Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gadal, O.
Right arrow Articles by Thuriaux, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gadal, O.
Right arrow Articles by Thuriaux, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 13, 8421-8427, March 26, 1999


Mutants in ABC10beta , a Conserved Subunit Shared by All Three Yeast RNA Polymerases, Specifically Affect RNA Polymerase I Assembly*

Olivier GadalDagger §, George V. ShpakovskiDagger parallel , and Pierre ThuriauxDagger **

From the Dagger  Service de Biochimie et Génétique Moléculaire, Bât. 142, Commissariat à l'Energie Atomique-Saclay. Gif sur Yvette, F 91191 cedex, France and  Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences. 16/10 Miklukho-Maklaya str, 117871 Moscow, GSP-7 V-437, Russia

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ABC10beta , a small polypeptide common to the three yeast RNA polymerases, has close homology to the N subunit of the archaeal enzyme and is remotely related to the smallest subunit of vaccinial RNA polymerase. The eucaryotic, archaeal, and viral polypeptides share an invariant motif CX2C... CC that is strictly essential for yeast growth, as shown by site-directed mutagenesis, whereas the rest of the ABC10beta sequence is fairly tolerant to amino acid replacements. ABC10beta has Zn2+ binding properties in vitro, and the CX2C ... CC motif may therefore define an atypical metal-chelating site. Hybrid subunits that derive most of their amino acids from the archaeal subunit are functional in yeast, indicating that the archaeal and eucaryotic polypeptides have a largely equivalent role in the organization of their respective transcription complexes. However, all eucaryotic forms of ABC10beta harbor a HVDLIEK motif that, when mutated or replaced by its archaeal counterpart, leads to a polymerase I-specific lethal defect in vivo. This is accompanied by a specific lack in the largest subunit of RNA polymerase I (A190) in cell-free extracts, showing that the mutant enzyme is not properly assembled in vivo.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The nuclear genome of eucaryotes is transcribed by three heteromultimeric RNA polymerases that respectively contain 14, 12, and 17 distinct subunits in Saccharomyces cerevisiae. The two largest subunits are related to the beta ' and beta  components of the alpha 2beta beta ' bacterial core enzyme and to the equivalent subunits of the archaeal and vaccinial RNA polymerases. Biochemical and genetic studies have established that they harbor the active site of the yeast (1, 2) and bacterial (3) enzymes. Homology to the bacterial alpha  subunit, although less pregnant, was also observed with the eucaryotic and archaeal enzymes (4, 5). The alpha 2beta beta ' core polymerase structure is therefore preserved in all eucaryotic, archaeal, bacterial, and viral forms of RNA polymerases. A number of additional subunits are structurally conserved or even strictly identical from one to another polymerases (6-8) and are functionally conserved from yeast to man (9, 10). Most of them are structurally related to known components of the archaeal polymerase, indicating the existence of an extended core enzyme form that is common to the archaeal and eucaryotic lineages (5).

The present work deals with ABC10beta , a small polypeptide of 70 amino acids that is shared by all three yeast RNA polymerases, is able to bind Zn2+ in vitro (11) and is essential for growth (12). We have previously determined the amino acid sequence of that polypeptide (13), which has a close homology to the N subunit of the archaeal enzyme (5, 10, 14) and is remotely related to the smallest subunit of vaccinial RNA polymerase (15). We report here that the yeast subunit and its archaeal homolog are largely interchangeable in vivo and that the eucaryotic, archaeal, and viral polypeptides have in common an invariant metal binding domain (CX2C ... CC) critical for its biological activity in S. cerevisiae. Moreover, our data show that ABC10beta discriminates between RNA polymerase I and the other two nuclear RNA polymerases via an invariant eucaryotic motif, HVDLIEK. Replacing this motif by its archaeal counterpart strongly interferes with the heteromultimeric assembly of yeast RNA polymerase I.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Strains, Plasmids, and Growth Conditions-- Newly constructed strains and plasmids are listed in Table I. Plasmids pFL44L (16), pGEN and pGENSc-10beta (9), pFL44-RPB10e (13), pNOY102 (17), pASZ11 (18) and YCPA43-12 (19) were previously described. Plasmids bearing mutant or chimeric forms of RPB10 were expressed from the strong constitutive pPGK1 promoter of the TRP1 multicopy vector pGEN-B (Table I). The yeast (S. cerevisiae) and archaeal (Sulfolobus acidocaldarius) coding sequences were cloned between the EcoRI and XhoI sites of pGEN-B to generate pGEN-B/RPB10 and pGEN-B/RpoN. The latter plasmid contains a unique BamHI site in the RpoN coding sequence. The N-terminal and C-terminal halves of RPB10 and RpoN could be exchanged to form the F5 and F6 chimeric protein of Fig. 2A. This required an internal BamHI site at the equivalent position of RPB10, made by a GAA right-arrow CAA change at the 32nd codon corresponding to the phenotypically silent rpb10-E32P allele of plasmid pGEN-B/RPB10(E32P). The remaining RPB10/RpoN chimerae (F2, F4, F7) were constructed by PCR1 amplification with appropriate primers overlapping with either the EcoRI, BamHI, and XhoI site of pGEN-B/RPB10(E32P) and pGEN-B/RpoN. Plasmids bearing single-site mutations were generated by PCR-mediated mutagenesis of rpb10 (site-directed or random mutagenesis) on pGEN-Sc10beta and pGVS102 (Table I). N- and C-terminal hemagglutinin-tagged forms of ABC10beta were obtained by PCR amplification of RPB10 using primers bearing a single copy of the coding sequence of the hemagglutinin epitope.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Plasmids and yeast strains

