amersham Pharmacia Biotech). Subsequent rounds of library screening for
cDNA fragments overlapping with clone 25A were accomplished by
nucleic acid hybridization with nick-translated fragments of EcoRI/SalI 25A and EcoRI/Bsu1 25B
digests. Clone 25F had approximately 75% GC content, which
necessitated sequencing by the Maxim-Gilbert chemical method (14). All
cDNA fragments subcloned in pGEM 7 were sequenced along both sense
and antisense strands to confirm the sequence information. Sequence
formatting, assembly, and analysis were aided by MacVector and
AssemblyLIGN programs (Oxford Molecular Group, PLC) and GenBank 228 (National Center for Biotechnology Information).
RT-PCR Analysis of RIN ZF Expression--
Total RNA was prepared
from fresh BALB/c rat tissues by established methods (14). Fetal rat
tissues were obtained on approximately days 5-7 of gestation. cDNA
transcripts were synthesized from a 20-µl reaction of 1 µg of total
RNA in 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 20 units of RNase inhibitor (RNasin,
Promega), 25 units of M-murine leukemia virus reverse transcriptase
(New England Biolabs, Beverly, MA), and 20 pmol of a RIN ZF antisense primer, 5'-TGATCCCGTGATGAAGTCAGGCCATCTCTA (double underline,
Fig. 2). After incubation at 42° for 1 h, the reaction was
stopped by heating to 95 °C for 5 min. The reaction was diluted to
100 µl and the buffer adjusted to 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2,
and 20 pmol of a RIN ZF forward primer, 5'-GCGGTACTCCAATGATACTG (underline, Fig. 2) was added. The reaction was heated to
95 °C and cooled to 80 °C before 2.5 units of Taq
polymerase (AmpliTaq, Perkin-Elmer) was added to start the PCR reaction
for a total of 35 cycles (94 °C/30 s, 60 °C/30 s, 72 °C/2 min).
Recombinant RIN ZF Protein Production--
A 5'-truncated
version of RIN ZFsv was developed by PCR amplification from clone 25C
of a 962-bp fragment (bases 1181-2143) that was subsequently ligated
into the SalI site of clone 25A-pGem 7. The recombinant
product was then excised with BamHI digest and ligated into
a pGex 2T bacterial expression vector (Amersham Pharmacia Biotech).
Recombinant glutathione S-transferase (GST), GST-truncated
RIN ZFsv, and GST-Elk were expressed in JM109 Escherichia coli by a modified bacterial expression method (17). Briefly, transformed bacteria were grown at 37 °C overnight on LB ampicillin (50 µg/ml) plates. The bacterial colonies were then suspended into LB
broth (100 µg/ml ampicillin, 0.2 mM
isopropyl-1-thio- -galactoside, 10 µM
ZnSO4) and incubated at 30 °C for 3 h (200 rpm
shaking) before harvest and protein extraction. Extracts were prepared by sonication and purified by glutathione-Sepharose affinity binding by
well established methods (18). Gel mobility shift assays were by
previously described methods (6).
Transfection of SL 2 Cells and Recombinant Protein
Expression--
The full-length coding region and 3'-untranslated
sequences of RIN ZF and RIN ZFsv were excised and ligated in-frame with a start codon into an actin promoter-driven expression vector, pPac
(19). The coding region and 3'-untranslated region for clone 25A,
designated truncated RIN ZF (Fig. 5A), was ligated in-frame
with a start site into a pPac expression vector. Expression of all
three versions was confirmed by in vitro transcription and
translation (data not shown). Gastrin-luciferase reporter plasmids (6)
included one with a proximal gastrin promoter and another with a
concatamer of the CACC element. The 200 Gas-Luc plasmid has 200 bp of
5'-flanking sequence and noncoding exon 1 of human gastrin ligated to
the coding sequence for luciferase. The (CACC)6 pT81Luc
plasmid has a 6-mer of CCCCACCCCAT oligonucleotide from the CACC
element ligated to a heterologous thymidine kinase promoter and
luciferase reporter gene. Drosophila SL2 cells were passaged
in complete Schneider's media (Life Technologies, Inc.) supplemented
with 10% fetal bovine serum 1 day before transfection. Plasmid
preparations were by anionic exchange resin (Qiagen) and subsequent
Ca3(PO4)2-mediated transfection
into 6-well plates (35-mm wells) was by established methods (18).
