|
J Biol Chem, Vol. 274, Issue 12, 8175-8180, March 19, 1999
Cloning and Characterization of Human Guanine Deaminase
PURIFICATION AND PARTIAL AMINO ACID SEQUENCE OF THE MOUSE
PROTEIN*
Gang
Yuan §,
James C.
Bin§,
Donald J.
McKay§, and
Floyd F.
Snyder §¶
From the Departments of Medical Genetics and
§ Biochemistry & Molecular Biology, Faculty of Medicine,
University of Calgary, Calgary, Alberta T2N 4N1, Canada
 |
ABSTRACT |
Mouse erythrocyte guanine deaminase has been
purified to homogeneity. The native enzyme was dimeric, being comprised
of two identical subunits of approximately 50,000 Da. The protein
sequence was obtained from five cyanogen bromide cleavage products
giving sequences ranging from 12 to 25 amino acids in length and
corresponding to 99 residues. Basic Local Alignment Search Tool (BLAST)
analysis of expressed sequence databases enabled the retrieval of a
human expressed sequence tag cDNA clone highly homologous to one of the mouse peptide sequences. The presumed coding region of this clone
was used to screen a human kidney cDNA library and secondarily to
polymerase chain reaction-amplify the full-length coding sequence of
the human brain cDNA corresponding to an open reading frame of 1365 nucleotides and encoding a protein of 51,040 Da. Comparison of the
mouse peptide sequences with the inferred human protein sequence
revealed 88 of 99 residues to be identical. The human coding sequence
of the putative enzyme was subcloned into the bacterial expression
vector pMAL-c2, expressed, purified, and characterized as having
guanine deaminase activity with a Km for guanine of
9.5 ± 1.7 µM. The protein shares a 9-residue motif with other aminohydrolases and amidohydrolases
(PGX[VI]DXH[TVI]H) that has been shown to
be ligated with heavy metal ions, commonly zinc. The purified
recombinant guanine deaminase was found to contain approximately 1 atom
of zinc per 51-kDa monomer.
 |
INTRODUCTION |
Guanine deaminase (guanine aminohydrolase, EC 3.5.4.3) catalyzes
the hydrolytic deamination of guanine. By producing xanthine and
ammonia, this reaction irreversibly eliminates the guanine base from
further reutilization as a guanylate nucleotide in mammals. The product
xanthine is a substrate for xanthine oxidase in the production of uric
acid. Although it is an enzyme of purine catabolism, guanine deaminase
is not ubiquitously expressed and exhibits a general absence in
lymphoid tissues and variable expression elsewhere (1, 2). The highest
levels of expression were found in the proximal section of the small
intestine of the mouse (3). There are greater than 50-fold differences
in guanine deaminase among different regions of the mouse brain; the
cerebral cortex and amygdala have the highest activity (4), whereas
there is essentially no activity in the cerebellum of the mouse or cat
(4, 5). There are greater than 10-fold increases in the level of
expression of guanine deaminase in the liver, kidney, and brain during
the 40-day postnatal development of the rat (6), and alterations in
embryonic expression have also been characterized (7). In the adult
mouse, fractional increases in brain and liver enzyme activity occur in
response to intraperitoneal administration of a bolus of guanine (8).
The tissue-specific expression and the developmental and induced
changes in expression suggest a potential role for guanine deaminase in
the regulation of the guanine nucleotide pool. Cellular GTP has an
important role not only in specific enzyme reactions and protein
synthesis, but also in signal transduction pathways. The cloning and
characterization of guanine deaminase will advance our understanding of
this key enzyme in the catabolism of guanine metabolites.
Guanine deaminase has been purified from a number of mammalian sources
(9-13). We describe here the purification to homogeneity of mouse
erythrocytic guanine deaminase. Cyanogen bromide cleavage and peptide
sequencing facilitated the identification and retrieval of human
EST1 clones that were used to
isolate a full-length guanine deaminase cDNA from human brain.
Subsequent expression of the recombinant human protein and
characterization of its catalytic activity and kinetics properties
confirmed this cDNA to encode human guanine deaminase.
 |
MATERIALS AND METHODS |
Reagents--
Xanthine oxidase, uricase, and peroxidase were
purchased from ICN Pharmaceuticals. Guanine and 4-amino-antipyrine were
from Sigma, and 2,4,6-tribromo-3-hydroxybenzoic acid was from
Boehringer Mannheim. [ -32P]dCTP and
[ -32P]dATP were from Amersham. Restriction enzymes,
Taq DNA polymerase, and isopropyl- -thiogalactopyranoside
were obtained from Life Technologies, Inc.
