|
J Biol Chem, Vol. 274, Issue 12, 8161-8168, March 19, 1999
Multiple Murine Double Minute Gene 2 (MDM2) Proteins Are
Induced by Ultraviolet Light*
Leslie J.
Saucedo ,
Cena D.
Myers§, and
Mary Ellen
Perry¶
From the Program in Cell and Molecular Biology and the Department
of Oncology, McArdle Laboratory for Cancer Research, University of
Wisconsin Medical School, Madison, Wisconsin 53706
 |
ABSTRACT |
The mdm2 (murine
double minute 2) oncogene encodes
several proteins, the largest of which (p90) binds to and inactivates
the p53 tumor suppressor protein. Multiple MDM2 proteins have been detected in tumors and in cell lines expressing high levels of mdm2 mRNAs. Here we show that one of these proteins
(p76) is expressed, along with p90, in wild-type and
p53-null mouse embryo fibroblasts, indicating that it may
have an important physiological role in normal cells. Expression of
this protein is induced, as is that of p90, by UV light in a
p53-dependent manner. The p76 protein is synthesized via
translational initiation at AUG codon 50 and thus lacks the N terminus
of p90 and does not bind p53. In cells, p90 and p76 can be synthesized
from mdm2 mRNAs transcribed from both the P1
(constitutive) and P2 (p53-responsive) promoters. Site-directed
mutagenesis reveals that these RNAs give rise to p76 via internal
initiation of translation. In addition, mdm2 mRNAs
lacking exon 3 give rise to p76 exclusively, and such mRNAs are
induced by p53 in response to UV light. These data indicate that p76
may be an important product of the mdm2 gene and a
downstream effector of p53.
 |
INTRODUCTION |
The mdm2 oncogene is a determinant of embryogenesis (1,
2), tumorigenesis (3, 4), and cell cycle progression (5, 6). The
effects of MDM2 on these processes depend, in part, on its ability to
inactivate the p53 tumor suppressor protein. For example, mice with a
homozygous deletion of the mdm2 gene die during
embryogenesis, and this deficiency is rescued if p53 is also
deleted (1, 2). In human tumors, the homologue of MDM2 is overexpressed
most often in the subset lacking inactivating mutations in the p53 gene
(7). Thus, high levels of MDM2 may be redundant with mutational
inactivation of p53. Following exposure of cells to -radiation, MDM2
inactivates the G1 block mediated by p53 (5). In some cell
types, MDM2 can inhibit apoptosis mediated by p53 (8). MDM2 binds to
p53, inhibiting the transcriptional activation function of p53 (3, 9)
and stimulating degradation of p53 (10, 11). Recently, MDM2 has been
shown to bind to another tumor suppressor protein, p19ARF
(12, 13). The ability of MDM2 to stimulate degradation of p53 is
inhibited by p19ARF, indicating that the interaction of
p19ARF and MDM2 may be an important determinant of cell
cycle progression.
In addition to interacting with p53 and p19ARF, MDM2 binds
to and alters the function of other proteins that regulate cell
division. For example, overexpression of MDM2 stimulates the activity
of the E2F transcription factor (14) and reverses an arrest in the cell
cycle mediated by either the retinoblastoma protein (15) or a related
protein, p107 (6). These effects of MDM2 do not depend on the presence
of p53. Further evidence for p53-independent functions of MDM2
was provided by Lundgren et al. (4), who generated
mice expressing high levels of MDM2 in the mammary gland. The mammary
epithelial cells of these mice developed polyploidy, and this effect of
MDM2 was also seen in mice lacking p53. Mammary tumors arose in mice
overexpressing mdm2, but the dependence on p53 was not
measured since mice lacking p53 die before mammary tumors would have
developed. Sigalis et al. (16) found that alternatively
spliced mdm2 mRNAs were overexpressed in some human tumors. Introduction of these mRNAs into NIH3T3 cells resulted in
morphological transformation, even though a subset of them encoded MDM2
proteins that could not bind p53. Therefore, some of the oncogenic
effects of MDM2 are independent of p53.
Several MDM2 proteins are detectable in cells overexpressing MDM2,
including human tumor cells and transformed murine cell lines (17, 18).
Olson et al. (17) hypothesized that these proteins arise
through alternative splicing, proteolytic processing, or
post-translational modification. It has not been clear whether these
proteins arise through mechanisms used in the normal regulation of
mdm2 expression. Multiple MDM2 proteins can be translated
from single mRNAs in rabbit reticulocyte lysates, indicating that
internal initiation may be a mechanism whereby multiple MDM2 proteins
are expressed in cells (19). In fact, there is evidence that enhanced translation accounts for the overexpression of multiple MDM2 proteins in some human tumors (18). In the DM3T3 cell line, in which the
mdm2 gene is amplified, multiple MDM2 proteins and mRNAs
are expressed (17, 20). The most abundant protein in DM3T3 cells (p90)
is the well characterized mdm2 gene product that binds to p53 and inhibits its function (3, 9, 10, 11). The second most abundant
protein (p76) does not bind p53 (17, 19), but does bind
p19ARF (13). The primary structure and source of p76 have
not been established.
Here we show that p76 is a bona fide product of the mdm2
gene, as it is expressed in normal wild-type
MEFs,1 but not in
mdm2-null fibroblasts. Expression of p76 is induced by UV
light in a p53-dependent manner. Using epitope mapping and site-directed mutagenesis, we show that p76 appears to be the product
of translational initiation at codon 50 (AUG). Both internal initiation
and alternate splicing can give rise to p76 in cells. The
p53-responsive internal promoter of mdm2 is induced by UV light, and a fraction of the induced RNA is spliced such that it lacks
exon 3 and the first two AUG codons. In this alternatively spliced
mRNA, AUG codon 50 (referred to hereafter as AUG 50) is the first
initiation codon. We provide evidence that the increase in this
alternatively spliced mRNA accounts for the induction of p76
expression in response to UV light. Identification and characterization
of p76 are important because it is likely to share some oncogenic
functions with p90.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Wild-type MEFs were obtained from Arnold J. Levine. MEFs lacking p53 or both p53 and MDM2 were provided by
Guillermina Lozano (21). All three strains of fibroblasts were derived
from 14-day-old embryos with a mixed Sv129 × C57BL/6 genotype.
DM3T3 cells are transformed murine fibroblasts that contain amplified
copies of the mdm2 gene (20). C127 is a nontransformed
murine cell line expressing wild-type p53 (22). The (10)3 cell line
lacks p53 and was derived from 14-day-old embryos of BALB/c mice (23). COS-1 cells are African green monkey kidney cells expressing the large
T-antigen of simian virus 40 (24). All cells were cultured in
Dulbecco's modified Eagle's medium plus 10% fetal calf serum (Summit).
