|
J Biol Chem, Vol. 274, Issue 13, 8421-8427, March 26, 1999
Mutants in ABC10 , a Conserved Subunit Shared by All Three
Yeast RNA Polymerases, Specifically Affect RNA Polymerase I
Assembly*
Olivier
Gadal §,
George V.
Shpakovski ¶ , and
Pierre
Thuriaux **
From the Service de Biochimie et
Génétique Moléculaire, Bât. 142, Commissariat
à l'Energie Atomique-Saclay. Gif sur Yvette, F 91191 cedex,
France and ¶ Shemyakin-Ovchinnikov Institute of Bioorganic
Chemistry, Russian Academy of Sciences. 16/10 Miklukho-Maklaya str,
117871 Moscow, GSP-7 V-437, Russia
 |
ABSTRACT |
ABC10 , a small polypeptide common to the three
yeast RNA polymerases, has close homology to the N subunit of the
archaeal enzyme and is remotely related to the smallest subunit of
vaccinial RNA polymerase. The eucaryotic, archaeal, and viral
polypeptides share an invariant motif
CX2C... CC that is strictly essential for yeast growth, as shown by site-directed mutagenesis, whereas the rest
of the ABC10 sequence is fairly tolerant to amino acid replacements. ABC10 has Zn2+ binding properties in vitro,
and the CX2C ... CC motif may therefore define an atypical metal-chelating site. Hybrid subunits that derive
most of their amino acids from the archaeal subunit are functional in
yeast, indicating that the archaeal and eucaryotic polypeptides have a
largely equivalent role in the organization of their respective
transcription complexes. However, all eucaryotic forms of ABC10
harbor a HVDLIEK motif that, when mutated or replaced by its archaeal
counterpart, leads to a polymerase I-specific lethal defect in
vivo. This is accompanied by a specific lack in the largest
subunit of RNA polymerase I (A190) in cell-free extracts, showing that
the mutant enzyme is not properly assembled in vivo.
 |
INTRODUCTION |
The nuclear genome of eucaryotes is transcribed by three
heteromultimeric RNA polymerases that respectively contain 14, 12, and
17 distinct subunits in Saccharomyces cerevisiae. The two largest subunits are related to the ' and components of the 2 ' bacterial core enzyme and to the equivalent
subunits of the archaeal and vaccinial RNA polymerases. Biochemical and
genetic studies have established that they harbor the active site of
the yeast (1, 2) and bacterial (3) enzymes. Homology to the bacterial
subunit, although less pregnant, was also observed with the
eucaryotic and archaeal enzymes (4, 5). The 2 ' core polymerase structure is therefore preserved in all eucaryotic, archaeal, bacterial, and viral forms of RNA polymerases. A number of
additional subunits are structurally conserved or even strictly identical from one to another polymerases (6-8) and are
functionally conserved from yeast to man (9, 10). Most of them are
structurally related to known components of the archaeal polymerase,
indicating the existence of an extended core enzyme form that is common
to the archaeal and eucaryotic lineages (5).
The present work deals with ABC10 , a small polypeptide of 70 amino
acids that is shared by all three yeast RNA polymerases, is able to
bind Zn2+ in vitro (11) and is essential for
growth (12). We have previously determined the amino acid sequence of
that polypeptide (13), which has a close homology to the N subunit of
the archaeal enzyme (5, 10, 14) and is remotely related to the smallest
subunit of vaccinial RNA polymerase (15). We report here that the yeast subunit and its archaeal homolog are largely interchangeable in vivo and that the eucaryotic, archaeal, and viral polypeptides have in common an invariant metal binding domain
(CX2C ... CC) critical for its biological
activity in S. cerevisiae. Moreover, our data show that
ABC10 discriminates between RNA polymerase I and the other two
nuclear RNA polymerases via an invariant eucaryotic motif, HVDLIEK.
Replacing this motif by its archaeal counterpart strongly interferes
with the heteromultimeric assembly of yeast RNA polymerase I.
 |
MATERIALS AND METHODS |
Strains, Plasmids, and Growth Conditions--
Newly constructed
strains and plasmids are listed in Table
I. Plasmids pFL44L (16), pGEN and
pGENSc-10 (9), pFL44-RPB10e (13), pNOY102 (17), pASZ11 (18) and
YCPA43-12 (19) were previously described. Plasmids bearing mutant or
chimeric forms of RPB10 were expressed from the strong
constitutive pPGK1 promoter of the TRP1 multicopy vector
pGEN-B (Table I). The yeast (S. cerevisiae) and archaeal
(Sulfolobus acidocaldarius) coding sequences were cloned
between the EcoRI and XhoI sites of pGEN-B to
generate pGEN-B/RPB10 and pGEN-B/RpoN. The latter plasmid contains a
unique BamHI site in the RpoN coding sequence.
The N-terminal and C-terminal halves of RPB10 and
RpoN could be exchanged to form the F5 and F6 chimeric
protein of Fig. 2A. This required an internal
BamHI site at the equivalent position of RPB10,
made by a GAA CAA change at the 32nd codon corresponding to
the phenotypically silent rpb10-E32P allele
of plasmid pGEN-B/RPB10(E32P). The remaining RPB10/RpoN chimerae (F2,
F4, F7) were constructed by
PCR1 amplification with
appropriate primers overlapping with either the EcoRI,
BamHI, and XhoI site of pGEN-B/RPB10(E32P) and
pGEN-B/RpoN. Plasmids bearing single-site mutations were generated by
PCR-mediated mutagenesis of rpb10 (site-directed or random
mutagenesis) on pGEN-Sc10 and pGVS102 (Table I). N- and C-terminal
hemagglutinin-tagged forms of ABC10 were obtained by PCR
amplification of RPB10 using primers bearing a single copy of the
coding sequence of the hemagglutinin epitope.