Purification of Mouse Erythrocyte Guanine
Deaminase--
Heparanized blood was collected from C57BL/6J adult
mice as described previously (14). Blood pooled from 30-50 mice was centrifuged at 900 × g for 5 min, and the erythrocyte
pellet was resuspended and washed once with 10 volumes of isotonic
saline. The cell pellet was lysed by adding an equal volume of 2×
Buffer A (20 mM Tris-HCl, 5 mM
MgCl2, and 1 mM DTT, pH 6.0) followed by three
30-s pulses at the maximum setting on the Polytron (Brinkmann Instruments). The lysate was centrifuged at 10,000 × g
for 10 min at 4 °C, and the supernatant was used in subsequent steps.
The crude supernatant (approximately 20 ml) was applied to a 25-ml
DEAE-Sepharose column previously equilibrated in Buffer A and washed
with 10 column volumes of Buffer A. The enzyme was eluted with a
gradient formed between equal volumes of Buffer A and Buffer B (buffer
A containing 0.5 M KCl) at 1.5 ml/min. 3-ml fractions were
collected, and guanine deaminase was typically eluted at approximately
150 mM KCl. Fractions containing guanine deaminase were
pooled and concentrated using an Amicon ultrafiltration YM10 membrane.
Subsequent steps were performed on a Pharmacia fast protein liquid
chromatography system. 1× volume of 100 mM sodium
phosphate, pH 6.8, 1 mM DTT, and 3.2 M
(NH4)2SO4 was added to the
concentrated fractions, and the sample was loaded on a 10-ml
phenol-Sepharose high performance column (Pharmacia) equilibrated in
Buffer C (50 mM sodium phosphate, pH 6.8, and 1 mM DTT) containing 1.6 M
(NH4)2SO4. The column was washed at
1 ml/min with 8 volumes of loading buffer and then eluted by a stepwise
gradient of 10 ml each in descending 0.2-M increments of
(NH4)2SO4 in Buffer C, collecting
1-ml fractions. Guanine deaminase eluted at approximately 0.6 M (NH4)2SO4. Fractions were pooled and concentrated by Amicon ultrafiltration as described above.
Combined fractions were concentrated to 1 ml and adjusted to 3.2 M (NH4)2SO4 in Buffer
C. The sample was applied to a 1-ml Source 15PHE column (Pharmacia) and
eluted at 1 ml/min, collecting 1-ml fractions. The column was washed
with Buffer D (10 ml of Buffer C containing 3.2 M
(NH4)2SO4) and then eluted stepwise with decreasing amounts of
(NH4)2SO4 formed from mixtures of
Buffers C and D as follows: 0-5 min, 100% to 75% Buffer D; 5-15
min, held at 75% Buffer D; 15-75 min, 75% to 45% Buffer D; and
75-100 min, 45% to 0% Buffer D. Guanine deaminase typically eluted
at approximately 45 min, and fractions containing activity were pooled
and concentrated, and the buffer was changed to 20 mM
Tris-HCl, pH 7.0, 1 mM EDTA, and 1 mM DTT. For
storage at 70 °C, 20% glycerol was added to the final buffer.
The native molecular mass was determined by fractionation of purified
erythrocyte guanine deaminase on a Superose 6 HR column (Pharmacia)
(bed volume, 24 ml) eluted with 10 mM Tris-HCl, 150 mM NaCl, and 1 mM DTT, pH 8.0, at 0.4 ml/min
and monitored by absorbance at 280 nm. Molecular weight standards were
also run under the same conditions.
Protein Sequencing--
Cyanogen bromide cleavage was performed
on 10 µg of protein (15). The digest was vacuum dried, treated with
propylamine (16), and dried further. Cyanogen bromide fragments were
purified for sequencing by SDS-polyacrylamide gel electrophoresis (17), electroblotted to polyvinylidene difluoride, and stained with Coomassie
Blue. N-terminal peptide sequencing was performed using a Perkin Elmer
Applied Biosystems 491 sequencer operated in the gas-phase mode.
Individual stained bands were cut from the polyvinylidene difluoride
blot with a scalpel and installed in the sequencer blot sample cartridge.
Metal Analysis of Guanine Deaminase--
The zinc and manganese
content of guanine deaminase was determined by graphite furnace atomic
absorption (Gailbraith Laboratories, Knoxville, TN). The lower limit
for detection was <0.2 nmol for zinc and <0.02 nmol for manganese.
