Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, G.
Right arrow Articles by Snyder, F. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, G.
Right arrow Articles by Snyder, F. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 12, 8175-8180, March 19, 1999


Cloning and Characterization of Human Guanine Deaminase
PURIFICATION AND PARTIAL AMINO ACID SEQUENCE OF THE MOUSE PROTEIN*

Gang YuanDagger §, James C. Bin§, Donald J. McKay§, and Floyd F. SnyderDagger §

From the Departments of Dagger  Medical Genetics and § Biochemistry & Molecular Biology, Faculty of Medicine, University of Calgary, Calgary, Alberta T2N 4N1, Canada

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Mouse erythrocyte guanine deaminase has been purified to homogeneity. The native enzyme was dimeric, being comprised of two identical subunits of approximately 50,000 Da. The protein sequence was obtained from five cyanogen bromide cleavage products giving sequences ranging from 12 to 25 amino acids in length and corresponding to 99 residues. Basic Local Alignment Search Tool (BLAST) analysis of expressed sequence databases enabled the retrieval of a human expressed sequence tag cDNA clone highly homologous to one of the mouse peptide sequences. The presumed coding region of this clone was used to screen a human kidney cDNA library and secondarily to polymerase chain reaction-amplify the full-length coding sequence of the human brain cDNA corresponding to an open reading frame of 1365 nucleotides and encoding a protein of 51,040 Da. Comparison of the mouse peptide sequences with the inferred human protein sequence revealed 88 of 99 residues to be identical. The human coding sequence of the putative enzyme was subcloned into the bacterial expression vector pMAL-c2, expressed, purified, and characterized as having guanine deaminase activity with a Km for guanine of 9.5 ± 1.7 µM. The protein shares a 9-residue motif with other aminohydrolases and amidohydrolases (PGX[VI]DXH[TVI]H) that has been shown to be ligated with heavy metal ions, commonly zinc. The purified recombinant guanine deaminase was found to contain approximately 1 atom of zinc per 51-kDa monomer.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES

Guanine deaminase (guanine aminohydrolase, EC 3.5.4.3) catalyzes the hydrolytic deamination of guanine. By producing xanthine and ammonia, this reaction irreversibly eliminates the guanine base from further reutilization as a guanylate nucleotide in mammals. The product xanthine is a substrate for xanthine oxidase in the production of uric acid. Although it is an enzyme of purine catabolism, guanine deaminase is not ubiquitously expressed and exhibits a general absence in lymphoid tissues and variable expression elsewhere (1, 2). The highest levels of expression were found in the proximal section of the small intestine of the mouse (3). There are greater than 50-fold differences in guanine deaminase among different regions of the mouse brain; the cerebral cortex and amygdala have the highest activity (4), whereas there is essentially no activity in the cerebellum of the mouse or cat (4, 5). There are greater than 10-fold increases in the level of expression of guanine deaminase in the liver, kidney, and brain during the 40-day postnatal development of the rat (6), and alterations in embryonic expression have also been characterized (7). In the adult mouse, fractional increases in brain and liver enzyme activity occur in response to intraperitoneal administration of a bolus of guanine (8). The tissue-specific expression and the developmental and induced changes in expression suggest a potential role for guanine deaminase in the regulation of the guanine nucleotide pool. Cellular GTP has an important role not only in specific enzyme reactions and protein synthesis, but also in signal transduction pathways. The cloning and characterization of guanine deaminase will advance our understanding of this key enzyme in the catabolism of guanine metabolites.

Guanine deaminase has been purified from a number of mammalian sources (9-13). We describe here the purification to homogeneity of mouse erythrocytic guanine deaminase. Cyanogen bromide cleavage and peptide sequencing facilitated the identification and retrieval of human EST1 clones that were used to isolate a full-length guanine deaminase cDNA from human brain. Subsequent expression of the recombinant human protein and characterization of its catalytic activity and kinetics properties confirmed this cDNA to encode human guanine deaminase.

    MATERIALS AND METHODS

Reagents-- Xanthine oxidase, uricase, and peroxidase were purchased from ICN Pharmaceuticals. Guanine and 4-amino-antipyrine were from Sigma, and 2,4,6-tribromo-3-hydroxybenzoic acid was from Boehringer Mannheim. [alpha -32P]dCTP and [alpha -32P]dATP were from Amersham. Restriction enzymes, Taq DNA polymerase, and isopropyl-beta -thiogalactopyranoside were obtained from Life Technologies, Inc.