Plasmid Shuffling and Dosage-dependent
Suppression--
Mutants and chimeric forms of rpb10 were
tested for their ability to complement the null allele
rpb10- ::HIS3 of strains YGVS017 or OG10-6a
(Table I) on the rich medium YPD at 16, 30, and 37 °C, using a
plasmid shuffle assay (9). In vivo complementation of the
null mutant was monitored by the formation of uracil auxotrophic subclones (selected in the presence of 5-fluoroorotic acid) in the case
of OG10-6a or of red sectors on YPD in the case of YGVS017. Multicopy
suppression was systematically monitored by testing several independent
transformants by the relevant suppressor plasmid and by checking
that spontaneous subclones lacking the suppressor plasmid (selected in
the presence of 5-fluoroorotic acid) invariably lose the suppressor phenotype.
RNA Polymerase I- and III-dependent Transcription in
Vivo--
[3H]Uracil labeling was done on strains
made prototrophic for uracil by transformation with pFL44L. Cells were
grown in casamino acids medium (30 °C) supplemented with adenine
(20 µg/ml) to an optical density of 0.2 at 600 nm and shifted for 1, 4, or 8 h at 37 °C. 150 µCi of [5,6 3H]uracil
(1mCi/ml) were added to 10 ml of culture for 10 min. RNA was prepared
as described previously (20).
mRNA Steady-state Levels in Northern Blot
Analysis--
Total RNA were separated by electrophoresis on a 1.2%
agarose gel after denaturation with glyoxal and dimethyl sulfoxide and transferred to a positively charged nylon membrane (Boehringer Mannheim) by vacuum blotting (2 h, 200 millibars) in a 785 Vacuum Blotter (Bio-Rad) in 10× SSC (1× SSC =0.15 M NaCl and
0.015 M sodium citrate). RNAs were cross-linked using a
UV-Stratalinker apparatus (Stratagene) and hybridized against
DED1 and ACT1 probes that were PCR-amplified on
yeast genomic DNA using TAACAACAACGGCGGCTACA and CCATCAAATCTCTGCCGTTG
(DED1) or TTGAGAGTTGCCCCAGAAGAACACC and CACCATCACCGGAATCCAAAACAAT (ACT1) as primers. These probes
were randomly labeled using a Megaprime DNA labeling kit (Amersham Pharmacia Biotech).
Immunoblot Analysis--
Six-liter cultures of strains
OG22-2b-WTHA (RPB10+) and F4HA (rpb10-F4) grown
on minimal SD-Gal (supplemented with casamino extract but lacking
adenine) were harvested at a absorbance of about 1.0. Cell-free
extracts were prepared as previously described (21) and cleared by
centrifugation. 15 µg of the supernatant proteins was loaded on
SDS-PAGE gels (11 and 8% polyacrylamide). These preparations were
probed on nitrocellulose membranes by antibodies raised against
purified pol I and by a mixture of antibodies raised against the two
largest subunits of yeast RNA polymerase II, using a commercial
detection system (Amersham Pharmacia Biotech).
 |
RESULTS |
A Conserved RNA Polymerase Subunit--
Fig.
1A presents the alignment of
four eucaryotic, four archaeal, and three viral gene products related
to ABC10 and documents the particularly strong conservation of the
eucaryotic sequences with 41 identical amino acid positions in the
fungal, plant, and human sequences. We have previously shown that the
human and fission yeast polypeptides are functional in S. cerevisiae (9, 10, 22). The archaeal sequences (including the N
polypeptide, a proven polymerase subunit of S. acidocaldarius (14)), are less stringently conserved but still
clearly related to the eucaryotic subunit. Three cytoplasmic DNA
viruses (vaccinia, African swine fever virus and chilo Iridovirus)
encode products that are loosely related to each other and to ABC10 ,
but the vaccinial polypeptide copurifies with RNA polymerase and is
thus in all likelihood a genuine subunit of that enzyme (15). In
contrast, there is no ABC10 -related sequence in any of the bacterial
genomes currently available in public data banks. In particular,
ABC10 is unrelated to , a small polypeptide that copurifies with
the holopolymerase of Escherichia coli ((23) and references
therein).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Sequence conservation and mutational analysis
of ABC10 . A, sequence
alignments. The S. cerevisiae sequence is the correct one as
determined by Lalo et al. (13). Black boxes
correspond to amino acids that are invariant between all eucaryotic
sequences or that are shared between the eucaryotic sequences and all
their archaeal or viral counterpart. Shaded boxes correspond
to amino acids that are specifically invariant in archaeal sequences.
Two eucaryote-specific domains are denoted by a thick bar
above the human sequence. In the case of the more distantly related
viral sequences, optimal scores (as determined by the Fasta algorithm)
were 73 (vaccinia), 62 (African swine fever virus, AFSV),
and 127 (chilo iridescent virus, CIV). The corresponding Z
values are 6, 5, and 15 (using a Monte-Carlo analysis based on 1000 randomized ABC10 sequences). Z values >6 denote significant
homology. H. sapiens, Homo sapiens; B. napus, Brassica napus; S. pombe,
Schizosaccharomyces pombe; M. jannaschii,
Methanococcus jannaschii; aa, amino acids.