Expression and reporter gene plasmids were cotransfected in equivalent
amounts (0.5 µg/well), and cells were harvested for luciferase and
Bradford protein assays (20) at 48 h post-transfection.
Transfected wells were in triplicate, and each experiment was repeated
four times for confirmation.
 |
RESULTS |
RIN ZF Cloning--
A gt11 phage expression library was
constructed from poly(A)-selected RNA obtained from RIN 38A cells, a
rat insulinoma cell line. Previously, several DNA-binding proteins
demonstrating sequence-specific binding to the CACC element in the
gastrin promoter were detected in nuclear extracts from RIN 38A cells.
Approximately 1 × 106 plaque-forming units of phage
were screened by a Southwestern binding assay using a
nick-translated-labeled six-copy concatamer of the human gastrin CACC
element. Twelve positive clones were identified and subsequently
screened with a mutated CACC concatamer probe to verify sequence
specificity. Four true-positive CACC-binding phage isolates were then
plaque-purified. After subcloning and sequencing the cDNA inserts,
gene fragments homologous to rat Sp1 (accession number D12768) (20) and
closely homologous to mouse Pur-1 (95% identity, accession number
L04649) (21) and human SPR-2 (94% identity, accession number X68560)
(22) were identified. All of the cDNA inserts identified in this
assay for CACC binding possessed zinc finger domains of the
Cys2-His2 type, including one, clone 25A, which
otherwise had no close homology with known genes. The latter clone was
chosen for further investigation.
Clone 25A was fully sequenced and found to be 2082 bases long and had
an open reading frame (ORF) from the 5' end extending 1413 bases.
Within the 25A ORF were two complete and one partial Cys2-His2 zinc finger domains. The subsequent
screening, plaque purification, subcloning, and sequencing of cDNA
fragments homologous to 25A is shown in schematic form in Fig.
1. cDNA fragments 25B, C, D, and E
were identified by screening for homology to the 5'-Sal fragment of
25A. Clones 25B and E were identical in their overlapping regions, as
were 25C and D. However, the pairs differed from each other presumably
by splice variation in an 87-base pair region that was not present in
25C and D. A 5'-Bsu fragment from 25B was then used to
screen the library for the clone 25F. The overlapping sequences of 25F
with 25B-E were identical. As shown in Fig.
2, assembly of the overlapping
25A-F-cloned fragments yielded a cDNA sequence of 3850 bases.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic diagram of cDNA clones isolated
from RIN 38A gt11 phage library. Clones
A, B, E, and F had
identical sequences in overlapping segments, whereas clones
C and D were identical except for the splice
variation. Hatch marks denote 500 bases. Zinc finger domain
is noted in the boxed ZF, and the splice site is marked by
triangulating lines.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 2.
RIN ZF cDNA sequence with open reading
frame translation. Boxed bases identify the splice
variation. Double-dotted underlined bases denote the zinc
finger domains. Single and double-underlined
bases denote forward and reverse PCR primer sites, respectively. The
translated sequence of RIN ZF ORF is noted in italics.
|
|
Analysis of the assembled cDNA sequence revealed a single long ORF
from 674 to 3180 (Fig. 2). The ATG codon from base 674 is within a
favorable context for initiation (23). This putative initiator codon
has three upstream, in-frame terminator codons. Of the other three
upstream ATG sequences present, all are out-of-frame and have a very
weak context for initiation. The full-length ORF encodes a putative
protein of 836 amino acids in length with a predicted molecular weight
of 91 kDa. As previously noted, several of the cDNA sequences
differed in the lack of an 87-base pair sequence shown in Fig. 2 in the
boxed sequence. This apparent splice variation is located
between bases 1457 and 1544, which is equivalent to a 29-codon
difference. The exon donor and recipient half-sites conform with known
splice site consensus motifs (24). The predicted molecular weight of
the smaller splice variant is 89 kDa. The zinc finger motifs are of the
Cys2-His2 type and are located near the
COOH-terminal region. Two complete zinc finger domains and one partial
domain are present and have the typical seven-codon HC connector
sequences. However, these sequences are not similar to the
Krüppel consensus motifs (25). Gapped BLAST (V2.0) (16) sequence
analysis of the RIN ZF DNA and its translated sequences did not find
any matches or close homologies with known genes.