Enzyme Assay and Kinetics--
Guanine deaminase was assayed
spectrophotometrically by following the conversion of guanine to
xanthine in a coupled reaction at 512 nm at 37 °C (18). The reaction
consisted of 1 mM 2,4,6-tribromo-3-hydroxybenzoic acid, 0.1 mM 4-amino-antipyrene, 0.025 unit/ml xanthine oxidase, 0.00325 unit/ml uricase, and 0.002 unit/ml peroxidase. The color factor
for xanthine was determined empirically over a range of concentrations
and was 14.8 nmol/absorbance unit at 512 nm. Protein was determined as
described previously (14). Initial rates in the kinetic experiments
were analyzed by a weighted nonlinear least-squares curve fitting
program (19).
Isolation and Sequence of Human Guanine Deaminase
cDNA--
The Basic Local Alignment Search Tool (20) was used to
identify EST clone-encoded proteins that were highly homologous to the
mouse peptide sequences. The human EST cDNA clones were ordered from Research Genetics, Inc. and had the following accession numbers: 25984, 33881, and 48404. Each of these was found to have a 1.9-kb insert and common sequence. The insert for plasmid 48404 was sequenced in both directions, and the apparent coding region was used to generate
a probe to screen the human kidney 5'-STRETCH PLUS cDNA lambda gt10
library (CLONTECH). Primer sequences used to
generate the probe by PCR were 5'dbGDA
(TTTGAATTCATGCCTGGGCTGGTTG, corresponding to bp 220-238)
and 3'dbGDA (CCCAAGCTTTCTAACTCCACCTGGGCACAA, bp 1443 to
1420). Probes (1.2 kb) were prepared by PCR amplification using EST
clone 48404 as a template under the following conditions: 94 °C for
5 min followed by 30 cycles of 94 °C for 1 min, 54 °C for 1 min,
and 72 °C for 1 min. Approximately 30 ng of PCR DNA product were
labeled with [32P]dATP by the random priming method (RTS
RadPrime DNA Labeling System; Life Technologies, Inc.). Hybridization
was carried out at 42 °C in 6× SSC, 5× Denhardt's solution, 0.1%
SDS, and 40% formamide for 16 h. Filters were washed with 2× SSC
and 0.1% SDS and 1× SSC and 0.1% SDS for 1 h each at 60 °C.
A single positive phage was isolated from approximately 500,000 colonies. The 2.2-kb insert was PCR-amplified using lambda gt10 forward
(AGCAAGTTCAGCCTGGTTAAG) and reverse (TAATGAGTATTTCTTCCAGGG) primers
followed by direct sequencing (21).
From the kidney cDNA sequence, two primers were generated for
amplification of the complete coding sequence from human brain MarathonTM-Ready cDNA (CLONTECH).
Primers derived from the human kidney cDNA and EST sequences were
5'GDA (AAAGAATTCATGTGTGCCGCTCAGATGCC, bp 1 to 20) and
3'dbGDA. Both strands of the product were sequenced using the ABI prism
TM Dye terminator cycle sequencing ready reaction kit (Perkin Elmer).
Expression of Human Guanine Deaminase Protein--
Two
oligonucleotides, 5'GDA and 3'dbGDA, were used to amplify the
full-length coding sequence. The resulting fragment was digested with
EcoRI and HindIII, subcloned into the pMAL-c2
expression vector (New England Biolabs), and transformed into DH5-
cells. The insert was sequenced to verify its structure. The expressed fusion protein was prepared essentially as described previously (14)
and according to the supplier's guidelines. The cleaved protein
contained an extra four amino acids, LSEF, at the N terminus. The
protein was analyzed by 12% SDS-polyacrylamide gel electrophoresis.
 |
RESULTS |
Mouse erythrocytic guanine deaminase was purified 900-fold to
homogeneity (Table I). The purified mouse
protein was analyzed by SDS-gel electrophoresis and gave a subunit
molecular mass of 50 kDa (Fig.
1A). Gel exclusion
chromatography on a Superose 6 HR column revealed the native protein to
consist principally of a dimer of 100 kDa with approximately 5% of the
protein present as a 200-kDa species, consistent with the presence of a
minor tetrameric component (Fig. 1B). Purified mouse
erythrocytic guanine deaminase gave a Km of
22.7 ± 2.9 µM for guanine.
View this table:
[in this window]
[in a new window]
|
Table I
Purification of mouse erythrocyte guanine deaminase
Results are given for a typical purification run; units are expressed
as nanomoles of guanine converted to xanthine per minute.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Subunit and native molecular mass of mouse
erythrocyte guanine deaminase. A, purification of guanine
deaminase monitored by SDS-gel electrophoresis. Lane 1,
standards; lane 2, purified guanine deaminase (0.5 µg);
lane 3, fractions after phenol-Sepharose chromatography (3 µg); lane 4, fractions after DEAE-Sepharose chromatography
(3 µg). B, molecular mass of native guanine deaminase.