Purification of Mouse Erythrocyte Guanine Deaminase-- Heparanized blood was collected from C57BL/6J adult mice as described previously (14). Blood pooled from 30-50 mice was centrifuged at 900 × g for 5 min, and the erythrocyte pellet was resuspended and washed once with 10 volumes of isotonic saline. The cell pellet was lysed by adding an equal volume of 2× Buffer A (20 mM Tris-HCl, 5 mM MgCl2, and 1 mM DTT, pH 6.0) followed by three 30-s pulses at the maximum setting on the Polytron (Brinkmann Instruments). The lysate was centrifuged at 10,000 × g for 10 min at 4 °C, and the supernatant was used in subsequent steps.

The crude supernatant (approximately 20 ml) was applied to a 25-ml DEAE-Sepharose column previously equilibrated in Buffer A and washed with 10 column volumes of Buffer A. The enzyme was eluted with a gradient formed between equal volumes of Buffer A and Buffer B (buffer A containing 0.5 M KCl) at 1.5 ml/min. 3-ml fractions were collected, and guanine deaminase was typically eluted at approximately 150 mM KCl. Fractions containing guanine deaminase were pooled and concentrated using an Amicon ultrafiltration YM10 membrane.

Subsequent steps were performed on a Pharmacia fast protein liquid chromatography system. 1× volume of 100 mM sodium phosphate, pH 6.8, 1 mM DTT, and 3.2 M (NH4)2SO4 was added to the concentrated fractions, and the sample was loaded on a 10-ml phenol-Sepharose high performance column (Pharmacia) equilibrated in Buffer C (50 mM sodium phosphate, pH 6.8, and 1 mM DTT) containing 1.6 M (NH4)2SO4. The column was washed at 1 ml/min with 8 volumes of loading buffer and then eluted by a stepwise gradient of 10 ml each in descending 0.2-M increments of (NH4)2SO4 in Buffer C, collecting 1-ml fractions. Guanine deaminase eluted at approximately 0.6 M (NH4)2SO4. Fractions were pooled and concentrated by Amicon ultrafiltration as described above.

Combined fractions were concentrated to 1 ml and adjusted to 3.2 M (NH4)2SO4 in Buffer C. The sample was applied to a 1-ml Source 15PHE column (Pharmacia) and eluted at 1 ml/min, collecting 1-ml fractions. The column was washed with Buffer D (10 ml of Buffer C containing 3.2 M (NH4)2SO4) and then eluted stepwise with decreasing amounts of (NH4)2SO4 formed from mixtures of Buffers C and D as follows: 0-5 min, 100% to 75% Buffer D; 5-15 min, held at 75% Buffer D; 15-75 min, 75% to 45% Buffer D; and 75-100 min, 45% to 0% Buffer D. Guanine deaminase typically eluted at approximately 45 min, and fractions containing activity were pooled and concentrated, and the buffer was changed to 20 mM Tris-HCl, pH 7.0, 1 mM EDTA, and 1 mM DTT. For storage at -70 °C, 20% glycerol was added to the final buffer.

The native molecular mass was determined by fractionation of purified erythrocyte guanine deaminase on a Superose 6 HR column (Pharmacia) (bed volume, 24 ml) eluted with 10 mM Tris-HCl, 150 mM NaCl, and 1 mM DTT, pH 8.0, at 0.4 ml/min and monitored by absorbance at 280 nm. Molecular weight standards were also run under the same conditions.

Protein Sequencing-- Cyanogen bromide cleavage was performed on 10 µg of protein (15). The digest was vacuum dried, treated with propylamine (16), and dried further. Cyanogen bromide fragments were purified for sequencing by SDS-polyacrylamide gel electrophoresis (17), electroblotted to polyvinylidene difluoride, and stained with Coomassie Blue. N-terminal peptide sequencing was performed using a Perkin Elmer Applied Biosystems 491 sequencer operated in the gas-phase mode. Individual stained bands were cut from the polyvinylidene difluoride blot with a scalpel and installed in the sequencer blot sample cartridge.

Metal Analysis of Guanine Deaminase-- The zinc and manganese content of guanine deaminase was determined by graphite furnace atomic absorption (Gailbraith Laboratories, Knoxville, TN). The lower limit for detection was <0.2 nmol for zinc and <0.02 nmol for manganese.