RIN ZF mRNA Expression--
To determine the expression of the
RIN ZF genes, poly(A)-selected RNA from Rin 38A, Rin B6, and
Rin 1056 cell lines were probed in Northern blot analysis. Only three
weak bands were detected at approximately 2.0, 5.0, and 9.0 kb in size
(data not shown). An RT-PCR approach was then employed to determine the
tissue and developmental expression pattern of the RIN ZF
genes. Oligonucleotide primers flanking the putative splice sites were
used in the RT-PCR assay shown in Fig. 3.
Panels of adult and fetal rat RNA samples were screened and yielded the
predicted PCR products of 791 and 704 bp in size. Both PCR products
were isolated, subcloned, and sequenced, confirming their identity with
the selected regions of the full-length and splice variant cDNA
library clones. The RIN ZF gene appears to be ubiquitously
expressed, having message present in all the fetal and adult rat
tissues tested. Although both forms of RIN ZF were detected, the
relative expression of each may be variable because this RT-PCR assay
was not quantitative. RNA from RIN cell lines 38A, B2, B6, 1056C, rat
fibroblast Rat2, myoblast L8, and pancreatic AR42J cell lines also
yielded PCR products of 791 and 704 bp (data not shown).

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 3.
Reverse transcriptase PCR amplification of
RIN ZF primed mRNA from rat tissues. Total RNA was isolated
from fetal and adult rat tissues and used in RT-PCR reaction as noted
under "Experimental Procedures." RIN 38A cell total RNA is denoted
as 38A, with (+RT) or without ( RT) reverse
transcriptase enzyme. RT-PCR products and DNA size markers were
resolved on 1.5% agarose gel. RIN ZF primers encompassed the splice
variation region as noted in Fig. 2.
|
|
Recombinant RIN ZF Gel Mobility Shift Assay--
An expression
vector for GST fusion-RIN ZF protein was developed by ligating an
in-frame sequence of a truncated form of the splice variant into pGEX
2T vector. Recombinant GST-RinZF protein was prepared and had an
approximate molecular size of 66 kDa (data not shown). Recombinant GST,
GST-Elk, and GST-RIN ZF were used in a gel mobility shift assay with a
gastrin CACC element probe. As shown in Fig.
4, only the GST-RIN ZF had CACC DNA
binding and probe shift. The GST-RIN ZF binding was sequence-specific,
because 50-fold excess of cold wild type competitor oligonucleotide
completely competed probe binding. However, a 50-fold excess of an
oligonucleotide with a 2-bp mutation failed to compete. Therefore,
recombinant RIN ZF has the correct sequence specificity of DNA-binding
proteins that interact with the gastrin CACC cis-regulatory
element. It is noteworthy that the doublet banding pattern of the
gel-shifted probe obtained with GST-RIN ZF is similar to that
previously observed with Rin 38A nuclear extracts (6).

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 4.
Gel mobility shift assay with CACC
oligonucleotide probe and recombinant extracts of GST, GST-Elk, and
GST-RIN ZF proteins. Bacterial expression extracts were prepared,
and recombinant GST fusion proteins were purified by affinity binding
to glutathione beads as described under "Experimental Procedures."
Equivalent volumes (25 µl) of purified extracts were mixed with
32P-labeled wild type CACC oligonucleotide probe
(CCCCACCCCATTCCTCTCGCCTGGA). A 50-fold excess of unlabeled wild type
(WT) CACC or mutant (Mut) CACC
(CCACACCACATTCCTCTCGCCTGGA) oligonucleotides
were added as competitors where indicated. After electrophoresis in 4%
nondenaturing polyacrylamide gel, the gel was dried and exposed to film
for 12 h.
|
|
RIN ZF Activation of Gastrin-Luciferase Expression--
It was
initially predicted that RIN ZF would be an activating transcription
factor because the CACC element was a positive cis-regulatory element in the gastrin promoter. However,
initial results of expression of RIN ZF in mammalian cells showed only weak activation, perhaps because of the presence of other transcription factors. Therefore, RIN ZF expression vectors were transfected into
Drosophila SL2 cells, as they had no Sp1-like activity (26). As shown in Fig. 5A, pPac
vectors for the expression of full-length, splice variant, and
5'-truncated forms of RIN ZF were utilized. These expression vectors
were cotransfected into SL2 cells with a proximal gastrin promoter
luciferase reporter gene, and the results shown in Fig. 5B.