B, in vitro mutagenesis of RPB10.
Twenty-eight single-site rpb10 mutations were created by
random or site-directed PCR mutagenesis and examined for their growth
effect on solid rich medium (YPD) at 16, 24, 30, and 37 °C.
Black boxes denote amino acid substitutions leading to a
complete growth defect. Shaded boxes symbolize conditional
or slow growing mutants. The 16 remaining mutations have no detectable
growth defect.
|
|
Domain Swapping between the Archaeal and Eucaryotic
Subunits--
The N subunit of S. acidocaldarius and of
Haloarcula marismortui cannot replace ABC10 in
vivo (9, 24). However, yeast/archaeal chimerae are largely
interchangeable in vivo with the yeast subunit, because they
support growth when introduced in a S. cerevisiae host
strain that is deleted for RPB10, the gene encoding ABC10 (Fig. 2). The archaeal and eucaryotic
polypeptides must therefore have largely equivalent functions in their
respective transcription complexes. In particular, all constructions
where the archaeal component extends up to the first 49 amino acids are
viable. In contrast, a chimeric construction (rpb10-F8)
extending the archaeal segment up to position His-53 was lethal, as was
also the case for a rpb10-F4, swapping the C-end of ABC10
downstream His-53. Deleting the last five amino acids (downstream of
Pro-65) had instead no growth defect (rpb10- LEK). The
amino acids falling between positions His-53 and Pro-65 are therefore
likely to account for the functional incompatibility observed between
full-size archaeal (S. acidocaldarius) and eucaryotic
ABC10 in vivo. Interestingly, this domain is moderately
conserved between archaeal and eucaryotic sequences but contains an
invariant HVDLIEK motif in all eucaryotic sequences identified so far
(Fig. 1A).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Domain swapping between
ABC10 and the N subunit of S. acidocaldarius. A, F1 to F8 are hybrid
constructions achieved by domain swapping, where black
frames represent segments that derive from the archaeal
polypeptide. The limits of these segments are indicated by the
corresponding amino acid position on the yeast sequence (Trp-18,
Glu-32, Met-49, His-53). LEK is a deletion made by PCR mutagenesis
and eliminating the last five coding triplets of the yeast sequence.
B, growth at 30 and 37 °C is illustrated for the three
temperature-sensitive constructions (F2, F5, and F7) after 4 days on
complete medium YPD, using a serial dilution technique. WT,
wild type.
|
|
An Atypical Metal-binding Domain (CX2C ... CC) Is
Critical in Vivo--
The S. acidocaldarius and S. cerevisiae subunits share 17 amino acids, of which 13 are
identical in all eucaryotes and archaeal sequences (Fig.
1A). Amino acid replacements were generated at these 17 positions and at 11 other highly conserved amino acids, expressed from
a strong promoter harbored on a multicopy plasmid (i.e.
under conditions maximizing the expression of the mutant allele) and
tested for their ability to support growth. Practically all the mutants
tested were phenotypically silent or had but a partial growth defect,
which in keeping with our domain swapping and heterospecific
complementation data, indicates that the precise amino acid sequence of
ABC10 is not very critical for its function (Fig. 1B).
However, conservative Cys to Ser or Thr substitutions at the
CX2C ... CC motif are lethal at all
temperatures tested, and mutants with partial growth defect also tend
to cluster near this motif. This fits very well with the fact that the
CX2C ... CC motif is the only sequence
feature shared by all relatives of ABC10 , including the three viral
gene products that hardly show any similarity outside this motif. In
view of the striking similarity with the canonical
CX2C ... CX2C
Zn2+ binding domain, and given that yeast ABC10 binds
Zn2+ in vitro (25), we propose that the
CX2C ... CC motif defines a new type of
metal-coordinating domain, although Zn2+ need not be the
true ligand chelated by that motif in vivo.
An Invariant Eucaryotic Motif (HVDLIEK) Is Critical for pol I in
Vivo--
As stated above, the growth properties of yeast/archaeal
chimeric constructions suggest that the eucaryotic motif HVDLIEK is
critical for the biological activity of ABC10 . This is confirmed by
the properties of temperature-sensitive mutants isolated from a library
of randomly mutagenizedRPB10 alleles. Only 2 of the 12 mutants thus obtained resulted from single amino acid substitutions (rpb10-K59E and rpb10-I57F), and both are in the
HVDLIEK motif (rpb10-K59E actually replaces the invariant
lysine by the glutamate of the archaeal sequence). These mutants are
strongly temperature-sensitive on plates (see Fig. 4) but can still
undergo two to three cycles of growth and division upon a shift to the
restrictive temperature, as shown by their delayed growth arrest (Fig.
3A). We monitored the in
vivo synthesis of rRNA and tRNA in the first 8 h after the
shift (i.e. before growth recedes) by short-pulse labeling with tritiated uracil and followed the accumulation of specific mRNAs by Northern hybridization. The results are shown for
rpb10-K59E, and similar data were obtained with
rpb10-I57F (not shown). tRNA and 5 S rRNA synthesis (pol
III) was not affected under these conditions, but there was a marked
effect on the three rRNA species (25 S, 18 S, and 5.8 S) synthesized by
pol I (Fig. 3B). In contrast to the rapid arrest observed for the
rpb1-1 mutant (26) specifically affecting the activity of
pol II, mRNA synthesis goes on in the rpb10 mutants for
at least 5 h after the temperature shift, although it progessively
decreases thereafter (Fig. 3C). Thus, both mutations primarily block the synthesis of pol I-dependent
transcripts, although ABC10 is shared by all three polymerases.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Growth and transcription pattern in a
rpb10-K59E mutant (OG20) and its isogenic wild type
(WT) control (YGVS017). A, growth.