Enzyme Assay and Kinetics-- Guanine deaminase was assayed spectrophotometrically by following the conversion of guanine to xanthine in a coupled reaction at 512 nm at 37 °C (18). The reaction consisted of 1 mM 2,4,6-tribromo-3-hydroxybenzoic acid, 0.1 mM 4-amino-antipyrene, 0.025 unit/ml xanthine oxidase, 0.00325 unit/ml uricase, and 0.002 unit/ml peroxidase. The color factor for xanthine was determined empirically over a range of concentrations and was 14.8 nmol/absorbance unit at 512 nm. Protein was determined as described previously (14). Initial rates in the kinetic experiments were analyzed by a weighted nonlinear least-squares curve fitting program (19).

Isolation and Sequence of Human Guanine Deaminase cDNA-- The Basic Local Alignment Search Tool (20) was used to identify EST clone-encoded proteins that were highly homologous to the mouse peptide sequences. The human EST cDNA clones were ordered from Research Genetics, Inc. and had the following accession numbers: 25984, 33881, and 48404. Each of these was found to have a 1.9-kb insert and common sequence. The insert for plasmid 48404 was sequenced in both directions, and the apparent coding region was used to generate a probe to screen the human kidney 5'-STRETCH PLUS cDNA lambda gt10 library (CLONTECH). Primer sequences used to generate the probe by PCR were 5'dbGDA (TTTGAATTCATGCCTGGGCTGGTTG, corresponding to bp 220-238) and 3'dbGDA (CCCAAGCTTTCTAACTCCACCTGGGCACAA, bp 1443 to 1420). Probes (1.2 kb) were prepared by PCR amplification using EST clone 48404 as a template under the following conditions: 94 °C for 5 min followed by 30 cycles of 94 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min. Approximately 30 ng of PCR DNA product were labeled with [32P]dATP by the random priming method (RTS RadPrime DNA Labeling System; Life Technologies, Inc.). Hybridization was carried out at 42 °C in 6× SSC, 5× Denhardt's solution, 0.1% SDS, and 40% formamide for 16 h. Filters were washed with 2× SSC and 0.1% SDS and 1× SSC and 0.1% SDS for 1 h each at 60 °C. A single positive phage was isolated from approximately 500,000 colonies. The 2.2-kb insert was PCR-amplified using lambda gt10 forward (AGCAAGTTCAGCCTGGTTAAG) and reverse (TAATGAGTATTTCTTCCAGGG) primers followed by direct sequencing (21).

From the kidney cDNA sequence, two primers were generated for amplification of the complete coding sequence from human brain MarathonTM-Ready cDNA (CLONTECH). Primers derived from the human kidney cDNA and EST sequences were 5'GDA (AAAGAATTCATGTGTGCCGCTCAGATGCC, bp -1 to 20) and 3'dbGDA. Both strands of the product were sequenced using the ABI prism TM Dye terminator cycle sequencing ready reaction kit (Perkin Elmer).

Expression of Human Guanine Deaminase Protein-- Two oligonucleotides, 5'GDA and 3'dbGDA, were used to amplify the full-length coding sequence. The resulting fragment was digested with EcoRI and HindIII, subcloned into the pMAL-c2 expression vector (New England Biolabs), and transformed into DH5-alpha cells. The insert was sequenced to verify its structure. The expressed fusion protein was prepared essentially as described previously (14) and according to the supplier's guidelines. The cleaved protein contained an extra four amino acids, LSEF, at the N terminus. The protein was analyzed by 12% SDS-polyacrylamide gel electrophoresis.

    RESULTS

Mouse erythrocytic guanine deaminase was purified 900-fold to homogeneity (Table I). The purified mouse protein was analyzed by SDS-gel electrophoresis and gave a subunit molecular mass of 50 kDa (Fig. 1A). Gel exclusion chromatography on a Superose 6 HR column revealed the native protein to consist principally of a dimer of 100 kDa with approximately 5% of the protein present as a 200-kDa species, consistent with the presence of a minor tetrameric component (Fig. 1B). Purified mouse erythrocytic guanine deaminase gave a Km of 22.7 ± 2.9 µM for guanine.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Purification of mouse erythrocyte guanine deaminase
Results are given for a typical purification run; units are expressed as nanomoles of guanine converted to xanthine per minute.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1.   Subunit and native molecular mass of mouse erythrocyte guanine deaminase. A, purification of guanine deaminase monitored by SDS-gel electrophoresis. Lane 1, standards; lane 2, purified guanine deaminase (0.5 µg); lane 3, fractions after phenol-Sepharose chromatography (3 µg); lane 4, fractions after DEAE-Sepharose chromatography (3 µg). B, molecular mass of native guanine deaminase. Guanine deaminase was fractionated on a Superose 6 HR column (top panel). Plot of the log of molecular weight of guanine deaminase (black-square) and standards versus Kav, the ratio of the elution volume:total available volume of column (bottom panel) are shown. Standards were as follows: thyroglobulin, 669 kDa (); beta -amylase, 200 kDa (triangle ); aldolase, 158 kDa (); bovine serum albumin, 132-kDa dimer (black-triangle); ovalbumin, 43 kDa (diamond ); and carbonic anhydrase, 29 kDa (*).