The full-length and splice variant versions had only modest activating
effects on 200 Gastrin-Luc reporter gene expression, resulting in
2-3-fold increase over the empty vector, pPac. A 5'-truncated version
of RIN ZF lacking 365 codons of the 5'-coding region but still
possessing the zinc finger domains failed to activate the reporter gene
expression. Because the function of some zinc finger transcription
factors may be concentration-dependent (28), RIN ZF
expression plasmids were transfected over a concentration range of
0.05-2.0 µg/well. However, there was no significant change in the
overall pattern of weak transcriptional activation of
gastrin-luciferase expression (data not shown).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 5.
Transfection of SL-2 cells with RIN ZF
expression vectors and 200 Gastrin-Luc reporter genes.
A, schematic diagram of RIN ZF-coding sequences in pPac
actin promoter expression vectors. Each RIN ZF plasmid contained the
zinc finger DNA binding domains but had varying lengths of
amino-terminal ends. B, SL-2 cells were transiently
transfected with pPac RIN ZF plasmids or empty pPac plasmid and a
gastrin-luciferase reporter plasmid containing 200 bp of 5'-flanking
sequence of the gastrin promoter. Luciferase and protein assays were
conducted at 48 h after transfection. Data are relative light
units/µg of protein in triplicate samples. aa, amino
acids.
|
|
To examine whether RIN ZFsv can act synergistically with Sp1 or inhibit
Sp1 transactivation, expression plasmids for both were cotransfected
into SL2 cells with a (CACC)6pT81Luc reporter gene. As
shown in Fig. 6, Sp1 strongly
transactivated CACC-Luc expression compared with the modest
transactivation associated with RIN ZFsv. When the two expression
vectors were cotransfected in equivalent amounts, the CACC-Luc
transactivation was 80% lower than the Sp1 alone. Increasing the
amounts of RIN ZFsv further diminished but did not completely block the
Sp1 effect. Similar results were obtained from cotransfection of the
full-length form of RIN ZF with Sp1 (data not shown). These results
suggest that RIN ZF does not act synergistically with Sp1 but rather
completes for binding to the CACC element.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
Co-transfection of SL-2 cells with RIN ZF and
Sp1 expression vectors and a (CACC)6 pT 81 Luc reporter
gene. A pPac Sp1 plasmid (0.25 µg/well) was cotransfected with
varying amounts of the splice variant RIN ZF, pPac plasmid (0-1
µg/well). Empty vector pPac was cotransfected to maintain equivalent
total plasmid amounts in each transfection. Six copies of
concatamerized CACC elements in a heterologous pT81 Luc vector served
as the reporter gene. Luciferase reporter gene activity and protein
assays were conducted 48 h after transfection. Data are relative
light units (RLU)/µg of protein in triplicate
samples.
|
|
 |
DISCUSSION |
Several hundred transcription factors have been cloned and
identified by a variety of methods over the past decade (27). Some,
like Sp1, were identified after purification of the native factor by
DNA affinity chromatography (13). Although this approach was initially
applied to the gastrin CACC-binding protein (6), it proved to be
impractical given the low abundance of the CACC binding factors. An
alternative approach of screening of a cDNA expression library by
DNA binding (28) was pursued because several CACC-binding proteins
ranging in size from 70-110 kDa were evident on a Southwestern blot of
RIN 38A cell extracts (6). Potential disadvantages of this approach are
that many transcription factors do not retain their DNA binding
properties under the screening conditions, and some require co-factors
or dimerization to bind in a sequence-specific manner. In addition,
DNA-binding proteins possessing broad sequence specificity can generate
false positive clones (29). With these caveats in mind, screening a RIN
38A cDNA library yielded several clones that showed strong binding activity to a concatamer of the gastrin CACC element. A secondary screen with mutant CACC concatamer probe verified sequence specificity by RIN ZF and several known zinc finger transcription factors. To
ensure that RIN ZF CACC binding was not an artifact of a concatamerized probe, sequence specificity was confirmed by gel mobility shift assay
with a monomeric CACC element probe.