Cell density was measured by turbidimetry. Double bars
denote parallel dilutions before overnight growth. B,RNA
polymerase I- and III-dependent transcription. Cells were
labeled for 10 min with 250 µCi of [3H]uracil (see
"Material and Methods"). Lanes 1-4, strain
OG20(rpb10-K59E). Lanes 5-8, wild type control
YGVS017(RPB10+). Cultures were shifted from
30 °C (lanes 1 and 5) to 37 °C for 1 h
(lanes 2 and 6), 5 h (lanes 3 and
7), or 8 h (lanes 4 and 8). Total
RNA (5 mg as determined by absorbance at 260 nm) was separated on 6%
acrylamide gel and exposed for 24 h to reveal the high molecular
weight rRNA (25 S and 18 S). Low molecular weight RNAs (5.8 S rRNA, 5 S
rRNA, and tRNAS) were revealed after a 7-day exposure. C,
RNA polymerase II-dependent transcription. Total RNA was
prepared from YGVS017(RPB10+) and
OG20(rpb10-K59E) and from Y260 (rpb1-1) (26).
After separation on a 1% agarose gel, RNA was transferred to
positively charged nylon membranes (Boehringer Mannheim) and hybridized
with ACT1 and DED1 probes to determine the
steady-state level of the corresponding mRNAs.
|
|
To further explore the transcriptional specificity of
rpb10-K59E and rpb10-I57F mutants, we examined
whether they could be rescued by making growth independent of pol I. The appropriate genetic context was created by introducing a
rpa43- ::LEU2 deletion that inactivates the
essential pol I subunit A43 (19) and is thus lethal, except in the
presence of a plasmid that expresses the rDNA transcript from the
galactose-inducible promoter pGAL7. This allows pol I-defective mutants
to be rescued on galactose by pol II-dependent
transcription (17, 19). Growth at 37 °C was indeed restored in
rpa43- ::LEU2 (pGAL7::rDNA)
constructions harboring rpb10-K59E or rpb10-I57F,
indicating that their temperature-sensitive phenotype is primarily
because of a pol I defect. As a control, we reintroduced the wild type
RPA43 gene by genetic transformation and shifted the
resulting transformants to a glucose medium, shutting off the RNA
polymerase II-dependent synthesis of rRNA and thus restoring pol I dependence. Both mutants regained their
temperature-sensitive phenotype under these conditions (Fig.
4). This pol I-specific defect is an
allele-specific property that was not observed in two other
temperature-sensitive mutants (rpb10-H53Q and
rpb10-M49L) nor in the rpc40-V78R mutant
affecting AC40, the -like subunit common to pol I and III.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 4.
RNA polymerase I dependence of the rpb10-I57F
and rpb10-K59E mutants. Left panel, strain
OG22-2b(rpa43- RPB10+) and isogenic
derivatives bearing the rpb10-I57F and rpb10-K59E
alleles were grown for 8 days on YP-glactose plates at 37 °C. In
these conditions, RNA polymerase I is fully inactive because of the
rpa43- deletion (19), and 35 S rRNA synthesis is made
dependent on RNA polymerase II by plasmid pNOY102
(pGAL7::rDNA). Right panel, the same strains were
transformed by plasmid pASZ11-RPA43(CEN RPA43) to restore
RNA polymerase I activity and grown on complete medium YPD for 4 days
at 37 °C (no difference was observed at 30 °C (not shown)). 35 S
rRNA synthesis is entirely dependent on RNA polymerase I because of
glucose repression of the pGAL7::rDNA transcription on
plasmid pNOY102. WT, wild type.
|
|
We next asked if the lethal phenotype of the rpb10-F4 and
rpb10-F6 chimerae (where HVDLIEK is replaced by its archaeal
counterpart) also results from a pol I-specific defect. Using the same
experimental approach, we found again both chimeric constructions to be
rescued on galactose, although they are fully lethal when pol
II-dependent synthesis of rRNA is shut off in the presence
of glucose (Fig. 5). However, growth was
slower than in isogenic wild type controls, indicating that there is
also a partial pol II and/or III defect. At this point, we began to
wonder if ABC10 itself, although shared by all three polymerases,
might be only essential for pol I-dependent transcription.
Reassuringly, we found that the rpb10- ::HIS3
deletion is lethal even when allowing pol II-dependent
synthesis of rRNA (data not shown).

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 5.
Viability of the rpb10-F4 and rpb10-F6
hybrids in a RNA polymerase I-defective context. The strains used
were OG22-2b(rpa43- RPB10+) and two isogenic
derivatives, where the wild type RPB10 is replaced by the
chimeric constructs F4 and F6 (see Fig. 2). Cells were streaked on
YP-galactose plates and incubated for 10 days at 30 °C (left
panel). In this genetic context, 35S rRNA synthesis is entirely
dependent on RNA polymerase II as described above (Fig. 4). The two
mutant strains are viable but slow-growing under these conditions. The
same strains were transformed with plasmid pASZ11-RPA43 (cen
rpa43), which restores a full set of RNA polymerase I subunits.