Plasmid Shuffling and Dosage-dependent Suppression-- Mutants and chimeric forms of rpb10 were tested for their ability to complement the null allele rpb10-Delta ::HIS3 of strains YGVS017 or OG10-6a (Table I) on the rich medium YPD at 16, 30, and 37  °C, using a plasmid shuffle assay (9). In vivo complementation of the null mutant was monitored by the formation of uracil auxotrophic subclones (selected in the presence of 5-fluoroorotic acid) in the case of OG10-6a or of red sectors on YPD in the case of YGVS017. Multicopy suppression was systematically monitored by testing several independent transformants by the relevant suppressor plasmid and by checking that spontaneous subclones lacking the suppressor plasmid (selected in the presence of 5-fluoroorotic acid) invariably lose the suppressor phenotype.

RNA Polymerase I- and III-dependent Transcription in Vivo-- [3H]Uracil labeling was done on strains made prototrophic for uracil by transformation with pFL44L. Cells were grown in casamino acids medium (30  °C) supplemented with adenine (20 µg/ml) to an optical density of 0.2 at 600 nm and shifted for 1, 4, or 8 h at 37  °C. 150 µCi of [5,6 3H]uracil (1mCi/ml) were added to 10 ml of culture for 10 min. RNA was prepared as described previously (20).

mRNA Steady-state Levels in Northern Blot Analysis-- Total RNA were separated by electrophoresis on a 1.2% agarose gel after denaturation with glyoxal and dimethyl sulfoxide and transferred to a positively charged nylon membrane (Boehringer Mannheim) by vacuum blotting (2 h, 200 millibars) in a 785 Vacuum Blotter (Bio-Rad) in 10× SSC (1× SSC =0.15 M NaCl and 0.015 M sodium citrate). RNAs were cross-linked using a UV-Stratalinker apparatus (Stratagene) and hybridized against DED1 and ACT1 probes that were PCR-amplified on yeast genomic DNA using TAACAACAACGGCGGCTACA and CCATCAAATCTCTGCCGTTG (DED1) or TTGAGAGTTGCCCCAGAAGAACACC and CACCATCACCGGAATCCAAAACAAT (ACT1) as primers. These probes were randomly labeled using a Megaprime DNA labeling kit (Amersham Pharmacia Biotech).

Immunoblot Analysis-- Six-liter cultures of strains OG22-2b-WTHA (RPB10+) and F4HA (rpb10-F4) grown on minimal SD-Gal (supplemented with casamino extract but lacking adenine) were harvested at a absorbance of about 1.0. Cell-free extracts were prepared as previously described (21) and cleared by centrifugation. 15 µg of the supernatant proteins was loaded on SDS-PAGE gels (11 and 8% polyacrylamide). These preparations were probed on nitrocellulose membranes by antibodies raised against purified pol I and by a mixture of antibodies raised against the two largest subunits of yeast RNA polymerase II, using a commercial detection system (Amersham Pharmacia Biotech).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

A Conserved RNA Polymerase Subunit-- Fig. 1A presents the alignment of four eucaryotic, four archaeal, and three viral gene products related to ABC10beta and documents the particularly strong conservation of the eucaryotic sequences with 41 identical amino acid positions in the fungal, plant, and human sequences. We have previously shown that the human and fission yeast polypeptides are functional in S. cerevisiae (9, 10, 22). The archaeal sequences (including the N polypeptide, a proven polymerase subunit of S. acidocaldarius (14)), are less stringently conserved but still clearly related to the eucaryotic subunit. Three cytoplasmic DNA viruses (vaccinia, African swine fever virus and chilo Iridovirus) encode products that are loosely related to each other and to ABC10beta , but the vaccinial polypeptide copurifies with RNA polymerase and is thus in all likelihood a genuine subunit of that enzyme (15). In contrast, there is no ABC10beta -related sequence in any of the bacterial genomes currently available in public data banks. In particular, ABC10beta is unrelated to omega , a small polypeptide that copurifies with the holopolymerase of Escherichia coli ((23) and references therein).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence conservation and mutational analysis of ABC10beta . A, sequence alignments. The S. cerevisiae sequence is the correct one as determined by Lalo et al. (13). Black boxes correspond to amino acids that are invariant between all eucaryotic sequences or that are shared between the eucaryotic sequences and all their archaeal or viral counterpart. Shaded boxes correspond to amino acids that are specifically invariant in archaeal sequences. Two eucaryote-specific domains are denoted by a thick bar above the human sequence. In the case of the more distantly related viral sequences, optimal scores (as determined by the Fasta algorithm) were 73 (vaccinia), 62 (African swine fever virus, AFSV), and 127 (chilo iridescent virus, CIV). The corresponding Z values are 6, 5, and 15 (using a Monte-Carlo analysis based on 1000 randomized ABC10beta sequences). Z values >6 denote significant homology. H. sapiens, Homo sapiens; B. napus, Brassica napus; S. pombe, Schizosaccharomyces pombe; M. jannaschii, Methanococcus jannaschii; aa, amino acids. B, in vitro mutagenesis of RPB10. Twenty-eight single-site rpb10 mutations were created by random or site-directed PCR mutagenesis and examined for their growth effect on solid rich medium (YPD) at 16, 24, 30, and 37 °C. Black boxes denote amino acid substitutions leading to a complete growth defect. Shaded boxes symbolize conditional or slow growing mutants. The 16 remaining mutations have no detectable growth defect.