As previously noted, although several CACC binding proteins were
detected in RIN cell nuclear extracts, a 70-kDa protein appeared most
prominent. Interestingly, none of the positive clones identified in the
Southwestern screen appeared to encode a 70-kDa protein. Although
unlikely, it is possible that RIN ZF and the 70-kDa protein are the
same if RIN ZF has an alternative translational initiation site from
the one predicted by ORF analysis. A number of viral and cellular genes
have been identified that yield multiple protein products resulting
from alternative initiation of translation. It has been observed that
growth factor and transcription factor mRNAs possessing long G + C-rich 5'-untranslated regions exhibit alternative translation
initiation, often through internal ribosome entry sites (30-32).
Similarly, RIN ZF has greater than 75% G + C content in the 5'
kilobases of sequence, which likely has significant secondary structure
inhibitory of ribosomal scanning. The issue of the relative size of
native RIN ZF proteins remains to be resolved by immunoblotting studies
with antisera prepared against recombinant RIN ZF.
Apart from the Cys2-His2 zinc finger domains,
the RIN ZF coding sequence bears little resemblance to other reported
zinc finger genes. Specifically, there were no Krüppel (25) or
BTB domains (33), which were first described in Drosophila
but are common in higher organisms. Other transcription factor domains
such as homeotic (34, 35), leucine zipper (36, 37), Ets (38), and basic
helix-loop-helix (39) also were not found in RIN ZF. Subdividing the
RIN ZF coding sequence and searching by BLAST alignment failed to
reveal any close homology with known genes. However, searching an
expressed sequence-tagged data base revealed a close match with an
expressed sequence tag derived from microdissected human prostatic
intraepithelial neoplasia 2 cells (accession number AA602975). This
299-bp expressed sequence tag overlapped 221 bases of the RIN ZF from
2044 to 2265, with an homology of 94%. In separate studies, we used
the RIN ZF PCR primers and DNA prepared from a human gastric tumor cell
line, AGS, to amplify the splice site domains. After subcloning the PCR
products, sequencing revealed a 98% homology between rat and human
sequences (data not shown). These results suggest that RIN ZF is a
conserved gene and has a human homolog.
The mRNA expression pattern of RIN ZF is not limited to those
tissues that express gastrin. Both splice forms appear to be ubiquitously expressed and not developmentally regulated. However, these observations are limited by the RT-PCR method to a qualitative assessment of message in whole tissues. Immunohistochemistry with antisera specific to the full-length and splice variant forms of RIN ZF
would better define the expression pattern and perhaps provide insights
into functionality. It is noteworthy that some zinc finger
transcription factors are developmentally regulated by expression of
alternatively spliced variants (40). Several transcription factors were
found to have splice variations in the DNA binding domains (41) as well
as in activation or repression domains (42). However, the RIN ZF splice
site domain, which is 5' to the zinc finger domains, consists of
largely neutral amino acids and has no recognizable motif. Therefore
the functional differences between the splice variants remains to be determined.
Both full-length and splice variant RIN ZF appeared to have weak
trans-activating effects on the gastrin promoter, whereas the truncated form had no effect (Fig. 5B). These results
indicate that within the RIN ZF amino-terminal region is an activation domain, despite the lack of recognizable activation motifs, such as
homopolymeric glutamine and proline-rich stretches (43). Instead, RIN
ZF possesses several regions rich in basic residues, often associated
with repressor domains (44). It may be that RIN ZF have intrinsically
weak transactivation domains or may require the presence of
coactivating factors (45) not present in the Drosophila
cells. Some zinc finger proteins contain both activation and repression
domains (46) and may be regulated by the context of the promoter
binding site or transcriptional cofactors. Further studies with
chimeric RIN ZF deletional constructs are in progress to determine
functional activity of RIN ZF domains.
It has been shown that some zinc finger proteins, such as
Krüppel, have opposite regulatory effects that are
concentration-dependent (47). Sauer and Jäckle (47)
found that monomers of Krüppel activate, whereas dimers repress
transcription even though both forms bind to the same element. In
contrast, RIN ZF expression vector did not vary in its activating
effects on gastrin-luciferase transcription throughout a wide
concentration range. Alternatively, RIN ZF may have a down-regulatory
effect on gastrin transcription by interfering with Sp1 binding or
function. BKLF, or basic Krüppel-like factor, is one example of a
zinc finger protein that competes with Sp1 binding at a CACCC element
of the -globin gene in erythroid cells (48). Similarly, ZBP-89
competes with Sp1 in binding to a GC-rich proximal element in the
gastrin gene (49). As Merchant and her colleagues have shown (49),
ZBP-89 inhibits Sp1 binding and blocks epidermal growth factor
induction of gastrin transcription. Other mechanisms of altering Sp1
activity include functional interactions with other transcription
factors (50), changing the Sp1 phosphorylation state (51) or targeting
Sp1 for proteolysis (52). The most likely mechanism is that RIN ZF
competes with Sp1 binding at the CACC element, but further studies are
needed to determine binding affinities and footprints.