Growth on YPD was tested after 5 days at 30 °C. WT, wild
type.
|
|
Dosage-dependent Suppression of rpb10-I57F and
rpb10-K59E by SRP40--
Taking advantage of a previously described
yeast genomic library constructed in the multicopy vector pFL44L (27),
we looked for dosage-dependent suppressor genes able to
partly correct the growth defect of the ts mutants
rpb10-I57F and rpb10-K59E at 37 °C. It has
often been observed that conditional mutants in a given pol I, pol II,
or pol III subunits are suppressed by increasing the gene dosage of
another subunit of the same enzyme (13, 28, 29). None of the 13 other
RNA polymerase I subunits had any suppressor effect, including
RPC19 and RPC40 (encoding the -like subunits
AC19 and AC40 of pol I and pol III), although ts alleles of these two
genes are themselves suppressed by a high dosage of RPB10
(13). However, an intriguing link between the -like subunit AC40 and
ABC10 is suggested by our observation that SRP40 (encoding a putative yeast homolog of the nucleolar protein Nopp140p in
mammals (30, 31) suppresses rpb10-I57F,
rpb10-K59E, and the chimeric construction
rpb10-F5 (this work). SRP40 was initially isolated by its
ability to suppress rpc40-V78R (13). Except for a weak
effect on a sec61 mutant defective in protein translocation (30), which may reflect the still poorly understood role of secretion
in ribosome biogenesis (32), SRP40 appears to act specifically on rpb10 and rpc40 mutants: it has
no effect on any of the numerous conditional pol I, pol II, and/or pol
III mutants isolated in this laboratory, and we were unable to confirm
a previous report that SRP40 suppresses a conditional mutant
of the pol III transcription factor TFIIIB (44).
The Chimeric Mutant Strain rpb10-F4 Lacks Subunit A190 in Cell-free
Extracts--
In view of the pol I-specific defect of mutants affected
in the HVDLIEK motif, we examined whether pol I is present in cell-free extracts of the rpb10-F4 strain OG22-2b-F4HA (where the
HVDLIEK domain is replaced by its archaeal counterpart) compared with an isogenic wild type strain. Both strains are equipped with a complete
set of RPA genes encoding all subunits of pol I and only differ by their RPB10 allele. They were grown on galactose,
to rescue the pol I defect of strain OG22-2b-F4HA by a pol
II-dependent synthesis of rRNA (see above). As shown in
Fig. 6A, a cell-free extract
of OG22-2b-F4HA contained no antigenically detectable form of A190,
although other pol I subunits (A135, A49, A43, and AC40) were present
in normal amount. The two large subunits of pol II (B220 and B150) were
also detected, although in lower amounts (Fig. 6B).
Conditional mutants defective in the essential subunit A43 (19) have a
normal amount in A190,2
indicating that the disappearance of A190 in cell-free extracts is not
the mere result of a pol I defect.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Accumulation of RNA polymerase I (A190, A135,
A49, A43, AC40) and II (B220 and B150) subunits in cell-free extracts
of the rpb10-F4 strain OG22-2b-F4HA and its isogenic wild type control
OG22-2b-WTHA. A, Western blotting using anti-pol I
antibodies was done as described under "Materials and Methods" and
reveals the five largest subunits of yeast RNA polymerase I (A190,
A135, A49, A43, and AC40). Lane 1 corresponds to 500 ng of a
highly purified yeast pol I preparation. Lanes 2 and
3 correspond to 15 µg of crude extracts from strain
OG22-2b-WTHA (wild type (WT)) and OG22-2b-F4HA (mutant).
Electrophoresis was done by SDS-PAGE on a gel containing 11% of
polyacrylamide. B, Western blotting done in the same
conditions on a gel containing 8% of polyacrylamide, using two
polyclonal antibodies raised against the two largest subunits (B220 and
B150) of yeast RNA polymerase II. The double signal obtained with
anti-B220 is because of the existence of a proteolyzed form of B220
lacking the highly repeated C-terminal domain. Lanes 2 and
3 correspond to the same amount (15 µg) of total
proteins.
|
|
 |
DISCUSSION |
The amino acid sequence of ABC10 (13) has a marked homology to
the N subunit of the archaeal enzyme (5, 24). Both are largely
interchangeable in vivo and thus presumably retained a very
similar function in their respective transcription complexes, despite
the early evolutionary divergence of archaea and eucaryotes, which are
thought to have separated about 1.8 billion years ago (33). Their
similarity to viral gene products, including a polypeptide copurifying
with the vaccinial enzyme (15), is restricted to a four-cysteine motif
(CX2C ... CC) but is likely to be
biologically significant, because it is the only invariant motif shared
by all eucaryotic, archaeal, and viral sequences identified so far and
corresponds to the only amino acids whose integrity is essential for
growth in S. cerevisiae. A search in current protein data banks failed to reveal the presence of that motif outside the ABC10
family. Nevertheless, its similarity to the canonical Zn2+
tetra-coordination domain (CX2C. . . . .
CX2C) is striking, except for the apposition of
the last two cysteines. Besides, the latter are invariably followed by
two arginines or lysines that, by increasing the pKa
of the adjacent cysteines, should favor metal coordination. Earlier
work has documented the ability of ABC10 to bind Zn2+
in vitro (34), and we are therefore inclined to believe that CX2C ... CC is an atypical metal binding
domain where the physiological ligand may be Zn2+ or
another metal ion.