Domain Swapping between the Archaeal and Eucaryotic Subunits-- The N subunit of S. acidocaldarius and of Haloarcula marismortui cannot replace ABC10beta in vivo (9, 24). However, yeast/archaeal chimerae are largely interchangeable in vivo with the yeast subunit, because they support growth when introduced in a S. cerevisiae host strain that is deleted for RPB10, the gene encoding ABC10beta (Fig. 2). The archaeal and eucaryotic polypeptides must therefore have largely equivalent functions in their respective transcription complexes. In particular, all constructions where the archaeal component extends up to the first 49 amino acids are viable. In contrast, a chimeric construction (rpb10-F8) extending the archaeal segment up to position His-53 was lethal, as was also the case for a rpb10-F4, swapping the C-end of ABC10beta downstream His-53. Deleting the last five amino acids (downstream of Pro-65) had instead no growth defect (rpb10-Delta LEK). The amino acids falling between positions His-53 and Pro-65 are therefore likely to account for the functional incompatibility observed between full-size archaeal (S. acidocaldarius) and eucaryotic ABC10beta in vivo. Interestingly, this domain is moderately conserved between archaeal and eucaryotic sequences but contains an invariant HVDLIEK motif in all eucaryotic sequences identified so far (Fig. 1A).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Domain swapping between ABC10beta and the N subunit of S. acidocaldarius. A, F1 to F8 are hybrid constructions achieved by domain swapping, where black frames represent segments that derive from the archaeal polypeptide. The limits of these segments are indicated by the corresponding amino acid position on the yeast sequence (Trp-18, Glu-32, Met-49, His-53). Delta LEK is a deletion made by PCR mutagenesis and eliminating the last five coding triplets of the yeast sequence. B, growth at 30 and 37 °C is illustrated for the three temperature-sensitive constructions (F2, F5, and F7) after 4 days on complete medium YPD, using a serial dilution technique. WT, wild type.

An Atypical Metal-binding Domain (CX2C ... CC) Is Critical in Vivo-- The S. acidocaldarius and S. cerevisiae subunits share 17 amino acids, of which 13 are identical in all eucaryotes and archaeal sequences (Fig. 1A). Amino acid replacements were generated at these 17 positions and at 11 other highly conserved amino acids, expressed from a strong promoter harbored on a multicopy plasmid (i.e. under conditions maximizing the expression of the mutant allele) and tested for their ability to support growth. Practically all the mutants tested were phenotypically silent or had but a partial growth defect, which in keeping with our domain swapping and heterospecific complementation data, indicates that the precise amino acid sequence of ABC10beta is not very critical for its function (Fig. 1B). However, conservative Cys to Ser or Thr substitutions at the CX2C ... CC motif are lethal at all temperatures tested, and mutants with partial growth defect also tend to cluster near this motif. This fits very well with the fact that the CX2C ... CC motif is the only sequence feature shared by all relatives of ABC10beta , including the three viral gene products that hardly show any similarity outside this motif. In view of the striking similarity with the canonical CX2C ... CX2C Zn2+ binding domain, and given that yeast ABC10beta binds Zn2+ in vitro (25), we propose that the CX2C ... CC motif defines a new type of metal-coordinating domain, although Zn2+ need not be the true ligand chelated by that motif in vivo.