Guanine deaminase was fractionated on a Superose 6 HR column (top
panel). Plot of the log of molecular weight of guanine deaminase
( ) and standards versus Kav, the ratio of the
elution volume:total available volume of column (bottom
panel) are shown. Standards were as follows: thyroglobulin, 669 kDa ( ); -amylase, 200 kDa ( ); aldolase, 158 kDa ( ); bovine
serum albumin, 132-kDa dimer ( ); ovalbumin, 43 kDa ( ); and
carbonic anhydrase, 29 kDa (*).
|
|
Attempts to sequence the intact native protein failed, indicating that
the protein was N-terminal modified. The purified protein was subjected
to cyanogen bromide cleavage followed by SDS-gel electrophoresis. Three
principal bands were obtained, and these were electroblotted onto a
polyvinylidene difluoride membrane, cut out, and subjected to
N-terminal gas phase sequencing. Two of these bands were comprised of
two peptides each; however, their sequences could be distinguished by
the differential signal intensity of the individual residues (Table
II). Overall sequence was obtained for
five peptides ranging from 12 to 25 residues and corresponding in total
to 99 amino acids.
View this table:
[in this window]
[in a new window]
|
Table II
Amino acid sequence of cyanogen bromide peptides from mouse guanine
deaminase and comparison to inferred human sequence
Differences between mouse and inferred human sequence (from Fig. 3) are
shown in bold. M, inferred methionine residue from cyanogen
bromide cleavage; X, residue not
determined.
|
|
The strategy for the retrieval of guanine deaminase cDNA is
outlined in Fig. 2. Basic Local Alignment
Search Tool analysis of expressed sequence databases (20) using the
mouse peptide sequence resulted in the identification of highly
homologous human cDNA sequences; none were represented in the
databases for the mouse. Only peptide IIa corresponded to an expressed
sequence clone. Three EST clones were retrieved, and a determination of their size and partial sequence indicated that the clones were essentially identical. The sequence of EST clone 48404 yielded coverage
of approximately 80% of the predicted open reading frame, including
some 3' noncoding sequence. The entire coding region of the dbEST clone
was used to screen a human kidney cDNA library and resulted in the
retrieval of a single colony. Upon sequencing this clone, the open
reading frame appeared to be lacking the equivalent of approximately 40 residues at the N-terminal end; however, an out-of-frame ATG codon was
apparent in approximately the right position near the 5' end of this
sequence. Primers were designed corresponding to the putative 5'- and
3'-coding ends of the gene, and a PCR product was obtained from a human
brain cDNA library (MarathonTM-Ready cDNA). The
sequence of this cDNA product gave an open reading frame of 1365 bp, corresponding to a protein of 51,040 Da, which is in agreement with
the subunit mass of the purified mouse protein (Fig. 1A). By
comparison, there was a single base deletion at position 911 (Fig.
2, C) of the EST clone that was not present in either the
kidney or brain cDNA sequences. In addition, a 4-bp deletion at
position 124-127 ( ATAG) of the kidney cDNA clone was
not present in the brain cDNA sequence and accounted for the absence of a complete open reading frame in the kidney cDNA
sequence.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2.
The EST and kidney cDNA clones and the
PCR-amplified brain cDNA guanine deaminase. The EST open
reading frame was used to screen and isolate the kidney cDNA
guanine deaminase. PCR primers based on the kidney cDNA sequence
were used to isolate brain cDNA.
|
|
The complete cDNA sequence is given in Fig.
3. The human translated sequence and the
corresponding mouse peptide sequences are identified (Table II and Fig.
3). For each mouse peptide, the residue preceding the N terminus
corresponded to a methionine in the human sequence, consistent with the
cyanogen bromide cleavage strategy.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 3.
cDNA and predicted amino acid sequence of
human guanine deaminase. Amino acid residues corresponding to
mouse peptide sequences are shown in bold.
|
|
Conclusive verification of the identity for the cloned human sequence
was obtained by subcloning the entire coding portion into the pMAL
expression vector and the production of recombinant human protein (Fig.