Attempts to sequence the intact native protein failed, indicating that the protein was N-terminal modified. The purified protein was subjected to cyanogen bromide cleavage followed by SDS-gel electrophoresis. Three principal bands were obtained, and these were electroblotted onto a polyvinylidene difluoride membrane, cut out, and subjected to N-terminal gas phase sequencing. Two of these bands were comprised of two peptides each; however, their sequences could be distinguished by the differential signal intensity of the individual residues (Table II). Overall sequence was obtained for five peptides ranging from 12 to 25 residues and corresponding in total to 99 amino acids.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Amino acid sequence of cyanogen bromide peptides from mouse guanine deaminase and comparison to inferred human sequence
Differences between mouse and inferred human sequence (from Fig. 3) are shown in bold. M, inferred methionine residue from cyanogen bromide cleavage; X, residue not determined.

The strategy for the retrieval of guanine deaminase cDNA is outlined in Fig. 2. Basic Local Alignment Search Tool analysis of expressed sequence databases (20) using the mouse peptide sequence resulted in the identification of highly homologous human cDNA sequences; none were represented in the databases for the mouse. Only peptide IIa corresponded to an expressed sequence clone. Three EST clones were retrieved, and a determination of their size and partial sequence indicated that the clones were essentially identical. The sequence of EST clone 48404 yielded coverage of approximately 80% of the predicted open reading frame, including some 3' noncoding sequence. The entire coding region of the dbEST clone was used to screen a human kidney cDNA library and resulted in the retrieval of a single colony. Upon sequencing this clone, the open reading frame appeared to be lacking the equivalent of approximately 40 residues at the N-terminal end; however, an out-of-frame ATG codon was apparent in approximately the right position near the 5' end of this sequence. Primers were designed corresponding to the putative 5'- and 3'-coding ends of the gene, and a PCR product was obtained from a human brain cDNA library (MarathonTM-Ready cDNA). The sequence of this cDNA product gave an open reading frame of 1365 bp, corresponding to a protein of 51,040 Da, which is in agreement with the subunit mass of the purified mouse protein (Fig. 1A). By comparison, there was a single base deletion at position 911 (Fig. 2, Delta C) of the EST clone that was not present in either the kidney or brain cDNA sequences. In addition, a 4-bp deletion at position 124-127 (Delta ATAG) of the kidney cDNA clone was not present in the brain cDNA sequence and accounted for the absence of a complete open reading frame in the kidney cDNA sequence.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   The EST and kidney cDNA clones and the PCR-amplified brain cDNA guanine deaminase. The EST open reading frame was used to screen and isolate the kidney cDNA guanine deaminase. PCR primers based on the kidney cDNA sequence were used to isolate brain cDNA.

The complete cDNA sequence is given in Fig. 3. The human translated sequence and the corresponding mouse peptide sequences are identified (Table II and Fig. 3). For each mouse peptide, the residue preceding the N terminus corresponded to a methionine in the human sequence, consistent with the cyanogen bromide cleavage strategy.


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 3.   cDNA and predicted amino acid sequence of human guanine deaminase. Amino acid residues corresponding to mouse peptide sequences are shown in bold.

