|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Biol Chem, Vol. 274, Issue 12, 8153-8160, March 19, 1999
From the Department of Biochemistry and Molecular Biology,
University of Calgary, Calgary, Alberta T2N 4N1, Canada
Previous reports of Na/Ca exchanger gene 1 (NCX1)
expression have revealed a major RNA transcript of 7 kilobase pairs
(kb), minor transcripts of ~13 and ~4 kb, and a relatively abundant 1.8-kb RNA band. In the present report we demonstrate that the 1.8-kb
message, which has a tissue and subcellular distribution matching that
of full-length NCX1 but is not polyadenylated, corresponds to a
perfectly circularized exon 2 species. The circular transcript contained the normal NCX1 start codon, a new stop codon introduced as a
consequence of circularization, and encoded a protein corresponding to
the NH2-terminal portion of NCX1, terminating just
after amino acid 600 in the cytoplasmic loop. A linear version of the
circular transcript was prepared and transfected into HEK-293 cells. A protein, matching the predicted size of ~70 kDa, was expressed, and
the transfected cells possessed Na/Ca exchange activity. Although in
native tissue we could not detect a protein corresponding exactly to
that predicted from the circular transcript, a prominent band of
slightly shorter size, possibly representing further proteolytic processing of circular transcript protein, was observed in membranes from LLC-MK2 cells and rat kidney.
The sodium-calcium exchanger
(NCX)1 plays an important role in
the regulation of intracellular Ca2+ levels in a broad
number of tissues (1). Molecular studies of the Na/Ca exchanger have
revealed that NCX1 is the predominant Na/Ca exchanger gene and is
expressed in almost every tissue but at a particularly high level in
heart, brain, and kidney (2). Studies on the organization of the human
NCX1 gene have revealed that it comprises at least 14 exons spread out
over more than 200 kb of genomic DNA (3, 4). Several reports have also identified two regions of alternative splicing in NCX1 transcripts from
various tissues and animal species.
The first site of alternative splicing is in the 5'-untranslated region
of the NCX1 message and involves exons referred to as 1a (or 1-Br), 1b,
1c (or 1-Kc), 1d (or 1-Ht), and 1e (3, 5). The use of tissue-specific
promoters and splicing patterns involving these exons gives rise to at
least three different transcripts, each with a unique exon 1 sequence
at the 5'-end (3, 4, 6-8). Studies in rat using an RNase protection
assay have demonstrated that heart expresses primarily NCX1 transcripts
possessing exon 1-Ht, kidney expresses transcripts with exon 1-Kc,
whereas NCX1 transcripts expressed elsewhere contain primarily exon
1-Br (5). It is thought that this pattern of splicing may allow
independent and selective regulation of NCX1 expression in different tissues.
The second region of alternative splicing encodes a stretch of amino
acids near the carboxyl terminus of the central intracellular loop of
the NCX1 protein. At this site, six different exons (exons 3-8) are
arranged in tissue-specific patterns (6, 9, 10). Heart expresses NCX1
transcripts containing exons 3, 5, 6, 7, and 8, brain expresses
transcripts with exons 3, 6, and sometimes 8, and most other tissues
express transcripts possessing exons 4 and 6 (and sometimes also
8). The functional consequences of this structural heterogeneity are
still uncertain (11, 12).
Lying between these two sites of alternative splicing is an unusually
long exon 2 sequence (1,832 bp coding for 600 amino acids in human
NCX1). Exon 2 encodes the amino-terminal half of the NCX1 protein,
including the initiating methionine, the first set of hydrophobic
transmembrane segments, and most of the central cytoplasmic regulatory loop.
Further alternative splicing, leading to a range of deletions among the
carboxyl-terminal transmembrane segments of NCX1, was proposed based on
studies in which a 6-kb canine cardiac NCX1 cDNA was expressed in
HEK-293 cells (13). Nucleotides 3198, 2821, 2620, and 1845 (based on
the coordinates of GenBank accession M57523 (14)) were identified as
potential splice donor sites. None of these sites, however, is close to
the exon boundaries identified in the human NCX1 gene (4).