The existence of a vaccinial form of ABC10 is particularly striking,
because this is the only vaccinial polypeptide (beyond the '- and
-like subunits) to have a recognizable homology to the nuclear
enzymes (35). In the African swine fever virus (36), instead, homology
extends to the two eucaryotic -like subunits and the common subunits
ABC27 and ABC23. Viral polymerases are therefore more or less
closely related to the nuclear enzymes in their subunit composition.
Based on the sequencing data available so far, however, all of them
share with the eucaryotic and archaeal polymerases a minimal subunit
structure that is invariably formed of ', , and ABC10 -like
subunits. The ' core is not surprising because the two large
subunits are known to harbor the active site of the yeast (1, 2) and
bacterial (3) enzymes, but the permanence of ABC10 -like subunits in
all nonbacterial forms of polymerases calls for an explanation.
To approach the function of ABC10 , we exploited the invariant motif
HVDLIEK of the yeast polypeptide, present in all eucaryotic forms but
loosely related to the corresponding archaeal domain. Domain swapping
experiments indicate that this motif is important for the biological
activity in yeast and is the main structural element preventing a
complete functional compatibility between the yeast and archaeal
subunits. In particular, its replacement by the equivalent S. acidocaldarius motif leads to a lethal phenotype, whereas the
rpb10-K59E mutation bringing HVDLIEK closer to the S. acidocaldarius sequence has a strong temperature-sensitive growth
defect. Because ABC10 is shared by all three eucaryotic polymerases,
we expected these mutants to be defective in all three forms of
transcription. Paradoxically, these phenotypes are bypassed when the 35 S ribosomal RNA precursor is made by RNA polymerase II. They are thus
due to a pol I-specific defect. In vitro, this is
accompanied by a complete lack of the largest pol I subunit (A190) in
mutant cell-free extracts. It is therefore tempting to speculate that
the HVDLIEK domain affects pol I assembly and that the largest
subunit is rapidly degraded if not properly incorporated in the
heteromultimeric enzyme structure.
Because ABC10 is shared by all three polymerases, we suppose that it
has the same structural function in pol I, pol II, and pol III.
However, the HVDLIEK motif appears to be especially important for pol
I, suggesting that this invariant motif was conserved throughout
eucaryotic evolution because it helps segregating the nucleolar
polymerase from its two sister enzymes pol II and III. A general role
of ABC10 in the assembly of RNA polymerases would be consistent with
its dosage-dependent suppression of conditional mutants in
the -like subunits AC40 and AC19 of RNA polymerases I and III (13).
It is also supported by the results of a systematic survey of
two-hybrid interactions in yeast RNA
polymerases,3 showing that
ABC10 can selectively bind the N-terminal part of the '-like
subunit of RNA polymerase II (B220) and the C-terminal part of the
-like subunit (B135). Our working hypothesis is that ABC10 brings
together these two domains (known to be topologically close on the
spatial structure of yeast (6, 38) and bacterial (39) polymerases) and
anchors them on the eucaryotic archaeal and viral equivalents of the
bacterial 2 structure. In yeast, the latter is defined by the
B44/B12.5 heterodimer of pol II and by its AC40/AC19 homolog in pol I
and III (13, 40, 41). Intriguingly, ts mutants defective in either
ABC10 or AC40 (but, so far, in no other subunits) are corrected by
the overexpression of Srp40p, a yeast component related to the
mammalian Nopp140 protein (30, 31, 37) that may be important for the
nucleolar assembly of yeast pol I.
Our hypothesis accounts for the pol I-specific defects of some (but not
all) of the RPB10 mutants analyzed in the present report,
because ABC10 would obviously bind to conserved but nonidentical target domains on the largest and second largest subunits of pol I, II,
and III. A similar structural role has been proposed for ABC23, another
common subunit that is highly conserved among nonbacterial polymerases
(42). In that case, however, it was also shown that a catalytically
inactive form of yeast pol I lacking ABC23 regains activity upon
addition of that subunit, implying that ABC23 is not only important for
the stability of the RNA polymerase I complex but is somehow connected
with its active site (43). In view of the impressive conservation of
ABC10 , we are inclined to believe that this subunit may also be
closely associated with the active site, although the lack of a
bacterial counterpart argues against a direct catalytic role.
 |
ACKNOWLEDGEMENTS |
We thank André Sentenac, Michel Werner,
and our colleagues from the Polymerase Group at Saclay for advice and
support. We are especially grateful to Gerald Peyroche for many useful
suggestions. RNA polymerase I preparations and antibodies were kindly
given by Christophe Carles and Michel Riva. Strain GF312-17c was
provided by Gérard Faye and plasmid pRPON by Doris Langer.
 |
FOOTNOTES |
*
This study was partly funded by a Grant from the European
Union (FMRX-CT96-0064).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of a scholarship financed by the Institut de Formation
Supérieure Biomédicale and by the Commissariat
à l'Energie Atomique.
Supported by Russian Foundation for Basic Research Grant
96-04-49867, International Science Foundation Grants MWE000 and MWE300, and the Russian governmental science and technology program Advances in Bioengineering.
**
To whom correspondence should be addressed. Tel.: 33-1-69-08-35-86;
Fax: 33-1-69-08-47-12; E-mail: thuriaux{at}jonas.saclay.cea.fr.