Plasmids and Mutagenesis--
Several plasmids expressing
mdm2 were used to generate MDM2 proteins in reticulocyte
lysates. pGEM1F, pGEM1X2, and pGEM1B (19) were kindly provided by Moshe
Oren. pGEM1F expresses an mRNA containing exons 1-12; pGEM1X2
contains exons 2-12; and pGEM1B contains part of exon 3 and exons
4-12. Derivatives of pGEM1F were made that contain mutations at either
ATG 50 (F50) or ATG 62 (F62) and at both ATGs
50 and 62 (F50,62). The template for site-directed
mutagenesis of the mdm2 coding region was pGEM1X2 (19).
Single- or double-base changes were achieved using two oligonucleotides, both of which contained the desired base change(s). The oligonucleotides were hybridized to a denatured circular plasmid and extended using Pfu polymerase (25). The reaction was
repeated 12 times. For each mutant, an AccI fragment
containing the mutation was transferred from pGEM1X2 to pGEM1F.
For transfection of mammalian cells, the cDNAs described above were
transferred to the EcoRI site of the vector pCMV5 (26), which contains the cytomegalovirus promoter, a polyadenylation signal,
and the SV40 origin of replication. A similar eukaryotic expression
vector with a cDNA containing exons 1, 2, and 4-12 of
mdm2 (pCOCD) was obtained from Moshe Oren. The cDNAs
encoding F, X2, and D mRNAs (19) were isolated from a testis
cDNA library.2
Transcription and Translation--
For transcription and
translation in vitro, 1 µg of each cDNA was linearized
and added to the transcription extract (Stratagene). RNAs were
incubated with rabbit reticulocyte lysate (Stratagene) in the
presence or absence of [35S]methionine (Amersham
Pharmacia Biotech).
Transfections--
Calcium phosphate transfection of COS-1 cells
was as described by Chu and Sharp (27). Cells were transfected in
suspension, replated, and labeled with 50 µCi/ml
[35S]Express (NEN Life Science Products) 48 h
post-transfection.
Pulse-Chase Analysis--
C127 cells were radiolabeled for
0.5 h with [35S]Express and then rinsed with
Dulbecco's modified Eagle's medium plus 10% fetal calf serum. For
the chase periods, cells were incubated in Dulbecco's modified
Eagle's medium, 10% fetal calf serum, and a 5-fold excess of
unlabeled methionine. Lysates were made and normalized for total cell
protein using the Bio-Rad protein assay. MDM2 was immunoprecipitated as
described below.
Antibodies and Immunoprecipitation--
The monoclonal
antibodies that recognized MDM2 were raised against human MDM2: 4B2,
3G5, 4B11, and 2A10 (28). For most experiments, MDM2 and p53 were
immunoprecipitated as described previously (29) with the antibodies
indicated in the figure legends. CM5 (Vector Labs, Inc.) is a
p53-specific polyclonal antiserum whose epitopes do not overlap
with those of antibody 421 (30).
Western Analysis--
Proteins were transferred to
nitrocellulose (Hybond-ECL). The membranes were blocked overnight in
5% nonfat dry milk in Tris-buffered saline and 0.5% Igepal-CA 630 (Sigma). MDM2 proteins were detected using hybridoma supernatant
containing the 2A10 antibody (diluted 1:50 in 5% milk) followed by
sheep anti-mouse Ig conjugated to horseradish peroxidase (1:500 in 5%
milk; Amersham Pharmacia Biotech). Immunoreactive proteins were
revealed by ECL (Amersham Pharmacia Biotech) following the
manufacturer's suggestions.
RT-PCR--
RNA was isolated using Tri Reagent (Molecular
Research Center, Inc.). Five µg of total RNA was reverse-transcribed
using oligo(dT) (Promega) as a primer, and the cDNA product of this
reaction was amplified by PCR. The amount of cDNA added to each PCR
was normalized using glyceraldehyde-3-phosphate dehydrogenase cDNA
as the standard. Glyceraldehyde-3-phosphate dehydrogenase
amounts were measured by limited PCR using the primer pair
5'-ACCACAGTCCATGCCATCACA and 5'-TCCACCACCCTGTTGCTGTA. Two primer sets
were used to amplify mdm2. One set amplifies only RNAs
initiated at the constitutive promoter, and the second set amplifies
RNAs initiated at both the constitutive and p53-responsive promoters. A
backward primer complementary to mdm2 exon 4 (5'-GCTCCAACGGACTTTAACAACTTC) was end-labeled with
[ -32P]ATP using T4 kinase (New England Biolabs Inc.).
This primer was paired with either a primer in exon 1 (5'-CGTGAAGGGTCGGAAGATGC) or a primer in exon 2 (5'-TGGGCGAGCGGGAGACCGAC) in PCRs using Taq polymerase. DNAs
were amplified for 25 cycles (94 °C for 30 s, 59 °C for
30 s, and 72 °C for 45 s), which was determined to be
within the exponential range of amplification of mdm2 in
these samples. To quantify the different mdm2
transcripts, several reactions were performed in the presence of
increasing amounts of an engineered internal standard (31). This
standard contained sequences complementary to the primer pairs used and
was amplified with efficiencies similar to those of the mdm2
cDNAs. The source for the standard was an mdm2 cDNA
lacking exon 3 isolated from C127 cells following amplification of
first-strand cDNA with a primer in exon 1 (5'-AGCCGCCGCCTTCTCGTC) and a primer that spans the junction of exons 4 and 5 (5'-TAATCTCTTGATAGTGTAAGTG). The PCR product was cloned using the Topo
TA kit (Invitrogen) and sequenced. The internal standard was created by
amplifying exons 1-4 of this mdm2 clone using a backward
primer containing an insertion of 20 random base pairs (shown in
boldface;
5'-GCTCCAACGGACTTTAACAACTTCCTCTACCAGTCAGCTATCCAAAAAGCAATG). Following amplification of cDNAs from untreated and
UV-irradiated C127 cells, the products were separated on 5%
nondenaturing polyacrylamide gels and quantified on a PhosphorImager
(Molecular Dynamics, Inc.). To determine the amount of each
mdm2 transcript, the logarithm of the amount of the internal
standard was plotted against the logarithm of the ratio of the internal
standard to the mdm2 transcript (31). When the ratio is 1, the log of the ratio is zero, and the amount of transcript is equal to
the amount of standard. From the known quantity of the standard, the
amount of each transcript was calculated.
 |
RESULTS |
Two MDM2 Proteins Are Present in Mouse Embryo
Fibroblasts--
DM3T3 cells, which are transformed and contain
multiple copies of the mdm2 gene (32), express multiple
proteins that react with antibodies to MDM2 (17). We compared the
number of immunoreactive proteins in DM3T3 cells with wild-type MEFs,
p53-null MEFs, and p53/mdm2-null MEFs (Fig.