4). The cleaved product had an apparent
molecular mass of 51 kDa and had the extra LSEF residues at the N
terminus. The recombinant protein catalyzed the conversion of guanine
to xanthine, with a Km of 9.5 ± 1.7 µM for guanine. The turnover number
(kcat) was 17.4 s 1, and the
catalytic efficiency
(kcat/Km) was 11.8 × 103 s 1 M 1. The
enzyme exhibited optimal activity at pH 7.0, with the
Km remaining constant between pH 6.5 and pH 7.5, as
described previously for the rabbit liver enzyme (12). Therefore, the
pseudo first-order rate constant
(Vm/Km) also showed a sharp
optimum at pH 7.0. The human enzyme showed no increase in activity or dependence upon zinc or magnesium ion; however, the addition of manganese consistently resulted in approximately 2-fold increased activity. Optimal activity was obtained at approximately 0.5 mM and remained constant to 10 mM manganese
chloride. The divalent metal content of guanine deaminase was
determined by atomic absorption. No detectable manganese was found
(<0.02 atom Mn2+ per monomer), whereas 0.70-0.91 atom
Zn2+ was associated per monomer of guanine deaminase.

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 4.
Expression and purification of recombinant
human guanine deaminase as monitored by SDS-polyacrylamide gel
electrophoresis. Lane 1, molecular weight standards;
lane 2, amylose column purified maltose-binding
protein-guanine deaminase fusion product (2 µg); lane 3,
factor Xa cleaved fusion product (2 µg); lane 4, purified
recombinant guanine deaminase (0.5 µg).
|
|
 |
DISCUSSION |
Mouse erythrocytic guanine deaminase was purified to homogeneity
(Fig. 1), and the amino acid sequence was obtained from five cyanogen
bromide cleavage products (Table I). The peptide sequences enabled the
retrieval of human EST clones, and a portion of these was used to clone
the full-length human cDNA guanine deaminase. Comparison of the
mouse amino acid sequence from five cyanogen bromide peptides showed an
identity of 88 of 99 residues with the inferred human protein sequence
(Table II). Further verification of the function of the retrieved human
cDNA was obtained by expression of the recombinant protein and its
characterization as having guanine deaminase activity. The predicted
molecular mass of the human cDNA, 51,040 Da, is in good agreement
with the subunit composition for the mouse protein estimated at 50,000 Da (Fig. 1A). These findings are in general agreement with
previous studies of purified mammalian guanine deaminases that gave
Mr subunit estimates of Mr 50,000 for pig brain (9),
Mr 52,000 for rabbit liver (10) and rat brain
(11), Mr 55,000 for rabbit liver (12), and
Mr 59,000 for human liver (13). The native
enzyme has generally been found to be dimeric (10, 11, 13, 22).
The purified native mouse erythrocytic protein was principally dimeric
in composition with a minor tetrameric component (Fig.
1B).
The Km values for the purified mouse erythrocytic
protein and recombinant human guanine deaminase were similar (22.7 and
9.5 µM, respectively). Michaelis constants for guanine
deaminase with guanine from other sources were also in this range: 4.2 µM for bovine liver (22), 11 µM for pig
brain (9), 12.5 µM for rabbit liver (12), and 15.3 µM for human liver (13). The purified enzymes have
exhibited pKa values consistent with the involvement
of essential cysteine and histidine residues (9, 12, 13), and
inactivation with p-hydroxymercuribenzoate (9, 13) and rose
bengal or diethylpyrocarbonate (23), respectively, has substantiated an
essential role for these residues. Comparative sequence analysis now
provides further evidence for the importance of histidine residues in
guanine deaminase.
Guanine deaminase shares a 9-residue N-terminal sequence previously
recognized in other aminohydrolases and amidohydrolases (24, 25).
Inspection of the SWISS-PROTEIN and TrEMBL databases using the Scan
Prosite tool (26) revealed that this motif is shared by 28 enzymes from
20 different species (Table III). This motif, particularly the invariant His-X-His portion, has
been implicated in the association of bound Zn with dihydroorotase. This site has been examined via site-directed mutagenesis, and substitution for either one of the histidine residues in dihydroorotase results in both loss of activity and loss of associated Zn (27, 28).
Human and mouse guanine deaminases (Table II and Fig. 3) share this
9-residue motif but are otherwise unique in primary sequence from other
members of this family. Metal analysis of the recombinant human guanine
deaminase confirmed the association of approximately one
Zn2+ atom per enzyme monomer.