2
G. Peyroche, personal communication.
3
A. Flores, J.-F. Briand, C. Boschiero, O. Gadal,
J.-C. Andrau, L. Rubbi, V. van Mullem, M. Goussot, C. Marck, C. Carles,
P. Thuriaux, A. Sentenac, and M. Werner, submitted for publication.
 |
ABBREVIATIONS |
The abbreviations used are:
PCR, polymerase
chain reaction;
YPD, yeast-peptone-dextrose;
pol, polymerase;
HA, hemagglutinin.
 |
REFERENCES |
-
Riva, M.,
Carles, C.,
Sentenac, A.,
Grachev, M. A.,
Mustaev, A. A.,
and Zaychikov, E. F.
(1990)
J. Biol. Chem.
265,
16498-16503[Abstract/Free Full Text]
-
Dieci, G.,
Hermann-Le Denmat, S.,
Lukhtanov, E.,
Thuriaux, P.,
Werner, M.,
and Sentenac, A.
(1995)
EMBO J.
14,
3766-3776[Medline]
[Order article via Infotrieve]
-
Zaychikov, E.,
Martin, E.,
Denissova, L.,
Kozlov, M.,
Heuman, H.,
Nikiforov, V.,
Goldfarb, A.,
and Mustaev, A.
(1996)
Science
273,
107-109[Abstract]
-
Martindale, D. W.
(1990)
Nucleic Acids Res.
18,
2953-2959[Abstract/Free Full Text]
-
Langer, D.,
Hain, J.,
Thuriaux, P.,
and Zillig, W.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5768-5772[Abstract/Free Full Text]
-
Thuriaux, P.,
and Sentenac, A.
(1992)
in
The Molecular Biology of Yeast (Jones, E. W., Pringle, J. R., and Broach, J. R., eds), Vol. 2, pp. 1-45, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory, NY
-
Woychik, N. A.,
and Young, R. A.
(1994)
in
Transcription Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), pp. 227-242, Raven Press, Ltd., New York
-
Chédin, S., Ferri, M. L., Peyroche, G., Andrau, J. C.,
Jourdain, S., Lefebvre, O., Werner, M., Carles, C., and Sentenac, A. (1998) Cold Spring Harbor Symp. Quant. Biol., in
press
-
Shpakovski, G. V.,
Acker, J.,
Wintzerith, M.,
Lacroix, J. F.,
Thuriaux, P.,
and Vigneron, M.
(1995)
Mol. Cell. Biol.
15,
4702-4710[Abstract]
-
McKune, K.,
Moore, P. A.,
Hull, M. W.,
and Woychik, N. A.
(1995)
Mol. Cell. Biol.
15,
6895-6900[Abstract]
-
Carles, C.,
Treich, I.,
Bouet, F.,
Riva, M.,
and Sentenac, A.
(1991)
J. Biol. Chem.
266,
24092-24096[Abstract/Free Full Text]
-
Woychik, N. A.,
and Young, R. A.
(1990)
J. Biol. Chem.
265,
17816-17819[Abstract/Free Full Text]
-
Lalo, D.,
Carles, C.,
Sentenac, A.,
and Thuriaux, P.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5524-5528[Abstract/Free Full Text]
-
Lanzendörfer, M.,
Langer, D.,
Hain, J.,
Klenk, H. P.,
Holz, I.,
Arnold-Ammer, I.,
and Zillig, W.
(1994)
Syst. Appl. Microbiol.
16,
656-664
-
Amegadzie, B. Y.,
Ahn, B. Y.,
and Moss, B.
(1992)
J. Virol.
66,
3003-3010[Abstract/Free Full Text]
-
Bonneaud, N.,
Ozier-Kalogeropoulos, O.,
Li, G.,
Labouesse, M.,
Minvielle-Sebastia, L.,
and Lacroute, F.
(1991)
Yeast
7,
609-615[CrossRef][Medline]
[Order article via Infotrieve]
-
Nogi, Y.,
Yano, R.,
and Nomura, M.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3962-3966[Abstract/Free Full Text]
-
Stotz, A.,
and Linder, P.
(1990)
Gene
95,
91-98[CrossRef][Medline]
[Order article via Infotrieve]
-
Thuriaux, P.,
Mariotte, S.,
Buhler, J. M.,
Sentenac, A.,
Vu, L.,
Lee, B. S.,
and Nomura, M.
(1995)
J. Biol. Chem.
270,
24252-24257[Abstract/Free Full Text]
-
Hermann-Le Denmat, S.,
Werner, M.,
Sentenac, A.,
and Thuriaux, P.
(1994)
Mol. Cell. Biol.
14,
2905-2913[Abstract/Free Full Text]
-
Riva, M.,
Buhler, J. M.,
Sentenac, A.,
Fromageot, P.,
and Hawthorne, D. C.
(1982)
J. Biol. Chem.
257,
4570-4577[Abstract/Free Full Text]
-
Shpakovski, G. V.,
Lebedenko, E. N.,
and Thuriaux, P.
(1997)
Bioorg. Khim.
23,
110-117[Medline]
[Order article via Infotrieve]
-
Mukerjee, K.,
and Chaterji, D.
(1997)
Eur. J. Biochem.
247,
884-889[Medline]
[Order article via Infotrieve]
-
McKune, K.,
and Woychik, N. A.
(1994)
J. Bacteriol.
176,
4754-4756[Abstract/Free Full Text]
-
Treich, I.,
Carles, C.,
Riva, M.,
and Sentenac, A.
(1992)
Gene Expr.
2,
31-37[Medline]
[Order article via Infotrieve]
-
Nonet, M.,
Scafe, C.,
Sexton, J.,
and Young, R.
(1987)
Mol. Cell. Biol.