1). Both DM3T3 cells and wild-type MEFs expressed at least four proteins that immunoreacted with the 2A10 monoclonal antibody. All four of these proteins were also evident in
p53-null embryo fibroblasts, but only two appeared in
p53/mdm2-null fibroblasts. Therefore, two of the
immunoreactive proteins in wild-type mouse embryo fibroblasts are
products of the mdm2 gene. These same two proteins were
over-represented in the lysate from DM3T3 cells. The larger MDM2
protein expressed in DM3T3 cells has previously been designated
"p90," whereas the smaller has been referred to as "p76" (17,
33). Our result indicates that both p90 and p76 arise from normal
alleles of the mdm2 gene.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 1.
Two MDM2 proteins are made in wild-type
MEFs. A lysate from a cell line containing amplified
mdm2 (DM3T3) was compared with lysates from three cell
strains of different genotypes using Western analysis with MDM2
monoclonal antibody 2A10 and ECL. First lane, DM3T3 (20 µg); second lane, wild-type (WT) mouse embryo
fibroblasts (150 µg); third lane, p53-null
fibroblasts (150 µg); fourth lane,
p53/mdm2-null fibroblasts (150 µg). The MDM2 proteins in
the p53-null cells are marked by asterisks.
|
|
Synthesis of Two MDM2 Proteins Is Induced by UV
Light--
Previously, we showed that exposure of the C127 murine cell
line to UV light results in a p53-dependent increase in
mdm2 expression (29, 34). Western blot analysis with a
polyclonal antiserum indicated that expression of two immunoreactive
proteins was increased (34). To determine whether the smaller protein
induced by UV light was similar to the p76 protein expressed in DM3T3
cells, we compared the mobilities of the proteins in DM3T3 cells with those in C127 cells before and after UV light (Fig.
2). The major form of MDM2 induced in
C127 cells migrated with p90 and the minor form with p76. Both proteins
were expressed in cells lacking p53 ((10)3), but neither protein was
induced following exposure of these cells to UV light.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of two MDM2 proteins is induced in
a p53-dependent manner in response to UV light. MDM2
proteins expressed in DM3T3 cells were compared with proteins induced
by UV light. C127 cells expressing p53 and (10)3 cells lacking p53 were
exposed to a UV dose of 0 or 4 J/m2 and harvested 2 h
post-irradiation. First lane, DM3T3 (15 µg); second
lane, untreated C127 cells (175 µg); third lane,
treated C127 cells (175 µg); fourth lane, untreated (10)3
cells (175 µg); fifth lane, treated (10)3 cells (175 µg). Proteins were separated by electrophoresis and analyzed by
Western blotting as described in the legend to Fig. 1.
|
|
Pulse-chase analysis of C127 cells before and after UV light (Fig.
3) demonstrated that de novo
synthesis of both p90 and p76 accounted for their increase in response
to UV light. In the absence of UV light, the relative ratio of p90 to
p76UV was ~4.0 (Fig. 3). Two h following exposure of C127
cells to a UV dose of 4 J/m2, the relative increase in p90
was 2.3-fold greater than that of p76UV, such that the
ratio was 9.2. The p76UV protein does not appear to be a
proteolytic product of p90 since it did not accumulate during the chase
period (Fig. 3). Furthermore, both proteins have a half-life of ~10
min after exposure of cells to UV light. These data led us to conclude
that the faster migrating protein, p76UV, was an MDM2
protein whose synthesis was induced by UV light.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 3.
p90 and p76UV have similar
half-lives. UV-treated and untreated C127 cells were labeled with
[35S]Express for 30 min and then incubated for 0, 20, 40, or 80 min in medium containing an excess of unlabeled methionine.
Equivalent amounts of total cell protein were immunoprecipitated twice
sequentially with antibody 2A10. Following the first
immunoprecipitation, the samples were boiled, cooled, diluted 2-fold
with lysis buffer, adjusted to 2.6% Triton X-100, and reincubated with
the 2A10 antibody and protein A-Sepharose.
|
|
Evidence That p76UV Lacks the N Terminus of
p90--
To further characterize p76UV, we compared the
mobility of p76UV to those of MDM2 proteins synthesized in
rabbit reticulocyte lysates. mRNAs transcribed from the
constitutive (P1) and p53-responsive (P2) promoters of mdm2
differed by the presence of exon 1, which is noncoding (Fig.
4A). Both mRNAs give rise
to multiple proteins when translated in rabbit reticulocyte lysates
(Fig. 4B) (19). The mechanism by which the multiple proteins
are expressed is proposed to be internal initiation since multiple AUG
codons exist in the mdm2 coding sequence, and none is in an
optimal ribosome-binding sequence (20, 35). The proteins are postulated
to be translated from AUGs 1 (and/or 6), 50, and 62 (19). Two of the
proteins translated from each mRNA migrated with mobilities similar
to those of the MDM2 proteins expressed in UV-treated C127 cells (Fig.
4B). The protein that migrates the same as p90 is thought to
initiate at AUG 1 (and/or 6), and the protein that migrates the same as
p76UV is thought to initiate at AUG 50 (19).
p76UV also migrated with a protein synthesized from an
mRNA, designated B, in which AUG 50 is the first start codon (Fig.
4B, compare lanes 3 and 4). The p76
protein in DM3T3 cells has been shown to lack the ability to bind p53,
as has an exogenously expressed MDM2 protein lacking amino acids 1-49
of p90 (26). To test whether p76UV could
co-immunoprecipitate with p53, we used two different p53-specific antibodies whose epitopes do not overlap (Fig. 4B). Whereas
p90 co-immunoprecipitated with p53 when either antibody was used, p76UV did not co-immunoprecipitate with p53 (lanes
5 and 6). These results indicate that p76UV
may lack the N terminus of p90 since the p53-binding site is at the N
terminus of MDM2 (28).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
Evidence that p76UV lacks the N
terminus of p90. A, schematic of ATG codons within the
first six exons of mdm2. Potential initiation codons for
p76UV are in exons 4-6 of mdm2. B,
p76UV does not bind p53. C127 cells were exposed to a UV
dose of 4 J/m2 and harvested 2 h later. A lysate was
incubated with MDM2 antibody 2A10 or p53 antibodies 421 and CM5, and
the resulting immunoprecipitates were analyzed by Western blotting as
described in the legend to Fig. 1. Lane 1, products of
in vitro translation of mdm2 RNA containing exons
1-12 (F); lane 2, products of in vitro
translation of mdm2 RNA lacking exon 1 (X2); lane
3, products of in vitro translation of mdm2
RNA lacking AUGs 1 and 6 (B); lane 4, products of
immunoprecipitation of C127 cell lysate (100 µg) with MDM2 antibody
2A10; lane 5, products of immunoprecipitation of C127 cell
lysate (1.5 mg) with p53 antibody 421; lane 6, products of
immunoprecipitation of C127 cell lysate (1.5 mg) with p53 antibody
CM5.