 |
ACKNOWLEDGEMENTS |
I am grateful to Philip J. Davis, James
F. Preston, and Dr. Shu-Li Wang for technical assistance. Many
thanks to Dr. Todd S. Gulick for advice regarding recombinant protein
expression. I greatly appreciate the support and encouragement
given by Dr. Stephen J. Brand at the start of this project.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant R29 DK49860.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF091457.
To whom correspondence should be addressed: CB7038, Rm. 148 Glaxo
Bldg., University of North Carolina, Chapel Hill, NC 27599-7038. Tel.:
919-966-7884; Fax: 919-966-7468; E-mail: lgtgi{at}med.unc.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
bp, base pair(s);
RT-PCR, reverse transcriptase polymerase chain reaction;
GST, glutathione S-transferase;
ORF, open reading frame;
RIN ZF, zinc finger gene cloned from rat insulinoma 38A
cells;
RIN ZFsv, splice variant;
BLAST, basic local alignment search
tool.
 |
REFERENCES |
-
Larsson, L.,
Rehfeld, J.,
Sundler, F.,
and Hakanson, R.
(1976)
Nature
262,
609-610[CrossRef][Medline]
[Order article via Infotrieve]
-
Luttichau, H. R.,
Van Solinge, W. W.,
Nielsen, F. C.,
and Rehfeld, J. F.
(1993)
Gastroenterology
104,
1092-1098[Medline]
[Order article via Infotrieve]
-
Van Solinge, W. W.,
Nielsen, F. C.,
Friis-Hansen, L.,
Falkmer, U. G.,
and Rehfeld, J. F.
(1993)
Gastroenterology
104,
1099-1107[Medline]
[Order article via Infotrieve]
-
Smith, J. P.,
Fantaskey, A. P.,
Liu, G.,
and Zagon, I. S.
(1995)
Am. J. Physiol.
268,
R135-R141[Abstract/Free Full Text]
-
Wang, T. C.,
Babyatsky, M. W.,
Oates, P. S.,
Zhang, Z.,
Tillotson, L.,
Chulak, M.,
Brand, S. J.,
and Schmidt, E. V.
(1995)
Am. J. Physiol.
268,
G1025-G1036[Abstract/Free Full Text]
-
Tillotson, L. G.,
Wang, T. C.,
and Brand, S. J.
(1994)
J. Biol. Chem.
269,
2234-2240[Abstract/Free Full Text]
-
Merchant, J. L.,
Demediuk, B.,
and Brand, S. J.
(1991)
Mol. Cell. Biol.
11,
2686-2696[Abstract/Free Full Text]
-
Chung, D. C.,
Brand, S. J.,
and Tillotson, L. G.
(1995)
J. Biol. Chem.
270,
8829-8836[Abstract/Free Full Text]
-
Wang, T. C.,
and Brand, S. J.
(1990)
J. Biol. Chem.
265,
8908-8914[Abstract/Free Full Text]
-
Demediuk, B. H.,
Tillotson, L. G.,
and Brand, S. J.
(1992)
Gastroenterology
102,
728[Medline]
[Order article via Infotrieve] (abstr.)
-
Merchant, J. L.,
Shumaker, D.,
Abrazinckas, D.,
and Shiotani, A.
(1993)
Gastroenterology
104,
283 (abstr.)
-
Tillotson, L.,
Chung, D.,
and Brand, S.
(1993)
Gastroenterology
104,
456 (abstr.)
-
Kadonaga, J. T.,
and Tjian, R.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
5889-5893[Abstract/Free Full Text]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 7.12-7.22, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Singh, H.,
LeBowitz, J. H.,
Baldwin, A. S.,
and Sharp, P. A.
(1988)
Cell
52,
415-423[CrossRef][Medline]
[Order article via Infotrieve]
-
Altschul, S.,
Gish, W.,
Miller, W.,
Myers, E.,
and Lipman, D.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
-
Suter-Crazzolara, C.,
and Unsicker, K.