View this table:
[in this window]
[in a new window]
|
Table III
Aminohydrolase and amidohydrolase enzymes sharing a 9-residue motif
Accession identification numbers for sequences matching the 9-residue
motif in the SWISS-PROT and TrEMBL databases are as follows: adenine
deaminase, P39761 and 050821; allantoinase, 032137; ULIP, Q14195 and
Q62188; DHPASE, Q14117, Q63150, Q44184, P81006, Q45515 and Q59699;
imidazolone propionase, 031200; P42084; isoaspartyldipeptidase; P39377;
D-aminoacylase, P72349; N-acyl-D-aspartate
amidohydrolase, P94212; GLNAC 6-P deacylase, 034450, 053382, and
P96166; dihydroorotase, P20054, P05990, P27708, P08955, Q91437, P46538,
P25995, P77884, Q58885, and 027199. ULIP, Urc-33-like phosphoprotein;
DHPASE; dihydropyrimidirase; GLNAc 6-P deacylase,
N-acetylglucosamine-6-phosphate
deacetylase.
|
|
The ligand array that features a proximal histidine pair,
HXH, and a third histidine rather distant in the sequence
has been described as a class II zinc site (29). Mammalian adenosine deaminase has a His-X-His motif at residues 15-17 that is
known to be associated with Zn with an additional His at 214, but it does not share the preceding sequence of the 9-residue motif (30). Guanine deaminase has His-Ile-His at residues 82-84, with a third histidine at residue 112. This sequence is also likely to be
responsible for the apparent 2-fold activation seen with manganese and
is presumably associated with the loss of enzyme activity attributed to
the plumbous ion (31).
There is evidence that guanine deaminase has a significant role in
urate production in mammals. The relative amount of xanthine formation
via guanine was estimated to be 80% versus that via hypoxanthine at 16% (32). For xanthenuric adults with no xanthine dehydrogenase activity, the mean urine excretion ratio of
xanthine:hypoxanthine is approximately 4:1 (33), again pointing to the
relative importance of the guanine to xanthine as opposed to the
hypoxanthine to xanthine catabolic pathway. Administration of lead
acetate in the pig as a model of acute lead exposure resulted in the
deposition of guanine crystals in the epiphyseal plate of the femoral
head, and this occurred in conjunction with lead-induced loss of
guanine deaminase activity (31). Hypoxanthine-guanine
phosphoribosyltransferase, which can convert guanine to GMP in the
presence of 5-phosphoribosyl-1-pyrophosphate, has a
Km for guanine (34, 35) that is approximately the
same as that of guanine deaminase. In tissues where both
hypoxanthine-guanine phosphoribosyltransferase and guanine deaminase
are expressed, the relative amounts of these enzymes and the
availability of 5-phosphoribosyl-1-pyrophosphate may be expected to
determine whether guanine will be reutilized or catabolized and eliminated.
Guanine deaminase has been immunohistochemically localized to the
cytoplasm of human liver (36), consistent with its isolation from the
supernatant of cell and tissue lysates. The serum enzyme activity in
man is among the most sensitive indicators of liver disease (1) as a
consequence of its near absence in normal human serum, erythrocytes,
and lymphoid cells (2). There is a single report of a full-term infant
who presented with acute anoxia at birth and died from respiratory
distress at day 2 who was found to be deficient in brain guanine
deaminase activity (37). Further studies may now be initiated by
mapping guanine deaminase and looking for human disease correlates
using model systems such as the mouse to explore the relationship
between guanine deaminase deficiency and clinical and metabolic phenotypes.
 |
ACKNOWLEDGEMENT |
We thank Florence Yang for assistance with
manuscript preparation.
 |
FOOTNOTES |
*
This work was supported by Grant MT-6376 from The Medical
Research Council of Canada.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF095286.
¶
To whom correspondence should be addressed: Dept. of Medical
Genetics, University of Calgary, Faculty of Medicine, 3330 Hospital Dr.
N.W., Calgary, Alberta T2N 4N1, Canada. Tel.: 403-220-6025; Fax:
403-283-8225; E-mail: snyder{at}ucalgary.ca.
 |
ABBREVIATIONS |
The abbreviations used are:
EST, expressed
sequence tag;
DTT, dithiothreitol;
PCR, polymerase chain reaction;
kb, kilobase;
bp, base pair(s).
 |
REFERENCES |
-
Kuzmits, R.,
Seyfried, H.,
Wolf, A.,
and Müller, M. M.
(1980)
Enzyme (Basel)
25,
148-152[Medline]
[Order article via Infotrieve]
-
Scholar, E. M.,
and Calabresi, P.
(1973)
Cancer Res.
33,
94-103[Abstract/Free Full Text]
-
Mohamedali, K. A.,
Guicherit, O. M.,
Kellems, R. E.,
and Rudolph, F. B.
(1993)
J. Biol. Chem.
268,
23728-23733[Abstract/Free Full Text]
-
Berger, S. J.,
Carter, J. G.,
and Lowry, O. H.