|
|
The epitopes of several monoclonal antibodies raised against human MDM2
have been determined (Fig. 5A)
(28). Since the sequences of the human and murine MDM2 proteins are
highly conserved, we used these antibodies to determine the domains of
MDM2 present in p76. Monoclonal antibody 4B2 requires amino acids
19-50 of human MDM2 for binding (17, 28). The 4B2 antibody recognized murine p90, but not p76UV (Fig. 5B), indicating
that p76UV lacks N-terminal sequences that contribute to
binding by 4B2. A monoclonal antibody (3G5) with an epitope between
amino acids 59 and 89 of human MDM2 recognized both p90 and
p76UV, as did two monoclonal antibodies (2A10 and 4B11)
that recognized epitopes in the middle (amino acids 294-339) and
C-terminal (amino acids 383-491) portions of human MDM2, respectively
(Fig. 5B). These results indicate that p76UV
lacks the N terminus of p90.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 5.
Epitope analysis of murine p90 and
76UV. A, schematic of the epitopes for four
monoclonal antibodies on human MDM2: 4B2, amino acids 19-50; 3G5,
amino acids 59-89; 2A10, amino acids 294-339; and 4B11, amino acids
383-491 (28). B, immunoprecipitation (IP) of p90
and p76UV with MDM2 antibodies 4B2, 3G5, 2A10, and 4B11
followed by Western analysis with 2A10 and ECL. To ensure equivalent
immunoprecipitation of p90 with the different monoclonal antibodies,
4B2 was cross-linked to protein A-Sepharose at high pH (41), and 3G5
was purified and then precipitated using immobilized anti-mouse IgG
(Calbiochem). Lane 1, MDM2 proteins expressed in a
reticulocyte lysate from RNA lacking exon 1; lane 2, total
C127 cell lysate (150 µg); lanes 3-6, products of
immunoprecipitation of C127 cell lysate (1.5 mg) with 4B2, 3G5, 2A10,
and 4B11, respectively; lane 7, total C127 cell
lysate.
|
|
Translation of p76UV Appears to Initiate at AUG
50--
There are several potential AUG initiation codons that are
conserved between mouse and human MDM2 at codons 1, 6, 50, 62, and 102 (3). Initiation of translation at either AUG 1 or 6 gives rise to a
protein the size of p90 (19, 28). AUG codons at positions 50, 62, and
102 could serve as initiation codons for smaller MDM2 proteins that
cannot bind p53. To identify the codon likely to serve as the
initiation codon for p76UV, we compared the
immunoreactivity of p76UV with that of MDM2 proteins
synthesized in rabbit reticulocyte lysates (Fig.
6A). Labeling the reticulocyte
lysate allowed resolution of the faster migrating species into two
distinct bands (Fig. 6A). The slower migrating protein in
the doublet (p76IVT) has been presumed to arise from AUG 50 (19), and the faster migrating protein in the doublet
(p74IVT) has been presumed to initiate at AUG 62 (19).
Thus, we asked whether any of the monoclonal antibodies used in Fig.
5B could distinguish between p76IVT and
p74IVT (Fig. 6A). As expected, all the
antibodies recognized p90. Only the 3G5 antibody distinguished between
p76IVT and p74IVT (lane 4). In fact,
the protein thought to initiate at AUG 50 (p76IVT) had
identical immunoreactivity to p76UV. Neither
p76IVT nor p76UV protein was precipitated by
4B2, but both were precipitated by 3G5, 2A10, and 4B11. The epitope for
3G5 on human MDM2 has been mapped to within amino acids 59 and 89, and
leucine 66, tyrosine 67, and glutamine 69, which are conserved between
murine and human MDM2, are part of the epitope for 3G5 (36). However,
it is not known whether 3G5 would be expected to distinguish between
proteins initiated at AUGs 50 and 62. The assumptions that
p76IVT initiates at AUG 50 and that p74IVT
initiates at AUG 62 had to be tested before the identity of
p76UV could be known.

View larger version (77K):
[in this window]
[in a new window]
|
Fig. 6.
Epitope analysis of MDM2 proteins translated
in reticulocyte lysates. A, an mdm2 RNA
containing exon 1 (from pGEM1F) was translated, and the resulting
proteins were immunoprecipitated (IP) with MDM2-specific
antibodies 4B2, 3G5, 2A10, and 4B11 and with p53-specific antibody 421. Lane 1, 14C-labeled molecular weight markers;
lane 2, total products of in vitro translation;
lane 3, 4B2; lane 4, 3G5; lane 5,
2A10; lane 6, 4B11; lane 7, 421; lane
8, total products of in vitro translation of wild-type
F RNA; lanes 9-11, products of translation of RNA with AUG
50 mutated to AUC, AUG 62 mutated to AUC, and AUGs 50 and 62 mutated to
AUC, respectively. B, shown is a comparison of
immunoreactivity of MDM2 proteins synthesized from wild-type RNA
(IVT F), RNA mutated at AUG 50 (IVT F50),
or RNA lacking AUGs 1 and 6 (IVT B). Lanes
1-4, same as in A; lane 5, 4B11;
lanes 6-9, products of in vitro
translation of RNA with AUG 50 mutated to AUC before (lane
6) and after (lanes 7-9) immunoprecipitation with the
same antibodies; lanes 10-13, total products of translation
of RNA lacking AUGs 1 and 6 before (lane 10) and after
(lanes 11-13) immunoprecipitation with the same
antibodies.
|
|
To determine whether the p76IVT and p74IVT
proteins initiate from AUGs 50 and 62, respectively, we used
site-directed mutagenesis to generate cDNAs in which the ATG codon
at position 50, 62, or 50 and 62 was changed to ATC. The cDNAs
contained exons 1-12 so that p90 would serve as an internal control
for translation. The mutant cDNAs were transcribed, and the
resulting mRNAs were translated in reticulocyte lysates.
Translation of RNAs containing single mutations resulted in synthesis
of p90 and two other proteins (Fig. 6A, lanes 9 and 10). Mutation of AUG 50 resulted in loss of the slower
migrating protein in the doublet (p76IVT), but revealed a
new protein with mobility intermediate between those of
p76IVT and p74IVT (lane 9). Mutation
of AUG 62 resulted in expression of proteins identical in mobility to
those expressed from pGEM1F (lane 10). Mutation of both AUGs
50 and 62 resulted in loss of p76IVT, but not
p74IVT (lane 11). The protein with identical
immunoreactivity to p76UV (p76IVT) initiated at
AUG 50 since p76IVT was lost upon mutation of AUG 50 alone
and in combination with AUG 62 (lanes 9 and 11).