An Invariant Eucaryotic Motif (HVDLIEK) Is Critical for pol I in Vivo-- As stated above, the growth properties of yeast/archaeal chimeric constructions suggest that the eucaryotic motif HVDLIEK is critical for the biological activity of ABC10beta . This is confirmed by the properties of temperature-sensitive mutants isolated from a library of randomly mutagenizedRPB10 alleles. Only 2 of the 12 mutants thus obtained resulted from single amino acid substitutions (rpb10-K59E and rpb10-I57F), and both are in the HVDLIEK motif (rpb10-K59E actually replaces the invariant lysine by the glutamate of the archaeal sequence). These mutants are strongly temperature-sensitive on plates (see Fig. 4) but can still undergo two to three cycles of growth and division upon a shift to the restrictive temperature, as shown by their delayed growth arrest (Fig. 3A). We monitored the in vivo synthesis of rRNA and tRNA in the first 8 h after the shift (i.e. before growth recedes) by short-pulse labeling with tritiated uracil and followed the accumulation of specific mRNAs by Northern hybridization. The results are shown for rpb10-K59E, and similar data were obtained with rpb10-I57F (not shown). tRNA and 5 S rRNA synthesis (pol III) was not affected under these conditions, but there was a marked effect on the three rRNA species (25 S, 18 S, and 5.8 S) synthesized by pol I (Fig. 3B). In contrast to the rapid arrest observed for the rpb1-1 mutant (26) specifically affecting the activity of pol II, mRNA synthesis goes on in the rpb10 mutants for at least 5 h after the temperature shift, although it progessively decreases thereafter (Fig. 3C). Thus, both mutations primarily block the synthesis of pol I-dependent transcripts, although ABC10beta is shared by all three polymerases.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Growth and transcription pattern in a rpb10-K59E mutant (OG20) and its isogenic wild type (WT) control (YGVS017). A, growth. Cell density was measured by turbidimetry. Double bars denote parallel dilutions before overnight growth. B,RNA polymerase I- and III-dependent transcription. Cells were labeled for 10 min with 250 µCi of [3H]uracil (see "Material and Methods"). Lanes 1-4, strain OG20(rpb10-K59E). Lanes 5-8, wild type control YGVS017(RPB10+). Cultures were shifted from 30 °C (lanes 1 and 5) to 37 °C for 1 h (lanes 2 and 6), 5 h (lanes 3 and 7), or 8 h (lanes 4 and 8). Total RNA (5 mg as determined by absorbance at 260 nm) was separated on 6% acrylamide gel and exposed for 24 h to reveal the high molecular weight rRNA (25 S and 18 S). Low molecular weight RNAs (5.8 S rRNA, 5 S rRNA, and tRNAS) were revealed after a 7-day exposure. C, RNA polymerase II-dependent transcription. Total RNA was prepared from YGVS017(RPB10+) and OG20(rpb10-K59E) and from Y260 (rpb1-1) (26). After separation on a 1% agarose gel, RNA was transferred to positively charged nylon membranes (Boehringer Mannheim) and hybridized with ACT1 and DED1 probes to determine the steady-state level of the corresponding mRNAs.

To further explore the transcriptional specificity of rpb10-K59E and rpb10-I57F mutants, we examined whether they could be rescued by making growth independent of pol I. The appropriate genetic context was created by introducing a rpa43-Delta ::LEU2 deletion that inactivates the essential pol I subunit A43 (19) and is thus lethal, except in the presence of a plasmid that expresses the rDNA transcript from the galactose-inducible promoter pGAL7. This allows pol I-defective mutants to be rescued on galactose by pol II-dependent transcription (17, 19). Growth at 37 °C was indeed restored in rpa43-Delta ::LEU2 (pGAL7::rDNA) constructions harboring rpb10-K59E or rpb10-I57F, indicating that their temperature-sensitive phenotype is primarily because of a pol I defect. As a control, we reintroduced the wild type RPA43 gene by genetic transformation and shifted the resulting transformants to a glucose medium, shutting off the RNA polymerase II-dependent synthesis of rRNA and thus restoring pol I dependence. Both mutants regained their temperature-sensitive phenotype under these conditions (Fig. 4). This pol I-specific defect is an allele-specific property that was not observed in two other temperature-sensitive mutants (rpb10-H53Q and rpb10-M49L) nor in the rpc40-V78R mutant affecting AC40, the alpha -like subunit common to pol I and III.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4.   RNA polymerase I dependence of the rpb10-I57F and rpb10-K59E mutants. Left panel, strain OG22-2b(rpa43-Delta RPB10+) and isogenic derivatives bearing the rpb10-I57F and rpb10-K59E alleles were grown for 8 days on YP-glactose plates at 37 °C. In these conditions, RNA polymerase I is fully inactive because of the rpa43-Delta deletion (19), and 35 S rRNA synthesis is made dependent on RNA polymerase II by plasmid pNOY102 (pGAL7::rDNA). Right panel, the same strains were transformed by plasmid pASZ11-RPA43(CEN RPA43) to restore RNA polymerase I activity and grown on complete medium YPD for 4 days at 37 °C (no difference was observed at 30 °C (not shown)). 35 S rRNA synthesis is entirely dependent on RNA polymerase I because of glucose repression of the pGAL7::rDNA transcription on plasmid pNOY102. WT, wild type.

We next asked if the lethal phenotype of the rpb10-F4 and rpb10-F6 chimerae (where HVDLIEK is replaced by its archaeal counterpart) also results from a pol I-specific defect. Using the same experimental approach, we found again both chimeric constructions to be rescued on galactose, although they are fully lethal when pol II-dependent synthesis of rRNA is shut off in the presence of glucose (Fig. 5). However, growth was slower than in isogenic wild type controls, indicating that there is also a partial pol II and/or III defect. At this point, we began to wonder if ABC10beta itself, although shared by all three polymerases, might be only essential for pol I-dependent transcription. Reassuringly, we found that the rpb10-Delta ::HIS3 deletion is lethal even when allowing pol II-dependent synthesis of rRNA (data not shown).


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 5.   Viability of the rpb10-F4 and rpb10-F6 hybrids in a RNA polymerase I-defective context. The strains used were OG22-2b(rpa43-Delta RPB10+) and two isogenic derivatives, where the wild type RPB10 is replaced by the chimeric constructs F4 and F6 (see Fig. 2). Cells were streaked on YP-galactose plates and incubated for 10 days at 30 °C (left panel). In this genetic context, 35S rRNA synthesis is entirely dependent on RNA polymerase II as described above (Fig. 4). The two mutant strains are viable but slow-growing under these conditions. The same strains were transformed with plasmid pASZ11-RPA43 (cen rpa43), which restores a full set of RNA polymerase I subunits. Growth on YPD was tested after 5 days at 30 °C. WT, wild type.