(1985)
J. Neurochem.
44,
1736-1740[CrossRef][Medline]
[Order article via Infotrieve]
-
Dawson, D. M.
(1971)
Neurology
21,
621-626[Free Full Text]
-
Nardiello, S.,
Galanti, B.,
Russo, M.,
and Guarino, F.
(1978)
Enzyme (Basel)
23,
353-355[Medline]
[Order article via Infotrieve]
-
Brosh, S.,
Sperling, O.,
Bromberg, Y.,
and Sidi, Y.
(1990)
J. Neurochem.
54,
1776-1781[CrossRef][Medline]
[Order article via Infotrieve]
-
Sitaramayya, A.,
Ali, S.,
Sree Kumar, K.,
and Krishnan, P. S.
(1974)
Biochem. J.
138,
143-146[Medline]
[Order article via Infotrieve]
-
Rossi, C. A.,
Hakim, G.,
and Solaini, G.
(1978)
Biochim. Biophys. Acta
526,
235-246[Medline]
[Order article via Infotrieve]
-
Bergstrom, J. D.,
and Bieber, A. L.
(1979)
Arch. Biochem. Biophys.
194,
107-116[CrossRef][Medline]
[Order article via Infotrieve]
-
Miyamato, S.,
Ogawa, H.,
Shiraki, H.,
and Nakagawa, H.
(1982)
J. Biochem. (Tokyo)
91,
167-176[Abstract/Free Full Text]
-
Lewis, A. S.,
and Glantz, M. D.
(1974)
J. Biol. Chem.
249,
3862-3866[Abstract/Free Full Text]
-
Gupta, N. K.,
and Glantz, N. D.
(1985)
Arch. Biochem. Biophys.
236,
266-276[CrossRef][Medline]
[Order article via Infotrieve]
-
Snyder, F. F.,
Jenuth, J. P.,
Dilay, J. E.,
Fung, E.,
Lightfoot, T.,
and Mably, E. R.
(1994)
Biochim. Biophys. Acta
1227,
33-40[Medline]
[Order article via Infotrieve]
-
Gross, E.
(1967)
Methods Enzymol.
11,
238-255[CrossRef]
-
Tarr, G. E.
(1986)
in
Methods of Protein Microcharacterization (Shively, J. E., ed), pp. 155-194, Humana Press, Clifton, New Jersey
-
Schagger, H.,
and von Jagow, G.
(1987)
Anal. Biochem.
166,
368-379[CrossRef][Medline]
[Order article via Infotrieve]
-
Le Tissier, P. R.,
Peters, J.,
and Skidmore, C. D.
(1984)
Anal. Biochem.
222,
168-175
-
Brooks, S. P. J.
(1992)
BioTechniques
13,
906-911[Medline]
[Order article via Infotrieve]
-
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
-
Snyder, F. F.,
Jenuth, J. P.,
Mably, E. R.,
and Mangat, R. K.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2522-2527[Abstract/Free Full Text]
-
Galilea, J. M.,
Canela, E. I.,
and Bozal, J.
(1981)
Int. J. Biochem. (Engl. Ed.)
13,
773-776
-
Solani, G.,
and Rossi, C. A.
(1982)
Ital. J. Biochem. (Engl. Ed.)
31,
253-260[Medline]
[Order article via Infotrieve]
-
Nygaard, P.,
Duckert, P.,
and Saxild, H. H.
(1996)
J. Bacteriol.
178,
846-853[Abstract/Free Full Text]
-
Kim, G.-J.,
and Kim, H.-S.
(1998)
Biochem. J.
330,
295-302
-
Bairoch, A.,
Bucher, P.,
and Hofmann, K.
(1997)
Nucleic Acids Res.
24,
217-221
-
Zimmermann, B. H.,
Kemling, N. M.,
and Evans, D. R.
(1995)
Biochemistry
34,
7038-7046[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, N. K.,
Manthey, M. K.,
Hambley, T. W.,
O'Donoghue, S. I.,
Keegan, M.,
Chapman, B. E.,
and Christopherson, R. I.
(1995)
Biochemistry
34,
11344-11352[CrossRef][Medline]
[Order article via Infotrieve]
-
Karlin, S.,
and Zhu, Z.-Y.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
14231-14236[Abstract/Free Full Text]
-
Kantz, J.,
and Schnakerz, K. D.
(1989)
Eur. J. Biochem.
181,
431-435[Medline]
[Order article via Infotrieve]
-
Farkas, W. R.,
and Stanawitz, T.
(1978)
Science
199,
786-787[Abstract/Free Full Text]
-
van Waeg, G.,
Niklasson, F.,
and de Verdier, C.-H.