The protein that did not bind to 3G5 (p74IVT) is not a
product of internal initiation at AUG 50 or 62 since it was not lost
upon mutagenesis. This protein may be the product of either degradation
or translation from AUG 102. AUG 62 is not used as an initiation codon
for p74IVT, but it is used for the protein of intermediate
mobility between p76IVT and p74IVT because this
protein is translated from RNA mutated at AUG 50, but not from RNA
mutated at AUGs 50 and 62 (lanes 9 and 11). This protein does not appear to be translated from the wild-type RNA, indicating that "leaky scanning" gives rise to translation of this
protein only in the lysate programmed with RNA containing AUC 50.
The results described above indicate that p74IVT is not
initiated at AUG 62, so we have no evidence that 3G5 can distinguish between proteins initiated at AUGs 50 and 62. To determine whether the
3G5 antibody could distinguish between proteins initiated at AUGs 50 and 62, we immunoprecipitated proteins expressed from the mRNA
designated F50 in which AUG 50 had been changed to AUC. This mRNA gave rise to a protein initiated at AUG 62. The presence of p90 acted as a control for the immunoprecipitations. As shown above,
two proteins translated from wild-type RNA containing exon 1 (F) were
recognized by 3G5: p90 and p76IVT (Fig. 6B,
lane 4). The p90 protein was also recognized by 3G5 when AUG
50 was altered to AUC (F50) (lane 8), but the
smaller MDM2 proteins were not recognized, even though they were more abundant than p90 in the lysate (lane 6). This result
indicates that 3G5 does not recognize MDM2 initiated at AUG 62, which
is present in this translation (lane 6). An MDM2 protein
with the same apparent mobility as p76UV was synthesized
from an mRNA in which AUG 50 is the first methionine (B) and was
recognized by 3G5 (lane 12). Together, these mapping experiments indicate that the MDM2 protein initiated at AUG 50 is
recognized by 3G5, whereas the one initiated at AUG 62 is not. Hence,
it is likely that p76UV, which is recognized by 3G5 (Fig.
5B), initiates at AUG 50.
Both Alternative Splicing and Internal Initiation Can Give Rise
to a Protein the Size of p76UV in Intact Cells--
There
is strong evidence that internal initiation of mdm2
mRNAs gives rise to multiple MDM2 proteins in rabbit reticulocyte lysates, but it has not been determined whether internal initiation of
mdm2 mRNAs occurs in cells. Smaller proteins could also
arise through alternative splicing of exons 3-5 of mdm2
since any one of three AUG codons could become the first initiation
codon (Fig. 4A) (37). Deletion of exon 3 alone would place
AUG 50 as the first methionine, and RNAs lacking exon 3 have been
detected in cells expressing multiple MDM2 proteins (20).
To determine whether full-length and alternately spliced mRNA
species lacking exon 3 were capable of directing synthesis of a protein
with mobility similar to that of p76 in intact cells, we transfected
mammalian cDNA expression plasmids into cultured cells (27). The
cDNAs encoded mRNA initiated at the P1 promoter (containing
exons 1-12; F), mRNA initiated at the P2 promoter (containing
exons 2-12; X2), alternatively spliced mRNA initiated at the P1
promoter (containing exons 1, 2, and 4-12; D), and an artificially
engineered mRNA (lacking exons 1 and 2 and part of exon 3 such that
AUG 50 is the first methionine; B). COS-1 cells were chosen because
they contain SV40 large T-antigen, which will stimulate replication of
the expression plasmids, which contain the SV40 origin of replication
(24), ensuring high levels of expression of the MDM2 proteins. The two
normally spliced mRNAs initiated at the P1 (F) and P2 (X2)
promoters directed the synthesis of MDM2 proteins with mobility similar
to those of p90 and p76 (Fig. 7). The
ratio of p90 to p76 was greater when the mRNA (X2) lacked exon 1. In fact, very little p76 could be detected when the mRNA lacked
exon 1. This pattern of expression differs from that in the
reticulocyte lysate in that there is less p76 made in cells, relative
to p90, when either the F or X2 mRNA is translated. The pattern is
similar in that F mRNA gives rise to more p76 relative to p90 than
does X2 mRNA. As expected, neither of the mRNAs lacking AUGs 1 and 6 gave rise to p90, but both gave rise to a protein the size of
p76UV. These data indicate that both internal initiation
and alternative splicing are mechanisms through which p76 can be
expressed in cells.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
Both internal initiation and alternative
splicing can give rise to proteins with the same mobility as
p76UV in cells. COS-1 cells were transfected with
pCMV5 (no cDNA insert), pCMV5F (exons 1-12), pCMV5X2 (exons
2-12), pCMV5B (exons 3-12, less the first two AUG codons), or pCOCD
(exons 1, 2, and 4-12). Cells were radiolabeled with
[35S]Express 48 h post-transfection, and MDM2
proteins were immunoprecipitated with polyclonal antisera against MDM2
(antibody 628).
|
|
If internal initiation were the mechanism by which the p76 proteins
were synthesized from the mRNAs containing AUGs 1 and 6, mutagenesis of AUGs 50 and 62 should alter the translation products.
These mutations were introduced into the mammalian expression vector
pCMV5F, and the resulting plasmids were introduced into COS-1 cells.
MDM2 proteins were radiolabeled and isolated by immunoprecipitation (Fig. 8). The results are similar to
those obtained using the rabbit reticulocyte lysate: p90 and p76 were
translated from wild-type mRNA and from mRNA with AUG 62 mutated to AUC. Mutation of AUG 50 abrogated expression of p76, but
resulted in expression of a protein with slightly faster mobility.
Mutation of AUGs 50 and 62 eliminated synthesis of this protein,
indicating that AUG 62 can act as an initiation codon when AUG 50 is
mutated. The fastest migrating MDM2 protein, p74, was not altered by
these mutations. These results show that p76 (and p74) MDM2 proteins
can be synthesized via internal initiation in intact cells.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 8.
AUGs 50 and 62 act as initiation codons for
MDM2 in cells. COS-1 cells were transfected with pCMV5, pCMV5B,
pCMV5F, and derivatives of pCMV5F containing mutations at AUG 50, 62, or 50 and 62. Cells were labeled, and MDM2 proteins were
immunoprecipitated twice in succession with 2A10 as described in the
legend to Fig. 3.
|
|
An Alternatively Spliced mdm2 mRNA Is Expressed in C127
Cells--
Previously, we showed that the most abundant
mdm2 RNA in C127 cells is initiated at the P1 promoter and
contains exon 3 (29). mRNA lacking exon 3 was not detected in RNA
from C127 cells using primer extension with a radiolabeled primer
complementary to exon 4.3
Since p76 is expressed in C127 cells in the absence of exposure to UV
light, it seemed reasonable to hypothesize that internal initiation was
the mechanism through which this protein was expressed in these cells.