Dosage-dependent Suppression of rpb10-I57F and rpb10-K59E by SRP40-- Taking advantage of a previously described yeast genomic library constructed in the multicopy vector pFL44L (27), we looked for dosage-dependent suppressor genes able to partly correct the growth defect of the ts mutants rpb10-I57F and rpb10-K59E at 37 °C. It has often been observed that conditional mutants in a given pol I, pol II, or pol III subunits are suppressed by increasing the gene dosage of another subunit of the same enzyme (13, 28, 29). None of the 13 other RNA polymerase I subunits had any suppressor effect, including RPC19 and RPC40 (encoding the alpha -like subunits AC19 and AC40 of pol I and pol III), although ts alleles of these two genes are themselves suppressed by a high dosage of RPB10 (13). However, an intriguing link between the alpha -like subunit AC40 and ABC10beta is suggested by our observation that SRP40 (encoding a putative yeast homolog of the nucleolar protein Nopp140p in mammals (30, 31) suppresses rpb10-I57F, rpb10-K59E, and the chimeric construction rpb10-F5 (this work). SRP40 was initially isolated by its ability to suppress rpc40-V78R (13). Except for a weak effect on a sec61 mutant defective in protein translocation (30), which may reflect the still poorly understood role of secretion in ribosome biogenesis (32), SRP40 appears to act specifically on rpb10 and rpc40 mutants: it has no effect on any of the numerous conditional pol I, pol II, and/or pol III mutants isolated in this laboratory, and we were unable to confirm a previous report that SRP40 suppresses a conditional mutant of the pol III transcription factor TFIIIB (44).

The Chimeric Mutant Strain rpb10-F4 Lacks Subunit A190 in Cell-free Extracts-- In view of the pol I-specific defect of mutants affected in the HVDLIEK motif, we examined whether pol I is present in cell-free extracts of the rpb10-F4 strain OG22-2b-F4HA (where the HVDLIEK domain is replaced by its archaeal counterpart) compared with an isogenic wild type strain. Both strains are equipped with a complete set of RPA genes encoding all subunits of pol I and only differ by their RPB10 allele. They were grown on galactose, to rescue the pol I defect of strain OG22-2b-F4HA by a pol II-dependent synthesis of rRNA (see above). As shown in Fig. 6A, a cell-free extract of OG22-2b-F4HA contained no antigenically detectable form of A190, although other pol I subunits (A135, A49, A43, and AC40) were present in normal amount. The two large subunits of pol II (B220 and B150) were also detected, although in lower amounts (Fig. 6B). Conditional mutants defective in the essential subunit A43 (19) have a normal amount in A190,2 indicating that the disappearance of A190 in cell-free extracts is not the mere result of a pol I defect.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   Accumulation of RNA polymerase I (A190, A135, A49, A43, AC40) and II (B220 and B150) subunits in cell-free extracts of the rpb10-F4 strain OG22-2b-F4HA and its isogenic wild type control OG22-2b-WTHA. A, Western blotting using anti-pol I antibodies was done as described under "Materials and Methods" and reveals the five largest subunits of yeast RNA polymerase I (A190, A135, A49, A43, and AC40). Lane 1 corresponds to 500 ng of a highly purified yeast pol I preparation. Lanes 2 and 3 correspond to 15 µg of crude extracts from strain OG22-2b-WTHA (wild type (WT)) and OG22-2b-F4HA (mutant). Electrophoresis was done by SDS-PAGE on a gel containing 11% of polyacrylamide. B, Western blotting done in the same conditions on a gel containing 8% of polyacrylamide, using two polyclonal antibodies raised against the two largest subunits (B220 and B150) of yeast RNA polymerase II. The double signal obtained with anti-B220 is because of the existence of a proteolyzed form of B220 lacking the highly repeated C-terminal domain. Lanes 2 and 3 correspond to the same amount (15 µg) of total proteins.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The amino acid sequence of ABC10beta (13) has a marked homology to the N subunit of the archaeal enzyme (5, 24). Both are largely interchangeable in vivo and thus presumably retained a very similar function in their respective transcription complexes, despite the early evolutionary divergence of archaea and eucaryotes, which are thought to have separated about 1.8 billion years ago (33). Their similarity to viral gene products, including a polypeptide copurifying with the vaccinial enzyme (15), is restricted to a four-cysteine motif (CX2C ... CC) but is likely to be biologically significant, because it is the only invariant motif shared by all eucaryotic, archaeal, and viral sequences identified so far and corresponds to the only amino acids whose integrity is essential for growth in S. cerevisiae. A search in current protein data banks failed to reveal the presence of that motif outside the ABC10beta family. Nevertheless, its similarity to the canonical Zn2+ tetra-coordination domain (CX2C. . . . . CX2C) is striking, except for the apposition of the last two cysteines. Besides, the latter are invariably followed by two arginines or lysines that, by increasing the pKa of the adjacent cysteines, should favor metal coordination. Earlier work has documented the ability of ABC10beta to bind Zn2+ in vitro (34), and we are therefore inclined to believe that CX2C ... CC is an atypical metal binding domain where the physiological ligand may be Zn2+ or another metal ion.