Studies of NCX1 expression have all revealed a major transcript of
about 7 kb which is expressed abundantly in many tissues (2, 6,
14-18). In addition to this major 7-kb transcript, less abundant
transcripts of ~13 and ~ 4 kb and an abundant RNA band of 1.8 kb have also been reported (6, 15-18). Although present in many
different tissues, the origin of these NCX1 transcripts has not been described.
In this report, we describe studies that demonstrate that the 1.8-kb
mRNA corresponds to a circularized NCX1 exon 2 transcript encoding
a truncated NCX1 protein. The distribution and possible functional role
of this transcript are also investigated.
All molecular procedures were performed essentially according to
standard protocols (19, 20) or the directions of reagent manufacturers,
unless indicated otherwise. Chemicals were of the highest quality
analytical grade available and were obtained from either Fisher, BDH,
or Sigma, unless indicated otherwise. Nucleic acid and protein amino
acid sequence analysis was performed with the MacVector software
package (Oxford Molecular Group) and by connection to the National
Center for Biotechnology Information at the National Institutes of
Health (www.ncbi.nlm.nih.gov).
RNA Isolation and Northern Blot Analysis--
Total RNA
preparations from whole tissues were isolated using the GITC-CsCl
centrifugation method and from cultured cells using the GITC
acid-phenol extraction protocol. Poly(A)+ mRNA
preparations were isolated from total RNA by passage through an
oligo(dT) column. To isolate nuclear RNA, nuclei were prepared by
hypotonic detergent lysis from LLC-MK2 cells. In brief, cells were
collected by centrifugation, washed several times with
phosphate-buffered saline, resuspended in 5 × the packed cell
volume of hypotonic buffer (10 mM HEPES/KOH, pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, and 10 mM KCl), chilled on ice for 15 min,
and then lysed by the addition of 0.6% (v/v) Nonidet P-40, followed by
gentle mixing and three strokes in a tight-fitting Dounce homogenizer. Nuclei were pelleted from this extract at 1,000 × g
for 3 min, and RNA was isolated using GITC acid-phenol extraction.
Samples of RNA were separated on 1% agarose-formaldehyde gels and
transferred into a nylon membrane by capillary diffusion overnight. The
UV cross-linked membranes were hybridized with antisense digoxigenin UTP-labeled riboprobes according to the directions of the manufacturer (Boehringer Mannheim) as described previously (21). Probe A was derived
from the 5'-untranslated region exon 1-Kc (nucleotides Inverse Polymerase Chain Reaction--
The schematic description
of the inverse PCR (IPCR) protocol is illustrated in Fig.
3B. 5 µg of RNA from LLC-MK2 cells was reverse transcribed
by Superscript II reverse transcriptase (Life Technologies, Inc.) using
the gene-specific primer GSP1 (GTCTTGGTGGTCTCTCCATT, antisense,
nucleotides 346-365; numbering is based on the published canine
cardiac NCX1 (14), GenBank accession number M36119). The cDNA was
converted to second strand essentially as described (21) and then
purified, phosphorylated, and circularized by ligation in dilute
solution. These circles were amplified using the primer pair IPCR-2
(ATGTCCTC[C,T]ATAGAAGTCATCAC, sense, nucleotides 289-311) and IPCR-3
(AGACCATGGCCAC[A,G]AAATACAC, antisense, nucleotides 229-250), which
lie upstream from GSP1 and face away from one another. Amplified
products were gel purified, subcloned, and sequenced with the Amplitaq
FS kit from Perkin-Elmer. Fluorescently labeled sequencing reactions
were analyzed at the University of Calgary Core DNA Service Facility.