However, if an mRNA lacking exon 3 were expressed at levels
undetectable by the primer extension assay, it might still be a source
for the small amount of p76 made. To test whether unirradiated C127
cells expressed mdm2 mRNA lacking exon 3, we used RT-PCR
to amplify cDNAs containing exons 1 and 4 of mdm2. Two
species were cloned and sequenced. One contained exons 1-4; the other
contained exons 1, 2, and 4.3 Therefore, both internal
initiation and alternative splicing are possible mechanisms for
expression of p76 in unirradiated C127 cells.
An Alternatively Spliced RNA Initiated at the Internal Promoter of
mdm2 is Induced in Response to UV Light--
The normally spliced
mdm2 mRNA induced by UV light (X2) is an inefficient
template for translation of p76 (Fig. 7). Since p76 is induced in C127
cells by UV light, we investigated whether some of the transcripts
initiated at the P2 promoter were spliced to lack exon 3. A sensitive,
quantitative, radioactive RT-PCR assay was designed to detect RNAs
containing and lacking exon 3. The amount of each mRNA was
determined before (Fig. 9A)
and after (Fig. 9B) exposure of C127 cells to UV light. Two
sets of primers were used. One set, in exons 1 and 4, amplified only
mRNAs containing exon 1 (initiated at the P1 promoter). The other
set, in exons 2 and 4, amplified mRNAs initiating at both the P1
and P2 promoters. The primer in exon 4 was end-labeled, and reactions were performed with increasing amounts of an internal standard so that
the amount of each mdm2 mRNA species could be
quantified. By subtracting the amount of mRNA initiated from the P1
promoter from the total, the amount of mRNA transcribed from the P2
promoter could be calculated. In untreated C127 cells (Fig.
9A), most of the mdm2 mRNA initiated at the
P1 promoter and contained exon 3. Twenty-five percent of the mRNA
synthesized from the P1 promoter was alternatively spliced and lacked
exon 3. Little normally spliced or alternatively spliced mRNA was
expressed from the P2 promoter in the absence of DNA damage. Two h
following exposure to a dose of UV light of 4 J/m2, there
was no change in the amount of either RNA initiated from the P1
promoter (Fig. 9B). However, the amount of mRNA
transcribed from the P2 promoter and containing exon 3 was increased
14-fold. At the same time, the amount of mRNA initiated from the P2
promoter and lacking exon 3 was increased 3-fold. These results
indicate that some or all of the increase in p76UV
expression following exposure to UV light is mediated by alternative splicing of an induced RNA.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 9.
An mdm2 transcript lacking
exon 3 is induced by UV light. A, RT-PCR of mRNAs
from C127 cells that had not been treated with UV light. RNA from C127
cells was reverse-transcribed into cDNA and amplified by PCR. For
quantitation, an internal standard was included in the PCRs. Primer
pairs in exons 1 and 4 (left) or exons 2 and 4 (right) were used as described under "Experimental
Procedures" to reveal transcripts from the P1 promoter of
mdm2 (left) and both the P1 and P2 promoters of
mdm2 (right). Both sets of primers amplified
cDNAs containing exon 3 (Ex 3 (+)) and lacking exon 3 (Ex 3 ( )). B, RT-PCR of mRNAs from C127
cells exposed to a UV dose of 4 J/m2 and harvested 2 h
later. RNA was isolated and treated as described above.
|
|
 |
DISCUSSION |
We have shown here that the p76 MDM2 protein is synthesized in
normal cells. Alternatively spliced mdm2 mRNAs lacking
exon 3 express p76, but not p90, and such mRNAs are induced by UV
light. Synthesis of p76 is initiated at an AUG codon at position 50 of the coding sequence for p90, and p76 lacks the N-terminal domain required for interaction with p53. However, the protein retains many of
the structural motifs of p90, including the nuclear localization signal, nuclear export signals, acidic domain (20), and RING finger
(38). It is likely that p76 shares some functions with p90, and its
presence in normal cells indicates that it may mediate some of the
physiological functions of MDM2.
The ability of MDM2 to stimulate the degradation of p53 requires that
MDM2 bind p53 (10, 11). However, the level of p76 may influence the
stability of p53 because p76 could bind factors that regulate the
process. For example, p76 binds the p19ARF protein, which
inhibits the ability of p90 to stimulate degradation of p53 (13). An
increase in the amount of p76 relative to p90 might free p90 to be more
effective at stimulating degradation of p53. Alternatively, it is
possible that p76 is a dominant-negative inhibitor of the ability of
p90 to stimulate degradation of p53 since p76 might titrate factors
required for that function of p90. We have preliminary evidence that
the second model is correct. Overexpression of p76 antagonizes the
decrease in p53 levels mediated by
p90.4 Therefore, regulation
of the relative amounts of p76 and p90 MDM2 may be an important
mediator of p53 levels.
The ratio of p90 to p76 protein is determined, at least in part, by the
ratio of the four different mdm2 mRNAs described here. The most abundant mdm2 mRNA in unstressed C127 cells is
expressed from the P1 promoter and contains exon 3. This mRNA gives
rise to p90 predominantly. Our RT-PCR analysis indicated that
mdm2 mRNAs lacking exon 3 account for 25% of the total
mdm2 mRNA in unstressed C127 cells. Such mRNAs give
rise to p76 only. The results of the transfection experiments indicate
that mRNAs lacking exon 3 may be up to five times more efficient at
giving rise to p76 than are normally spliced mRNAs, if equal
transfection efficiencies and RNA stabilities are assumed. If this
number is valid, then more than half of the p76 present in C127 cells
arises from alternatively spliced mRNA. These observations indicate
that the ratio of normally spliced mRNA to alternatively spliced
mRNA affects the ratio of p90 to p76. Indeed, 2 h following
exposure to a dose of UV light of 4 J/m2, C127 cells have a
higher ratio of p90 to p76, in part because there is more normally
spliced mRNA relative to alternatively spliced mRNA than in the
absence of exposure. In addition, the induced transcript is more
efficient than the constitutive transcript at giving rise to p90
relative to p76. Under these same conditions, p53 levels are high, and
the p53 protein is active as a transcriptional activator (29). Later in
the UV response, p53 levels return to normal. The relative ratio of p76
to p90 may change throughout the UV response and determine whether p53
is stable. Since p53 stimulates apoptosis in response to UV light (39),
its levels may be critical determinants of cell survival.
Dissection of the functions of p76 may reveal p53-independent functions
of MDM2. For example, p76 retains the recently identified HECT domain,
which is required for the ubiquitin ligase activity of MDM2 (40).