(1995)
Biotechniques
19,
202-204[Medline]
[Order article via Infotrieve]
-
Smith, D. B., and Corcoran, L. M. (1997) in Current Protocols in
Molecular Biology (Chanda, V., ed) 2 vols., pp. 16.7.1-16.7.7,
John Wiley & Sons, Inc., New York
-
Courey, A. J.,
and Tjian, R.
(1988)
Cell
55,
887-898[CrossRef][Medline]
[Order article via Infotrieve]
-
Imataka, H.,
Sogawa, K.,
Yasumoto, K.,
Kikuchi, Y.,
Sasano, K.,
Kobayashi, A.,
Hayami, M.,
and Fujii-Kuriyama, Y.
(1992)
EMBO J.
11,
3663-3671[Medline]
[Order article via Infotrieve]
-
Kennedy, G. C.,
and Rutter, W. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11498-11502[Abstract/Free Full Text]
-
Hagen, G.,
Muller, S.,
Beato, M.,
and Suske, G.
(1992)
Nucleic Acids Res.
20,
5519-5525[Abstract/Free Full Text]
-
Kozak, M.
(1996)
Mamm. Genome
7,
563-574[CrossRef][Medline]
[Order article via Infotrieve]
-
Mount, S.
(1982)
Nucleic Acids Res.
10,
459-472[Abstract/Free Full Text]
-
Bellefroid, E.,
Lecocq, P.,
Benhida, A.,
Poncelet, D.,
Belayew, A.,
and Martial, J.
(1989)
DNA (N. Y.)
8,
377-387[Medline]
[Order article via Infotrieve]
-
Hagen, G.,
Muller, S.,
Beato, M.,
and Suske, G.
(1994)
EMBO J.
13,
3843-3851[Medline]
[Order article via Infotrieve]
-
Pabo, C.,
and Sauer, R.
(1992)
Annu. Rev. Biochem.
61,
1053-1095[CrossRef][Medline]
[Order article via Infotrieve]
-
Singh, H.,
Clerc, R. G.,
and LeBowitz, J. H.
(1989)
Biotechniques
7,
252-261[Medline]
[Order article via Infotrieve]
-
Stuempfle, K.,
and Floros, J.
(1997)
Biotechniques
22,
260-264[Medline]
[Order article via Infotrieve]
-
Vagner, S.,
Gensac, M. C.,
Maret, A.,
Bayard, F.,
Amalric, F.,
Prats, H.,
and Prats, A. C.
(1995)
Mol. Cell. Biol.
15,
35-44[Abstract]
-
Akiri, G.,
Nahari, D.,
Finkelstein, Y.,
Le, S. Y.,
Elroy-Stein, O.,
and Levi, B. Z.
(1998)
Oncogene
17,
227-236[CrossRef][Medline]
[Order article via Infotrieve]
-
Kozak, M.
(1991)
J. Cell Biol.
115,
887-903[Abstract/Free Full Text]
-
Zollman, S.,
Godt, D.,
Priv, G. G.,
Couderc, J. L.,
and Laski, F. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
10717-10721[Abstract/Free Full Text]
-
Affolter, M.,
Schier, A.,
and Gehring, W. J.
(1990)
Curr. Opin. Cell Biol.
2,
485-495[CrossRef][Medline]
[Order article via Infotrieve]
-
Harada, R.,
Dufort, D.,
Denis-Larose, C.,
and Nepveu, A.
(1994)
J. Biol. Chem.
269,
2062-2067[Abstract/Free Full Text]
-
Chaplin, T.,
Ayton, P.,
Bernard, O. A.,
Saha, V.,
Della Valle, V.,
Hillion, J.,
Gregorini, A.,
Lillington, D.,
Berger, R.,
and Young, B. D.
(1995)
Blood
85,
1435-1441[Abstract/Free Full Text]
-
Landschulz, W.,
Johnson, P.,
and McKnight, S.
(1988)
Science
240,
1759-1764[Abstract/Free Full Text]
-
Wasylyk, B.,
Hahn, S.,
and Giovane, A.
(1993)
Eur. J. Biochem.
211,
7-18[Medline]
[Order article via Infotrieve]
-
Jan, Y.,
and Jan, L.
(1993)
Cell
75,
827-830[CrossRef][Medline]
[Order article via Infotrieve]
-
Hsu, T.,
Gogos, J.,
Kirsh, S.,
and Kafatos, F.