7,
1602-1611[Abstract/Free Full Text]
-
Stettler, S.,
Chiannilkulchai, N.,
Hermann-Le Denmat, S.,
Lalo, D.,
Lacroute, F.,
Sentenac, A.,
and Thuriaux, P.
(1993)
Mol. Gen. Genet.
239,
169-176[Medline]
[Order article via Infotrieve]
-
Archambault, J.,
Schappert, K. T.,
and Friesen, J. D.
(1990)
Mol. Cell. Biol.
10,
6123-6131[Abstract/Free Full Text]
-
Thuriaux, P.,
Werner, M.,
Stettler, S.,
and Lalo, D.
(1995)
Methods Mol. Genet.
6,
227-246
-
Ikonomova, R.,
Sommer, T.,
and Képès, F.
(1997)
DNA Cell Biol.
16,
1161-1173[Medline]
[Order article via Infotrieve]
-
Meier, U. T.
(1996)
J. Biol. Chem.
271,
19376-19384[Abstract/Free Full Text]
-
Mizuta, K.,
and Warner, J. R.
(1994)
Mol. Cell. Biol.
14,
2493-2502[Abstract/Free Full Text]
-
Doolittle, R. F.,
Feng, D. F.,
Tsang, S.,
Cho, G.,
and Little, E.
(1996)
Science
271,
470-477[Abstract]
-
Treich, I.,
Riva, M.,
and Sentenac, A.
(1991)
J. Biol. Chem.
266,
21971-21976[Abstract/Free Full Text]
-
Moss, B.
(1996)
in
Fields Virology (Fields, B. N., Knipe, S. M., and Howley, P. M., eds), Vol. 2, pp. 2637-2671, Lippincott-Raven Publishers, Philadelphia
-
Yanez, R. J.,
Rodriguez, J. M.,
Nogal, M. L.,
Yuste, L.,
Enriquez, C.,
Rodriguez, J. F.,
and Vinuela, E.
(1995)
Virology
208,
249-278[CrossRef][Medline]
[Order article via Infotrieve]
-
Meier, U. T.,
and Blobel, G.
(1992)
Cell
70,
127-138[CrossRef][Medline]
[Order article via Infotrieve]
-
Yano, R.,
and Nomura, M.
(1991)
Mol. Cell. Biol.
11,
754-764[Abstract/Free Full Text]
-
Severinov, K.,
Mooney, R.,
Darst, S. A.,
and Landick, R.
(1997)
J. Biol. Chem.
272,
24137-24140[Abstract/Free Full Text]
-
Dequard-Chablat, M.,
Riva, M.,
Carles, C.,
and Sentenac, A.
(1991)
J. Biol. Chem.
266,
15300-15307[Abstract/Free Full Text]
-
Woychik, N. A.,
McKune, K.,
Lane, W. S.,
and Young, R. A.
(1993)
Gene Expr.
3,
77-82[Medline]
[Order article via Infotrieve]
-
Nouraini, S.,
Archambault, J.,
and Friesen, J. D.
(1996)
Mol. Cell. Biol.
16,
5985-5996[Abstract]
-
Lanzendörfer, M.,
Smid, A.,
Klinger, C.,
Schultz, P.,
Sentenac, A.,
Carles, C.,
and Riva, M.
(1997)
Genes Dev.
11,
1033-1047
-
Lefebvre, O.,
Röth, J.,
and Sentenac, A.
(1994)
J. Biol. Chem.
269,
23374-23381[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Zaros, J.-F. Briand, Y. Boulard, S. Labarre-Mariotte, M. C. Garcia-Lopez, P. Thuriaux, and F. Navarro
Functional organization of the Rpb5 subunit shared by the three yeast RNA polymerases
Nucleic Acids Res.,
January 28, 2007;
35(2):
634 - 647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yashiroda and K. Tanaka
Hub1 is an essential ubiquitin-like protein without functioning as a typical modifier in fission yeast
Genes Cells,
December 1, 2004;
9(12):
1189 - 1197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Naryshkina, A. Bruning, O. Gadal, and K. Severinov
Role of Second-Largest RNA Polymerase I Subunit Zn-Binding Domain in Enzyme Assembly
Eukaryot. Cell,
October 1, 2003;
2(5):
1046 - 1052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-F. Briand, F. Navarro, P. Rematier, C. Boschiero, S. Labarre, M. Werner, G. V. Shpakovski, and P. Thuriaux
Partners of Rpb8p, a Small Subunit Shared by Yeast RNA Polymerases I, II, and III
Mol. Cell. Biol.,
September 1, 2001;
21(17):
6056 - 6065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Mackereth, C. H. Arrowsmith, A. M. Edwards, and L. P. McIntosh
Zinc-bundle structure of the essential RNA polymerase subunit RPB10 from Methanobacteriumthermoautotrophicum
PNAS,
June 6, 2000;
97(12):
6316 - 6321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Rubbi, S. Labarre-Mariotte, S. Chedin, and P. Thuriaux
Functional Characterization of ABC10alpha , an Essential Polypeptide Shared by All Three Forms of Eukaryotic DNA-dependent RNA Polymerases
J. Biol. Chem.,
October 29, 1999;
274(44):
31485 - 31492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Markov, T. Naryshkina, A. Mustaev, and K. Severinov
A zinc-binding site in the largest subunit of DNA-dependent RNA polymerase is involved in enzyme assembly
Genes & Dev.,
September 15, 1999;
13(18):
2439 - 2448.
[Abstract]
[Full Text]
|
 |
|
|