(1986)
in
Purine and Pyrimidine Metabolism (Nyhan, W. L., Thompson, L. F., and Watts, R. W. E., eds), pp. 425-430, Plenum Press, New York
-
Boulieu, R.,
Bory, C.,
Baltassat, P.,
and Divry, P.
(1984)
Clin. Chim. Acta
142,
82-89
-
Henderson, J. F.,
Brox, L. W.,
Kelley, W. N.,
Rosenbloom, F. M.,
and Seegmiller, J. E.
(1968)
J. Biol. Chem.
243,
2514-2522[Abstract/Free Full Text]
-
Krenitsky, T. A.,
Papaioannou, R.,
and Elion, G. B.
(1969)
J. Biol. Chem.
244,
1263-1270[Abstract/Free Full Text]
-
Ito, S.,
Iwaski, A.,
Syundo, J.,
Tamura, Y.,
Kishi, S.,
Mori, H.,
Ii, K.,
Matsuda, Y.,
and Katsunuma, N.
(1989)
J. Histochem. Cytochem.
37,
611-615[Abstract]
-
Kumar, S.,
Ou, W.-W.,
and Rathi, M.
(1979)
N. Engl. J. Med.
300,
1332-1333[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. M. Murphy, J. M. Bolduc, J. L. Gallaher, B. L. Stoddard, and D. Baker
Alteration of enzyme specificity by computational loop remodeling and design
PNAS,
June 9, 2009;
106(23):
9215 - 9220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chen and B. L. Firestein
RhoA Regulates Dendrite Branching in Hippocampal Neurons by Decreasing Cypin Protein Levels
J. Neurosci.,
August 1, 2007;
27(31):
8378 - 8386.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Chen, K. G. Lucas, B. F. Akum, G. Balasingam, T. M. Stawicki, J. M. Provost, G. M. Riefler, R. J. Jornsten, and B. L. Firestein
A Novel Role for Snapin in Dendrite Patterning: Interaction with Cypin
Mol. Biol. Cell,
November 1, 2005;
16(11):
5103 - 5114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Montsant, K. Jabbari, U. Maheswari, and C. Bowler
Comparative Genomics of the Pennate Diatom Phaeodactylum tricornutum
Plant Physiology,
February 1, 2005;
137(2):
500 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-H. Liaw, Y.-J. Chang, C.-T. Lai, H.-C. Chang, and G.-G. Chang
Crystal Structure of Bacillus subtilis Guanine Deaminase: THE FIRST DOMAIN-SWAPPED STRUCTURE IN THE CYTIDINE DEAMINASE SUPERFAMILY
J. Biol. Chem.,
August 20, 2004;
279(34):
35479 - 35485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-L. Soong, J. Ogawa, E. Sakuradani, and S. Shimizu
Barbiturase, a Novel Zinc-containing Amidohydrolase Involved in Oxidative Pyrimidine Metabolism
J. Biol. Chem.,
February 22, 2002;
277(9):
7051 - 7058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Hall, M. Brown, T. Jacobs, G. Ferrari, N. Cann, M. Teo, C. Monfries, and L. Lim
Collapsin Response Mediator Protein Switches RhoA and Rac1 Morphology in N1E-115 Neuroblastoma Cells and Is Regulated by Rho Kinase
J. Biol. Chem.,
November 9, 2001;
276(46):
43482 - 43486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Kim, D. E. Lee, and H.-S. Kim
Functional Expression and Characterization of the Two Cyclic Amidohydrolase Enzymes, Allantoinase and a Novel Phenylhydantoinase, from Escherichia coli
J. Bacteriol.,
December 15, 2000;
182(24):
7021 - 7028.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Nygaard, S. M. Bested, K. A. K. Andersen, and H. H. Saxild
Bacillus subtilis guanine deaminase is encoded by the yknA gene and is induced during growth with purines as the nitrogen source
Microbiology,
December 1, 2000;
146(12):
3061 - 3069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Maynes, R. G. Yuan, and F. F. Snyder
Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase
J. Bacteriol.,
August 15, 2000;
182(16):
4658 - 4660.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Kuwahara, N. Araki, K. Makino, N. Masuko, S. Honda, K. Kaibuchi, K. Fukunaga, E. Miyamoto, M. Ogawa, and H. Saya
A Novel NE-dlg/SAP102-associated Protein, p51-nedasin, Related to the Amidohydrolase Superfamily, Interferes with the Association between NE-dlg/SAP102 and N-Methyl-D-aspartate Receptor
J. Biol. Chem.,
November 5, 1999;
274(45):
32204 - 32214.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|