The existence of a vaccinial form of ABC10beta is particularly striking, because this is the only vaccinial polypeptide (beyond the beta '- and beta -like subunits) to have a recognizable homology to the nuclear enzymes (35). In the African swine fever virus (36), instead, homology extends to the two eucaryotic alpha -like subunits and the common subunits ABC27 and ABC23. Viral polymerases are therefore more or less closely related to the nuclear enzymes in their subunit composition. Based on the sequencing data available so far, however, all of them share with the eucaryotic and archaeal polymerases a minimal subunit structure that is invariably formed of beta ', beta , and ABC10beta -like subunits. The beta 'beta core is not surprising because the two large subunits are known to harbor the active site of the yeast (1, 2) and bacterial (3) enzymes, but the permanence of ABC10beta -like subunits in all nonbacterial forms of polymerases calls for an explanation.

To approach the function of ABC10beta , we exploited the invariant motif HVDLIEK of the yeast polypeptide, present in all eucaryotic forms but loosely related to the corresponding archaeal domain. Domain swapping experiments indicate that this motif is important for the biological activity in yeast and is the main structural element preventing a complete functional compatibility between the yeast and archaeal subunits. In particular, its replacement by the equivalent S. acidocaldarius motif leads to a lethal phenotype, whereas the rpb10-K59E mutation bringing HVDLIEK closer to the S. acidocaldarius sequence has a strong temperature-sensitive growth defect. Because ABC10beta is shared by all three eucaryotic polymerases, we expected these mutants to be defective in all three forms of transcription. Paradoxically, these phenotypes are bypassed when the 35 S ribosomal RNA precursor is made by RNA polymerase II. They are thus due to a pol I-specific defect. In vitro, this is accompanied by a complete lack of the largest pol I subunit (A190) in mutant cell-free extracts. It is therefore tempting to speculate that the HVDLIEK domain affects pol I assembly and that the largest subunit is rapidly degraded if not properly incorporated in the heteromultimeric enzyme structure.

Because ABC10beta is shared by all three polymerases, we suppose that it has the same structural function in pol I, pol II, and pol III. However, the HVDLIEK motif appears to be especially important for pol I, suggesting that this invariant motif was conserved throughout eucaryotic evolution because it helps segregating the nucleolar polymerase from its two sister enzymes pol II and III. A general role of ABC10beta in the assembly of RNA polymerases would be consistent with its dosage-dependent suppression of conditional mutants in the alpha -like subunits AC40 and AC19 of RNA polymerases I and III (13). It is also supported by the results of a systematic survey of two-hybrid interactions in yeast RNA polymerases,3 showing that ABC10beta can selectively bind the N-terminal part of the beta '-like subunit of RNA polymerase II (B220) and the C-terminal part of the beta -like subunit (B135). Our working hypothesis is that ABC10beta brings together these two domains (known to be topologically close on the spatial structure of yeast (6, 38) and bacterial (39) polymerases) and anchors them on the eucaryotic archaeal and viral equivalents of the bacterial alpha 2 structure. In yeast, the latter is defined by the B44/B12.5 heterodimer of pol II and by its AC40/AC19 homolog in pol I and III (13, 40, 41). Intriguingly, ts mutants defective in either ABC10beta or AC40 (but, so far, in no other subunits) are corrected by the overexpression of Srp40p, a yeast component related to the mammalian Nopp140 protein (30, 31, 37) that may be important for the nucleolar assembly of yeast pol I.

Our hypothesis accounts for the pol I-specific defects of some (but not all) of the RPB10 mutants analyzed in the present report, because ABC10beta would obviously bind to conserved but nonidentical target domains on the largest and second largest subunits of pol I, II, and III. A similar structural role has been proposed for ABC23, another common subunit that is highly conserved among nonbacterial polymerases (42). In that case, however, it was also shown that a catalytically inactive form of yeast pol I lacking ABC23 regains activity upon addition of that subunit, implying that ABC23 is not only important for the stability of the RNA polymerase I complex but is somehow connected with its active site (43). In view of the impressive conservation of ABC10beta , we are inclined to believe that this subunit may also be closely associated with the active site, although the lack of a bacterial counterpart argues against a direct catalytic role.

    ACKNOWLEDGEMENTS

We thank André Sentenac, Michel Werner, and our colleagues from the Polymerase Group at Saclay for advice and support. We are especially grateful to Gerald Peyroche for many useful suggestions. RNA polymerase I preparations and antibodies were kindly given by Christophe Carles and Michel Riva. Strain GF312-17c was provided by Gérard Faye and plasmid pRPON by Doris Langer.

    FOOTNOTES

* This study was partly funded by a Grant from the European Union (FMRX-CT96-0064).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Recipient of a scholarship financed by the Institut de Formation Supérieure Biomédicale and by the Commissariat à l'Energie Atomique.

parallel Supported by Russian Foundation for Basic Research Grant 96-04-49867, International Science Foundation Grants MWE000 and MWE300, and the Russian governmental science and technology program Advances in Bioengineering.

** To whom correspondence should be addressed. Tel.: 33-1-69-08-35-86; Fax: 33-1-69-08-47-12; E-mail: thuriaux{at}jonas.saclay.cea.fr.