Perhaps p76 targets a protein other than p53 for degradation. Evidence
suggests that some of the oncogenic effects of MDM2 are mediated by
mechanisms independent of p53 (4, 14, 15). In a subset of human tumors,
multiple MDM2 proteins are overexpressed (7, 18). The human gene has
AUG codons at positions 1, 6, 50, 62, and 102 (3), and a human p76
protein is expressed in normal fibroblasts.4 It may be that
p76 is overexpressed in tumors and contributes to development of
cancer. Identification of any oncogenic properties of p76 is important
because therapeutic interventions are being designed to disrupt the
interaction between p90 and p53. In tumors overexpressing p76, such
therapies may not be effective.
 |
ACKNOWLEDGEMENTS |
We thank Moshe Oren for mdm2
cDNA constructs; Arnold J. Levine for monoclonal antibodies
to p53, MDM2, and T-antigen; Angie Teresky for wild-type mouse embryo
fibroblasts; Guillermina Lozano for p53-null and
p53/mdm2-null mouse fibroblasts; and Bill Sugden for COS-1
cells. The technical expertise of Marisa Holubar and Amy Prevost is
greatly appreciated. We gratefully acknowledge Nancy Thompson and Kit
Nolan for advice on typing monoclonal antibodies and John Petrini for
advice on site-directed mutagenesis. We appreciate stimulating
conversations about this work with Marilyn Kozak, Moshe Oren, and Jeff
Ross and insightful comments on the manuscript by Chris Bradfield,
Susan Mendrysa, and Jeff Ross.
 |
FOOTNOTES |
*
This work was supported in part by Cancer Center Support
Grant CA-07175 (to the McArdle Laboratory for Cancer Research) and by
National Institutes of Health Grant CA-70718 (to M. E. P.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by NCI Predoctoral Grant CA-09135 from the National
Institutes of Health.
§
Supported by Predoctoral Grant GM-07215 from the National
Institutes of Health.
¶
To whom correspondence should be addressed: 207A McArdle Lab.
for Cancer Research, 1400 University Ave., Madison, WI 53706. Tel.:
608-265-5537; Fax: 608-262-2824; E-mail:
perry{at}oncology.wisc.edu.
2
M. Oren, personal communication.
3
L. J. Saucedo, unpublished results.
4
M. Holubar and M. E. Perry, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
MEFs, mouse embryo
fibroblasts;
RT-PCR, reverse transcription-polymerase chain
reaction.
 |
REFERENCES |
-
Montes de Oca Luna, R.,
Wagner, D. S.,
and Lozano, G.
(1995)
Nature
378,
203-206[CrossRef][Medline]
[Order article via Infotrieve]
-
Jones, S. N.,
Roe, A. E.,
Donehower, L. A.,
and Bradley, A.
(1995)
Nature
378,
206-208[CrossRef][Medline]
[Order article via Infotrieve]
-
Oliner, J. D.,
Kinzler, K. W.,
Meltzer, P. S.,
George, D. L.,
and Vogelstein, B.
(1992)
Nature
358,
80-83[CrossRef][Medline]
[Order article via Infotrieve]
-
Lundgren, K.,
Montes de Oca Luna, R.,
McNeill, Y. B.,
Emerick, E. P.,
Spencer, B.,
Barfield, C. R.,
Lozano, G.,
Rosenberg, M. P.,
and Finlay, C. A.
(1997)
Genes Dev.
11,
714-725[Abstract/Free Full Text]
-
Chen, C.-Y.,
Oliner, J. D.,
Zhan, Q.,
Fornace, A. J.,
Vogelstein, B.,
and Kastan, M. B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2684-2688[Abstract/Free Full Text]
-
Dubs-Poterszman, M.-C.,
Tocque, B.,
and Wasylyk, B.
(1995)
Oncogene
11,
2445-2449[Medline]
[Order article via Infotrieve]
-
Leach, F. S.,
Tokino, T.,
Meltzer, P.,
Burrell, M.,
Oliner, J. D.,
Smith, S.,
Hill, D. E.,
Sidransky, D.,
Kinzler, K. W.,
and Vogelstein, B.
(1993)
Cancer Res.
53,
2231-2234[Abstract/Free Full Text]
-
Haupt, Y.,
Barak, Y.,
and Oren, M.
(1996)
EMBO J.
15,
1596-1606[Medline]
[Order article via Infotrieve]
-
Momand, J.,
Zambetti, G. P.,
Olson, D. C.,
George, D.,
and Levine, A. J.
(1992)
Cell
69,
1237-1245[CrossRef][Medline]
[Order article via Infotrieve]
-
Haupt, Y.,
Maya, R.,
Kazaz, A.,
and Oren, M.
(1997)
Nature
387,
296-299[CrossRef][Medline]
[Order article via Infotrieve]
-
Kubbutat, M. H. G.,
Jones, S. N.,
and Vousden, K.
(1997)
Nature
387,
299-303[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhang, Y.,
Xiong, Y.,
and Yarborough, W. G.
(1998)
Cell
92,
725-734[CrossRef][Medline]
[Order article via Infotrieve]
-
Pomerantz, J.,
Schreiber-Agus, N.,
Liegeois, N. J.,
Silverman, A.,
Alland, L.,
Chin, L.,
Potes, J.,
Chen, K.,
Orlow, I.,
Lee, H.-W.,
Cordon-Cardo, C.,
and DePinho, R. A.
(1998)
Cell
92,
713-723[CrossRef][Medline]
[Order article via Infotrieve]
-
Martin, K.,
Trouche, D.,
Hagemeier, C.,
Sorensen, T. S.,
La Thangue, N. B.,
and Kouzarides, T.
(1995)
Nature
375,
691-694[CrossRef][Medline]
[Order article via Infotrieve]
-
Xiao, Z.-X.,
Chen, J.,
Levine, A. J.,
Modjtahedl, N.,
Xing, J.,
Sellers, W. R.,
and Livingston, D. M.
(1995)
Nature
375,
694-698[CrossRef][Medline]
[Order article via Infotrieve]
-
Sigalis, I.,
Calvert, A. H.,
Anderson, J. J.,
Neal, D. E.,
and Lunec, J.
(1996)
Nat. Med.
2,
912-917[CrossRef][Medline]
[Order article via Infotrieve]
-
Olson, D. C.,
Marechal, V.,
Momand, J.,
Chen, J.,
Romocki, C.,
and Levine, A. J.
(1993)
Oncogene
8,
2353-2360[Medline]
[Order article via Infotrieve]
-
Landers, J. E.,
Haines, D. S.,
Strauss, J. F.,
and George, D. L.
(1994)
Oncogene
9,
2745-2750[Medline]
[Order article via Infotrieve]
-
Barak, Y.,
Gottlieb, E.,
Juven-Gershon, T.,
and Oren, M.
(1994)
Genes Dev.
8,
1739-1749[Abstract/Free Full Text]
-
Fakharzadeh, S. S.,
Trusko, S. P.,
and George, D. L.