Conclusive verification of the identity for the cloned human sequence was obtained by subcloning the entire coding portion into the pMAL expression vector and the production of recombinant human protein (Fig. 4). The cleaved product had an apparent molecular mass of 51 kDa and had the extra LSEF residues at the N terminus. The recombinant protein catalyzed the conversion of guanine to xanthine, with a Km of 9.5 ± 1.7 µM for guanine. The turnover number (kcat) was 17.4 s-1, and the catalytic efficiency (kcat/Km) was 11.8 × 103 s-1 M-1. The enzyme exhibited optimal activity at pH 7.0, with the Km remaining constant between pH 6.5 and pH 7.5, as described previously for the rabbit liver enzyme (12). Therefore, the pseudo first-order rate constant (Vm/Km) also showed a sharp optimum at pH 7.0. The human enzyme showed no increase in activity or dependence upon zinc or magnesium ion; however, the addition of manganese consistently resulted in approximately 2-fold increased activity. Optimal activity was obtained at approximately 0.5 mM and remained constant to 10 mM manganese chloride. The divalent metal content of guanine deaminase was determined by atomic absorption. No detectable manganese was found (<0.02 atom Mn2+ per monomer), whereas 0.70-0.91 atom Zn2+ was associated per monomer of guanine deaminase.


View larger version (88K):
[in this window]
[in a new window]
 
Fig. 4.   Expression and purification of recombinant human guanine deaminase as monitored by SDS-polyacrylamide gel electrophoresis. Lane 1, molecular weight standards; lane 2, amylose column purified maltose-binding protein-guanine deaminase fusion product (2 µg); lane 3, factor Xa cleaved fusion product (2 µg); lane 4, purified recombinant guanine deaminase (0.5 µg).


    DISCUSSION

Mouse erythrocytic guanine deaminase was purified to homogeneity (Fig. 1), and the amino acid sequence was obtained from five cyanogen bromide cleavage products (Table I). The peptide sequences enabled the retrieval of human EST clones, and a portion of these was used to clone the full-length human cDNA guanine deaminase. Comparison of the mouse amino acid sequence from five cyanogen bromide peptides showed an identity of 88 of 99 residues with the inferred human protein sequence (Table II). Further verification of the function of the retrieved human cDNA was obtained by expression of the recombinant protein and its characterization as having guanine deaminase activity. The predicted molecular mass of the human cDNA, 51,040 Da, is in good agreement with the subunit composition for the mouse protein estimated at 50,000 Da (Fig. 1A). These findings are in general agreement with previous studies of purified mammalian guanine deaminases that gave Mr subunit estimates of Mr 50,000 for pig brain (9), Mr 52,000 for rabbit liver (10) and rat brain (11), Mr 55,000 for rabbit liver (12), and Mr 59,000 for human liver (13). The native enzyme has generally been found to be dimeric (10, 11, 13, 22). The purified native mouse erythrocytic protein was principally dimeric in composition with a minor tetrameric component (Fig. 1B).

The Km values for the purified mouse erythrocytic protein and recombinant human guanine deaminase were similar (22.7 and 9.5 µM, respectively). Michaelis constants for guanine deaminase with guanine from other sources were also in this range: 4.2 µM for bovine liver (22), 11 µM for pig brain (9), 12.5 µM for rabbit liver (12), and 15.3 µM for human liver (13). The purified enzymes have exhibited pKa values consistent with the involvement of essential cysteine and histidine residues (9, 12, 13), and inactivation with p-hydroxymercuribenzoate (9, 13) and rose bengal or diethylpyrocarbonate (23), respectively, has substantiated an essential role for these residues. Comparative sequence analysis now provides further evidence for the importance of histidine residues in guanine deaminase.

Guanine deaminase shares a 9-residue N-terminal sequence previously recognized in other aminohydrolases and amidohydrolases (24, 25). Inspection of the SWISS-PROTEIN and TrEMBL databases using the Scan Prosite tool (26) revealed that this motif is shared by 28 enzymes from 20 different species (Table III). This motif, particularly the invariant His-X-His portion, has been implicated in the association of bound Zn with dihydroorotase. This site has been examined via site-directed mutagenesis, and substitution for either one of the histidine residues in dihydroorotase results in both loss of activity and loss of associated Zn (27, 28). Human and mouse guanine deaminases (Table II and Fig. 3) share this 9-residue motif but are otherwise unique in primary sequence from other members of this family. Metal analysis of the recombinant human guanine deaminase confirmed the association of approximately one Zn2+ atom per enzyme monomer.