2 G. Peyroche, personal communication.

3 A. Flores, J.-F. Briand, C. Boschiero, O. Gadal, J.-C. Andrau, L. Rubbi, V. van Mullem, M. Goussot, C. Marck, C. Carles, P. Thuriaux, A. Sentenac, and M. Werner, submitted for publication.

    ABBREVIATIONS

The abbreviations used are: PCR, polymerase chain reaction; YPD, yeast-peptone-dextrose; pol, polymerase; HA, hemagglutinin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
  1. Riva, M., Carles, C., Sentenac, A., Grachev, M. A., Mustaev, A. A., and Zaychikov, E. F. (1990) J. Biol. Chem. 265, 16498-16503[Abstract/Free Full Text]
  2. Dieci, G., Hermann-Le Denmat, S., Lukhtanov, E., Thuriaux, P., Werner, M., and Sentenac, A. (1995) EMBO J. 14, 3766-3776[Medline] [Order article via Infotrieve]
  3. Zaychikov, E., Martin, E., Denissova, L., Kozlov, M., Heuman, H., Nikiforov, V., Goldfarb, A., and Mustaev, A. (1996) Science 273, 107-109[Abstract]
  4. Martindale, D. W. (1990) Nucleic Acids Res. 18, 2953-2959[Abstract/Free Full Text]
  5. Langer, D., Hain, J., Thuriaux, P., and Zillig, W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5768-5772[Abstract/Free Full Text]
  6. Thuriaux, P., and Sentenac, A. (1992) in The Molecular Biology of Yeast (Jones, E. W., Pringle, J. R., and Broach, J. R., eds), Vol. 2, pp. 1-45, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory, NY
  7. Woychik, N. A., and Young, R. A. (1994) in Transcription Mechanisms and Regulation (Conaway, R. C., and Conaway, J. W., eds), pp. 227-242, Raven Press, Ltd., New York
  8. Chédin, S., Ferri, M. L., Peyroche, G., Andrau, J. C., Jourdain, S., Lefebvre, O., Werner, M., Carles, C., and Sentenac, A. (1998) Cold Spring Harbor Symp. Quant. Biol., in press
  9. Shpakovski, G. V., Acker, J., Wintzerith, M., Lacroix, J. F., Thuriaux, P., and Vigneron, M. (1995) Mol. Cell. Biol. 15, 4702-4710[Abstract]
  10. McKune, K., Moore, P. A., Hull, M. W., and Woychik, N. A. (1995) Mol. Cell. Biol. 15, 6895-6900[Abstract]
  11. Carles, C., Treich, I., Bouet, F., Riva, M., and Sentenac, A. (1991) J. Biol. Chem. 266, 24092-24096[Abstract/Free Full Text]
  12. Woychik, N. A., and Young, R. A. (1990) J. Biol. Chem. 265, 17816-17819[Abstract/Free Full Text]
  13. Lalo, D., Carles, C., Sentenac, A., and Thuriaux, P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5524-5528[Abstract/Free Full Text]
  14. Lanzendörfer, M., Langer, D., Hain, J., Klenk, H. P., Holz, I., Arnold-Ammer, I., and Zillig, W. (1994) Syst. Appl. Microbiol. 16, 656-664
  15. Amegadzie, B. Y., Ahn, B. Y., and Moss, B. (1992) J. Virol. 66, 3003-3010[Abstract/Free Full Text]
  16. Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G., Labouesse, M., Minvielle-Sebastia, L., and Lacroute, F. (1991) Yeast 7, 609-615[CrossRef][Medline] [Order article via Infotrieve]
  17. Nogi, Y., Yano, R., and Nomura, M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3962-3966[Abstract/Free Full Text]
  18. Stotz, A., and Linder, P. (1990) Gene 95, 91-98[CrossRef][Medline] [Order article via Infotrieve]
  19. Thuriaux, P., Mariotte, S., Buhler, J. M., Sentenac, A., Vu, L., Lee, B. S., and Nomura, M. (1995) J. Biol. Chem. 270, 24252-24257[Abstract/Free Full Text]
  20. Hermann-Le Denmat, S., Werner, M., Sentenac, A., and Thuriaux, P. (1994) Mol. Cell. Biol. 14, 2905-2913[Abstract/Free Full Text]
  21. Riva, M., Buhler, J. M., Sentenac, A., Fromageot, P., and Hawthorne, D. C. (1982) J. Biol. Chem. 257, 4570-4577[Abstract/Free Full Text]
  22. Shpakovski, G. V., Lebedenko, E. N., and Thuriaux, P. (1997) Bioorg. Khim. 23, 110-117[Medline] [Order article via Infotrieve]
  23. Mukerjee, K., and Chaterji, D. (1997) Eur. J. Biochem. 247, 884-889[Medline] [Order article via Infotrieve]
  24. McKune, K., and Woychik, N. A. (1994) J. Bacteriol. 176, 4754-4756[Abstract/Free Full Text]
  25. Treich, I., Carles, C., Riva, M., and Sentenac, A. (1992) Gene Expr. 2, 31-37[Medline] [Order article via Infotrieve]
  26. Nonet, M., Scafe, C., Sexton, J., and Young, R. (1987) Mol. Cell. Biol. 7, 1602-1611[Abstract/Free Full Text]