(1991)
EMBO J.
10,
1565-1569[Medline]
[Order article via Infotrieve]
-
McMasters, K. M.,
Montes de Oca Luna, R.,
Pena, J. R.,
and Lozano, G.
(1996)
Oncogene
13,
1731-1736[Medline]
[Order article via Infotrieve]
-
Sherley, J. L.
(1991)
J. Biol. Chem.
266,
24815-24828[Abstract/Free Full Text]
-
Harvey, D. M.,
and Levine, A. J.
(1991)
Genes Dev.
5,
2375-2385[Abstract/Free Full Text]
-
Gluzman, Y.
(1981)
Cell
23,
175-182[CrossRef][Medline]
[Order article via Infotrieve]
-
Papworth, C.,
Bauer, J. C.,
Braman, J.,
and Wright, D. A.
(1995)
Strategies
9,
3-4
-
Haines, D. S.,
Landers, J. E.,
Engle, L. J.,
and George, D. L.
(1994)
Mol. Cell. Biol.
14,
1171-1178[Abstract/Free Full Text]
-
Chu, G.,
and Sharp, P. A.
(1981)
Gene (Amst.)
13,
197-202[CrossRef][Medline]
[Order article via Infotrieve]
-
Chen, J.,
Marechal, V.,
and Levine, A. J.
(1993)
Mol. Cell. Biol.
13,
4107-4114[Abstract/Free Full Text]
-
Saucedo, L. J.,
Carstens, B. C.,
Seavey, S. E.,
Albee, L. D.,
and Perry, M. E.
(1998)
Cell Growth Differ.
9,
119-130[Abstract]
-
Lane, D. P.,
Stephen, C. W.,
Midgley, C. A.,
Sparks, A.,
Hupp, T. R.,
Daniels, D. A.,
Greaves, R.,
Reid, A.,
Vojtesek, B.,
and Picksley, S. M.
(1996)
Oncogene
12,
2461-2466[Medline]
[Order article via Infotrieve]
-
Kirchmaier, A.,
and Sugden, B.
(1998)
J. Virol.
72,
1766-1775
-
Cahilly Snyder, L.,
Yang-Feng, T.,
Francke, U.,
and George, D. L.
(1987)
Somatic Cell Mol. Genet.
13,
235-244[CrossRef][Medline]
[Order article via Infotrieve]
-
Hinds, P. W.,
Finlay, C. A.,
Quartin, R. S.,
Baker, S. J.,
Fearon, E. R.,
Vogelstein, B.,
and Levine, A. J.
(1990)
Cell Growth Differ.
1,
571-580[Abstract]
-
Perry, M. E.,
Piette, J.,
Zawadski, J. A.,
Harvey, D.,
and Levine, A. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11623-11627[Abstract/Free Full Text]
-
Kozak, M.
(1984)
Nature
308,
241-246[CrossRef][Medline]
[Order article via Infotrieve]
-
Bottger, A.,
Bottger, V.,
Garcia-Echeverria, C.,
Chene, P.,
Hochkeppel, H.-K.,
Sampson, W.,
Ang, K.,
Howard, S. F.,
Picksley, S. M.,
and Lane, D. P.
(1997)
J. Mol. Biol.
269,
744-756[CrossRef][Medline]
[Order article via Infotrieve]
-
Montes de Oca Luna, R.,
Tabor, A. D.,
Eberspaecher, H.,
Hulboy, D. L.,
Worth, L. L.,
Coleman, M. S.,
Finlay, C. A.,
and Lozano, G.
(1996)
Genomics
33,
352-357[CrossRef][Medline]
[Order article via Infotrieve]
-
Boddy, M. N.,
Freemont, P. S.,
and Borden, K. L. B.
(1994)
Trends Biochem. Sci.
19,
198-199[CrossRef][Medline]
[Order article via Infotrieve]
-
Zeigler, A.,
Jonason, A. S.,
Lefell, D. J.,
Simon, J. A.,
Sharma, H. W.,
Kimmelman, J.,
Remington, L.,
Jacks, T.,
and Brash, D. E.
(1994)
Nature
372,
773-776[CrossRef][Medline]
[Order article via Infotrieve]
-
Honda, R.,
Tanaka, H.,
and Yasuda, H.
(1997)
FEBS Lett.
420,
25-27[CrossRef][Medline]
[Order article via Infotrieve]
-
Harlow, E.,
and Lane, D.
(1988)
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T.-H. Cheng and S. N. Cohen
Human MDM2 Isoforms Translated Differentially on Constitutive versus p53-Regulated Transcripts Have Distinct Functions in the p53/MDM2 and TSG101/MDM2 Feedback Control Loops
Mol. Cell. Biol.,
January 1, 2007;
27(1):
111 - 119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Nelson, V. Bhaskaran, W. R. Foster, and L. D. Lehman-McKeeman
p53-Independent Induction of Rat Hepatic Mdm2 following Administration of Phenobarbital and Pregnenolone 16{alpha}-Carbonitrile
Toxicol. Sci.,
December 1, 2006;
94(2):
272 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Van Vleet, T. L. Watterson, P. J. Klein, and R. A. Coulombe Jr.
Aflatoxin B1 Alters the Expression of p53 in Cytochrome P450-Expressing Human Lung Cells
Toxicol. Sci.,
February 1, 2006;
89(2):
399 - 407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-J. Chang, D. J. Freeman, and H. Wu
PTEN Regulates Mdm2 Expression through the P1 Promoter
J. Biol. Chem.,
July 9, 2004;
279(28):
29841 - 29848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Iwakuma and G. Lozano
MDM2, An Introduction
Mol. Cancer Res.,
December 1, 2003;
1(14):
993 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bartl, J. Ban, H. Weninger, G. Jug, and H. Kovar
A small nuclear RNA, hdm365, is the major processing product of the human mdm2 gene
Nucleic Acids Res.,
February 15, 2003;
31(4):
1136 - 1147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Mendrysa and M. E. Perry
The p53 Tumor Suppressor Protein Does Not Regulate Expression of Its Own Inhibitor, MDM2, Except under Conditions of Stress
Mol. Cell. Biol.,
March 15, 2000;
20(6):
2023 - 2030.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. E. Perry, S. M. Mendrysa, L. J. Saucedo, P. Tannous, and M. Holubar
p76MDM2 Inhibits the Ability of p90MDM2 to Destabilize p53
J. Biol. Chem.,
February 25, 2000;
275(8):
5733 - 5738.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Seavey, M. Holubar, L. J. Saucedo, and M. E. Perry
The E7 Oncoprotein of Human Papillomavirus Type 16 Stabilizes p53 through a Mechanism Independent of p19ARF
J. Virol.,
September 1, 1999;
73(9):
7590 - 7598.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|