                              
View this table:
[in this window]
[in a new window]
 
Table III
Aminohydrolase and amidohydrolase enzymes sharing a 9-residue motif
Accession identification numbers for sequences matching the 9-residue motif in the SWISS-PROT and TrEMBL databases are as follows: adenine deaminase, P39761 and 050821; allantoinase, 032137; ULIP, Q14195 and Q62188; DHPASE, Q14117, Q63150, Q44184, P81006, Q45515 and Q59699; imidazolone propionase, 031200; P42084; isoaspartyldipeptidase; P39377; D-aminoacylase, P72349; N-acyl-D-aspartate amidohydrolase, P94212; GLNAC 6-P deacylase, 034450, 053382, and P96166; dihydroorotase, P20054, P05990, P27708, P08955, Q91437, P46538, P25995, P77884, Q58885, and 027199. ULIP, Urc-33-like phosphoprotein; DHPASE; dihydropyrimidirase; GLNAc 6-P deacylase, N-acetylglucosamine-6-phosphate deacetylase.

The ligand array that features a proximal histidine pair, HXH, and a third histidine rather distant in the sequence has been described as a class II zinc site (29). Mammalian adenosine deaminase has a His-X-His motif at residues 15-17 that is known to be associated with Zn with an additional His at 214, but it does not share the preceding sequence of the 9-residue motif (30). Guanine deaminase has His-Ile-His at residues 82-84, with a third histidine at residue 112. This sequence is also likely to be responsible for the apparent 2-fold activation seen with manganese and is presumably associated with the loss of enzyme activity attributed to the plumbous ion (31).

There is evidence that guanine deaminase has a significant role in urate production in mammals. The relative amount of xanthine formation via guanine was estimated to be 80% versus that via hypoxanthine at 16% (32). For xanthenuric adults with no xanthine dehydrogenase activity, the mean urine excretion ratio of xanthine:hypoxanthine is approximately 4:1 (33), again pointing to the relative importance of the guanine to xanthine as opposed to the hypoxanthine to xanthine catabolic pathway. Administration of lead acetate in the pig as a model of acute lead exposure resulted in the deposition of guanine crystals in the epiphyseal plate of the femoral head, and this occurred in conjunction with lead-induced loss of guanine deaminase activity (31). Hypoxanthine-guanine phosphoribosyltransferase, which can convert guanine to GMP in the presence of 5-phosphoribosyl-1-pyrophosphate, has a Km for guanine (34, 35) that is approximately the same as that of guanine deaminase. In tissues where both hypoxanthine-guanine phosphoribosyltransferase and guanine deaminase are expressed, the relative amounts of these enzymes and the availability of 5-phosphoribosyl-1-pyrophosphate may be expected to determine whether guanine will be reutilized or catabolized and eliminated.

Guanine deaminase has been immunohistochemically localized to the cytoplasm of human liver (36), consistent with its isolation from the supernatant of cell and tissue lysates. The serum enzyme activity in man is among the most sensitive indicators of liver disease (1) as a consequence of its near absence in normal human serum, erythrocytes, and lymphoid cells (2). There is a single report of a full-term infant who presented with acute anoxia at birth and died from respiratory distress at day 2 who was found to be deficient in brain guanine deaminase activity (37). Further studies may now be initiated by mapping guanine deaminase and looking for human disease correlates using model systems such as the mouse to explore the relationship between guanine deaminase deficiency and clinical and metabolic phenotypes.

    ACKNOWLEDGEMENT

We thank Florence Yang for assistance with manuscript preparation.

    FOOTNOTES

* This work was supported by Grant MT-6376 from The Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF095286.

To whom correspondence should be addressed: Dept. of Medical Genetics, University of Calgary, Faculty of Medicine, 3330 Hospital Dr. N.W., Calgary, Alberta T2N 4N1, Canada. Tel.: 403-220-6025; Fax: 403-283-8225; E-mail: snyder{at}ucalgary.ca.