(1992)
Science
257,
1946-1955[Abstract/Free Full Text]
-
Cabanillas, A. M.,
and Darling, Y. J.
(1996)
DNA Cell Biol.
15,
643-651[Medline]
[Order article via Infotrieve]
-
Foulkes, N.,
and Sassone-Corsi, P.
(1992)
Cell
68,
411-414[CrossRef][Medline]
[Order article via Infotrieve]
-
Gerber, H.-P.,
Seipel, K.,
Georgiev, O.,
Hofferer, M.,
Hug, M.,
Rusconi, S.,
and Schaffner, W.
(1994)
Science
263,
808-814[Abstract/Free Full Text]
-
Saha, S.,
Brickman, J.,
Lehming, N.,
and Ptashne, M.
(1993)
Nature
363,
648-652[CrossRef][Medline]
[Order article via Infotrieve]
-
Pugh, B. F.,
and Tjian, R.
(1990)
Cell
61,
1187-1197[CrossRef][Medline]
[Order article via Infotrieve]
-
Yet, S.-F.,
McA'Nulty, M. M.,
Folta, S. C.,
Yen, H.-W.,
Yoshizumi, M.,
Hsich, C.-M.,
Layne, M. D.,
Chin, M. T.,
Wang, H.,
Perrella, M. A.,
Jain, M. K.,
and Lee, M.-E.
(1998)
J. Biol. Chem.
273,
1026-1031[Abstract/Free Full Text]
-
Sauer, F.,
and Jackle, H.
(1993)
Nature
364,
454-457[CrossRef][Medline]
[Order article via Infotrieve]
-
Crossley, M.,
Whitelaw, E.,
Perkins, A.,
Williams, G.,
Fujiwara, Y.,
and Orkin, S.
(1996)
Mol. Cell. Biol.
16,
1695-1705[Abstract]
-
Merchant, J.,
Iyer, G.,
Taylor, B.,
Kitchen, J.,
Mortensen, E.,
Wang, Z.,
Flintoft, R.,
Michel, J.,
and Bassel-Duby, R.
(1996)
Mol. Cell. Biol.
16,
6644-6653[Abstract]
-
Lin, S.-Y.,
Black, A. R.,
Kostic, D.,
Pajovic, S.,
Hoover, D. N.,
and Azizkhan, J. C.
(1996)
Mol. Cell. Biol.
16,
1668-1675[Abstract]
-
Leggett, R. W.,
Armstrong, S. A.,
Barry, D.,
and Mueller, C. R.
(1995)
J. Biol. Chem.
270,
25879-25884[Abstract/Free Full Text]
-
Mortensen, E.,
Marks, P.,
Shiotani, A.,
and Merchant, J.
(1997)
J. Biol. Chem.
272,
16540-16547[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. U. Mertens-Talcott, S. Chintharlapalli, X. Li, and S. Safe
The Oncogenic microRNA-27a Targets Genes That Regulate Specificity Protein Transcription Factors and the G2-M Checkpoint in MDA-MB-231 Breast Cancer Cells
Cancer Res.,
November 15, 2007;
67(22):
11001 - 11011.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. K. Scott, M. D. Mattie, C. E. Berger, S. C. Benz, and C. C. Benz
Rapid Alteration of MicroRNA Levels by Histone Deacetylase Inhibition
Cancer Res.,
February 1, 2006;
66(3):
1277 - 1281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Hoogendoorn, S. L. Coleman, C. A. Guy, K. Smith, T. Bowen, P. R. Buckland, and M. C. O'Donovan
Functional analysis of human promoter polymorphisms
Hum. Mol. Genet.,
September 15, 2003;
12(18):
2249 - 2254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xing and M. R. Sairam
Role of CACC-Box in the Regulation of Ovine Follicle-Stimulating Hormone Receptor Expression
Biol Reprod,
October 1, 2001;
65(4):
1142 - 1149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Uchida, Y. Tanaka, H. Ito, F. Saitoh-Ohara, J. Inazawa, K. K. Yokoyama, S. Sasaki, and F. Marumo
Transcriptional Regulation of the CLC-K1 Promoter by myc-Associated Zinc Finger Protein and Kidney-Enriched Kruppel-Like Factor, a Novel Zinc Finger Repressor
Mol. Cell. Biol.,
October 1, 2000;
20(19):
7319 - 7331.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|