  27. Stettler, S., Chiannilkulchai, N., Hermann-Le Denmat, S., Lalo, D., Lacroute, F., Sentenac, A., and Thuriaux, P. (1993) Mol. Gen. Genet. 239, 169-176[Medline] [Order article via Infotrieve]
  28. Archambault, J., Schappert, K. T., and Friesen, J. D. (1990) Mol. Cell. Biol. 10, 6123-6131[Abstract/Free Full Text]
  29. Thuriaux, P., Werner, M., Stettler, S., and Lalo, D. (1995) Methods Mol. Genet. 6, 227-246
  30. Ikonomova, R., Sommer, T., and Képès, F. (1997) DNA Cell Biol. 16, 1161-1173[Medline] [Order article via Infotrieve]
  31. Meier, U. T. (1996) J. Biol. Chem. 271, 19376-19384[Abstract/Free Full Text]
  32. Mizuta, K., and Warner, J. R. (1994) Mol. Cell. Biol. 14, 2493-2502[Abstract/Free Full Text]
  33. Doolittle, R. F., Feng, D. F., Tsang, S., Cho, G., and Little, E. (1996) Science 271, 470-477[Abstract]
  34. Treich, I., Riva, M., and Sentenac, A. (1991) J. Biol. Chem. 266, 21971-21976[Abstract/Free Full Text]
  35. Moss, B. (1996) in Fields Virology (Fields, B. N., Knipe, S. M., and Howley, P. M., eds), Vol. 2, pp. 2637-2671, Lippincott-Raven Publishers, Philadelphia
  36. Yanez, R. J., Rodriguez, J. M., Nogal, M. L., Yuste, L., Enriquez, C., Rodriguez, J. F., and Vinuela, E. (1995) Virology 208, 249-278[CrossRef][Medline] [Order article via Infotrieve]
  37. Meier, U. T., and Blobel, G. (1992) Cell 70, 127-138[CrossRef][Medline] [Order article via Infotrieve]
  38. Yano, R., and Nomura, M. (1991) Mol. Cell. Biol. 11, 754-764[Abstract/Free Full Text]
  39. Severinov, K., Mooney, R., Darst, S. A., and Landick, R. (1997) J. Biol. Chem. 272, 24137-24140[Abstract/Free Full Text]
  40. Dequard-Chablat, M., Riva, M., Carles, C., and Sentenac, A. (1991) J. Biol. Chem. 266, 15300-15307[Abstract/Free Full Text]
  41. Woychik, N. A., McKune, K., Lane, W. S., and Young, R. A. (1993) Gene Expr. 3, 77-82[Medline] [Order article via Infotrieve]
  42. Nouraini, S., Archambault, J., and Friesen, J. D. (1996) Mol. Cell. Biol. 16, 5985-5996[Abstract]
  43. Lanzendörfer, M., Smid, A., Klinger, C., Schultz, P., Sentenac, A., Carles, C., and Riva, M. (1997) Genes Dev. 11, 1033-1047
  44. Lefebvre, O., Röth, J., and Sentenac, A. (1994) J. Biol. Chem. 269, 23374-23381[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
C. Zaros, J.-F. Briand, Y. Boulard, S. Labarre-Mariotte, M. C. Garcia-Lopez, P. Thuriaux, and F. Navarro
Functional organization of the Rpb5 subunit shared by the three yeast RNA polymerases
Nucleic Acids Res., January 28, 2007; 35(2): 634 - 647.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
H. Yashiroda and K. Tanaka
Hub1 is an essential ubiquitin-like protein without functioning as a typical modifier in fission yeast
Genes Cells, December 1, 2004; 9(12): 1189 - 1197.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Naryshkina, A. Bruning, O. Gadal, and K. Severinov
Role of Second-Largest RNA Polymerase I Subunit Zn-Binding Domain in Enzyme Assembly
Eukaryot. Cell, October 1, 2003; 2(5): 1046 - 1052.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-F. Briand, F. Navarro, P. Rematier, C. Boschiero, S. Labarre, M. Werner, G. V. Shpakovski, and P. Thuriaux
Partners of Rpb8p, a Small Subunit Shared by Yeast RNA Polymerases I, II, and III
Mol. Cell. Biol., September 1, 2001; 21(17): 6056 - 6065.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. D. Mackereth, C. H. Arrowsmith, A. M. Edwards, and L. P. McIntosh
Zinc-bundle structure of the essential RNA polymerase subunit RPB10 from Methanobacteriumthermoautotrophicum
PNAS, June 6, 2000; 97(12): 6316 - 6321.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Rubbi, S. Labarre-Mariotte, S. Chedin, and P. Thuriaux
Functional Characterization of ABC10alpha , an Essential Polypeptide Shared by All Three Forms of Eukaryotic DNA-dependent RNA Polymerases
J. Biol. Chem., October 29, 1999; 274(44): 31485 - 31492.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. Markov, T. Naryshkina, A. Mustaev, and K. Severinov
A zinc-binding site in the largest subunit of DNA-dependent RNA polymerase is involved in enzyme assembly
Genes & Dev., September 15, 1999; 13(18): 2439 - 2448.
[Abstract] [Full Text]


This Article