    ABBREVIATIONS

The abbreviations used are: EST, expressed sequence tag; DTT, dithiothreitol; PCR, polymerase chain reaction; kb, kilobase; bp, base pair(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
REFERENCES
  1. Kuzmits, R., Seyfried, H., Wolf, A., and Müller, M. M. (1980) Enzyme (Basel) 25, 148-152[Medline] [Order article via Infotrieve]
  2. Scholar, E. M., and Calabresi, P. (1973) Cancer Res. 33, 94-103[Abstract/Free Full Text]
  3. Mohamedali, K. A., Guicherit, O. M., Kellems, R. E., and Rudolph, F. B. (1993) J. Biol. Chem. 268, 23728-23733[Abstract/Free Full Text]
  4. Berger, S. J., Carter, J. G., and Lowry, O. H. (1985) J. Neurochem. 44, 1736-1740[CrossRef][Medline] [Order article via Infotrieve]
  5. Dawson, D. M. (1971) Neurology 21, 621-626[Free Full Text]
  6. Nardiello, S., Galanti, B., Russo, M., and Guarino, F. (1978) Enzyme (Basel) 23, 353-355[Medline] [Order article via Infotrieve]
  7. Brosh, S., Sperling, O., Bromberg, Y., and Sidi, Y. (1990) J. Neurochem. 54, 1776-1781[CrossRef][Medline] [Order article via Infotrieve]
  8. Sitaramayya, A., Ali, S., Sree Kumar, K., and Krishnan, P. S. (1974) Biochem. J. 138, 143-146[Medline] [Order article via Infotrieve]
  9. Rossi, C. A., Hakim, G., and Solaini, G. (1978) Biochim. Biophys. Acta 526, 235-246[Medline] [Order article via Infotrieve]
  10. Bergstrom, J. D., and Bieber, A. L. (1979) Arch. Biochem. Biophys. 194, 107-116[CrossRef][Medline] [Order article via Infotrieve]
  11. Miyamato, S., Ogawa, H., Shiraki, H., and Nakagawa, H. (1982) J. Biochem. (Tokyo) 91, 167-176[Abstract/Free Full Text]
  12. Lewis, A. S., and Glantz, M. D. (1974) J. Biol. Chem. 249, 3862-3866[Abstract/Free Full Text]
  13. Gupta, N. K., and Glantz, N. D. (1985) Arch. Biochem. Biophys. 236, 266-276[CrossRef][Medline] [Order article via Infotrieve]
  14. Snyder, F. F., Jenuth, J. P., Dilay, J. E., Fung, E., Lightfoot, T., and Mably, E. R. (1994) Biochim. Biophys. Acta 1227, 33-40[Medline] [Order article via Infotrieve]
  15. Gross, E. (1967) Methods Enzymol. 11, 238-255[CrossRef]
  16. Tarr, G. E. (1986) in Methods of Protein Microcharacterization (Shively, J. E., ed), pp. 155-194, Humana Press, Clifton, New Jersey
  17. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379[CrossRef][Medline] [Order article via Infotrieve]
  18. Le Tissier, P. R., Peters, J., and Skidmore, C. D. (1984) Anal. Biochem. 222, 168-175
  19. Brooks, S. P. J. (1992) BioTechniques 13, 906-911[Medline] [Order article via Infotrieve]
  20. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410[CrossRef][Medline] [Order article via Infotrieve]
  21. Snyder, F. F., Jenuth, J. P., Mably, E. R., and Mangat, R. K. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 2522-2527[Abstract/Free Full Text]
  22. Galilea, J. M., Canela, E. I., and Bozal, J. (1981) Int. J. Biochem. (Engl. Ed.) 13, 773-776
  23. Solani, G., and Rossi, C. A. (1982) Ital. J. Biochem. (Engl. Ed.) 31, 253-260[Medline] [Order article via Infotrieve]
  24. Nygaard, P., Duckert, P., and Saxild, H. H. (1996) J. Bacteriol. 178, 846-853[Abstract/Free Full Text]
  25. Kim, G.-J., and Kim, H.-S. (1998) Biochem. J. 330, 295-302
  26. Bairoch, A., Bucher, P., and Hofmann, K. (1997) Nucleic Acids Res. 24, 217-221
  27. Zimmermann, B. H., Kemling, N. M., and Evans, D. R. (1995) Biochemistry 34, 7038-7046[CrossRef][Medline] [Order article via Infotrieve]
  28. Williams, N. K., Manthey, M. K., Hambley, T. W., O'Donoghue, S. I., Keegan, M., Chapman, B. E., and Christopherson, R. I. (1995) Biochemistry 34, 11344-11352[CrossRef][Medline] [Order article via Infotrieve]
  29. Karlin, S., and Zhu, Z.-Y. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14231-14236[Abstract/Free Full Text]
  30. Kantz, J., and Schnakerz, K. D. (1989) Eur. J. Biochem. 181, 431-435[Medline] [Order article via Infotrieve]
  31. Farkas, W. R., and Stanawitz, T. (1978) Science 199, 786-787[Abstract/Free Full Text]
  32. van Waeg, G., Niklasson, F., and de Verdier, C.-H. (1986) in Purine and Pyrimidine Metabolism (Nyhan, W. L., Thompson, L. F., and Watts, R. W. E., eds), pp. 425-430, Plenum Press, New York