Reverse Transcription-coupled Polymerase Chain Reaction
(RT-PCR)--
2 µg of total RNA from LLC-MK2 cells was reverse
transcribed using either GSP1 as described above or oligo(dT). The
cDNA was then amplified using different pairs of primers based on
the exon 2 region. The design of primers is shown in Fig.
4B. The first primer pair, C1 and C1', face away from one
another (C1, same as IPCR-1, above; C1', GAGTGAGAGCATTGGCATCATG, sense,
nucleotides 1638-1659). The second (C2 and C2') and third (C3 and C3')
primer pairs face toward each other (C2, TTGCTGAGACAGAAATGGAAGGA,
sense, nucleotides 92-114; C2', TCCACAACACCAGGAGAGATGA, antisense,
nucleotides 662-683; C3, CTGTCATCTCTCCTGGTGTTGT, sense, nucleotides
659-680; C3', GAGCTCCAGATGTTCTCAATAC, antisense, nucleotides
1669-1690). The amplified products were gel purified, subcloned, and sequenced.
Isolation of the Circular Exon 2 Transcript from Total RNA of
LLC-MK2 Cells--
To isolate the circular exon 2 transcript, we
designed a 16-nucleotide, 5'-end biotin-labeled, antisense
oligonucleotide (circular oligonucleotide: AGAACCTA ACAATTTC) which
bridged the circularized 3'- and 5'-ends of exon 2 (8 nucleotides from
each end). As a control, we also prepared a similar oligonucleotide
(exon 1/2 oligonucleotide, AGAACCTA AGTTTTGA), which spanned the
junction of the 3'-end of exon 1 and the 5'-end of exon 2 and was
designed to isolate the full-length NCX1 transcript. Total RNA isolated from LLC-MK2 cells (30 µg) was hybridized with 1.5 µM
biotin-labeled circular oligonucleotide or exon 1/2 oligonucleotide and
10 µg of yeast tRNA for 5 min at 65 °C in 300 µl of binding
buffer (0.5 M NaCl, 10 mM Tris-Cl, 1 mM EDTA, pH 7.5), cooled slowly to room temperature, and
then incubated at 37 °C for 30 min. The samples were then diluted to
2 ml with binding buffer and passed over an Immuno-Pure immobilized
monomeric avidin column (Pierce). The procedure followed the
instructions from the manufacturer except that phosphate-saline buffer
was replaced by binding buffer. The biotin-oligonucleotide-hybridized
RNA was eluted from the column in TE buffer (10 mM Tris-Cl,
pH 8.0, 1 mM EDTA) containing 2 mM biotin. 10 µg of yeast tRNA was added, and the sample was precipitated with cold
ethanol. The precipitated samples were then analyzed by Northern blot
with probe B to detect the isolated transcripts.
Expression Constructs--
The full-length NCX1 construct was
prepared by amplifying oligo(dT)-primed reverse transcribed LLC-MK2
cell total RNA with a pair of primers containing BamHI
restriction sites at their 5'-ends (Pr-1,
CGCGGATCCAACATGCGGCGATTAAGTCTTTC, sense, nucleotides Expression in HEK-293 Cells--
Transfection of cDNA
expression constructs into HEK-293 cells was performed using a standard
calcium-phosphate precipitation protocol with BES buffer essentially as
described previously (22, 23). The circular construct cloned in the
reverse orientation in the pcDNA3.1 vector was used as a control.
Protein expression in crude microsome preparations was analyzed by
immunoblotting with the C2C12 monoclonal antibody at 1:1,000 dilution.
Calcium transport into transfected HEK cells was analyzed by Fura-2
fluorescent ratio digital imaging essentially as described previously
(22). In brief, 2 days after transfection, cells grown on coverslips were loaded by incubation in 5 µM Fura-2/AM, 0.01%
pluronic F-127, in serum-free Dulbecco's modified Eagle's medium
buffered with 25 mM Tris-HEPES for 20-30 min at room
temperature. The coverslips were mounted in a temperature-controlled
perfusion chamber (Warner Instruments), maintained at 37 °C, on the
stage of a Zeiss Axiovert135 microscope. The cells were perfused
continually at 3 ml/min with solutions containing 10 mM
Tris-HEPES, pH 7.4, 11 mM glucose, 0.5 mM
CaCl2, and 145 mM NaCl or LiCl. The 340 nm/380
nm excitation ratio of Fura-2 fluorescence was measured using the
ImageMaster System from Photon Technology International.
Immunoblotting in Native Tissues--
Crude microsome
preparations and immunoblotting were performed essentially as described
previously (24, 25). In brief, fresh or frozen tissue from rabbit
heart, rat heart, or kidney was homogenized with a Polytron in ice-cold
sucrose buffer containing a mixture of protease inhibitors (Boehringer
Mannheim). LLC-MK2 cells were first swollen hypotonically on ice and
then lysed with a Dounce homogenizer in buffer containing protease
inhibitors. The cell homogenates were centrifuged, first at 8,000 × g for 20 min to remove nuclei, mitochondria, and debris
and then at 100,000 × g for 60 min to pellet a crude
fraction containing plasma membranes, endoplasmic reticulum, and other
microsomes. These crude microsomal fractions were separated on
SDS-polyacrylamide gels, electrophoretically transferred to
nitrocellulose membranes, and analyzed by immunoblotting using
SuperSignal Plus ECL reagents from Pierce. The monoclonal antibody
C2C12 recognizes an epitope between amino acids 372 and 525 (26) in the
central cytoplasmic loop of the exchanger. The monoclonal antibody 6H2,
which was a generous gift from Robert Reilly, University of Colorado,
recognizes an epitope within the first extracellular 40 amino acids of
the mature exchanger protein.
Several different groups have reported a relatively abundant NCX1
transcript of ~1.8 kb in size (15, 16, 18), although in previous
studies we had not observed this species (6, 8, 17). Fig.
1 shows that we were able to confirm the
existence of the 1.8-kb transcript when Northern blots were analyzed
with a probe spanning most of the NCX1 coding region (probe B). Indeed, we found that this transcript was present in every tissue and animal
species tested. The abundance of the 1.8-kb band appeared to correlate
roughly with the abundance of the major 7-kb full-length NCX1
transcript, although the precise ratio varied among animal species. A
particularly high amount of 1.8-kb transcript was observed in RNA from
monkey tissues and in LLC-MK2 cells, a cell line derived from monkey
kidney.
To characterize the nature of the 1.8-kb NCX1 transcript, we performed
the experiments shown in Fig. 2. First, a
Northern blot of total RNA from rat kidney was analyzed with three
different probes: A (from exon 1-Kc), B (spanning most of the coding
region, exons 2, 4, 6, and 9-12), and C (spanning most of exon 11 and part of exon 12). As seen in Fig. 2A, the 1.8-kb NCX1
transcript was detected only with probe B, although 7- and ~13-kb
transcripts were clearly evident with all three probes.
Next, total RNA isolated from LLC-MK2 cells was passed over an oligo(dT) column to isolate poly(A)+ mRNA. Northern blot analysis of the total RNA, poly (A)+ mRNA, and flow-through fractions revealed that the 1.8-kb NCX1 transcript was present quantitatively in the column flow-through, suggesting that it was not polyadenylated (see Fig. 2B). Note that the poly(A)+ mRNA lane contained about six times the relative amount of material compared with the other lanes. A band of ~4.5 kb in size was also visible in the poly(A)+ mRNA, as described previously (6). Finally, cellular localization of the 1.8-kb transcript was examined. Total RNA was isolated either from a preparation of detergent-extracted LLC-MK2 cell nuclei or from an equivalent number of whole cells and analyzed by Northern blot. The majority of both 1.8- and 7-kb NCX1 transcripts were present in the cytoplasm and not in the nucleus (see Fig. 2C). The coincidence of size and the pattern of hybridization with different
probes led us to hypothesize that the 1.8-kb NCX1 transcript originated
from the unusually long exon 2 sequence. We examined this issue further
with a combination of IPCR and RT-PCR studies. Initially, we used the
technique of IPCR to define the 5'-untranslated region of NCX1
transcripts expressed in the LLC-MK2 cell line. Following this
procedure, as shown in lane 1 of Fig.
3A, two major product bands were
detected: one of ~500 bp and one of ~1.8 kb. Subcloning and
sequencing revealed that the 500-bp band extended back past the
beginning of exon 2, ending in unique sequence that we presume to be
the NCX1 exon 1 used in LLC-MK2 cells. The sequence of the 1.8-kb
fragment also extended to the 5'-end of exon 2 but then
continued directly with sequence from the 3'-end of exon 2 (based on
the published exon boundaries (3, 4)). It is noteworthy that the 5'-end
of the human NCX1 cDNA reported by Komuro et al. (15)
has a structure virtually identical to the LLC-MK2 1.8-kb band, with
sequence from the end of exon 2 appearing in the 5'-untranslated region
upstream of position
Analysis of individual clones for both the 500-bp and 1.8-kb bands indicated that some clones were missing a TAG triplet at the 5'-end of exon 2. This difference may arise from the presence of two closely spaced splice acceptor sites at this location (3, 4) and is consistent with our previous observation of splicing heterogeneity at the same location in the rat NCX1 gene (5). When reverse transcriptase was omitted from the protocol, no bands were detected, as shown in lane 3 of Fig. 3A, indicating that the amplified products did not arise from genomic DNA contamination. Moreover, when the ligation step of the IPCR protocol was omitted, we still were able to detect the 1.8-kb band, but not the 500-bp product (Fig. 3A, lane 2). These results suggested the possibility that the 1.8-kb fragment arose from a circularized exon 2 transcript, as illustrated in the schematic of Fig. 3B. To confirm the circular nature of the exon 2 transcript, we performed RT-PCR on LLC-MK2 cell RNA using either a gene-specific primer from exon 2 (GSP1) or oligo(dT) to prime the reverse transcription reaction. The cDNA products were then amplified with different pairs of primers from within exon 2, as shown in panel B of Fig. 4. The first pair of primers (C1 and C1') face away from one another and are therefore expected to amplify only a circular template. The other primer sets (C2 and C2', C3 and C3') face toward one another and will thus amplify both linear and circular templates. However, because both of these primer sets have at least one member downstream from the GSP1 reverse transcription priming site, products would only be expected from a linear template if it were primed with oligo(dT). As shown in Fig. 4A, products were in fact seen from GSP1-primed cDNA for all three primer sets, whereas oligo(dT)-primed cDNA yielded bands only with the primer pairs designed for a linear template. Sequencing confirmed the identity of bands, as illustrated schematically in Fig. 4B.
The IPCR and RT-PCR experiments thus demonstrated the presence of a circularized NCX1 exon 2 transcript of 1.8 kb in length which was not polyadenylated. The 1.8-kb transcript observed on Northern blots was not polyadenylated and was only detected with a probe containing exon 2 sequence. To demonstrate directly that the 1.8-kb transcript corresponded to a circularized exon 2, we used oligonucleotide affinity chromatography. Biotinylated oligonucleotides spanning the junction between the ends of circular exon 2 (circular oligonucleotide) or the 3'-end of exon 1 and the 5'-end of exon 2 (exon 1/2 oligonucleotide) were hybridized with total RNA from LLC-MK2 cells. The hybridized samples were then passed over an avidin column, washed, eluted, and analyzed by Northern blot, as shown in Fig. 5. It is evident from these data that hybridization with the circular oligonucleotide selectively enriched for the 1.8-kb transcript, whereas hybridization with the exon 1/2 oligonucleotide selectively enriched for the full-length 7-kb transcript.
The circular NCX1 exon 2 transcript contained the normal NH2-terminal start codon for full-length NCX1 and a new stop codon introduced as a consequence of the circularization and thus encoded a protein of 602 amino acids (Fig. 6). Constructs expressing the full-length LLC-MK2 cell NCX1, or a linear version of the circular exon 2 transcript encoding the truncated protein, were prepared by high fidelity PCR. The deduced amino acid sequence from these cDNAs is shown in Fig. 6. The full-length monkey kidney NCX1 molecule contained 934 amino acids and was greater than 99% identical to human cardiac NCX1 except in the region of alternative splicing, where human cardiac NCX1 contained exons 3, 5, 6, 7, and 8 (isoform NCX1.1; alternatively spliced exons previously referred to as A, C, D, E and F), whereas LLC-MK2 cell NCX1 contains only exons 4 and 6 (exons B and D, isoform NCX1.3). The truncated protein extends to amino acid 600 of full-length LLC-MK2 cell NCX1, plus two more amino acids (Arg and Phe).
Both truncated and full-length constructs were transfected into HEK-293
cells. As seen in the left panel of Fig.
7A, immunoblots using the C2C12
antibody showed a strong band at 70 kDa for the truncated construct,
which was absent from control-transfected cells. The full-length
construct generated a broad band at 110 kDa, representing the complete
NCX1.3 protein, and a minor band at ~50-60 kDa which probably
represents a proteolytic degradation product. When the protein samples
were run in the absence of reducing agent, as shown in the right
panel of Fig. 7A, in addition to the truncated protein
product of 70 kDa, a major band of ~140 kDa and a minor band at
~250 kDa were also observed. These aggregates suggested the
possibility that truncated NCX1 protein formed disulfide-linked homomeric dimers in the membrane. In the absence of
Fluorescent calcium ratio imaging with Fura-2 was used to examine the transport function of the expressed NCX1 proteins, as illustrated in Fig. 7B. Cells grown on coverslips were transfected, loaded with Fura-2, and then mounted in a perfusion device on a microscope stage and maintained at 37 °C. The cells were first perfused in a medium containing 145 mM sodium chloride and then switched to a medium containing 145 mM lithium chloride. This maneuver reverses the sodium gradient and removes sodium competition at the outwardly facing calcium binding sites and therefore favors calcium entry through an NCX molecule. In cells transfected with a nonexpressing control construct, the medium switch did not elicited any change in Fura-2 fluorescence. In transfected cells expressing the truncated NCX1 protein, the medium switch elicited a significant increase in Fura-2 fluorescence, indicating calcium entry. In paired experiments, however, the change in Fura-2 fluorescence was not as rapid nor as large as that seen for cells expressing the full-length NCX1.3 protein. Having demonstrated that the truncated construct gave rise to a functional Na/Ca exchange protein when expressed in HEK cells, we investigated the possibility that the circular NCX1 exon 2 transcript could be translated into protein in native tissues. Microsomal fractions isolated from rabbit heart, LLC-MK2 cells, or transfected HEK cells were analyzed by immunoblotting with monoclonal antibodies C2C12 (epitope in the central cytoplasmic domain between amino acids 372 and 525 (26)) or 6H2 (epitope in the extracellular NH2-terminal 40 amino acids of the mature protein). As illustrated in Fig. 8, the C2C12 and 6H2 antibodies recognized both the 110-kDa full-length NCX1.3 protein and the 70-kDa truncated NCX protein when expressed in HEK cells. In microsomes isolated from rabbit heart or from cultured LLC-MK2 cells, full-length NCX1.1 and NCX1.3 were evident at 120 kDa and 110 kDa, respectively, with either antibody. In addition to the full-length NCX protein, the C2C12 antibody also recognized bands of ~70 kDa in heart and ~60 kDa in both heart and transfected HEK cells, likely corresponding to proteolytic fragments of the exchanger (14, 27-29). Neither of these bands was evident in LLC-MK2 microsomes (even at longer exposure). The 6H2 antibody, on the other hand, recognized none of the shorter NCX fragments seen with C2C12 but instead recognized a prominent band of ~60 kDa in the LLC-MK2 cell microsomes which was severalfold more abundant than the full-length NCX1.3 protein. A band of similar size but lower intensity was also observed in microsomes from rat kidney but not rat heart (data not shown). The ~60-kDa band recognized by 6H2 but not by C2C12 thus corresponds to an NCX1 polypeptide extending from the NH2 terminus to the cytosolic loop but terminating before the complete C2C12 epitope (amino acids 372-525). The relative abundance of the ~60-kDa and ~110-kDa NCX1 protein species is comparable to the ratio of 1.8-kb to 7-kb transcripts found in the LLC-MK2 cells (see Fig. 2, B and C).
In this manuscript we have used IPCR, RT-PCR, and oligonucleotide affinity chromatography to demonstrate that the previously described 1.8-kb NCX1 transcript of unknown origin corresponds to a circularized exon 2 species. The 1.8-kb transcript is expressed ubiquitously, with an abundance that correlates with the abundance of full-length 7-kb NCX1 transcript in all of the tissues and animal species we have tested. Although the 1.8-kb transcript is found in the cytoplasm, it is not polyadenylated. We believe that the inconsistent reporting of this species in earlier literature can be explained by the requirements for a probe to include exon 2 sequence and for the analysis to be of total RNA rather than poly(A)+ mRNA. The appearance of circular transcripts is not unique to NCX1. Eukaryotic circular RNA was first reported in the human ets-1 gene (30) and subsequently in the mouse testis-determining gene, sry (31), the rat cytochrome P450 2C24 gene (32), and the human cytochrome P-450 2C18 gene (33). The functional role(s) for these circular transcripts remain(s) uncertain. Some of the circular transcripts contains several exons joined together in an order different from that present in genomic DNA, whereas others contain a single exon joined head to tail. None of the reported circular transcripts is polyadenylated, and all are present in cytoplasm. Only the circular transcript from the testis-determining gene, sry, is like NCX1 in that it contains a single exon joined exactly head to tail, with the normal protein start codon and a new stop codon. It seems likely, however, that the mechanism that generates the circular species is entirely different for sry compared with NCX1. In the mouse sry gene, two large inverted repeats flank the circularized exon and are required for its excision from a large linear RNA precursor molecule (31, 34, 35). No similar inverted repeat structures are evident in the NCX1 gene in proximity to exon 2. Instead, we believe that the unusual length of NCX1 exon 2 (1.8 kb) may account for the appearance of this perfectly circular transcript. Presumably the 5'-end of exon 2, because of its length, can become arranged in three-dimensional space to lie in proximity to the 3'-end of the same exon. During processing, the splicing event that would normally join the 3'-end of exon 2 to the 5'-end of the subsequent exon instead joins it to its own 5'-end, in an exact head-to-tail arrangement. Circular transcripts of a number of different genes have been found to accumulate in the cytoplasm, suggesting a biological role for these molecules beyond the splicing process. The circular NCX1 exon 2 transcript encodes a 602-amino acid protein. Internal initiation of translation has been observed in mammalian cells (36), so it is possible that a protein product could be made from the circular transcript, although the efficiency of translation may be affected by the circular structure as well as by the absence of a cap (37) or poly(A) tail (38). Moreover, Chen and Sarnow (39) have demonstrated that circular transcripts can be translated into protein. The normal NCX1 protein comprises a cleaved signal sequence followed by
a short glycosylated extracellular region, a domain of five hydrophobic
transmembrane segments, a long cytoplasmic loop, and a final region of
six transmembrane segments (14). Two segments of amino acid sequence,
one from the center of each hydrophobic region, have been recognized as
similar and are thought to have arisen from an ancient gene duplication
event. These regions, the The truncated NCX protein encoded by the circular exon 2 transcript
contains the first 600 amino acids found in the full-length protein,
plus two extra amino acids resulting from circularization, and
terminates at the site of alternative splicing in the cytoplasmic domain. This protein thus lacks the COOH-terminal hydrophobic domain
and therefore the second of the two The finding that a truncated protein lacking the COOH-terminal
hydrophobic region of NCX1 was functional suggests several possible
models. First, it is possible that the COOH-terminal part of NCX1 is
not essential for transport. This seems unlikely, however, because
mutagenesis studies have shown that key residues within the second The truncated NCX1 protein was expressed in HEK cells at a level
similar to full-length NCX1.3 yet had a dramatically lower transport
activity. This may reflect the relative inefficiency of an We searched for the presence of truncated NCX1 protein that might have originated from a circular transcript using the C2C12 and 6H2 antibodies to blot microsomes isolated from rabbit heart, LLC-MK2 cells, rat heart, and rat kidney. Although no band was observed which corresponded exactly in both length and antigenicity to the product from the circular transcript construct, a very strong ~60-kDa band was detected in LLC-MK2 cells. In contrast to the truncated NCX1 protein produced in HEK cells which ran at 70 kDa on SDS gels and was recognized by both 6H2 and C2C12 antibodies, the 60-kDa LLC-MK2 protein was recognized only by the 6H2 antibody and not the C2C12 antibody. It is thus possible that the 60-kDa band in LLC-MK2 cells was derived from protein synthesis off the circular transcript followed by proteolytic processing in the cytosolic loop which shortened the protein and removed part of the epitope essential for recognition by the C2C12 antibody. Strikingly, the LLC-MK2 cell 60-kDa band was much more intense than the full-length 110-kDa NCX1.3 band. Indeed, the relative abundance of 60-kDa and 110-kDa proteins closely matched that of 1.8-kb and 7-kb mRNA transcripts in these cells (see Fig. 2, B and C). A similar 60-kDa band was also observed, although at lower abundance, in microsomes isolated from rat kidney but not rat or rabbit heart. The abundance of truncated protein found in different tissues thus does not match the abundance of 1.8-kb transcript, suggesting tissue-specific regulation of transcription and/or protein stability. In summary, we have demonstrated the presence of a circularized NCX1
exon 2 transcript corresponding to a previously described 1.8-kb NCX1
RNA band of unknown origin. The tissue and cellular distribution of the
circular transcript match those of the full-length linear NCX1
transcript. The circular RNA encodes a truncated NCX1 protein that
expresses Na/Ca exchange function when expressed in HEK cells. We have
identified a protein of similar size in membrane fractions from rat
kidney and LLC-MK2 cells, possibly suggesting that the protein product
of the circular transcript plays a special role in kidney cells.
We thank Bob Winkfein and Conan Cooper for assistance in the cloning and imaging studies, Robert Reilly (University of Colorado) for the gift of the 6H2 antibody, and Ken Philipson (UCLA) and Wayne Chen (University of Calgary) for helpful suggestions.
* This work was supported in part by an establishment grant from the Alberta Heritage Foundation for Medical Research and Group Grant GR13917 from the Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF107593 and AF109888.
§ Scholar of the Alberta Heritage Foundation for Medical Research and an Established Investigator of the American Heart Association. To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Calgary Health Sciences Centre, 3330 Hospital Dr. NW, Calgary, Alberta, Canada T2N 4N1. Tel.: 403-220-2893; Fax: 403-283-4841; E-mail: jlytton{at}ucalgary.ca.
The abbreviations used are: NCX, sodium-calcium exchanger; NCX1, sodium-calcium exchanger gene 1 (SLC8A1); bp, base pair(s); kb, kilobase pair(s); PCR, polymerase chain reaction; IPCR, inverse polymerase chain reaction; GSP1, gene-specific primer 1; RT-PCR, reverse transcription-coupled PCR; BES, 2-[bis(2-hydroxyethyl)amino]ethanesulfonic acid; GITC, guanidine isothiocyanate.
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||