  33. Boulieu, R., Bory, C., Baltassat, P., and Divry, P. (1984) Clin. Chim. Acta 142, 82-89
  34. Henderson, J. F., Brox, L. W., Kelley, W. N., Rosenbloom, F. M., and Seegmiller, J. E. (1968) J. Biol. Chem. 243, 2514-2522[Abstract/Free Full Text]
  35. Krenitsky, T. A., Papaioannou, R., and Elion, G. B. (1969) J. Biol. Chem. 244, 1263-1270[Abstract/Free Full Text]
  36. Ito, S., Iwaski, A., Syundo, J., Tamura, Y., Kishi, S., Mori, H., Ii, K., Matsuda, Y., and Katsunuma, N. (1989) J. Histochem. Cytochem. 37, 611-615[Abstract]
  37. Kumar, S., Ou, W.-W., and Rathi, M. (1979) N. Engl. J. Med. 300, 1332-1333[Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. M. Murphy, J. M. Bolduc, J. L. Gallaher, B. L. Stoddard, and D. Baker
Alteration of enzyme specificity by computational loop remodeling and design
PNAS, June 9, 2009; 106(23): 9215 - 9220.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Chen and B. L. Firestein
RhoA Regulates Dendrite Branching in Hippocampal Neurons by Decreasing Cypin Protein Levels
J. Neurosci., August 1, 2007; 27(31): 8378 - 8386.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Chen, K. G. Lucas, B. F. Akum, G. Balasingam, T. M. Stawicki, J. M. Provost, G. M. Riefler, R. J. Jornsten, and B. L. Firestein
A Novel Role for Snapin in Dendrite Patterning: Interaction with Cypin
Mol. Biol. Cell, November 1, 2005; 16(11): 5103 - 5114.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Montsant, K. Jabbari, U. Maheswari, and C. Bowler
Comparative Genomics of the Pennate Diatom Phaeodactylum tricornutum
Plant Physiology, February 1, 2005; 137(2): 500 - 513.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-H. Liaw, Y.-J. Chang, C.-T. Lai, H.-C. Chang, and G.-G. Chang
Crystal Structure of Bacillus subtilis Guanine Deaminase: THE FIRST DOMAIN-SWAPPED STRUCTURE IN THE CYTIDINE DEAMINASE SUPERFAMILY
J. Biol. Chem., August 20, 2004; 279(34): 35479 - 35485.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-L. Soong, J. Ogawa, E. Sakuradani, and S. Shimizu
Barbiturase, a Novel Zinc-containing Amidohydrolase Involved in Oxidative Pyrimidine Metabolism
J. Biol. Chem., February 22, 2002; 277(9): 7051 - 7058.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Hall, M. Brown, T. Jacobs, G. Ferrari, N. Cann, M. Teo, C. Monfries, and L. Lim
Collapsin Response Mediator Protein Switches RhoA and Rac1 Morphology in N1E-115 Neuroblastoma Cells and Is Regulated by Rho Kinase
J. Biol. Chem., November 9, 2001; 276(46): 43482 - 43486.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G. J. Kim, D. E. Lee, and H.-S. Kim
Functional Expression and Characterization of the Two Cyclic Amidohydrolase Enzymes, Allantoinase and a Novel Phenylhydantoinase, from Escherichia coli
J. Bacteriol., December 15, 2000; 182(24): 7021 - 7028.
[Abstract] [Full Text]


Home page
MicrobiologyHome page
P. Nygaard, S. M. Bested, K. A. K. Andersen, and H. H. Saxild
Bacillus subtilis guanine deaminase is encoded by the yknA gene and is induced during growth with purines as the nitrogen source
Microbiology, December 1, 2000; 146(12): 3061 - 3069.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. T. Maynes, R. G. Yuan, and F. F. Snyder
Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase
J. Bacteriol., August 15, 2000; 182(16): 4658 - 4660.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Kuwahara, N. Araki, K. Makino, N. Masuko, S. Honda, K. Kaibuchi, K. Fukunaga, E. Miyamoto, M. Ogawa, and H. Saya
A Novel NE-dlg/SAP102-associated Protein, p51-nedasin, Related to the Amidohydrolase Superfamily, Interferes with the Association between NE-dlg/SAP102 and N-Methyl-D-aspartate Receptor
J. Biol. Chem., November 5, 1999; 274(45): 32204 - 32214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, G.
Right arrow Articles by Snyder, F. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, G.
Right arrow Articles by Snyder, F. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement